Str Search List
Search STRs
GET /api/v1/strs/?format=api
{ "count": 259, "next": "https://panelapp-aus.org/api/v1/strs/?format=api&page=2", "previous": null, "results": [ { "gene_data": { "alias": [ "TFIID" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11588", "gene_name": "TATA-box binding protein", "omim_gene": [ "600075" ], "alias_name": null, "gene_symbol": "TBP", "hgnc_symbol": "TBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:170863390-170881958", "ensembl_id": "ENSG00000112592" } }, "GRch38": { "90": { "location": "6:170554302-170572870", "ensembl_id": "ENSG00000112592" } } }, "hgnc_date_symbol_changed": "1993-05-26" }, "entity_type": "str", "entity_name": "TBP_SCA17_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "10484774", "20301611" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 17 MIM#607136" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 170870996, 170871109 ], "grch38_coordinates": [ 170561908, 170562021 ], "normal_repeats": 40, "pathogenic_repeats": 49, "tags": [], "panel": { "id": 24, "hash_id": null, "name": "Early-onset Dementia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.58", "version_created": "2026-03-31T16:43:37.497568+11:00", "relevant_disorders": [ "Cognitive impairment", "HP:0100543" ], "stats": { "number_of_genes": 96, "number_of_strs": 6, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MGC23980", "DENNL72" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28337", "gene_name": "chromosome 9 open reading frame 72", "omim_gene": [ "614260" ], "alias_name": null, "gene_symbol": "C9orf72", "hgnc_symbol": "C9orf72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:27546544-27573864", "ensembl_id": "ENSG00000147894" } }, "GRch38": { "90": { "location": "9:27546545-27573866", "ensembl_id": "ENSG00000147894" } } }, "hgnc_date_symbol_changed": "2004-01-06" }, "entity_type": "str", "entity_name": "C9orf72_FTDALS_GGGGCC", "confidence_level": "3", "penetrance": null, "publications": [ "25577942", "21944779", "21944778" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGGGCC", "chromosome": "9", "grch37_coordinates": [ 27573427, 27573544 ], "grch38_coordinates": [ 27573529, 27573546 ], "normal_repeats": 25, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 24, "hash_id": null, "name": "Early-onset Dementia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.58", "version_created": "2026-03-31T16:43:37.497568+11:00", "relevant_disorders": [ "Cognitive impairment", "HP:0100543" ], "stats": { "number_of_genes": 96, "number_of_strs": 6, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "B37" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3033", "gene_name": "atrophin 1", "omim_gene": [ "607462" ], "alias_name": null, "gene_symbol": "ATN1", "hgnc_symbol": "ATN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:7033626-7051484", "ensembl_id": "ENSG00000111676" } }, "GRch38": { "90": { "location": "12:6924463-6942321", "ensembl_id": "ENSG00000111676" } } }, "hgnc_date_symbol_changed": "2005-03-17" }, "entity_type": "str", "entity_name": "ATN1_DRPLA_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301664" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Dentatorubral-pallidoluysian atrophy MIM#125370" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 7045892, 7045936 ], "grch38_coordinates": [ 6936729, 6936773 ], "normal_repeats": 35, "pathogenic_repeats": 48, "tags": [ "STR" ], "panel": { "id": 24, "hash_id": null, "name": "Early-onset Dementia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.58", "version_created": "2026-03-31T16:43:37.497568+11:00", "relevant_disorders": [ "Cognitive impairment", "HP:0100543" ], "stats": { "number_of_genes": 96, "number_of_strs": 6, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "JP-3", "CAGL237", "HDL2", "JP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14203", "gene_name": "junctophilin 3", "omim_gene": [ "605268" ], "alias_name": null, "gene_symbol": "JPH3", "hgnc_symbol": "JPH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:87635441-87731762", "ensembl_id": "ENSG00000154118" } }, "GRch38": { "90": { "location": "16:87601835-87698156", "ensembl_id": "ENSG00000154118" } } }, "hgnc_date_symbol_changed": "2000-12-08" }, "entity_type": "str", "entity_name": "JPH3_HDL2_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301701" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Huntington disease-like 2 MIM#606438" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "16", "grch37_coordinates": [ 87637894, 87637935 ], "grch38_coordinates": [ 87604288, 87604329 ], "normal_repeats": 28, "pathogenic_repeats": 40, "tags": [ "STR" ], "panel": { "id": 24, "hash_id": null, "name": "Early-onset Dementia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.58", "version_created": "2026-03-31T16:43:37.497568+11:00", "relevant_disorders": [ "Cognitive impairment", "HP:0100543" ], "stats": { "number_of_genes": 96, "number_of_strs": 6, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [], "panel": { "id": 24, "hash_id": null, "name": "Early-onset Dementia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.58", "version_created": "2026-03-31T16:43:37.497568+11:00", "relevant_disorders": [ "Cognitive impairment", "HP:0100543" ], "stats": { "number_of_genes": 96, "number_of_strs": 6, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 24, "hash_id": null, "name": "Early-onset Dementia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.58", "version_created": "2026-03-31T16:43:37.497568+11:00", "relevant_disorders": [ "Cognitive impairment", "HP:0100543" ], "stats": { "number_of_genes": 96, "number_of_strs": 6, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "AIS", "NR3C4", "SMAX1", "HUMARA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:644", "gene_name": "androgen receptor", "omim_gene": [ "313700" ], "alias_name": [ "testicular feminization", "Kennedy disease" ], "gene_symbol": "AR", "hgnc_symbol": "AR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:66764465-66950461", "ensembl_id": "ENSG00000169083" } }, "GRch38": { "90": { "location": "X:67544032-67730619", "ensembl_id": "ENSG00000169083" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "AR_SBMA_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "20301508", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinal and bulbar muscular atrophy of Kennedy MIM#313200" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "CAG", "chromosome": "X", "grch37_coordinates": [ 66765160, 66765225 ], "grch38_coordinates": [ 67545318, 67545383 ], "normal_repeats": 34, "pathogenic_repeats": 38, "tags": [ "STR" ], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MGC23980", "DENNL72" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28337", "gene_name": "chromosome 9 open reading frame 72", "omim_gene": [ "614260" ], "alias_name": null, "gene_symbol": "C9orf72", "hgnc_symbol": "C9orf72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:27546544-27573864", "ensembl_id": "ENSG00000147894" } }, "GRch38": { "90": { "location": "9:27546545-27573866", "ensembl_id": "ENSG00000147894" } } }, "hgnc_date_symbol_changed": "2004-01-06" }, "entity_type": "str", "entity_name": "C9orf72_FTDALS_GGGGCC", "confidence_level": "3", "penetrance": null, "publications": [ "25577942", "21944779", "21944778" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGGGCC", "chromosome": "9", "grch37_coordinates": [ 27573427, 27573544 ], "grch38_coordinates": [ 27573529, 27573546 ], "normal_repeats": 25, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10555", "gene_name": "ataxin 2", "omim_gene": [ "601517" ], "alias_name": [ "trinucleotide repeat containing 13" ], "gene_symbol": "ATXN2", "hgnc_symbol": "ATXN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:111890018-112037480", "ensembl_id": "ENSG00000204842" } }, "GRch38": { "90": { "location": "12:111452214-111599676", "ensembl_id": "ENSG00000204842" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN2_SCA2_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "20301452" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia 2 MIM#183090" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 112036755, 112036823 ], "grch38_coordinates": [ 111598951, 111599016 ], "normal_repeats": 31, "pathogenic_repeats": 35, "tags": [], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ST7", "FLJ12929" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31708", "gene_name": "LDL receptor related protein 12", "omim_gene": null, "alias_name": null, "gene_symbol": "LRP12", "hgnc_symbol": "LRP12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:105501459-105601252", "ensembl_id": "ENSG00000147650" } }, "GRch38": { "90": { "location": "8:104489231-104589024", "ensembl_id": "ENSG00000147650" } } }, "hgnc_date_symbol_changed": "2004-07-06" }, "entity_type": "str", "entity_name": "LRP12_ALS_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "37339631" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Amyotrophic lateral sclerosis MONDO:0004976", "Amyotrophic lateral sclerosis 28, MIM#\t620452" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "8", "grch37_coordinates": [ 105601201, 105601227 ], "grch38_coordinates": [ 104588973, 104588999 ], "normal_repeats": 50, "pathogenic_repeats": 61, "tags": [], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "JP-3", "CAGL237", "HDL2", "JP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14203", "gene_name": "junctophilin 3", "omim_gene": [ "605268" ], "alias_name": null, "gene_symbol": "JPH3", "hgnc_symbol": "JPH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:87635441-87731762", "ensembl_id": "ENSG00000154118" } }, "GRch38": { "90": { "location": "16:87601835-87698156", "ensembl_id": "ENSG00000154118" } } }, "hgnc_date_symbol_changed": "2000-12-08" }, "entity_type": "str", "entity_name": "JPH3_HDL2_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "11558794", "20301701" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Huntington disease-like 2 MIM#606438" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "16", "grch37_coordinates": [ 87637894, 87637935 ], "grch38_coordinates": [ 87604288, 87604329 ], "normal_repeats": 28, "pathogenic_repeats": 40, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NCRNA00003" ], "biotype": "antisense_RNA", "hgnc_id": "HGNC:10561", "gene_name": "ATXN8 opposite strand (non-protein coding)", "omim_gene": [ "603680" ], "alias_name": [ "non-protein coding RNA 3" ], "gene_symbol": "ATXN8OS", "hgnc_symbol": "ATXN8OS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:70681345-70713561", "ensembl_id": "ENSG00000230223" } }, "GRch38": { "90": { "location": "13:70107213-70139429", "ensembl_id": "ENSG00000230223" } } }, "hgnc_date_symbol_changed": "2006-07-18" }, "entity_type": "str", "entity_name": "ATXN8OS_SCA8_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "24285970", "20301445", "10192387" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia 8 MIM#608768" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "13", "grch37_coordinates": [ 70713486, 70713560 ], "grch38_coordinates": [ 70139354, 70139428 ], "normal_repeats": 50, "pathogenic_repeats": 80, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NSCL2", "TAFII250", "KAT4", "DYT3/TAF1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11535", "gene_name": "TATA-box binding protein associated factor 1", "omim_gene": [ "313650" ], "alias_name": null, "gene_symbol": "TAF1", "hgnc_symbol": "TAF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:70586114-70752224", "ensembl_id": "ENSG00000147133" } }, "GRch38": { "90": { "location": "X:71366239-71532374", "ensembl_id": "ENSG00000147133" } } }, "hgnc_date_symbol_changed": "2001-12-07" }, "entity_type": "str", "entity_name": "TAF1_XDP_CCCTCT", "confidence_level": "3", "penetrance": null, "publications": [ "17273961", "29229810" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Dystonia-Parkinsonism, X-linked MIM#314250" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCCTCT", "chromosome": "X", "grch37_coordinates": [ 70672905, 70672979 ], "grch38_coordinates": [ 71453055, 71453129 ], "normal_repeats": 13, "pathogenic_repeats": 30, "tags": [ "founder" ], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "A1", "PO-GA", "RFC140", "MHCBFB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9969", "gene_name": "replication factor C subunit 1", "omim_gene": [ "102579" ], "alias_name": null, "gene_symbol": "RFC1", "hgnc_symbol": "RFC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:39289076-39367995", "ensembl_id": "ENSG00000035928" } }, "GRch38": { "90": { "location": "4:39287456-39366375", "ensembl_id": "ENSG00000035928" } } }, "hgnc_date_symbol_changed": "1994-10-14" }, "entity_type": "str", "entity_name": "RFC1_CANVAS_ANNGN", "confidence_level": "3", "penetrance": null, "publications": [ "39833204", "39152783", "38789445", "36705320", "35013364" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Parkinson disease MONDO:0005180" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "ANNGN", "chromosome": "4", "grch37_coordinates": [ 39350045, 39350103 ], "grch38_coordinates": [ 39348425, 39348483 ], "normal_repeats": 0, "pathogenic_repeats": 400, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PR55-BETA", "PR52B", "B55beta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9305", "gene_name": "protein phosphatase 2 regulatory subunit Bbeta", "omim_gene": [ "604325" ], "alias_name": [ "PP2A subunit B isoform beta" ], "gene_symbol": "PPP2R2B", "hgnc_symbol": "PPP2R2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:145967936-146464347", "ensembl_id": "ENSG00000156475" } }, "GRch38": { "90": { "location": "5:146581146-147084784", "ensembl_id": "ENSG00000156475" } } }, "hgnc_date_symbol_changed": "1993-01-25" }, "entity_type": "str", "entity_name": "PPP2R2B_SCA12_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "31286011", "27864267", "33811808", "10581021" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia 12 MIM#604326" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "5", "grch37_coordinates": [ 146258292, 146258321 ], "grch38_coordinates": [ 146878729, 146878758 ], "normal_repeats": 32, "pathogenic_repeats": 51, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX3", "JOS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7106", "gene_name": "ataxin 3", "omim_gene": [ "607047" ], "alias_name": null, "gene_symbol": "ATXN3", "hgnc_symbol": "ATXN3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:92524896-92572965", "ensembl_id": "ENSG00000066427" } }, "GRch38": { "90": { "location": "14:92038652-92106621", "ensembl_id": "ENSG00000066427" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN3_SCA3_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "11176969", "7574470", "7874163", "20301375", "29325606" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Machado-Joseph disease MIM#109150", "Spinocerebellar ataxia type 3" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "14", "grch37_coordinates": [ 92537355, 92537396 ], "grch38_coordinates": [ 92071011, 92071052 ], "normal_repeats": 44, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MGC23980", "DENNL72" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28337", "gene_name": "chromosome 9 open reading frame 72", "omim_gene": [ "614260" ], "alias_name": null, "gene_symbol": "C9orf72", "hgnc_symbol": "C9orf72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:27546544-27573864", "ensembl_id": "ENSG00000147894" } }, "GRch38": { "90": { "location": "9:27546545-27573866", "ensembl_id": "ENSG00000147894" } } }, "hgnc_date_symbol_changed": "2004-01-06" }, "entity_type": "str", "entity_name": "C9orf72_FTDALS_GGGGCC", "confidence_level": "3", "penetrance": null, "publications": [ "25577942", "21944779", "21944778", "31779815" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGGGCC", "chromosome": "9", "grch37_coordinates": [ 27573427, 27573544 ], "grch38_coordinates": [ 27573529, 27573546 ], "normal_repeats": 25, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10555", "gene_name": "ataxin 2", "omim_gene": [ "601517" ], "alias_name": [ "trinucleotide repeat containing 13" ], "gene_symbol": "ATXN2", "hgnc_symbol": "ATXN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:111890018-112037480", "ensembl_id": "ENSG00000204842" } }, "GRch38": { "90": { "location": "12:111452214-111599676", "ensembl_id": "ENSG00000204842" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN2_SCA2_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "11761482", "17923635", "8896555", "29325606", "20301452" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia 2 MIM#183090" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 112036755, 112036823 ], "grch38_coordinates": [ 111598951, 111599019 ], "normal_repeats": 31, "pathogenic_repeats": 35, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "D6S504E", "ATX1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10548", "gene_name": "ataxin 1", "omim_gene": [ "601556" ], "alias_name": null, "gene_symbol": "ATXN1", "hgnc_symbol": "ATXN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:16299343-16761722", "ensembl_id": "ENSG00000124788" } }, "GRch38": { "90": { "location": "6:16299112-16761491", "ensembl_id": "ENSG00000124788" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN1_SCA1_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "•\tPMID: 24602359" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar Ataxia type 1", "Parkinsonism", "OMIM 164400" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 16327867, 16327953 ], "grch38_coordinates": [ 16327636, 16327722 ], "normal_repeats": 36, "pathogenic_repeats": 45, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TFIID" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11588", "gene_name": "TATA-box binding protein", "omim_gene": [ "600075" ], "alias_name": null, "gene_symbol": "TBP", "hgnc_symbol": "TBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:170863390-170881958", "ensembl_id": "ENSG00000112592" } }, "GRch38": { "90": { "location": "6:170554302-170572870", "ensembl_id": "ENSG00000112592" } } }, "hgnc_date_symbol_changed": "1993-05-26" }, "entity_type": "str", "entity_name": "TBP_SCA17_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "10484774", "20301611", "29325606", "27172828", "14638975", "11313753", "11914409" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 17 MIM#607136" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 170870996, 170871109 ], "grch38_coordinates": [ 170561908, 170562021 ], "normal_repeats": 40, "pathogenic_repeats": 49, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "IT15" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4851", "gene_name": "huntingtin", "omim_gene": [ "613004" ], "alias_name": null, "gene_symbol": "HTT", "hgnc_symbol": "HTT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:3076408-3245676", "ensembl_id": "ENSG00000197386" } }, "GRch38": { "90": { "location": "4:3074681-3243959", "ensembl_id": "ENSG00000197386" } } }, "hgnc_date_symbol_changed": "2007-12-04" }, "entity_type": "str", "entity_name": "HTT_HD_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "20301482", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Huntington disease MIM#143100" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "4", "grch37_coordinates": [ 3076604, 3076666 ], "grch38_coordinates": [ 3074877, 3074939 ], "normal_repeats": 26, "pathogenic_repeats": 40, "tags": [ "STR" ], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FMRP", "FRAXA", "MGC87458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3775", "gene_name": "fragile X mental retardation 1", "omim_gene": [ "309550" ], "alias_name": null, "gene_symbol": "FMR1", "hgnc_symbol": "FMR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:146993469-147032645", "ensembl_id": "ENSG00000102081" } }, "GRch38": { "90": { "location": "X:147911951-147951125", "ensembl_id": "ENSG00000102081" } } }, "hgnc_date_symbol_changed": "1992-01-17" }, "entity_type": "str", "entity_name": "FMR1_FXTAS_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "27340021", "28176767", "20301558", "23765048", "25227148", "11445641" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Fragile X tremor/ataxia syndrome MIM#300623" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "repeated_sequence": "CGG", "chromosome": "X", "grch37_coordinates": [ 146993569, 146993628 ], "grch38_coordinates": [ 147912051, 147912110 ], "normal_repeats": 44, "pathogenic_repeats": 55, "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "BPES1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1092", "gene_name": "forkhead box L2", "omim_gene": [ "605597" ], "alias_name": null, "gene_symbol": "FOXL2", "hgnc_symbol": "FOXL2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:138663066-138665982", "ensembl_id": "ENSG00000183770" } }, "GRch38": { "90": { "location": "3:138944224-138947140", "ensembl_id": "ENSG00000183770" } } }, "hgnc_date_symbol_changed": "1992-02-28" }, "entity_type": "str", "entity_name": "FOXL2_BPES_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11468277", "33811808" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100", "Premature ovarian failure 3 MIM#608996" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "3", "grch37_coordinates": [ 138664863, 138664904 ], "grch38_coordinates": [ 138946021, 138946062 ], "normal_repeats": 14, "pathogenic_repeats": 19, "tags": [], "panel": { "id": 55, "hash_id": null, "name": "Blepharophimosis", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with syndromic and non-syndromic blepharophimosis.", "status": "public", "version": "1.3", "version_created": "2025-04-27T09:04:52.368864+10:00", "relevant_disorders": [ "Blepharophimosis", "HP:0000581" ], "stats": { "number_of_genes": 23, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 63, "hash_id": null, "name": "Congenital anomalies of the kidney and urinary tract (CAKUT)", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel contains genes associated with nonsyndromic and syndromic congenital anomalies of the kidney and urinary tract (CAKUT).", "status": "public", "version": "0.204", "version_created": "2026-03-19T13:24:30.325727+11:00", "relevant_disorders": [ "Abnormality of the urinary system HP:0000079" ], "stats": { "number_of_genes": 124, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "RNF163", "ZCCHC22", "CNBP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13164", "gene_name": "CCHC-type zinc finger nucleic acid binding protein", "omim_gene": [ "116955" ], "alias_name": null, "gene_symbol": "CNBP", "hgnc_symbol": "CNBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:128888327-128902765", "ensembl_id": "ENSG00000169714" } }, "GRch38": { "90": { "location": "3:129169484-129183922", "ensembl_id": "ENSG00000169714" } } }, "hgnc_date_symbol_changed": "2006-06-29" }, "entity_type": "str", "entity_name": "CNBP_DM2_CCTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301639", "11486088", "37123986", "34024776", "29086017", "28491317" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 