Str Search List
Search STRs
GET /api/v1/strs/?format=api&page=2
{ "count": 259, "next": "https://panelapp-aus.org/api/v1/strs/?format=api&page=3", "previous": "https://panelapp-aus.org/api/v1/strs/?format=api", "results": [ { "gene_data": { "alias": [ "TFIID" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11588", "gene_name": "TATA-box binding protein", "omim_gene": [ "600075" ], "alias_name": null, "gene_symbol": "TBP", "hgnc_symbol": "TBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:170863390-170881958", "ensembl_id": "ENSG00000112592" } }, "GRch38": { "90": { "location": "6:170554302-170572870", "ensembl_id": "ENSG00000112592" } } }, "hgnc_date_symbol_changed": "1993-05-26" }, "entity_type": "str", "entity_name": "TBP_SCA17_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "10484774", "20301611", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 17 MIM#607136" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 170870996, 170871109 ], "grch38_coordinates": [ 170561908, 170562021 ], "normal_repeats": 40, "pathogenic_repeats": 49, "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.610", "version_created": "2026-03-31T18:57:58.699788+11:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "str", "entity_name": "FXN_FRDA_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "20301458", "8596916" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Friedreich ataxia MIM#229300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GAA", "chromosome": "9", "grch37_coordinates": [ 71652203, 71652220 ], "grch38_coordinates": [ 69037287, 69037304 ], "normal_repeats": 33, "pathogenic_repeats": 66, "tags": [ "paediatric-onset" ], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.359", "version_created": "2026-04-03T14:38:51.840380+11:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 12, "pathogenic_repeats": 14, "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA1463", "FLJ34278" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29284", "gene_name": "disco interacting protein 2 homolog B", "omim_gene": [ "611379" ], "alias_name": null, "gene_symbol": "DIP2B", "hgnc_symbol": "DIP2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:50898768-51142450", "ensembl_id": "ENSG00000066084" } }, "GRch38": { "90": { "location": "12:50504985-50748667", "ensembl_id": "ENSG00000066084" } } }, "hgnc_date_symbol_changed": "2006-01-13" }, "entity_type": "str", "entity_name": "DIP2B_FRA12A_CGG", "confidence_level": "2", "penetrance": null, "publications": [ "17236128", "33510257", "39854091", "41028987" ], "evidence": [ "Expert Review Amber", "Other" ], "phenotypes": [ "Mental retardation, FRA12A type MIM#136630" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "12", "grch37_coordinates": [ 50898787, 50898807 ], "grch38_coordinates": [ 50505004, 50505024 ], "normal_repeats": 23, "pathogenic_repeats": 280, "tags": [ "5'UTR" ], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "XT-I", "PXYLT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15516", "gene_name": "xylosyltransferase 1", "omim_gene": [ "608124" ], "alias_name": [ "protein xylosyltransferase 1" ], "gene_symbol": "XYLT1", "hgnc_symbol": "XYLT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:17195626-17564738", "ensembl_id": "ENSG00000103489" } }, "GRch38": { "90": { "location": "16:17101769-17470881", "ensembl_id": "ENSG00000103489" } } }, "hgnc_date_symbol_changed": "2001-04-06" }, "entity_type": "str", "entity_name": "XYLT1_DBQD2_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "30554721" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Desbuquois dysplasia 2 MIM#615777" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 17564765, 17564779 ], "grch38_coordinates": [ 17470908, 17470922 ], "normal_repeats": 20, "pathogenic_repeats": 120, "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FRAXE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3776", "gene_name": "AF4/FMR2 family member 2", "omim_gene": [ "300806" ], "alias_name": null, "gene_symbol": "AFF2", "hgnc_symbol": "AFF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:147582139-148082193", "ensembl_id": "ENSG00000155966" } }, "GRch38": { "90": { "location": "X:148500619-149000663", "ensembl_id": "ENSG00000155966" } } }, "hgnc_date_symbol_changed": "2005-06-27" }, "entity_type": "str", "entity_name": "AFF2_FRAXE_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "8334699", "8673085", "11388762" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Fragile X syndrome, FRAXE type (OMIM 309548)" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCC", "chromosome": "X", "grch37_coordinates": [ 147582158, 147582202 ], "grch38_coordinates": [ 148500638, 148500682 ], "normal_repeats": 44, "pathogenic_repeats": 200, "tags": [ "STR" ], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ISSX", "CT121", "EIEE1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18060", "gene_name": "aristaless related homeobox", "omim_gene": [ "300382" ], "alias_name": [ "cancer/testis antigen 121" ], "gene_symbol": "ARX", "hgnc_symbol": "ARX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:25021811-25034065", "ensembl_id": "ENSG00000004848" } }, "GRch38": { "90": { "location": "X:25003694-25016420", "ensembl_id": "ENSG00000004848" } } }, "hgnc_date_symbol_changed": "2002-02-11" }, "entity_type": "str", "entity_name": "ARX_EIEE1_GCN2", "confidence_level": "3", "penetrance": null, "publications": [ "11889467", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Developmental and epileptic encephalopathy 1 MIM#308350", "Intellectual disability, X-linked 29 and others MIM#300419", "Partington syndrome MIM#309510" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 25031647, 25031682 ], "grch38_coordinates": [ 25013530, 25013565 ], "normal_repeats": 12, "pathogenic_repeats": 20, "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HPE5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12873", "gene_name": "Zic family member 2", "omim_gene": [ "603073" ], "alias_name": [ "Zinc finger protein of the cerebellum 2" ], "gene_symbol": "ZIC2", "hgnc_symbol": "ZIC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:100634026-100639018", "ensembl_id": "ENSG00000043355" } }, "GRch38": { "90": { "location": "13:99981772-99986773", "ensembl_id": "ENSG00000043355" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "str", "entity_name": "ZIC2_HPE5_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11285244", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Holoprosencephaly 5 MIM#609637" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "13", "grch37_coordinates": [ 100637703, 100637747 ], "grch38_coordinates": [ 99985449, 99985493 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0838", "GLS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4331", "gene_name": "glutaminase", "omim_gene": [ "138280" ], "alias_name": null, "gene_symbol": "GLS", "hgnc_symbol": "GLS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:191745553-191830278", "ensembl_id": "ENSG00000115419" } }, "GRch38": { "90": { "location": "2:190880827-190965552", "ensembl_id": "ENSG00000115419" } } }, "hgnc_date_symbol_changed": "1989-02-07" }, "entity_type": "str", "entity_name": "GLS_GDPAG_GCA", "confidence_level": "3", "penetrance": null, "publications": [ "30970188" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCA", "chromosome": "2", "grch37_coordinates": [ 191745599, 191745646 ], "grch38_coordinates": [ 190880873, 190880920 ], "normal_repeats": 16, "pathogenic_repeats": 400, "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ISSX", "CT121", "EIEE1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18060", "gene_name": "aristaless related homeobox", "omim_gene": [ "300382" ], "alias_name": [ "cancer/testis antigen 121" ], "gene_symbol": "ARX", "hgnc_symbol": "ARX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:25021811-25034065", "ensembl_id": "ENSG00000004848" } }, "GRch38": { "90": { "location": "X:25003694-25016420", "ensembl_id": "ENSG00000004848" } } }, "hgnc_date_symbol_changed": "2002-02-11" }, "entity_type": "str", "entity_name": "ARX_EIEE1_GCN1", "confidence_level": "3", "penetrance": null, "publications": [ "11889467", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Developmental and epileptic encephalopathy 1 MIM#308350", "Intellectual disability, X-linked 29 and others MIM#300419", "Partington syndrome MIM#309510" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 25031767, 25031814 ], "grch38_coordinates": [ 25013650, 25013697 ], "normal_repeats": 16, "pathogenic_repeats": 23, "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FMRP", "FRAXA", "MGC87458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3775", "gene_name": "fragile X mental retardation 1", "omim_gene": [ "309550" ], "alias_name": null, "gene_symbol": "FMR1", "hgnc_symbol": "FMR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:146993469-147032645", "ensembl_id": "ENSG00000102081" } }, "GRch38": { "90": { "location": "X:147911951-147951125", "ensembl_id": "ENSG00000102081" } } }, "hgnc_date_symbol_changed": "1992-01-17" }, "entity_type": "str", "entity_name": "FMR1_FXS_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "33795824", "25227148", "1710175", "2031184" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Fragile X syndrome\tMIM#300624" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "repeated_sequence": "CGG", "chromosome": "X", "grch37_coordinates": [ 146993569, 146993628 ], "grch38_coordinates": [ 147912051, 147912110 ], "normal_repeats": 44, "pathogenic_repeats": 200, "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "DMK", "DM1PK", "MDPK", "MT-PK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2933", "gene_name": "DM1 protein kinase", "omim_gene": [ "605377" ], "alias_name": [ "dystrophia myotonica 1", "DM protein kinase", "myotonin protein kinase A", "myotonic dystrophy associated protein kinase", "thymopoietin homolog" ], "gene_symbol": "DMPK", "hgnc_symbol": "DMPK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:46272975-46285810", "ensembl_id": "ENSG00000104936" } }, "GRch38": { "90": { "location": "19:45769717-45782552", "ensembl_id": "ENSG00000104936" } } }, "hgnc_date_symbol_changed": "1997-10-10" }, "entity_type": "str", "entity_name": "DMPK_DM1_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301344", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 1 MIM#160900" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "19", "grch37_coordinates": [ 46273463, 46273522 ], "grch38_coordinates": [ 45770205, 45770264 ], "normal_repeats": 34, "pathogenic_repeats": 50, "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5136", "gene_name": "homeobox D13", "omim_gene": [ "142989" ], "alias_name": null, "gene_symbol": "HOXD13", "hgnc_symbol": "HOXD13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:176957619-176960666", "ensembl_id": "ENSG00000128714" } }, "GRch38": { "90": { "location": "2:176092891-176095938", "ensembl_id": "ENSG00000128714" } } }, "hgnc_date_symbol_changed": "1991-05-08" }, "entity_type": "str", "entity_name": "HOXD13_SPD1_GCG", "confidence_level": "3", "penetrance": null, "publications": [ "8817328", "33811808", "33533119" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Synpolydactyly 1 MIM#186000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCG", "chromosome": "2", "grch37_coordinates": [ 176957787, 176957831 ], "grch38_coordinates": [ 176093059, 176093103 ], "normal_repeats": 15, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "XT-I", "PXYLT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15516", "gene_name": "xylosyltransferase 1", "omim_gene": [ "608124" ], "alias_name": [ "protein xylosyltransferase 1" ], "gene_symbol": "XYLT1", "hgnc_symbol": "XYLT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:17195626-17564738", "ensembl_id": "ENSG00000103489" } }, "GRch38": { "90": { "location": "16:17101769-17470881", "ensembl_id": "ENSG00000103489" } } }, "hgnc_date_symbol_changed": "2001-04-06" }, "entity_type": "str", "entity_name": "XYLT1_DBQD2_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "30554721" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Desbuquois dysplasia 2 MIM#615777" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 17564765, 17564779 ], "grch38_coordinates": [ 17470908, 17470922 ], "normal_repeats": 20, "pathogenic_repeats": 120, "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MED", "THBS5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2227", "gene_name": "cartilage oligomeric matrix protein", "omim_gene": [ "600310" ], "alias_name": [ "thrombospondin-5" ], "gene_symbol": "COMP", "hgnc_symbol": "COMP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:18893583-18902123", "ensembl_id": "ENSG00000105664" } }, "GRch38": { "90": { "location": "19:18782773-18791314", "ensembl_id": "ENSG00000105664" } } }, "hgnc_date_symbol_changed": "1994-05-24" }, "entity_type": "str", "entity_name": "COMP_MEDPSACH_GAC", "confidence_level": "3", "penetrance": null, "publications": [ "9887340", "17133256", "21922596" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Epiphyseal dysplasia, multiple, 1 MIM#132400", "Pseudoachondroplasia MIM#177170" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GAC", "chromosome": "19", "grch37_coordinates": [ 18896844, 18896859 ], "grch38_coordinates": [ 18786034, 18786049 ], "normal_repeats": 5, "pathogenic_repeats": 6, "tags": [ "paediatric-onset" ], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Cav2.1", "EA2", "APCA", "HPCA", "FHM" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1388", "gene_name": "calcium voltage-gated channel subunit alpha1 A", "omim_gene": [ "601011" ], "alias_name": null, "gene_symbol": "CACNA1A", "hgnc_symbol": "CACNA1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:13317256-13734804", "ensembl_id": "ENSG00000141837" } }, "GRch38": { "90": { "location": "19:13206442-13633025", "ensembl_id": "ENSG00000141837" } } }, "hgnc_date_symbol_changed": "1996-06-18" }, "entity_type": "str", "entity_name": "CACNA1A_SCA6_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "20301319", "29325606" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Spinocerebellar ataxia 6 MIM#183086", "Episodic ataxia, type 2 MIM#108500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "19", "grch37_coordinates": [ 13318673, 13318691 ], "grch38_coordinates": [ 13207859, 13207897 ], "normal_repeats": 18, "pathogenic_repeats": 20, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10555", "gene_name": "ataxin 2", "omim_gene": [ "601517" ], "alias_name": [ "trinucleotide repeat containing 13" ], "gene_symbol": "ATXN2", "hgnc_symbol": "ATXN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:111890018-112037480", "ensembl_id": "ENSG00000204842" } }, "GRch38": { "90": { "location": "12:111452214-111599676", "ensembl_id": "ENSG00000204842" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN2_SCA2_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "40741828" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia type 2 MONDO:0008458" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 112036755, 112036823 ], "grch38_coordinates": [ 111598951, 111599019 ], "normal_repeats": 31, "pathogenic_repeats": 35, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HRIHFB2206", "CTG-B45d", "CTG-B43a" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23194", "gene_name": "THAP domain containing 11", "omim_gene": [ "609119" ], "alias_name": null, "gene_symbol": "THAP11", "hgnc_symbol": "THAP11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:67876213-67878097", "ensembl_id": "ENSG00000168286" } }, "GRch38": { "90": { "location": "16:67842082-67844195", "ensembl_id": "ENSG00000168286" } } }, "hgnc_date_symbol_changed": "2003-10-08" }, "entity_type": "str", "entity_name": "THAP11_SCA51_CAG", "confidence_level": "2", "penetrance": null, "publications": [ "15368101", "24677642", "34165550", "38113319", "40459937", "39651830", "37148549" ], "evidence": [ "Literature", "Expert Review Amber", "Expert Review Amber", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia 51 MONDO:0975800" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "16", "grch37_coordinates": [ 67876766, 67876853 ], "grch38_coordinates": [ 67842863, 67842950 ], "normal_repeats": 39, "pathogenic_repeats": 47, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ZNF927" ], "biotype": "protein_coding", "hgnc_id": "HGNC:777", "gene_name": "zinc finger homeobox 3", "omim_gene": [ "104155" ], "alias_name": null, "gene_symbol": "ZFHX3", "hgnc_symbol": "ZFHX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:72816784-73093597", "ensembl_id": "ENSG00000140836" } }, "GRch38": { "90": { "location": "16:72782885-73144447", "ensembl_id": "ENSG00000140836" } } }, "hgnc_date_symbol_changed": "2007-08-09" }, "entity_type": "str", "entity_name": "ZFHX3_SCA4_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "38035881", "38197134" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "spinocerebellar ataxia type 4 MONDO:0010847" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 72821594, 72821657 ], "grch38_coordinates": [ 72787695, 72787758 ], "normal_repeats": 30, "pathogenic_repeats": 48, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TFIID" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11588", "gene_name": "TATA-box binding protein", "omim_gene": [ "600075" ], "alias_name": null, "gene_symbol": "TBP", "hgnc_symbol": "TBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:170863390-170881958", "ensembl_id": "ENSG00000112592" } }, "GRch38": { "90": { "location": "6:170554302-170572870", "ensembl_id": "ENSG00000112592" } } }, "hgnc_date_symbol_changed": "1993-05-26" }, "entity_type": "str", "entity_name": "TBP_SCA17_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "20301611", "29325606" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 17 MIM#607136" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 170870996, 170871109 ], "grch38_coordinates": [ 170561908, 170562021 ], "normal_repeats": 40, "pathogenic_repeats": 49, "tags": [ "STR" ], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "A1", "PO-GA", "RFC140", "MHCBFB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9969", "gene_name": "replication factor C subunit 1", "omim_gene": [ "102579" ], "alias_name": null, "gene_symbol": "RFC1", "hgnc_symbol": "RFC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:39289076-39367995", "ensembl_id": "ENSG00000035928" } }, "GRch38": { "90": { "location": "4:39287456-39366375", "ensembl_id": "ENSG00000035928" } } }, "hgnc_date_symbol_changed": "1994-10-14" }, "entity_type": "str", "entity_name": "RFC1_CANVAS_ANNGN", "confidence_level": "3", "penetrance": null, "publications": [ "30926972" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "ANNGN", "chromosome": "4", "grch37_coordinates": [ 39350045, 39350103 ], "grch38_coordinates": [ 39348425, 39348483 ], "normal_repeats": 0, "pathogenic_repeats": 400, "tags": [ "STR" ], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699424 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PR55-BETA", "PR52B", "B55beta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9305", "gene_name": "protein phosphatase 2 regulatory subunit Bbeta", "omim_gene": [ "604325" ], "alias_name": [ "PP2A subunit B isoform beta" ], "gene_symbol": "PPP2R2B", "hgnc_symbol": "PPP2R2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:145967936-146464347", "ensembl_id": "ENSG00000156475" } }, "GRch38": { "90": { "location": "5:146581146-147084784", "ensembl_id": "ENSG00000156475" } } }, "hgnc_date_symbol_changed": "1993-01-25" }, "entity_type": "str", "entity_name": "PPP2R2B_SCA12_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "27864267", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 12 MIM#604326" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "5", "grch37_coordinates": [ 146258292, 146258321 ], "grch38_coordinates": [ 146878729, 146878758 ], "normal_repeats": 32, "pathogenic_repeats": 51, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "SCA36" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15911", "gene_name": "NOP56 ribonucleoprotein", "omim_gene": [ "614154" ], "alias_name": [ "spinocerebellar ataxia 36" ], "gene_symbol": "NOP56", "hgnc_symbol": "NOP56", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:2632791-2639039", "ensembl_id": "ENSG00000101361" } }, "GRch38": { "90": { "location": "20:2652145-2658393", "ensembl_id": "ENSG00000101361" } } }, "hgnc_date_symbol_changed": "2009-01-13" }, "entity_type": "str", "entity_name": "NOP56_SCA36_GGCCTG", "confidence_level": "3", "penetrance": null, "publications": [ "21683323" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 36 MIM#614153" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGCCTG", "chromosome": "20", "grch37_coordinates": [ 2633380, 2633403 ], "grch38_coordinates": [ 2652734, 2652757 ], "normal_repeats": 14, "pathogenic_repeats": 650, "tags": [ "STR" ], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "str", "entity_name": "FXN_FRDA_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "20301458" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Friedreich ataxia MIM#229300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GAA", "chromosome": "9", "grch37_coordinates": [ 71652203, 71652220 ], "grch38_coordinates": [ 69037287, 69037304 ], "normal_repeats": 33, "pathogenic_repeats": 66, "tags": [ "STR" ], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FMRP", "FRAXA", "MGC87458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3775", "gene_name": "fragile X mental retardation 1", "omim_gene": [ "309550" ], "alias_name": null, "gene_symbol": "FMR1", "hgnc_symbol": "FMR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:146993469-147032645", "ensembl_id": "ENSG00000102081" } }, "GRch38": { "90": { "location": "X:147911951-147951125", "ensembl_id": "ENSG00000102081" } } }, "hgnc_date_symbol_changed": "1992-01-17" }, "entity_type": "str", "entity_name": "FMR1_FXTAS_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "23765048", "25227148" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Fragile X tremor/ataxia syndrome MIM#300623" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "repeated_sequence": "CGG", "chromosome": "X", "grch37_coordinates": [ 146993569, 146993628 ], "grch38_coordinates": [ 147912051, 147912110 ], "normal_repeats": 44, "pathogenic_repeats": 55, "tags": [ "STR" ], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FHF4", "SCA27" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3671", "gene_name": "fibroblast growth factor 14", "omim_gene": [ "601515" ], "alias_name": null, "gene_symbol": "FGF14", "hgnc_symbol": "FGF14", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:102372134-103054124", "ensembl_id": "ENSG00000102466" } }, "GRch38": { "90": { "location": "13:101710804-102402457", "ensembl_id": "ENSG00000102466" } } }, "hgnc_date_symbol_changed": "1996-12-18" }, "entity_type": "str", "entity_name": "FGF14_SCA27B_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "37165652", "36516086", "36493768" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia type 27B MONDO:0012247", "Spinocerebellar ataxia 50", "late-onset cerebellar ataxias (LOCAs)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GAA", "chromosome": "13", "grch37_coordinates": [ 102813926, 102814076 ], "grch38_coordinates": [ 102161576, 102161726 ], "normal_repeats": 249, "pathogenic_repeats": 300, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2661", "gene_name": "DAB1, reelin adaptor protein", "omim_gene": [ "603448" ], "alias_name": null, "gene_symbol": "DAB1", "hgnc_symbol": "DAB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:57460451-59012406", "ensembl_id": "ENSG00000173406" } }, "GRch38": { "90": { "location": "1:56994778-58546734", "ensembl_id": "ENSG00000173406" } } }, "hgnc_date_symbol_changed": "1998-06-12" }, "entity_type": "str", "entity_name": "DAB1_SCA37_ATTTC", "confidence_level": "3", "penetrance": null, "publications": [ "28686858", "31145571" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia 37 MIM#615945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTTC", "chromosome": "1", "grch37_coordinates": [ 57832716, 57832797 ], "grch38_coordinates": [ 57367044, 57367121 ], "normal_repeats": 0, "pathogenic_repeats": 31, "tags": [ "STR" ], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CST6", "PME" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2482", "gene_name": "cystatin B", "omim_gene": [ "601145" ], "alias_name": [ "stefin B" ], "gene_symbol": "CSTB", "hgnc_symbol": "CSTB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:45192393-45196326", "ensembl_id": "ENSG00000160213" } }, "GRch38": { "90": { "location": "21:43772511-43776445", "ensembl_id": "ENSG00000160213" } } }, "hgnc_date_symbol_changed": "1996-12-12" }, "entity_type": "str", "entity_name": "CSTB_EPM1_CCCCGCCCCGCG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301321" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "CCCCGCCCCGCG", "chromosome": "21", "grch37_coordinates": [ 