2 MIM#602668" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCTG", "chromosome": "3", "grch37_coordinates": [ 128891420, 128891499 ], "grch38_coordinates": [ 129172577, 129172656 ], "normal_repeats": 26, "pathogenic_repeats": 75, "tags": [ "adult-onset" ], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "DMK", "DM1PK", "MDPK", "MT-PK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2933", "gene_name": "DM1 protein kinase", "omim_gene": [ "605377" ], "alias_name": [ "dystrophia myotonica 1", "DM protein kinase", "myotonin protein kinase A", "myotonic dystrophy associated protein kinase", "thymopoietin homolog" ], "gene_symbol": "DMPK", "hgnc_symbol": "DMPK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:46272975-46285810", "ensembl_id": "ENSG00000104936" } }, "GRch38": { "90": { "location": "19:45769717-45782552", "ensembl_id": "ENSG00000104936" } } }, "hgnc_date_symbol_changed": "1997-10-10" }, "entity_type": "str", "entity_name": "DMPK_DM1_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301344", "29325606" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 1 MIM#160900" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "19", "grch37_coordinates": [ 46273463, 46273522 ], "grch38_coordinates": [ 45770205, 45770264 ], "normal_repeats": 34, "pathogenic_repeats": 50, "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "XT-I", "PXYLT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15516", "gene_name": "xylosyltransferase 1", "omim_gene": [ "608124" ], "alias_name": [ "protein xylosyltransferase 1" ], "gene_symbol": "XYLT1", "hgnc_symbol": "XYLT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:17195626-17564738", "ensembl_id": "ENSG00000103489" } }, "GRch38": { "90": { "location": "16:17101769-17470881", "ensembl_id": "ENSG00000103489" } } }, "hgnc_date_symbol_changed": "2001-04-06" }, "entity_type": "str", "entity_name": "XYLT1_DBQD2_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "30554721" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Desbuquois dysplasia 2 MIM#615777" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 17564765, 17564779 ], "grch38_coordinates": [ 17470908, 17470922 ], "normal_repeats": 20, "pathogenic_repeats": 120, "tags": [], "panel": { "id": 68, "hash_id": null, "name": "Congenital Disorders of Glycosylation", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Congenital Disorders of Glycosylation' panel v2.4 with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.85", "version_created": "2026-04-02T10:46:27.496905+11:00", "relevant_disorders": [ "Abnormal transferrin saturation", "HP:0040135" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Phox2b", "NBPhox" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9143", "gene_name": "paired like homeobox 2b", "omim_gene": [ "603851" ], "alias_name": null, "gene_symbol": "PHOX2B", "hgnc_symbol": "PHOX2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:41746099-41750987", "ensembl_id": "ENSG00000109132" } }, "GRch38": { "90": { "location": "4:41744082-41748970", "ensembl_id": "ENSG00000109132" } } }, "hgnc_date_symbol_changed": "2003-02-14" }, "entity_type": "str", "entity_name": "PHOX2B_CCHS_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12640453", "34012823", "20301600", "18798833" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "4", "grch37_coordinates": [ 41747989, 41748048 ], "grch38_coordinates": [ 41745972, 41746031 ], "normal_repeats": 20, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 71, "hash_id": null, "name": "Central Hypoventilation", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed by and is maintained by VCGS.\r\n\r\nMore than 90% of individuals with congenital central hypoventilation syndrome have variants in the PHOX2B gene, most commonly an expansion of the polyalanine tract, which may not be tractable by all NGS assays.", "status": "public", "version": "1.7", "version_created": "2026-01-04T18:41:11.422790+11:00", "relevant_disorders": [ "Central hypoventilation HP:0007110" ], "stats": { "number_of_genes": 12, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CATCH22" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11592", "gene_name": "T-box 1", "omim_gene": [ "602054" ], "alias_name": null, "gene_symbol": "TBX1", "hgnc_symbol": "TBX1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:19744226-19771116", "ensembl_id": "ENSG00000184058" } }, "GRch38": { "90": { "location": "22:19756703-19783593", "ensembl_id": "ENSG00000184058" } } }, "hgnc_date_symbol_changed": "1997-05-15" }, "entity_type": "str", "entity_name": "TBX1_TOF_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "19948535", "11748311" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Tetralogy of Fallot MIM#187500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "22", "grch37_coordinates": [ 19754285, 19754330 ], "grch38_coordinates": [ 19766762, 19766807 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.534", "version_created": "2026-03-30T13:14:35.719896+11:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 253, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "SEF2-1B", "ITF2", "bHLHb19", "E2-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11634", "gene_name": "transcription factor 4", "omim_gene": [ "602272" ], "alias_name": null, "gene_symbol": "TCF4", "hgnc_symbol": "TCF4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:52889562-53332018", "ensembl_id": "ENSG00000196628" } }, "GRch38": { "90": { "location": "18:55222331-55664787", "ensembl_id": "ENSG00000196628" } } }, "hgnc_date_symbol_changed": "1990-10-16" }, "entity_type": "str", "entity_name": "TCF4_FECD3_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "25722209", "24255041" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Corneal dystrophy, Fuchs endothelial, 3 MIM#613267" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "18", "grch37_coordinates": [ 53253387, 53253458 ], "grch38_coordinates": [ 55586156, 55586227 ], "normal_repeats": 31, "pathogenic_repeats": 51, "tags": [], "panel": { "id": 91, "hash_id": null, "name": "Corneal Dystrophy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThe corneal dystrophies are a heterogenous group of bilateral genetically determined non-inflammatory corneal diseases that are restricted to the cornea, causing opacification. The corneal dystrophies can be divided into three groups based on the sole or predominant anatomical location of the abnormalities: (a). the anterior corneal dystrophies affect primarily the corneal epithelium and its basement membrane or Bowman layer and the superficial corneal stroma, (b).the stromal corneal dystrophies affect the corneal stroma, (c). the posterior corneal dystrophies affect the Descemet membrane and the corneal endothelium. \r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Corneal Dystrophy' panel with all discrepancies resolved, and reciprocal feedback provided to Genomics England, 27/07/2020.", "status": "public", "version": "1.21", "version_created": "2026-02-22T15:53:37.257206+11:00", "relevant_disorders": [ "Abnormal corneal morphology", "HP:0000481" ], "stats": { "number_of_genes": 33, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.46", "version_created": "2026-04-02T12:35:34.329595+11:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Phox2b", "NBPhox" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9143", "gene_name": "paired like homeobox 2b", "omim_gene": [ "603851" ], "alias_name": null, "gene_symbol": "PHOX2B", "hgnc_symbol": "PHOX2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:41746099-41750987", "ensembl_id": "ENSG00000109132" } }, "GRch38": { "90": { "location": "4:41744082-41748970", "ensembl_id": "ENSG00000109132" } } }, "hgnc_date_symbol_changed": "2003-02-14" }, "entity_type": "str", "entity_name": "PHOX2B_CCHS_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12640453", "34012823", "20301600", "18798833" ], "evidence": [ "Expert list", "Expert Review Green", "Expert list" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "4", "grch37_coordinates": [ 41747989, 41748048 ], "grch38_coordinates": [ 41745972, 41746031 ], "normal_repeats": 20, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 110, "hash_id": null, "name": "Hirschsprung disease", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.28", "version_created": "2026-01-04T18:41:54.183701+11:00", "relevant_disorders": [ "Aganglionic megacolon", "HP:0002251" ], "stats": { "number_of_genes": 14, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HPE5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12873", "gene_name": "Zic family member 2", "omim_gene": [ "603073" ], "alias_name": [ "Zinc finger protein of the cerebellum 2" ], "gene_symbol": "ZIC2", "hgnc_symbol": "ZIC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:100634026-100639018", "ensembl_id": "ENSG00000043355" } }, "GRch38": { "90": { "location": "13:99981772-99986773", "ensembl_id": "ENSG00000043355" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "str", "entity_name": "ZIC2_HPE5_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11285244", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Holoprosencephaly 5 MIM#609637" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "13", "grch37_coordinates": [ 100637703, 100637747 ], "grch38_coordinates": [ 99985449, 99985493 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 112, "hash_id": null, "name": "Holoprosencephaly and septo-optic dysplasia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "1.24", "version_created": "2026-03-03T11:24:20.637349+11:00", "relevant_disorders": [ "Holoprosencephaly", "HP:0001360; Septo-optic dysplasia", "HP:0100842" ], "stats": { "number_of_genes": 31, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "IT15" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4851", "gene_name": "huntingtin", "omim_gene": [ "613004" ], "alias_name": null, "gene_symbol": "HTT", "hgnc_symbol": "HTT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:3076408-3245676", "ensembl_id": "ENSG00000197386" } }, "GRch38": { "90": { "location": "4:3074681-3243959", "ensembl_id": "ENSG00000197386" } } }, "hgnc_date_symbol_changed": "2007-12-04" }, "entity_type": "str", "entity_name": "HTT_HD_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8458085", "20301482", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Huntington disease MIM#143100" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "4", "grch37_coordinates": [ 3076604, 3076666 ], "grch38_coordinates": [ 3074877, 3074939 ], "normal_repeats": 26, "pathogenic_repeats": 40, "tags": [], "panel": { "id": 126, "hash_id": null, "name": "Incidentalome", "disease_group": "", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with adult-onset cardiac, cancer and neurodegenerative disorders.\r\n\r\nThese genes are excluded from the Mendeliome panel to enable the use of the Mendeliome for panel-agnostic analysis in complex paediatric cases, while minimising the chance of incidental findings related to adult-onset conditions.\r\n\r\nIf analysis of these genes is required, the relevant panel should be requested (e.g. Adult Additional Findings; Neurodegenerative Disease_Adult Onset; Breast Cancer etc).", "status": "public", "version": "0.433", "version_created": "2026-03-25T17:03:27.624542+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 161, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MGC23980", "DENNL72" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28337", "gene_name": "chromosome 9 open reading frame 72", "omim_gene": [ "614260" ], "alias_name": null, "gene_symbol": "C9orf72", "hgnc_symbol": "C9orf72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:27546544-27573864", "ensembl_id": "ENSG00000147894" } }, "GRch38": { "90": { "location": "9:27546545-27573866", "ensembl_id": "ENSG00000147894" } } }, "hgnc_date_symbol_changed": "2004-01-06" }, "entity_type": "str", "entity_name": "C9orf72_FTDALS_GGGGCC", "confidence_level": "3", "penetrance": null, "publications": [ "25577942", "21944779", "21944778" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGGGCC", "chromosome": "9", "grch37_coordinates": [ 27573427, 27573544 ], "grch38_coordinates": [ 27573529, 27573546 ], "normal_repeats": 25, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 126, "hash_id": null, "name": "Incidentalome", "disease_group": "", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with adult-onset cardiac, cancer and neurodegenerative disorders.\r\n\r\nThese genes are excluded from the Mendeliome panel to enable the use of the Mendeliome for panel-agnostic analysis in complex paediatric cases, while minimising the chance of incidental findings related to adult-onset conditions.\r\n\r\nIf analysis of these genes is required, the relevant panel should be requested (e.g. Adult Additional Findings; Neurodegenerative Disease_Adult Onset; Breast Cancer etc).", "status": "public", "version": "0.433", "version_created": "2026-03-25T17:03:27.624542+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 161, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 21, "pathogenic_repeats": 14, "tags": [], "panel": { "id": 136, "hash_id": null, "name": "Mandibulofacial Acrofacial dysostosis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel contains genes associated with the facial dysostoses, which can be subdivided into mandibulofacial dysostoses, which present with craniofacial defects only, and acrofacial dysostoses, which encompass both craniofacial and limb anomalies. Facial dysostoses arise as a consequence of abnormal development of the first and second pharyngeal arches and their derivatives, including the upper and lower jaw and their hyoid support structures.", "status": "public", "version": "1.22", "version_created": "2026-03-25T17:21:58.910310+11:00", "relevant_disorders": [ "Craniofacial dysostosis", "HP:0004439" ], "stats": { "number_of_genes": 35, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PAB2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8565", "gene_name": "poly(A) binding protein nuclear 1", "omim_gene": [ "602279" ], "alias_name": null, "gene_symbol": "PABPN1", "hgnc_symbol": "PABPN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:23790498-23795394", "ensembl_id": "ENSG00000100836" } }, "GRch38": { "90": { "location": "14:23321289-23326185", "ensembl_id": "ENSG00000100836" } } }, "hgnc_date_symbol_changed": "1995-05-01" }, "entity_type": "str", "entity_name": "PABPN1_OPMD_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "9462747", "20301305" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Oculopharyngeal muscular dystrophy MIM#164300" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "repeated_sequence": "GCN", "chromosome": "14", "grch37_coordinates": [ 23790682, 23790711 ], "grch38_coordinates": [ 23321473, 23321502 ], "normal_repeats": 10, "pathogenic_repeats": 11, "tags": [ "adult-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:13997", "gene_name": "PR/SET domain 12", "omim_gene": [ "616458" ], "alias_name": [ "PR-domain containing protein 12", "PR-domain zinc finger protein 12" ], "gene_symbol": "PRDM12", "hgnc_symbol": "PRDM12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:133539981-133558368", "ensembl_id": "ENSG00000130711" } }, "GRch38": { "90": { "location": "9:130664594-130682981", "ensembl_id": "ENSG00000130711" } } }, "hgnc_date_symbol_changed": "2000-11-28" }, "entity_type": "str", "entity_name": "PRDM12_HSAN8_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "26005867" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCC", "chromosome": "9", "grch37_coordinates": [ 133556993, 133557026 ], "grch38_coordinates": [ 130681606, 130681639 ], "normal_repeats": 14, "pathogenic_repeats": 18, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TFIID" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11588", "gene_name": "TATA-box binding protein", "omim_gene": [ "600075" ], "alias_name": null, "gene_symbol": "TBP", "hgnc_symbol": "TBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:170863390-170881958", "ensembl_id": "ENSG00000112592" } }, "GRch38": { "90": { "location": "6:170554302-170572870", "ensembl_id": "ENSG00000112592" } } }, "hgnc_date_symbol_changed": "1993-05-26" }, "entity_type": "str", "entity_name": "TBP_SCA17_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "20301611", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 17 MIM#607136" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 170870996, 170871109 ], "grch38_coordinates": [ 170561908, 170562021 ], "normal_repeats": 40, "pathogenic_repeats": 49, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "GTT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18063", "gene_name": "StAR related lipid transfer domain containing 7", "omim_gene": [ "616712" ], "alias_name": null, "gene_symbol": "STARD7", "hgnc_symbol": "STARD7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:96850597-96874563", "ensembl_id": "ENSG00000084090" } }, "GRch38": { "90": { "location": "2:96184859-96208825", "ensembl_id": "ENSG00000084090" } } }, "hgnc_date_symbol_changed": "2002-01-24" }, "entity_type": "str", "entity_name": "STARD7_FAME2_ATTTC", "confidence_level": "3", "penetrance": null, "publications": [ "11701600", "24114805", "31664034" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 2 MIM#607876" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTTC", "chromosome": "2", "grch37_coordinates": [ 96862805, 96862859 ], "grch38_coordinates": [ 96197067, 96197121 ], "normal_repeats": 0, "pathogenic_repeats": 661, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ZNF927" ], "biotype": "protein_coding", "hgnc_id": "HGNC:777", "gene_name": "zinc finger homeobox 3", "omim_gene": [ "104155" ], "alias_name": null, "gene_symbol": "ZFHX3", "hgnc_symbol": "ZFHX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:72816784-73093597", "ensembl_id": "ENSG00000140836" } }, "GRch38": { "90": { "location": "16:72782885-73144447", "ensembl_id": "ENSG00000140836" } } }, "hgnc_date_symbol_changed": "2007-08-09" }, "entity_type": "str", "entity_name": "ZFHX3_SCA4_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "38035881", "38197134" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "spinocerebellar ataxia type 4 MONDO:0010847" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 72821594, 72821657 ], "grch38_coordinates": [ 72787695, 72787758 ], "normal_repeats": 30, "pathogenic_repeats": 48, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PDZ-GEF1", "RA-GEF", "DKFZP586O1422", "KIAA0313" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16854", "gene_name": "Rap guanine nucleotide exchange factor 2", "omim_gene": [ "609530" ], "alias_name": [ "Rap GEP" ], "gene_symbol": "RAPGEF2", "hgnc_symbol": "RAPGEF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:160025330-160281321", "ensembl_id": "ENSG00000109756" } }, "GRch38": { "90": { "location": "4:159104178-159360169", "ensembl_id": "ENSG00000109756" } } }, "hgnc_date_symbol_changed": "2004-03-01" }, "entity_type": "str", "entity_name": "RAPGEF2_FAME7_TTTCA", "confidence_level": "2", "penetrance": null, "publications": [ "29507423", "30351492", "33791773" ], "evidence": [ "Literature", "Expert Review Amber", "Expert Review Amber", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 7 MIM#618075" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "4", "grch37_coordinates": [ 160263679, 160263768 ], "grch38_coordinates": [ 159342527, 159342616 ], "normal_repeats": 0, "pathogenic_repeats": 1, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ST7", "FLJ12929" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31708", "gene_name": "LDL receptor related protein 12", "omim_gene": null, "alias_name": null, "gene_symbol": "LRP12", "hgnc_symbol": "LRP12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:105501459-105601252", "ensembl_id": "ENSG00000147650" } }, "GRch38": { "90": { "location": "8:104489231-104589024", "ensembl_id": "ENSG00000147650" } } }, "hgnc_date_symbol_changed": "2004-07-06" }, "entity_type": "str", "entity_name": "LRP12_OPDM1_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "31332380", "34047774", "37339631" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Oculopharyngodistal myopathy 1 MIM#164310", "Amyotrophic lateral sclerosis MONDO:0004976" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "8", "grch37_coordinates": [ 105601201, 105601227 ], "grch38_coordinates": [ 104588973, 104588999 ], "normal_repeats": 45, "pathogenic_repeats": 85, "tags": [ "adult-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "S3-12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29393", "gene_name": "perilipin 4", "omim_gene": [ "613247" ], "alias_name": null, "gene_symbol": "PLIN4", "hgnc_symbol": "PLIN4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:4502204-4517716", "ensembl_id": "ENSG00000167676" } }, "GRch38": { "90": { "location": "19:4502180-4518465", "ensembl_id": "ENSG00000167676" } } }, "hgnc_date_symbol_changed": "2009-08-12" }, "entity_type": "str", "entity_name": "PLIN4_MRUPAV_33-mer", "confidence_level": "3", "penetrance": null, "publications": [ "32451610", "37145156", "36151849", "35499779" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "myopathy, distal, with rimmed vacuoles MONDO:0014945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC", "chromosome": "19", "grch37_coordinates": [ 4510975, 4511073 ], "grch38_coordinates": [ 4510963, 4511061 ], "normal_repeats": 31, "pathogenic_repeats": 39, "tags": [ "STR" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HPE5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12873", "gene_name": "Zic family member 2", "omim_gene": [ "603073" ], "alias_name": [ "Zinc finger protein of the cerebellum 2" ], "gene_symbol": "ZIC2", "hgnc_symbol": "ZIC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:100634026-100639018", "ensembl_id": "ENSG00000043355" } }, "GRch38": { "90": { "location": "13:99981772-99986773", "ensembl_id": "ENSG00000043355" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "str", "entity_name": "ZIC2_HPE5_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11285244", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Holoprosencephaly 5 MIM#609637" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "13", "grch37_coordinates": [ 100637703, 100637747 ], "grch38_coordinates": [ 99985449, 99985493 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5136", "gene_name": "homeobox D13", "omim_gene": [ "142989" ], "alias_name": null, "gene_symbol": "HOXD13", "hgnc_symbol": "HOXD13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:176957619-176960666", "ensembl_id": "ENSG00000128714" } }, "GRch38": { "90": { "location": "2:176092891-176095938", "ensembl_id": "ENSG00000128714" } } }, "hgnc_date_symbol_changed": "1991-05-08" }, "entity_type": "str", "entity_name": "HOXD13_SPD1_GCG", "confidence_level": "3", "penetrance": null, "publications": [ "8817328", "33811808", "33533119" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Synpolydactyly 1 MIM#186000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCG", "chromosome": "2", "grch37_coordinates": [ 176957787, 176957831 ], "grch38_coordinates": [ 176093059, 176093103 ], "normal_repeats": 15, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ39458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31750", "gene_name": "sterile alpha motif domain containing 12", "omim_gene": null, "alias_name": null, "gene_symbol": "SAMD12", "hgnc_symbol": "SAMD12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:119201698-119634234", "ensembl_id": "ENSG00000177570" } }, "GRch38": { "90": { "location": "8:118189459-118621995", "ensembl_id": "ENSG00000177570" } } }, "hgnc_date_symbol_changed": "2004-07-15" }, "entity_type": "str", "entity_name": "SAMD12_FAME1_TTTCA", "confidence_level": "3", "penetrance": null, "publications": [ "30194086", "29507423" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 1 MIM#601068" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "repeated_sequence": "TTTCA", "chromosome": "8", "grch37_coordinates": [ 119379055, 119379157 ], "grch38_coordinates": [ 118366816, 118366918 ], "normal_repeats": 0, "pathogenic_repeats": 100, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX3", "JOS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7106", "gene_name": "ataxin 3", "omim_gene": [ "607047" ], "alias_name": null, "gene_symbol": "ATXN3", "hgnc_symbol": "ATXN3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:92524896-92572965", "ensembl_id": "ENSG00000066427" } }, "GRch38": { "90": { "location": "14:92038652-92106621", "ensembl_id": "ENSG00000066427" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN3_SCA3_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "20301375", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Machado-Joseph disease MIM#109150", "Spinocerebellar ataxia type 3" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "14", "grch37_coordinates": [ 92537355, 92537396 ], "grch38_coordinates": [ 92071011, 92071052 ], "normal_repeats": 44, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PR55-BETA", "PR52B", "B55beta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9305", "gene_name": "protein phosphatase 2 regulatory subunit Bbeta", "omim_gene": [ "604325" ], "alias_name": [ "PP2A subunit B isoform beta" ], "gene_symbol": "PPP2R2B", "hgnc_symbol": "PPP2R2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:145967936-146464347", "ensembl_id": "ENSG00000156475" } }, "GRch38": { "90": { "location": "5:146581146-147084784", "ensembl_id": "ENSG00000156475" } } }, "hgnc_date_symbol_changed": "1993-01-25" }, "entity_type": "str", "entity_name": "PPP2R2B_SCA12_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "27864267", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 12 MIM#604326" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "5", "grch37_coordinates": [ 146258292, 146258321 ], "grch38_coordinates": [ 146878729, 146878758 ], "normal_repeats": 32, "pathogenic_repeats": 51, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "antisense_RNA", "hgnc_id": "HGNC:51204", "gene_name": "NUTM2B antisense RNA 1", "omim_gene": null, "alias_name": null, "gene_symbol": "NUTM2B-AS1", "hgnc_symbol": "NUTM2B-AS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:81563813-81586350", "ensembl_id": "ENSG00000225484" } }, "GRch38": { "90": { "location": "10:79663088-79826594", "ensembl_id": "ENSG00000225484" } } }, "hgnc_date_symbol_changed": "2014-08-07" }, "entity_type": "str", "entity_name": "NUTM2B-AS1_OPDM_CCG", "confidence_level": "3", "penetrance": null, "publications": [ "31332380" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCG", "chromosome": "10", "grch37_coordinates": [ 81586142, 81586159 ], "grch38_coordinates": [ 79826386, 79826403 ], "normal_repeats": 16, "pathogenic_repeats": 35, "tags": [ "adult-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ39378" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26814", "gene_name": "Rab interacting lysosomal protein like 1", "omim_gene": [ "614092" ], "alias_name": null, "gene_symbol": "RILPL1", "hgnc_symbol": "RILPL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:123955925-124018265", "ensembl_id": "ENSG00000188026" } }, "GRch38": { "90": { "location": "12:123470054-123533718", "ensembl_id": "ENSG00000188026" } } }, "hgnc_date_symbol_changed": "2007-11-27" }, "entity_type": "str", "entity_name": "RILPL1_OPDM4_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "35148830" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngodistal myopathy MONDO:0025193" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "12", "grch37_coordinates": [ 124018270, 124018296 ], "grch38_coordinates": [ 123533723, 123533749 ], "normal_repeats": 16, "pathogenic_repeats": 139, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "SCA36" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15911", "gene_name": "NOP56 ribonucleoprotein", "omim_gene": [ "614154" ], "alias_name": [ "spinocerebellar ataxia 36" ], "gene_symbol": "NOP56", "hgnc_symbol": "NOP56", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:2632791-2639039", "ensembl_id": "ENSG00000101361" } }, "GRch38": { "90": { "location": "20:2652145-2658393", "ensembl_id": "ENSG00000101361" } } }, "hgnc_date_symbol_changed": "2009-01-13" }, "entity_type": "str", "entity_name": "NOP56_SCA36_GGCCTG", "confidence_level": "3", "penetrance": null, "publications": [ "21683323" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 36 MIM#614153" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGCCTG", "chromosome": "20", "grch37_coordinates": [ 2633380, 2633403 ], "grch38_coordinates": [ 2652734, 2652757 ], "normal_repeats": 14, "pathogenic_repeats": 650, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "A1", "PO-GA", "RFC140", "MHCBFB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9969", "gene_name": "replication factor C subunit 1", "omim_gene": [ "102579" ], "alias_name": null, "gene_symbol": "RFC1", "hgnc_symbol": "RFC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:39289076-39367995", "ensembl_id": "ENSG00000035928" } }, "GRch38": { "90": { "location": "4:39287456-39366375", "ensembl_id": "ENSG00000035928" } } }, "hgnc_date_symbol_changed": "1994-10-14" }, "entity_type": "str", "entity_name": "RFC1_CANVAS_ANNGN", "confidence_level": "3", "penetrance": null, "publications": [ "33237689", "32694621", "33103729", "35355059", "37450567" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "ANNGN", "chromosome": "4", "grch37_coordinates": [ 39350045, 39350103 ], "grch38_coordinates": [ 39348425, 39348483 ], "normal_repeats": 0, "pathogenic_repeats": 400, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "E46L", "FLJ37990" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10549", "gene_name": "ataxin 10", "omim_gene": [ "611150" ], "alias_name": null, "gene_symbol": "ATXN10", "hgnc_symbol": "ATXN10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:46067678-46241187", "ensembl_id": "ENSG00000130638" } }, "GRch38": { "90": { "location": "22:45671798-45845307", "ensembl_id": "ENSG00000130638" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "str", "entity_name": "ATXN10_SCA10_ATTCT", "confidence_level": "3", "penetrance": null, "publications": [ "20301354" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 10 MIM#603516" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTCT", "chromosome": "22", "grch37_coordinates": [ 46191235, 46191304 ], "grch38_coordinates": [ 45795355, 45795424 ], "normal_repeats": 32, "pathogenic_repeats": 800, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ22215", "VWA-1", "WARP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30910", "gene_name": "von Willebrand factor A domain containing 1", "omim_gene": [ "611901" ], "alias_name": null, "gene_symbol": "VWA1", "hgnc_symbol": "VWA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:1370241-1378262", "ensembl_id": "ENSG00000179403" } }, "GRch38": { "90": { "location": "1:1434861-1442882", "ensembl_id": "ENSG00000179403" } } }, "hgnc_date_symbol_changed": "2005-07-18" }, "entity_type": "str", "entity_name": "VWA1_HMNMYO_GCGCGGAGCG", "confidence_level": "3", "penetrance": null, "publications": [ "33559681", "33459760" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Neuropathy, hereditary motor, with myopathic features\tMIM#619216" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCGCGGAGCG", "chromosome": "1", "grch37_coordinates": [ 1371179, 1371198 ], "grch38_coordinates": [ 1435799, 1435818 ], "normal_repeats": 2, "pathogenic_repeats": 3, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "XT-I", "PXYLT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15516", "gene_name": "xylosyltransferase 1", "omim_gene": [ "608124" ], "alias_name": [ "protein xylosyltransferase 1" ], "gene_symbol": "XYLT1", "hgnc_symbol": "XYLT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:17195626-17564738", "ensembl_id": "ENSG00000103489" } }, "GRch38": { "90": { "location": "16:17101769-17470881", "ensembl_id": "ENSG00000103489" } } }, "hgnc_date_symbol_changed": "2001-04-06" }, "entity_type": "str", "entity_name": "XYLT1_DBQD2_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "30554721" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Desbuquois dysplasia 2 MIM#615777" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 17564765, 17564779 ], "grch38_coordinates": [ 17470908, 17470922 ], "normal_repeats": 20, "pathogenic_repeats": 120, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "JP-3", "CAGL237", "HDL2", "JP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14203", "gene_name": "junctophilin 3", "omim_gene": [ "605268" ], "alias_name": null, "gene_symbol": "JPH3", "hgnc_symbol": "JPH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:87635441-87731762", "ensembl_id": "ENSG00000154118" } }, "GRch38": { "90": { "location": "16:87601835-87698156", "ensembl_id": "ENSG00000154118" } } }, "hgnc_date_symbol_changed": "2000-12-08" }, "entity_type": "str", "entity_name": "JPH3_HDL2_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301701" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Huntington disease-like 2 MIM#606438" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "16", "grch37_coordinates": [ 87637894, 87637935 ], "grch38_coordinates": [ 87604288, 87604329 ], "normal_repeats": 28, "pathogenic_repeats": 40, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "SEF2-1B", "ITF2", "bHLHb19", "E2-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11634", "gene_name": "transcription factor 4", "omim_gene": [ "602272" ], "alias_name": null, "gene_symbol": "TCF4", "hgnc_symbol": "TCF4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:52889562-53332018", "ensembl_id": "ENSG00000196628" } }, "GRch38": { "90": { "location": "18:55222331-55664787", "ensembl_id": "ENSG00000196628" } } }, "hgnc_date_symbol_changed": "1990-10-16" }, "entity_type": "str", "entity_name": "TCF4_FECD3_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "25722209", "24255041" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Corneal