45196325, 45196360 ], "grch38_coordinates": [ 43776444, 43776479 ], "normal_repeats": 3, "pathogenic_repeats": 30, "tags": [ "STR" ], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:24160", "gene_name": "brain expressed associated with NEDD4 1", "omim_gene": [ "612051" ], "alias_name": null, "gene_symbol": "BEAN1", "hgnc_symbol": "BEAN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:66461200-66527432", "ensembl_id": "ENSG00000166546" } }, "GRch38": { "90": { "location": "16:66427297-66493529", "ensembl_id": "ENSG00000166546" } } }, "hgnc_date_symbol_changed": "2010-10-05" }, "entity_type": "str", "entity_name": "BEAN1_SCA31_TGGAA", "confidence_level": "3", "penetrance": null, "publications": [ "19878914", "31755042" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Spinocerebellar ataxia 31 MIM#117210" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TGGAA", "chromosome": "16", "grch37_coordinates": [ 66524300, 66524369 ], "grch38_coordinates": [ 66490397, 66490466 ], "normal_repeats": 22, "pathogenic_repeats": 80, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NCRNA00003" ], "biotype": "antisense_RNA", "hgnc_id": "HGNC:10561", "gene_name": "ATXN8 opposite strand (non-protein coding)", "omim_gene": [ "603680" ], "alias_name": [ "non-protein coding RNA 3" ], "gene_symbol": "ATXN8OS", "hgnc_symbol": "ATXN8OS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:70681345-70713561", "ensembl_id": "ENSG00000230223" } }, "GRch38": { "90": { "location": "13:70107213-70139429", "ensembl_id": "ENSG00000230223" } } }, "hgnc_date_symbol_changed": "2006-07-18" }, "entity_type": "str", "entity_name": "ATXN8OS_SCA8_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301445" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Spinocerebellar ataxia 8 MIM#608768" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "13", "grch37_coordinates": [ 70713486, 70713560 ], "grch38_coordinates": [ 70139354, 70139422 ], "normal_repeats": 50, "pathogenic_repeats": 80, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "OPCA3", "ADCAII" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10560", "gene_name": "ataxin 7", "omim_gene": [ "607640" ], "alias_name": null, "gene_symbol": "ATXN7", "hgnc_symbol": "ATXN7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:63850233-63989138", "ensembl_id": "ENSG00000163635" } }, "GRch38": { "90": { "location": "3:63864557-64003462", "ensembl_id": "ENSG00000163635" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "str", "entity_name": "ATXN7_SCA7_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301433" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Spinocerebellar ataxia 7 MIM#164500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "3", "grch37_coordinates": [ 63898362, 63898391 ], "grch38_coordinates": [ 63912686, 63912715 ], "normal_repeats": 27, "pathogenic_repeats": 37, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX3", "JOS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7106", "gene_name": "ataxin 3", "omim_gene": [ "607047" ], "alias_name": null, "gene_symbol": "ATXN3", "hgnc_symbol": "ATXN3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:92524896-92572965", "ensembl_id": "ENSG00000066427" } }, "GRch38": { "90": { "location": "14:92038652-92106621", "ensembl_id": "ENSG00000066427" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN3_SCA3_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "20301375", "29325606" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Machado-Joseph disease MIM#109150", "Spinocerebellar ataxia type 3" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "14", "grch37_coordinates": [ 92537355, 92537396 ], "grch38_coordinates": [ 92071011, 92071052 ], "normal_repeats": 44, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "D6S504E", "ATX1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10548", "gene_name": "ataxin 1", "omim_gene": [ "601556" ], "alias_name": null, "gene_symbol": "ATXN1", "hgnc_symbol": "ATXN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:16299343-16761722", "ensembl_id": "ENSG00000124788" } }, "GRch38": { "90": { "location": "6:16299112-16761491", "ensembl_id": "ENSG00000124788" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN1_SCA1_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301363" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Spinocerebellar ataxia 1 MIM#164400" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 16327918, 16327953 ], "grch38_coordinates": [ 16327687, 16327722 ], "normal_repeats": 35, "pathogenic_repeats": 39, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "E46L", "FLJ37990" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10549", "gene_name": "ataxin 10", "omim_gene": [ "611150" ], "alias_name": null, "gene_symbol": "ATXN10", "hgnc_symbol": "ATXN10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:46067678-46241187", "ensembl_id": "ENSG00000130638" } }, "GRch38": { "90": { "location": "22:45671798-45845307", "ensembl_id": "ENSG00000130638" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "str", "entity_name": "ATXN10_SCA10_ATTCT", "confidence_level": "3", "penetrance": null, "publications": [ "20301354" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Spinocerebellar ataxia 10 MIM#603516" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTCT", "chromosome": "22", "grch37_coordinates": [ 46191235, 46191304 ], "grch38_coordinates": [ 45795355, 45795424 ], "normal_repeats": 32, "pathogenic_repeats": 800, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "B37" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3033", "gene_name": "atrophin 1", "omim_gene": [ "607462" ], "alias_name": null, "gene_symbol": "ATN1", "hgnc_symbol": "ATN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:7033626-7051484", "ensembl_id": "ENSG00000111676" } }, "GRch38": { "90": { "location": "12:6924463-6942321", "ensembl_id": "ENSG00000111676" } } }, "hgnc_date_symbol_changed": "2005-03-17" }, "entity_type": "str", "entity_name": "ATN1_DRPLA_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301664" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Dentatorubral-pallidoluysian atrophy MIM#125370" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 7045892, 7045936 ], "grch38_coordinates": [ 6936729, 6936773 ], "normal_repeats": 35, "pathogenic_repeats": 48, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "B37" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3033", "gene_name": "atrophin 1", "omim_gene": [ "607462" ], "alias_name": null, "gene_symbol": "ATN1", "hgnc_symbol": "ATN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:7033626-7051484", "ensembl_id": "ENSG00000111676" } }, "GRch38": { "90": { "location": "12:6924463-6942321", "ensembl_id": "ENSG00000111676" } } }, "hgnc_date_symbol_changed": "2005-03-17" }, "entity_type": "str", "entity_name": "ATN1_DRPLA_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8136840", "8136826", "29325606", "20301664" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Dentatorubral-pallidoluysian atrophy MIM#125370" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 7045892, 7045936 ], "grch38_coordinates": [ 6936729, 6936773 ], "normal_repeats": 35, "pathogenic_repeats": 48, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ISSX", "CT121", "EIEE1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18060", "gene_name": "aristaless related homeobox", "omim_gene": [ "300382" ], "alias_name": [ "cancer/testis antigen 121" ], "gene_symbol": "ARX", "hgnc_symbol": "ARX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:25021811-25034065", "ensembl_id": "ENSG00000004848" } }, "GRch38": { "90": { "location": "X:25003694-25016420", "ensembl_id": "ENSG00000004848" } } }, "hgnc_date_symbol_changed": "2002-02-11" }, "entity_type": "str", "entity_name": "ARX_EIEE1_GCN1", "confidence_level": "3", "penetrance": null, "publications": [ "11889467", "33811808" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Developmental and epileptic encephalopathy 1 