dystrophy, Fuchs endothelial, 3 MIM#613267" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "18", "grch37_coordinates": [ 53253387, 53253458 ], "grch38_coordinates": [ 55586156, 55586227 ], "normal_repeats": 31, "pathogenic_repeats": 51, "tags": [ "adult-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CATCH22" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11592", "gene_name": "T-box 1", "omim_gene": [ "602054" ], "alias_name": null, "gene_symbol": "TBX1", "hgnc_symbol": "TBX1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:19744226-19771116", "ensembl_id": "ENSG00000184058" } }, "GRch38": { "90": { "location": "22:19756703-19783593", "ensembl_id": "ENSG00000184058" } } }, "hgnc_date_symbol_changed": "1997-05-15" }, "entity_type": "str", "entity_name": "TBX1_TOF_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "19948535", "11748311" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Tetralogy of Fallot MIM#187500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "22", "grch37_coordinates": [ 19754285, 19754330 ], "grch38_coordinates": [ 19766762, 19766807 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "D6S504E", "ATX1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10548", "gene_name": "ataxin 1", "omim_gene": [ "601556" ], "alias_name": null, "gene_symbol": "ATXN1", "hgnc_symbol": "ATXN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:16299343-16761722", "ensembl_id": "ENSG00000124788" } }, "GRch38": { "90": { "location": "6:16299112-16761491", "ensembl_id": "ENSG00000124788" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN1_SCA1_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301363" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 1 MIM#164400" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 16327918, 16327953 ], "grch38_coordinates": [ 16327687, 16327722 ], "normal_repeats": 35, "pathogenic_repeats": 39, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TIP-2", "Hs.6454", "GIPC", "SEMCAP", "GLUT1CBP", "SYNECTIN", "NIP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1226", "gene_name": "GIPC PDZ domain containing family member 1", "omim_gene": [ "605072" ], "alias_name": null, "gene_symbol": "GIPC1", "hgnc_symbol": "GIPC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:14588572-14606944", "ensembl_id": "ENSG00000123159" } }, "GRch38": { "90": { "location": "19:14477760-14496149", "ensembl_id": "ENSG00000123159" } } }, "hgnc_date_symbol_changed": "2005-06-28" }, "entity_type": "str", "entity_name": "GIPC1_OPDM2_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "32413282", "33374016" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngodistal myopathy 2 MIM#618940" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "19", "grch37_coordinates": [ 14606854, 14606886 ], "grch38_coordinates": [ 14496042, 14496074 ], "normal_repeats": 32, "pathogenic_repeats": 70, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0838", "GLS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4331", "gene_name": "glutaminase", "omim_gene": [ "138280" ], "alias_name": null, "gene_symbol": "GLS", "hgnc_symbol": "GLS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:191745553-191830278", "ensembl_id": "ENSG00000115419" } }, "GRch38": { "90": { "location": "2:190880827-190965552", "ensembl_id": "ENSG00000115419" } } }, "hgnc_date_symbol_changed": "1989-02-07" }, "entity_type": "str", "entity_name": "GLS_GDPAG_GCA", "confidence_level": "3", "penetrance": null, "publications": [ "30970188" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCA", "chromosome": "2", "grch37_coordinates": [ 191745599, 191745646 ], "grch38_coordinates": [ 190880873, 190880920 ], "normal_repeats": 16, "pathogenic_repeats": 400, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FRAXE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3776", "gene_name": "AF4/FMR2 family member 2", "omim_gene": [ "300806" ], "alias_name": null, "gene_symbol": "AFF2", "hgnc_symbol": "AFF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:147582139-148082193", "ensembl_id": "ENSG00000155966" } }, "GRch38": { "90": { "location": "X:148500619-149000663", "ensembl_id": "ENSG00000155966" } } }, "hgnc_date_symbol_changed": "2005-06-27" }, "entity_type": "str", "entity_name": "AFF2_FRAXE_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "8334699", "8673085", "11388762" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Intellectual developmental disorder, X-linked 109 MIM#309548" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCC", "chromosome": "X", "grch37_coordinates": [ 147582158, 147582202 ], "grch38_coordinates": [ 148500638, 148500682 ], "normal_repeats": 44, "pathogenic_repeats": 200, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA1463", "FLJ34278" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29284", "gene_name": "disco interacting protein 2 homolog B", "omim_gene": [ "611379" ], "alias_name": null, "gene_symbol": "DIP2B", "hgnc_symbol": "DIP2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:50898768-51142450", "ensembl_id": "ENSG00000066084" } }, "GRch38": { "90": { "location": "12:50504985-50748667", "ensembl_id": "ENSG00000066084" } } }, "hgnc_date_symbol_changed": "2006-01-13" }, "entity_type": "str", "entity_name": "DIP2B_FRA12A_CGG", "confidence_level": "2", "penetrance": null, "publications": [ "17236128", "33510257", "39854091", "41028987" ], "evidence": [ "Expert Review Amber", "Other" ], "phenotypes": [ "Intellectual developmental disorder, autosomal dominant, FRA12A type MIM#136630" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "12", "grch37_coordinates": [ 50898787, 50898807 ], "grch38_coordinates": [ 50505004, 50505024 ], "normal_repeats": 23, "pathogenic_repeats": 280, "tags": [ "5'UTR" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "BPES1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1092", "gene_name": "forkhead box L2", "omim_gene": [ "605597" ], "alias_name": null, "gene_symbol": "FOXL2", "hgnc_symbol": "FOXL2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:138663066-138665982", "ensembl_id": "ENSG00000183770" } }, "GRch38": { "90": { "location": "3:138944224-138947140", "ensembl_id": "ENSG00000183770" } } }, "hgnc_date_symbol_changed": "1992-02-28" }, "entity_type": "str", "entity_name": "FOXL2_BPES_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11468277", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100", "Premature ovarian failure 3 MIM#608996" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "repeated_sequence": "GCN", "chromosome": "3", "grch37_coordinates": [ 138664863, 138664904 ], "grch38_coordinates": [ 138946021, 138946062 ], "normal_repeats": 14, "pathogenic_repeats": 19, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NSCL2", "TAFII250", "KAT4", "DYT3/TAF1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11535", "gene_name": "TATA-box binding protein associated factor 1", "omim_gene": [ "313650" ], "alias_name": null, "gene_symbol": "TAF1", "hgnc_symbol": "TAF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:70586114-70752224", "ensembl_id": "ENSG00000147133" } }, "GRch38": { "90": { "location": "X:71366239-71532374", "ensembl_id": "ENSG00000147133" } } }, "hgnc_date_symbol_changed": "2001-12-07" }, "entity_type": "str", "entity_name": "TAF1_XDP_CCCTCT", "confidence_level": "3", "penetrance": null, "publications": [ "17273961", "29229810" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Dystonia-Parkinsonism, X-linked MIM#314250" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "CCCTCT", "chromosome": "X", "grch37_coordinates": [ 70672905, 70672979 ], "grch38_coordinates": [ 71453055, 71453129 ], "normal_repeats": 13, "pathogenic_repeats": 30, "tags": [ "founder", "adult-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Phox2b", "NBPhox" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9143", "gene_name": "paired like homeobox 2b", "omim_gene": [ "603851" ], "alias_name": null, "gene_symbol": "PHOX2B", "hgnc_symbol": "PHOX2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:41746099-41750987", "ensembl_id": "ENSG00000109132" } }, "GRch38": { "90": { "location": "4:41744082-41748970", "ensembl_id": "ENSG00000109132" } } }, "hgnc_date_symbol_changed": "2003-02-14" }, "entity_type": "str", "entity_name": "PHOX2B_CCHS_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12640453", "34012823", "20301600", "18798833" ], "evidence": [ "Expert list", "Expert Review Green", "Expert list" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "4", "grch37_coordinates": [ 41747989, 41748048 ], "grch38_coordinates": [ 41745972, 41746031 ], "normal_repeats": 20, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "str", "entity_name": "FXN_FRDA_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "20301458", "8596916" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Friedreich ataxia MIM#229300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GAA", "chromosome": "9", "grch37_coordinates": [ 71652203, 71652220 ], "grch38_coordinates": [ 69037287, 69037304 ], "normal_repeats": 33, "pathogenic_repeats": 66, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11199", "gene_name": "SRY-box 3", "omim_gene": [ "313430" ], "alias_name": null, "gene_symbol": "SOX3", "hgnc_symbol": "SOX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:139585152-139587225", "ensembl_id": "ENSG00000134595" } }, "GRch38": { "90": { "location": "X:140502985-140505116", "ensembl_id": "ENSG00000134595" } } }, "hgnc_date_symbol_changed": "1993-11-30" }, "entity_type": "str", "entity_name": "SOX3_PHPX_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12428212", "15800844", "33811808", "23505376", "19654509" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Intellectual disability, X-linked, with isolated growth hormone deficiency MIM#300123", "Panhypopituitarism, X-linked MIM#312000" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 139586482, 139586526 ], "grch38_coordinates": [ 140504317, 140504361 ], "normal_repeats": 15, "pathogenic_repeats": 22, "tags": [ "paediatric-onset" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10555", "gene_name": "ataxin 2", "omim_gene": [ "601517" ], "alias_name": [ "trinucleotide repeat containing 13" ], "gene_symbol": "ATXN2", "hgnc_symbol": "ATXN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:111890018-112037480", "ensembl_id": "ENSG00000204842" } }, "GRch38": { "90": { "location": "12:111452214-111599676", "ensembl_id": "ENSG00000204842" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN2_SCA2_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301452" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 2 MIM#183090" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 112036755, 112036823 ], "grch38_coordinates": [ 111598951, 111599019 ], "normal_repeats": 31, "pathogenic_repeats": 35, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2661", "gene_name": "DAB1, reelin adaptor protein", "omim_gene": [ "603448" ], "alias_name": null, "gene_symbol": "DAB1", "hgnc_symbol": "DAB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:57460451-59012406", "ensembl_id": "ENSG00000173406" } }, "GRch38": { "90": { "location": "1:56994778-58546734", "ensembl_id": "ENSG00000173406" } } }, "hgnc_date_symbol_changed": "1998-06-12" }, "entity_type": "str", "entity_name": "DAB1_SCA37_ATTTC", "confidence_level": "3", "penetrance": null, "publications": [ "28686858", "31145571" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 37 MIM#615945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTTC", "chromosome": "1", "grch37_coordinates": [ 57832716, 57832797 ], "grch38_coordinates": [ 57367044, 57367121 ], "normal_repeats": 0, "pathogenic_repeats": 31, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "DMK", "DM1PK", "MDPK", "MT-PK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2933", "gene_name": "DM1 protein kinase", "omim_gene": [ "605377" ], "alias_name": [ "dystrophia myotonica 1", "DM protein kinase", "myotonin protein kinase A", "myotonic dystrophy associated protein kinase", "thymopoietin homolog" ], "gene_symbol": "DMPK", "hgnc_symbol": "DMPK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:46272975-46285810", "ensembl_id": "ENSG00000104936" } }, "GRch38": { "90": { "location": "19:45769717-45782552", "ensembl_id": "ENSG00000104936" } } }, "hgnc_date_symbol_changed": "1997-10-10" }, "entity_type": "str", "entity_name": "DMPK_DM1_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301344", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 1 MIM#160900" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "19", "grch37_coordinates": [ 46273463, 46273522 ], "grch38_coordinates": [ 45770205, 45770264 ], "normal_repeats": 34, "pathogenic_repeats": 50, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "RNF163", "ZCCHC22", "CNBP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13164", "gene_name": "CCHC-type zinc finger nucleic acid binding protein", "omim_gene": [ "116955" ], "alias_name": null, "gene_symbol": "CNBP", "hgnc_symbol": "CNBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:128888327-128902765", "ensembl_id": "ENSG00000169714" } }, "GRch38": { "90": { "location": "3:129169484-129183922", "ensembl_id": "ENSG00000169714" } } }, "hgnc_date_symbol_changed": "2006-06-29" }, "entity_type": "str", "entity_name": "CNBP_DM2_CCTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301639", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 2 MIM#602668" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCTG", "chromosome": "3", "grch37_coordinates": [ 128891420, 128891499 ], "grch38_coordinates": [ 129172577, 129172656 ], "normal_repeats": 26, "pathogenic_repeats": 75, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PMP70", "ZWS2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:67", "gene_name": "ATP binding cassette subfamily D member 3", "omim_gene": [ "170995" ], "alias_name": null, "gene_symbol": "ABCD3", "hgnc_symbol": "ABCD3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:94883933-94984222", "ensembl_id": "ENSG00000117528" } }, "GRch38": { "90": { "location": "1:94418455-94518666", "ensembl_id": "ENSG00000117528" } } }, "hgnc_date_symbol_changed": "1992-03-03" }, "entity_type": "str", "entity_name": "ABCD3_OPDM_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "39068203" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngodistal myopathy 5, MIM# 621446" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCC", "chromosome": "1", "grch37_coordinates": [ 94883977, 94883998 ], "grch38_coordinates": [ 94418421, 94418442 ], "normal_repeats": 50, "pathogenic_repeats": 118, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:24160", "gene_name": "brain expressed associated with NEDD4 1", "omim_gene": [ "612051" ], "alias_name": null, "gene_symbol": "BEAN1", "hgnc_symbol": "BEAN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:66461200-66527432", "ensembl_id": "ENSG00000166546" } }, "GRch38": { "90": { "location": "16:66427297-66493529", "ensembl_id": "ENSG00000166546" } } }, "hgnc_date_symbol_changed": "2010-10-05" }, "entity_type": "str", "entity_name": "BEAN1_SCA31_TGGAA", "confidence_level": "3", "penetrance": null, "publications": [ "19878914", "31755042" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 31 MIM#117210" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TGGAA", "chromosome": "16", "grch37_coordinates": [ 66524301, 66524302 ], "grch38_coordinates": [ 66490398, 66490399 ], "normal_repeats": 22, "pathogenic_repeats": 80, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "OPCA3", "ADCAII" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10560", "gene_name": "ataxin 7", "omim_gene": [ "607640" ], "alias_name": null, "gene_symbol": "ATXN7", "hgnc_symbol": "ATXN7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:63850233-63989138", "ensembl_id": "ENSG00000163635" } }, "GRch38": { "90": { "location": "3:63864557-64003462", "ensembl_id": "ENSG00000163635" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "str", "entity_name": "ATXN7_SCA7_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301433" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 7 MIM#164500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "3", "grch37_coordinates": [ 63898362, 63898391 ], "grch38_coordinates": [ 63912686, 63912715 ], "normal_repeats": 27, "pathogenic_repeats": 37, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TEB4", "MARCH-VI", "RNF176" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30550", "gene_name": "membrane associated ring-CH-type finger 6", "omim_gene": [ "613297" ], "alias_name": null, "gene_symbol": "MARCH6", "hgnc_symbol": "MARCH6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:10353815-10440500", "ensembl_id": "ENSG00000145495" } }, "GRch38": { "90": { "location": "5:10353703-10440388", "ensembl_id": "ENSG00000145495" } } }, "hgnc_date_symbol_changed": "2005-01-26" }, "entity_type": "str", "entity_name": "MARCHF6_FAME3_TTTCA", "confidence_level": "3", "penetrance": null, "publications": [ "31664039" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 3 MIM#613608" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "5", "grch37_coordinates": [ 10356451, 10356519 ], "grch38_coordinates": [ 10356347, 10356411 ], "normal_repeats": 0, "pathogenic_repeats": 660, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5136", "gene_name": "homeobox D13", "omim_gene": [ "142989" ], "alias_name": null, "gene_symbol": "HOXD13", "hgnc_symbol": "HOXD13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:176957619-176960666", "ensembl_id": "ENSG00000128714" } }, "GRch38": { "90": { "location": "2:176092891-176095938", "ensembl_id": "ENSG00000128714" } } }, "hgnc_date_symbol_changed": "1991-05-08" }, "entity_type": "str", "entity_name": "HOXD13_SPD1_GCG", "confidence_level": "3", "penetrance": null, "publications": [ "8817328", "33811808", "33533119" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Synpolydactyly 1 MIM#186000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCG", "chromosome": "2", "grch37_coordinates": [ 176957787, 176957831 ], "grch38_coordinates": [ 176093059, 176093103 ], "normal_repeats": 15, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 159, "hash_id": null, "name": "Polydactyly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It contains genes that cause syndromic and non-syndromic polydactyly.", "status": "public", "version": "0.301", "version_created": "2026-03-12T11:30:58.449890+11:00", "relevant_disorders": [ "Polydactyly", "HP:0010442" ], "stats": { "number_of_genes": 141, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 159, "hash_id": null, "name": "Polydactyly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It contains genes that cause syndromic and non-syndromic polydactyly.", "status": "public", "version": "0.301", "version_created": "2026-03-12T11:30:58.449890+11:00", "relevant_disorders": [ "Polydactyly", "HP:0010442" ], "stats": { "number_of_genes": 141, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 12, "pathogenic_repeats": 14, "tags": [], "panel": { "id": 160, "hash_id": null, "name": "Pierre Robin Sequence", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.61", "version_created": "2026-01-26T17:52:14.382309+11:00", "relevant_disorders": [ "Pierre Robin sequence", "HP:0000201" ], "stats": { "number_of_genes": 54, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Phox2b", "NBPhox" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9143", "gene_name": "paired like homeobox 2b", "omim_gene": [ "603851" ], "alias_name": null, "gene_symbol": "PHOX2B", "hgnc_symbol": "PHOX2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:41746099-41750987", "ensembl_id": "ENSG00000109132" } }, "GRch38": { "90": { "location": "4:41744082-41748970", "ensembl_id": "ENSG00000109132" } } }, "hgnc_date_symbol_changed": "2003-02-14" }, "entity_type": "str", "entity_name": "PHOX2B_CCHS_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12640453", "34012823", "20301600", "18798833" ], "evidence": [ "Expert list", "Expert Review Green", "Expert list" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "4", "grch37_coordinates": [ 41747989, 41748048 ], "grch38_coordinates": [ 41745972, 41746031 ], "normal_repeats": 20, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 162, "hash_id": null, "name": "Pulmonary Fibrosis_Interstitial Lung Disease", "disease_group": "Respiratory disorders", "disease_sub_group": "", "description": "This panel includes genes causing lung fibrosis across the age spectrum. The paediatric manifestations include the childhood interstitial lung diseases (chILD), which are characterised by remodelling of lung parenchyma leading to abnormal gas exchange and have been classified broadly into those that occur during infancy (<2 years of age) and those that are not specific to infancy (>2 years of age). These childhood presentations are generally distinct from the presentations of ILD in older adults, which primarily manifests as Idiopathic Pulmonary Fibrosis (IPF).\r\n\r\nThis panel was originally developed by VCGS. It incorporates the panel used by chILDRANZ, the Australian Genomics Childhood Interstitial Lung Disease Flagship study, PMID: 36085161, with thanks to Dr Suzanna Lindsey-Temple.\r\n\r\nDepending on the specific clinical findings, please also consider the Pulmonary Arterial Hypertension, Immunological Disorders_Superpanel, and the Ciliary Dyskinesia panels.\r\n\r\nUpdated following literature review 19/12/2025.", "status": "public", "version": "1.10", "version_created": "2026-03-17T11:39:32.713501+11:00", "relevant_disorders": [ "Pulmonary fibrosis", "HP:0002206; Abnormal pulmonary interstitial morphology", "HP:0006530" ], "stats": { "number_of_genes": 97, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 163, "hash_id": null, "name": "Radial Ray Abnormalities", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Radial Dysplasia' panel and all differences have been resolved, with reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.21", "version_created": "2026-01-15T11:51:47.687282+11:00", "relevant_disorders": [ "Abnormality of radial ray", "HP:0410049" ], "stats": { "number_of_genes": 62, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "GTT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18063", "gene_name": "StAR related lipid transfer domain containing 7", "omim_gene": [ "616712" ], "alias_name": null, "gene_symbol": "STARD7", "hgnc_symbol": "STARD7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:96850597-96874563", "ensembl_id": "ENSG00000084090" } }, "GRch38": { "90": { "location": "2:96184859-96208825", "ensembl_id": "ENSG00000084090" } } }, "hgnc_date_symbol_changed": "2002-01-24" }, "entity_type": "str", "entity_name": "STARD7_FAME2_ATTTC", "confidence_level": "3", "penetrance": null, "publications": [ "11701600", "24114805", "31664034" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 2 MIM#607876" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTTC", "chromosome": "2", "grch37_coordinates": [ 96862805, 96862859 ], "grch38_coordinates": [ 96197067, 96197121 ], "normal_repeats": 0, "pathogenic_repeats": 661, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ39458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31750", "gene_name": "sterile alpha motif domain containing 12", "omim_gene": null, "alias_name": null, "gene_symbol": "SAMD12", "hgnc_symbol": "SAMD12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:119201698-119634234", "ensembl_id": "ENSG00000177570" } }, "GRch38": { "90": { "location": "8:118189459-118621995", "ensembl_id": "ENSG00000177570" } } }, "hgnc_date_symbol_changed": "2004-07-15" }, "entity_type": "str", "entity_name": "SAMD12_FAME1_TTTCA", "confidence_level": "3", "penetrance": null, "publications": [ "30194086", "29507423" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 1 MIM#601068" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "repeated_sequence": "TTTCA", "chromosome": "8", "grch37_coordinates": [ 119379055, 119379157 ], "grch38_coordinates": [ 118366816, 118366918 ], "normal_repeats": 0, "pathogenic_repeats": 100, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "B37" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3033", "gene_name": "atrophin 1", "omim_gene": [ "607462" ], "alias_name": null, "gene_symbol": "ATN1", "hgnc_symbol": "ATN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:7033626-7051484", "ensembl_id": "ENSG00000111676" } }, "GRch38": { "90": { "location": "12:6924463-6942321", "ensembl_id": "ENSG00000111676" } } }, "hgnc_date_symbol_changed": "2005-03-17" }, "entity_type": "str", "entity_name": "ATN1_DRPLA_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8136840", "8136826", "29325606", "20301664" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Dentatorubral-pallidoluysian atrophy MIM#125370" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 7045892, 7045936 ], "grch38_coordinates": [ 6936729, 6936773 ], "normal_repeats": 32, "pathogenic_repeats": 48, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ISSX", "CT121", "EIEE1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18060", "gene_name": "aristaless related homeobox", "omim_gene": [ "300382" ], "alias_name": [ "cancer/testis antigen 121" ], "gene_symbol": "ARX", "hgnc_symbol": "ARX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:25021811-25034065", "ensembl_id": "ENSG00000004848" } }, "GRch38": { "90": { "location": "X:25003694-25016420", "ensembl_id": "ENSG00000004848" } } }, "hgnc_date_symbol_changed": "2002-02-11" }, "entity_type": "str", "entity_name": "ARX_EIEE1_GCN2", "confidence_level": "3", "penetrance": null, "publications": [ "11889467", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Developmental and epileptic encephalopathy 1 MIM#308350", "Intellectual disability, X-linked 29 and others MIM#300419", "Partington syndrome MIM#309510" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 25031647, 25031682 ], "grch38_coordinates": [ 25013530, 25013565 ], "normal_repeats": 12, "pathogenic_repeats": 20, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0838", "GLS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4331", "gene_name": "glutaminase", "omim_gene": [ "138280" ], "alias_name": null, "gene_symbol": "GLS", "hgnc_symbol": "GLS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:191745553-191830278", "ensembl_id": "ENSG00000115419" } }, "GRch38": { "90": { "location": "2:190880827-190965552", "ensembl_id": "ENSG00000115419" } } }, "hgnc_date_symbol_changed": "1989-02-07" }, "entity_type": "str", "entity_name": "GLS_GDPAG_GCA", "confidence_level": "3", "penetrance": null, "publications": [ "30970188" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCA", "chromosome": "2", "grch37_coordinates": [ 191745599, 191745646 ], "grch38_coordinates": [ 190880873, 190880920 ], "normal_repeats": 16, "pathogenic_repeats": 400, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ISSX", "CT121", "EIEE1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18060", "gene_name": "aristaless related homeobox", "omim_gene": [ "300382" ], "alias_name": [ "cancer/testis antigen 121" ], "gene_symbol": "ARX", "hgnc_symbol": "ARX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:25021811-25034065", "ensembl_id": "ENSG00000004848" } }, "GRch38": { "90": { "location": "X:25003694-25016420", "ensembl_id": "ENSG00000004848" } } }, "hgnc_date_symbol_changed": "2002-02-11" }, "entity_type": "str", "entity_name": "ARX_EIEE1_GCN1", "confidence_level": "3", "penetrance": null, "publications": [ "11889467", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Developmental and epileptic encephalopathy 1 MIM#308350", "Intellectual disability, X-linked 29 and others MIM#300419", "Partington syndrome MIM#309510" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 25031767, 25031814 ], "grch38_coordinates": [ 25013650, 25013697 ], "normal_repeats": 16, "pathogenic_repeats": 23, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PDZ-GEF1", "RA-GEF", "DKFZP586O1422", "KIAA0313" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16854", "gene_name": "Rap guanine nucleotide exchange factor 2", "omim_gene": [ "609530" ], "alias_name": [ "Rap GEP" ], "gene_symbol": "RAPGEF2", "hgnc_symbol": "RAPGEF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:160025330-160281321", "ensembl_id": "ENSG00000109756" } }, "GRch38": { "90": { "location": "4:159104178-159360169", "ensembl_id": "ENSG00000109756" } } }, "hgnc_date_symbol_changed": "2004-03-01" }, "entity_type": "str", "entity_name": "RAPGEF2_FAME7_TTTCA", "confidence_level": "2", "penetrance": null, "publications": [ "29507423", "30351492", "33791773" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 7 MIM#618075" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "4", "grch37_coordinates": [ 160263679, 160263768 ], "grch38_coordinates": [ 159342527, 159342616 ], "normal_repeats": 0, "pathogenic_repeats": 1, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TEB4", "MARCH-VI", "RNF176" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30550", "gene_name": "membrane associated ring-CH-type finger 6", "omim_gene": [ "613297" ], "alias_name": null, "gene_symbol": "MARCH6", "hgnc_symbol": "MARCH6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:10353815-10440500", "ensembl_id": "ENSG00000145495" } }, "GRch38": { "90": { "location": "5:10353703-10440388", "ensembl_id": "ENSG00000145495" } } }, "hgnc_date_symbol_changed": "2005-01-26" }, "entity_type": "str", "entity_name": "MARCHF6_FAME3_TTTCA", "confidence_level": "3", "penetrance": null, "publications": [ "31664039" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 3 MIM#613608" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "5", "grch37_coordinates": [ 10356451, 10356519 ], "grch38_coordinates": [ 10356347, 10356411 ], "normal_repeats": 0, "pathogenic_repeats": 660, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CST6", "PME" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2482", "gene_name": "cystatin B", "omim_gene": [ "601145" ], "alias_name": [ "stefin B" ], "gene_symbol": "CSTB", "hgnc_symbol": "CSTB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:45192393-45196326", "ensembl_id": "ENSG00000160213" } }, "GRch38": { "90": { "location": "21:43772511-43776445", "ensembl_id": "ENSG00000160213" } } }, "hgnc_date_symbol_changed": "1996-12-12" }, "entity_type": "str", "entity_name": "CSTB_EPM1_CCCCGCCCCGCG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301321", "9126745" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "CCCCGCCCCGCG", "chromosome": "21", "grch37_coordinates": [ 45196325, 45196360 ], "grch38_coordinates": [ 43776444, 43776479 ], "normal_repeats": 3, "pathogenic_repeats": 30, "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "str", "entity_name": "FXN_FRDA_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "20301458", "8596916" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Friedreich ataxia MIM#229300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GAA", "chromosome": "9", "grch37_coordinates": [ 71652203, 71652220 ], "grch38_coordinates": [ 69037287, 69037304 ], "normal_repeats": 33, "pathogenic_repeats": 66, "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 437, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "E46L", "FLJ37990" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10549", "gene_name": "ataxin 10", "omim_gene": [ "611150" ], "alias_name": null, "gene_symbol": "ATXN10", "hgnc_symbol": "ATXN10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:46067678-46241187", "ensembl_id": "ENSG00000130638" } }, "GRch38": { "90": { "location": "22:45671798-45845307", "ensembl_id": "ENSG00000130638" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "str", "entity_name": "ATXN10_SCA10_ATTCT", "confidence_level": "3", "penetrance": null, "publications": [ "20301354", "11017075" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 10 MIM#603516" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTCT", "chromosome": "22", "grch37_coordinates": [ 46191235, 46191304 ], "grch38_coordinates": [ 45795355, 45795424 ], "normal_repeats": 32, "pathogenic_repeats": 800, "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2661", "gene_name": "DAB1, reelin adaptor protein", "omim_gene": [ "603448" ], "alias_name": null, "gene_symbol": "DAB1", "hgnc_symbol": "DAB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:57460451-59012406", "ensembl_id": "ENSG00000173406" } }, "GRch38": { "90": { "location": "1:56994778-58546734", "ensembl_id": "ENSG00000173406" } } }, "hgnc_date_symbol_changed": "1998-06-12" }, "entity_type": "str", "entity_name": "DAB1_SCA37_ATTTC", "confidence_level": "3", "penetrance": null, "publications": [ "28686858", "31145571" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 37 MIM#615945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTTC", "chromosome": "1", "grch37_coordinates": [ 57832716, 57832797 ], "grch38_coordinates": [ 57367044, 57367121 ], "normal_repeats": 0, "pathogenic_repeats": 31, "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TFIID" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11588", "gene_name": "TATA-box binding protein", "omim_gene": [ "600075" ], "alias_name": null, "gene_symbol": "TBP", "hgnc_symbol": "TBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:170863390-170881958", "ensembl_id": "ENSG00000112592" } }, "GRch38": { "90": { "location": "6:170554302-170572870", "ensembl_id": "ENSG00000112592" } } }, "hgnc_date_symbol_changed": "1993-05-26" }, "entity_type": "str", "entity_name": "TBP_SCA17_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "10484774", "20301611", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 17 MIM#607136" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 170870996, 170871109 ], "grch38_coordinates": [ 170561908, 170562021 ], "normal_repeats": 40, "pathogenic_repeats": 49, "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.610", "version_created": "2026-03-31T18:57:58.699788+11:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.610", "version_created": "2026-03-31T18:57:58.699788+11:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } } ] }