MIM#308350", "Intellectual disability, X-linked 29 and others MIM#300419", "Partington syndrome MIM#309510" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 25031767, 25031814 ], "grch38_coordinates": [ 25013650, 25013697 ], "normal_repeats": 16, "pathogenic_repeats": 23, "tags": [], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ISSX", "CT121", "EIEE1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18060", "gene_name": "aristaless related homeobox", "omim_gene": [ "300382" ], "alias_name": [ "cancer/testis antigen 121" ], "gene_symbol": "ARX", "hgnc_symbol": "ARX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:25021811-25034065", "ensembl_id": "ENSG00000004848" } }, "GRch38": { "90": { "location": "X:25003694-25016420", "ensembl_id": "ENSG00000004848" } } }, "hgnc_date_symbol_changed": "2002-02-11" }, "entity_type": "str", "entity_name": "ARX_EIEE1_GCN2", "confidence_level": "3", "penetrance": null, "publications": [ "11889467", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Developmental and epileptic encephalopathy 1 MIM#308350", "Intellectual disability, X-linked 29 and others MIM#300419", "Partington syndrome MIM#309510" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 25031647, 25031682 ], "grch38_coordinates": [ 25013530, 25013565 ], "normal_repeats": 12, "pathogenic_repeats": 20, "tags": [], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MGC23980", "DENNL72" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28337", "gene_name": "chromosome 9 open reading frame 72", "omim_gene": [ "614260" ], "alias_name": null, "gene_symbol": "C9orf72", "hgnc_symbol": "C9orf72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:27546544-27573864", "ensembl_id": "ENSG00000147894" } }, "GRch38": { "90": { "location": "9:27546545-27573866", "ensembl_id": "ENSG00000147894" } } }, "hgnc_date_symbol_changed": "2004-01-06" }, "entity_type": "str", "entity_name": "C9orf72_FTDALS_GGGGCC", "confidence_level": "3", "penetrance": null, "publications": [ "26166205", "24363131", "26187722", "25577942", "21944779", "21944778" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGGGCC", "chromosome": "9", "grch37_coordinates": [ 27573427, 27573544 ], "grch38_coordinates": [ 27573529, 27573546 ], "normal_repeats": 25, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "JP-3", "CAGL237", "HDL2", "JP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14203", "gene_name": "junctophilin 3", "omim_gene": [ "605268" ], "alias_name": null, "gene_symbol": "JPH3", "hgnc_symbol": "JPH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:87635441-87731762", "ensembl_id": "ENSG00000154118" } }, "GRch38": { "90": { "location": "16:87601835-87698156", "ensembl_id": "ENSG00000154118" } } }, "hgnc_date_symbol_changed": "2000-12-08" }, "entity_type": "str", "entity_name": "JPH3_HDL2_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "11558794", "20301701" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Huntington disease-like 2 MIM#606438" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "16", "grch37_coordinates": [ 87637894, 87637935 ], "grch38_coordinates": [ 87604288, 87604329 ], "normal_repeats": 28, "pathogenic_repeats": 40, "tags": [ "adult-onset" ], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NSCL2", "TAFII250", "KAT4", "DYT3/TAF1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11535", "gene_name": "TATA-box binding protein associated factor 1", "omim_gene": [ "313650" ], "alias_name": null, "gene_symbol": "TAF1", "hgnc_symbol": "TAF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:70586114-70752224", "ensembl_id": "ENSG00000147133" } }, "GRch38": { "90": { "location": "X:71366239-71532374", "ensembl_id": "ENSG00000147133" } } }, "hgnc_date_symbol_changed": "2001-12-07" }, "entity_type": "str", "entity_name": "TAF1_XDP_CCCTCT", "confidence_level": "3", "penetrance": null, "publications": [ "17273961", "29229810" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Dystonia-Parkinsonism, X-linked MIM#314250" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "CCCTCT", "chromosome": "X", "grch37_coordinates": [ 70672905, 70672979 ], "grch38_coordinates": [ 71453055, 71453129 ], "normal_repeats": 13, "pathogenic_repeats": 30, "tags": [ "founder" ], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [ "adult-onset" ], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "IT15" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4851", "gene_name": "huntingtin", "omim_gene": [ "613004" ], "alias_name": null, "gene_symbol": "HTT", "hgnc_symbol": "HTT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:3076408-3245676", "ensembl_id": "ENSG00000197386" } }, "GRch38": { "90": { "location": "4:3074681-3243959", "ensembl_id": "ENSG00000197386" } } }, "hgnc_date_symbol_changed": "2007-12-04" }, "entity_type": "str", "entity_name": "HTT_HD_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8458085", "20301482", "29325606" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Huntington disease MIM#143100" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "4", "grch37_coordinates": [ 3076604, 3076666 ], "grch38_coordinates": [ 3074877, 3074939 ], "normal_repeats": 26, "pathogenic_repeats": 40, "tags": [ "adult-onset" ], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TFIID" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11588", "gene_name": "TATA-box binding protein", "omim_gene": [ "600075" ], "alias_name": null, "gene_symbol": "TBP", "hgnc_symbol": "TBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:170863390-170881958", "ensembl_id": "ENSG00000112592" } }, "GRch38": { "90": { "location": "6:170554302-170572870", "ensembl_id": "ENSG00000112592" } } }, "hgnc_date_symbol_changed": "1993-05-26" }, "entity_type": "str", "entity_name": "TBP_SCA17_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "10484774", "20301611", "29325606" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 17 MIM#607136" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 170870996, 170871109 ], "grch38_coordinates": [ 170561908, 170562021 ], "normal_repeats": 40, "pathogenic_repeats": 49, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.393", "version_created": "2026-03-26T22:06:36.010882+11:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MGC23980", "DENNL72" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28337", "gene_name": "chromosome 9 open reading frame 72", "omim_gene": [ "614260" ], "alias_name": null, "gene_symbol": "C9orf72", "hgnc_symbol": "C9orf72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:27546544-27573864", "ensembl_id": "ENSG00000147894" } }, "GRch38": { "90": { "location": "9:27546545-27573866", "ensembl_id": "ENSG00000147894" } } }, "hgnc_date_symbol_changed": "2004-01-06" }, "entity_type": "str", "entity_name": "C9orf72_FTDALS_GGGGCC", "confidence_level": "3", "penetrance": "Incomplete", "publications": [ "36970046", "36632182" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MONDO:0007105" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGGGCC", "chromosome": "9", "grch37_coordinates": [ 27573427, 27573544 ], "grch38_coordinates": [ 27573529, 27573546 ], "normal_repeats": 25, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.393", "version_created": "2026-03-26T22:06:36.010882+11:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.393", "version_created": "2026-03-26T22:06:36.010882+11:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "RNF163", "ZCCHC22", "CNBP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13164", "gene_name": "CCHC-type zinc finger nucleic acid binding protein", "omim_gene": [ "116955" ], "alias_name": null, "gene_symbol": "CNBP", "hgnc_symbol": "CNBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:128888327-128902765", "ensembl_id": "ENSG00000169714" } }, "GRch38": { "90": { "location": "3:129169484-129183922", "ensembl_id": "ENSG00000169714" } } }, "hgnc_date_symbol_changed": "2006-06-29" }, "entity_type": "str", "entity_name": "CNBP_DM2_CCTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301639", "11486088" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 2 MIM#602668" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCTG", "chromosome": "3", "grch37_coordinates": [ 128891420, 128891499 ], "grch38_coordinates": [ 129172577, 129172656 ], "normal_repeats": 26, "pathogenic_repeats": 75, "tags": [ "adult-onset" ], "panel": { "id": 302, "hash_id": null, "name": "Skeletal Muscle Channelopathies", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that encode skeletal muscle channel proteins, and associated with malignant hyperthermia and periodic paralysis (hyperkalemic, hypokalemic/thyrotoxic, normokalemic potassium-sensitive)/congenital myotonia. It is maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nThis panel has been compared against the Genomics England PanelApp \"Skeletal Muscle Channelopathy\" panel with all discrepancies resolved, and reciprocal feedback provided to Genomics England, 20/8/20.", "status": "public", "version": "1.3", "version_created": "2026-01-04T18:02:13.252564+11:00", "relevant_disorders": [ "Periodic paralysis", "HP:0003768; Myotonia", "HP:0002486" ], "stats": { "number_of_genes": 13, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "DMK", "DM1PK", "MDPK", "MT-PK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2933", "gene_name": "DM1 protein kinase", "omim_gene": [ "605377" ], "alias_name": [ "dystrophia myotonica 1", "DM protein kinase", "myotonin protein kinase A", "myotonic dystrophy associated protein kinase", "thymopoietin homolog" ], "gene_symbol": "DMPK", "hgnc_symbol": "DMPK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:46272975-46285810", "ensembl_id": "ENSG00000104936" } }, "GRch38": { "90": { "location": "19:45769717-45782552", "ensembl_id": "ENSG00000104936" } } }, "hgnc_date_symbol_changed": "1997-10-10" }, "entity_type": "str", "entity_name": "DMPK_DM1_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301344", "29325606", "1546325" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 1 MIM#160900" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "19", "grch37_coordinates": [ 46273463, 46273522 ], "grch38_coordinates": [ 45770205, 45770264 ], "normal_repeats": 34, "pathogenic_repeats": 50, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 302, "hash_id": null, "name": "Skeletal Muscle Channelopathies", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that encode skeletal muscle channel proteins, and associated with malignant hyperthermia and periodic paralysis (hyperkalemic, hypokalemic/thyrotoxic, normokalemic potassium-sensitive)/congenital myotonia. It is maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nThis panel has been compared against the Genomics England PanelApp \"Skeletal Muscle Channelopathy\" panel with all discrepancies resolved, and reciprocal feedback provided to Genomics England, 20/8/20.", "status": "public", "version": "1.3", "version_created": "2026-01-04T18:02:13.252564+11:00", "relevant_disorders": [ "Periodic paralysis", "HP:0003768; Myotonia", "HP:0002486" ], "stats": { "number_of_genes": 13, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "str", "entity_name": "FXN_FRDA_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "20301458", "8596916" ], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "Friedreich ataxia MIM#229300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GAA", "chromosome": "9", "grch37_coordinates": [ 71652203, 71652220 ], "grch38_coordinates": [ 69037287, 69037301 ], "normal_repeats": 33, "pathogenic_repeats": 66, "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CST6", "PME" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2482", "gene_name": "cystatin B", "omim_gene": [ "601145" ], "alias_name": [ "stefin B" ], "gene_symbol": "CSTB", "hgnc_symbol": "CSTB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:45192393-45196326", "ensembl_id": "ENSG00000160213" } }, "GRch38": { "90": { "location": "21:43772511-43776445", "ensembl_id": "ENSG00000160213" } } }, "hgnc_date_symbol_changed": "1996-12-12" }, "entity_type": "str", "entity_name": "CSTB_EPM1_CCCCGCCCCGCG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301321", "9126745" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "CCCCGCCCCGCG", "chromosome": "21", "grch37_coordinates": [ 45196325, 45196360 ], "grch38_coordinates": [ 43776444, 43776479 ], "normal_repeats": 3, "pathogenic_repeats": 30, "tags": [], "panel": { "id": 331, "hash_id": null, "name": "Progressive Myoclonic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause progressive myoclonic epilepsies (PME) and neuronal ceroid lipofuscinoses (NCLs). It is maintained by Royal Melbourne Hospital.", "status": "public", "version": "0.28", "version_created": "2025-11-21T09:34:57.163082+11:00", "relevant_disorders": [ "Myoclonic seizure", "HP:0032794" ], "stats": { "number_of_genes": 33, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "str", "entity_name": "FXN_FRDA_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "20301458", "8596916" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Friedreich ataxia MIM#229300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GAA", "chromosome": "9", "grch37_coordinates": [ 71652203, 71652220 ], "grch38_coordinates": [ 69037287, 69037304 ], "normal_repeats": 33, "pathogenic_repeats": 66, "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:13997", "gene_name": "PR/SET domain 12", "omim_gene": [ "616458" ], "alias_name": [ "PR-domain containing protein 12", "PR-domain zinc finger protein 12" ], "gene_symbol": "PRDM12", "hgnc_symbol": "PRDM12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:133539981-133558368", "ensembl_id": "ENSG00000130711" } }, "GRch38": { "90": { "location": "9:130664594-130682981", "ensembl_id": "ENSG00000130711" } } }, "hgnc_date_symbol_changed": "2000-11-28" }, "entity_type": "str", "entity_name": "PRDM12_HSAN8_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "26005867" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature", "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCC", "chromosome": "9", "grch37_coordinates": [ 133556993, 133557026 ], "grch38_coordinates": [ 130681606, 130681639 ], "normal_repeats": 14, "pathogenic_repeats": 18, "tags": [ "paediatric-onset" ], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ZNF927" ], "biotype": "protein_coding", "hgnc_id": "HGNC:777", "gene_name": "zinc finger homeobox 3", "omim_gene": [ "104155" ], "alias_name": null, "gene_symbol": "ZFHX3", "hgnc_symbol": "ZFHX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:72816784-73093597", "ensembl_id": "ENSG00000140836" } }, "GRch38": { "90": { "location": "16:72782885-73144447", "ensembl_id": "ENSG00000140836" } } }, "hgnc_date_symbol_changed": "2007-08-09" }, "entity_type": "str", "entity_name": "ZFHX3_SCA4_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "38035881", "38197134" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "spinocerebellar ataxia type 4 MONDO:0010847" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 72821594, 72821657 ], "grch38_coordinates": [ 72787695, 72787758 ], "normal_repeats": 30, "pathogenic_repeats": 48, "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "A1", "PO-GA", "RFC140", "MHCBFB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9969", "gene_name": "replication factor C subunit 1", "omim_gene": [ "102579" ], "alias_name": null, "gene_symbol": "RFC1", "hgnc_symbol": "RFC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:39289076-39367995", "ensembl_id": "ENSG00000035928" } }, "GRch38": { "90": { "location": "4:39287456-39366375", "ensembl_id": "ENSG00000035928" } } }, "hgnc_date_symbol_changed": "1994-10-14" }, "entity_type": "str", "entity_name": "RFC1_CANVAS_ANNGN", "confidence_level": "3", "penetrance": null, "publications": [ "30926972" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "ANNGN", "chromosome": "4", "grch37_coordinates": [ 39350045, 39350103 ], "grch38_coordinates": [ 39348425, 39348483 ], "normal_repeats": 0, "pathogenic_repeats": 400, "tags": [ "STR" ], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ22215", "VWA-1", "WARP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30910", "gene_name": "von Willebrand factor A domain containing 1", "omim_gene": [ "611901" ], "alias_name": null, "gene_symbol": "VWA1", "hgnc_symbol": "VWA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:1370241-1378262", "ensembl_id": "ENSG00000179403" } }, "GRch38": { "90": { "location": "1:1434861-1442882", "ensembl_id": "ENSG00000179403" } } }, "hgnc_date_symbol_changed": "2005-07-18" }, "entity_type": "str", "entity_name": "VWA1_HMNMYO_GCGCGGAGCG", "confidence_level": "3", "penetrance": null, "publications": [ "33559681", "33459760" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature", "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Neuropathy, hereditary motor, with myopathic features\tMIM#619216" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCGCGGAGCG", "chromosome": "1", "grch37_coordinates": [ 1371179, 1371198 ], "grch38_coordinates": [ 1435799, 1435818 ], "normal_repeats": 2, "pathogenic_repeats": 3, "tags": [ "paediatric-onset" ], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "antisense_RNA", "hgnc_id": "HGNC:51204", "gene_name": "NUTM2B antisense RNA 1", "omim_gene": null, "alias_name": null, "gene_symbol": "NUTM2B-AS1", "hgnc_symbol": "NUTM2B-AS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:81563813-81586350", "ensembl_id": "ENSG00000225484" } }, "GRch38": { "90": { "location": "10:79663088-79826594", "ensembl_id": "ENSG00000225484" } } }, "hgnc_date_symbol_changed": "2014-08-07" }, "entity_type": "str", "entity_name": "NUTM2B-AS1_OPDM_CCG", "confidence_level": "3", "penetrance": null, "publications": [ "31332380", "37923380", "39308795", "38159879" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngodistal myopathy MONDO:0025193" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCG", "chromosome": "10", "grch37_coordinates": [ 81586142, 81586159 ], "grch38_coordinates": [ 79826386, 79826403 ], "normal_repeats": 16, "pathogenic_repeats": 35, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "RNF163", "ZCCHC22", "CNBP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13164", "gene_name": "CCHC-type zinc finger nucleic acid binding protein", "omim_gene": [ "116955" ], "alias_name": null, "gene_symbol": "CNBP", "hgnc_symbol": "CNBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:128888327-128902765", "ensembl_id": "ENSG00000169714" } }, "GRch38": { "90": { "location": "3:129169484-129183922", "ensembl_id": "ENSG00000169714" } } }, "hgnc_date_symbol_changed": "2006-06-29" }, "entity_type": "str", "entity_name": "CNBP_DM2_CCTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301639", "11486088" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 2 MIM#602668" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCTG", "chromosome": "3", "grch37_coordinates": [ 128891420, 128891499 ], "grch38_coordinates": [ 129172577, 129172656 ], "normal_repeats": 26, "pathogenic_repeats": 75, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "DMK", "DM1PK", "MDPK", "MT-PK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2933", "gene_name": "DM1 protein kinase", "omim_gene": [ "605377" ], "alias_name": [ "dystrophia myotonica 1", "DM protein kinase", "myotonin protein kinase A", "myotonic dystrophy associated protein kinase", "thymopoietin homolog" ], "gene_symbol": "DMPK", "hgnc_symbol": "DMPK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:46272975-46285810", "ensembl_id": "ENSG00000104936" } }, "GRch38": { "90": { "location": "19:45769717-45782552", "ensembl_id": "ENSG00000104936" } } }, "hgnc_date_symbol_changed": "1997-10-10" }, "entity_type": "str", "entity_name": "DMPK_DM1_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301344", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 1 MIM#160900" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "19", "grch37_coordinates": [ 46273463, 46273522 ], "grch38_coordinates": [ 45770205, 45770264 ], "normal_repeats": 34, "pathogenic_repeats": 50, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TIP-2", "Hs.6454", "GIPC", "SEMCAP", "GLUT1CBP", "SYNECTIN", "NIP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1226", "gene_name": "GIPC PDZ domain containing family member 1", "omim_gene": [ "605072" ], "alias_name": null, "gene_symbol": "GIPC1", "hgnc_symbol": "GIPC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:14588572-14606944", "ensembl_id": "ENSG00000123159" } }, "GRch38": { "90": { "location": "19:14477760-14496149", "ensembl_id": "ENSG00000123159" } } }, "hgnc_date_symbol_changed": "2005-06-28" }, "entity_type": "str", "entity_name": "GIPC1_OPDM2_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "32413282", "33374016" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Oculopharyngodistal myopathy 2 MIM#618940" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "19", "grch37_coordinates": [ 14606854, 14606886 ], "grch38_coordinates": [ 14496042, 14496074 ], "normal_repeats": 32, "pathogenic_repeats": 70, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ST7", "FLJ12929" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31708", "gene_name": "LDL receptor related protein 12", "omim_gene": null, "alias_name": null, "gene_symbol": "LRP12", "hgnc_symbol": "LRP12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:105501459-105601252", "ensembl_id": "ENSG00000147650" } }, "GRch38": { "90": { "location": "8:104489231-104589024", "ensembl_id": "ENSG00000147650" } } }, "hgnc_date_symbol_changed": "2004-07-06" }, "entity_type": "str", "entity_name": "LRP12_OPDM1_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "31332380", "34047774" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Oculopharyngodistal myopathy 1 MIM#164310" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "8", "grch37_coordinates": [ 105601201, 105601227 ], "grch38_coordinates": [ 104588973, 104588999 ], "normal_repeats": 45, "pathogenic_repeats": 85, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PAB2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8565", "gene_name": "poly(A) binding protein nuclear 1", "omim_gene": [ "602279" ], "alias_name": null, "gene_symbol": "PABPN1", "hgnc_symbol": "PABPN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:23790498-23795394", "ensembl_id": "ENSG00000100836" } }, "GRch38": { "90": { "location": "14:23321289-23326185", "ensembl_id": "ENSG00000100836" } } }, "hgnc_date_symbol_changed": "1995-05-01" }, "entity_type": "str", "entity_name": "PABPN1_OPMD_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "9462747", "20301305" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Oculopharyngeal muscular dystrophy MIM#164300" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "repeated_sequence": "GCN", "chromosome": "14", "grch37_coordinates": [ 23790682, 23790711 ], "grch38_coordinates": [ 23321473, 23321502 ], "normal_repeats": 10, "pathogenic_repeats": 11, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "S3-12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29393", "gene_name": "perilipin 4", "omim_gene": [ "613247" ], "alias_name": null, "gene_symbol": "PLIN4", "hgnc_symbol": "PLIN4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:4502204-4517716", "ensembl_id": "ENSG00000167676" } }, "GRch38": { "90": { "location": "19:4502180-4518465", "ensembl_id": "ENSG00000167676" } } }, "hgnc_date_symbol_changed": "2009-08-12" }, "entity_type": "str", "entity_name": "PLIN4_MRUPAV_33-mer", "confidence_level": "3", "penetrance": null, "publications": [ "32451610", "37145156", "36151849", "35499779" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "myopathy, distal, with rimmed vacuoles MONDO:0014945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC", "chromosome": "19", "grch37_coordinates": [ 4510975, 4511073 ], "grch38_coordinates": [ 4510963, 4511061 ], "normal_repeats": 31, "pathogenic_repeats": 39, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ39378" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26814", "gene_name": "Rab interacting lysosomal protein like 1", "omim_gene": [ "614092" ], "alias_name": null, "gene_symbol": "RILPL1", "hgnc_symbol": "RILPL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:123955925-124018265", "ensembl_id": "ENSG00000188026" } }, "GRch38": { "90": { "location": "12:123470054-123533718", "ensembl_id": "ENSG00000188026" } } }, "hgnc_date_symbol_changed": "2007-11-27" }, "entity_type": "str", "entity_name": "RILPL1_OPDM4_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "35148830" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngodistal myopathy MONDO:0025193" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "12", "grch37_coordinates": [ 124018270, 124018296 ], "grch38_coordinates": [ 123533723, 123533749 ], "normal_repeats": 16, "pathogenic_repeats": 139, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PMP70", "ZWS2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:67", "gene_name": "ATP binding cassette subfamily D member 3", "omim_gene": [ "170995" ], "alias_name": null, "gene_symbol": "ABCD3", "hgnc_symbol": "ABCD3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:94883933-94984222", "ensembl_id": "ENSG00000117528" } }, "GRch38": { "90": { "location": "1:94418455-94518666", "ensembl_id": "ENSG00000117528" } } }, "hgnc_date_symbol_changed": "1992-03-03" }, "entity_type": "str", "entity_name": "ABCD3_OPDM_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "39068203" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngodistal myopathy 5, MIM# 621446" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCC", "chromosome": "1", "grch37_coordinates": [ 94883977, 94883998 ], "grch38_coordinates": [ 94418421, 94418442 ], "normal_repeats": 50, "pathogenic_repeats": 118, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "OPCA3", "ADCAII" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10560", "gene_name": "ataxin 7", "omim_gene": [ "607640" ], "alias_name": null, "gene_symbol": "ATXN7", "hgnc_symbol": "ATXN7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:63850233-63989138", "ensembl_id": "ENSG00000163635" } }, "GRch38": { "90": { "location": "3:63864557-64003462", "ensembl_id": "ENSG00000163635" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "str", "entity_name": "ATXN7_SCA7_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8908515", "29325606", "20301433" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia 7 MIM#164500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "3", "grch37_coordinates": [ 63898362, 63898391 ], "grch38_coordinates": [ 63912686, 63912715 ], "normal_repeats": 27, "pathogenic_repeats": 37, "tags": [], "panel": { "id": 3099, "hash_id": null, "name": "Syndromic Retinopathy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause retinopathy with at least one other consistent extra-ocular feature, forming a syndrome. The panel does NOT include the Bardet-Biedl syndrome, Stickler syndrome, and Usher syndrome genes, which have their own panels and are part of the Retinal Disorders Superpanel.\r\n\r\nConsider using the panel Retinal Disorders Superpanel when ophthalmological findings are not specific for a sub-group of disorders, particularly in individuals early in the diagnostic trajectory or if a dual diagnosis is a possibility.", "status": "public", "version": "0.256", "version_created": "2026-03-31T19:05:29.271183+11:00", "relevant_disorders": [ "Retinopathy", "HP:0000488" ], "stats": { "number_of_genes": 138, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:13997", "gene_name": "PR/SET domain 12", "omim_gene": [ "616458" ], "alias_name": [ "PR-domain containing protein 12", "PR-domain zinc finger protein 12" ], "gene_symbol": "PRDM12", "hgnc_symbol": "PRDM12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:133539981-133558368", "ensembl_id": "ENSG00000130711" } }, "GRch38": { "90": { "location": "9:130664594-130682981", "ensembl_id": "ENSG00000130711" } } }, "hgnc_date_symbol_changed": "2000-11-28" }, "entity_type": "str", "entity_name": "PRDM12_HSAN8_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "26005867" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCC", "chromosome": "9", "grch37_coordinates": [ 133556993, 133557026 ], "grch38_coordinates": [ 130681606, 130681639 ], "normal_repeats": 14, "pathogenic_repeats": 18, "tags": [ "paediatric-onset" ], "panel": { "id": 3126, "hash_id": null, "name": "Pain syndromes", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Mendelian disorders of pain perception, including insensitivity to pain or increased pain perception, with thanks to Genomics England PanelApp.", "status": "public", "version": "0.38", "version_created": "2026-02-22T15:47:27.675595+11:00", "relevant_disorders": [ "Pain", "HP:0012531" ], "stats": { "number_of_genes": 31, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "BPES1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1092", "gene_name": "forkhead box L2", "omim_gene": [ "605597" ], "alias_name": null, "gene_symbol": "FOXL2", "hgnc_symbol": "FOXL2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:138663066-138665982", "ensembl_id": "ENSG00000183770" } }, "GRch38": { "90": { "location": "3:138944224-138947140", "ensembl_id": "ENSG00000183770" } } }, "hgnc_date_symbol_changed": "1992-02-28" }, "entity_type": "str", "entity_name": "FOXL2_BPES_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11468277", "33811808" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100", "Premature ovarian failure 3 MIM#608996" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "3", "grch37_coordinates": [ 138664863, 138664904 ], "grch38_coordinates": [ 138946021, 138946062 ], "normal_repeats": 14, "pathogenic_repeats": 19, "tags": [], "panel": { "id": 3166, "hash_id": null, "name": "Primary Ovarian Insufficiency_Premature Ovarian Failure", "disease_group": "Endocrine disorders", "disease_sub_group": "Gonadal and sex development disorders", "description": "This panel contains genes that cause non-syndromic and syndromic amenorrhoea, and ovarian insufficiency/failure. It was developed by RMH and Genetic Health QLD. It is a consensus panel used by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Primary ovarian insufficiency' panel V1.69, with all discrepancies reviewed and resolved (October 2025). \r\n\r\nWith early onset premature ovarian insufficiency, the following should be considered:\r\n• X chromosome abnormality such as Turner syndrome\r\n• Presence of FMR1 premutation\r\n• Iatrogenic cause (bilateral oophorectomy, chemotherapy, radiotherapy or any other iatrogenic cause)\r\n• Presence of thyroid or adrenal auto-antibodies\r\n\r\nTesting for fragile X premutation and chromosome abnormalities are strongly recommended prior to genomic testing.\r\n\r\nThis panel should be used for individuals with raised FSH. If FSH is low, the Hypogonadotropic hypogonadism panel should be used.\r\n\r\nPlease also consider the Differences of Sex Development panel where appropriate depending on clinical features.", "status": "public", "version": "0.408", "version_created": "2026-03-27T17:02:19.488211+11:00", "relevant_disorders": [ "Premature ovarian insufficiency", "HP:0008209" ], "stats": { "number_of_genes": 163, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FMRP", "FRAXA", "MGC87458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3775", "gene_name": "fragile X mental retardation 1", "omim_gene": [ "309550" ], "alias_name": null, "gene_symbol": "FMR1", "hgnc_symbol": "FMR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:146993469-147032645", "ensembl_id": "ENSG00000102081" } }, "GRch38": { "90": { "location": "X:147911951-147951125", "ensembl_id": "ENSG00000102081" } } }, "hgnc_date_symbol_changed": "1992-01-17" }, "entity_type": "str", "entity_name": "FMR1_FXPOI_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "20301558" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Premature ovarian failure 1 MIM#311360" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "repeated_sequence": "CGG", "chromosome": "X", "grch37_coordinates": [ 146993569, 146993628 ], "grch38_coordinates": [ 147912051, 147912110 ], "normal_repeats": 44, "pathogenic_repeats": 55, "tags": [ "5'UTR" ], "panel": { "id": 3166, "hash_id": null, "name": "Primary Ovarian Insufficiency_Premature Ovarian Failure", "disease_group": "Endocrine disorders", "disease_sub_group": "Gonadal and sex development disorders", "description": "This panel contains genes that cause non-syndromic and syndromic amenorrhoea, and ovarian insufficiency/failure. It was developed by RMH and Genetic Health QLD. It is a consensus panel used by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Primary ovarian insufficiency' panel V1.69, with all discrepancies reviewed and resolved (October 2025). \r\n\r\nWith early onset premature ovarian insufficiency, the following should be considered:\r\n• X chromosome abnormality such as Turner syndrome\r\n• Presence of FMR1 premutation\r\n• Iatrogenic cause (bilateral oophorectomy, chemotherapy, radiotherapy or any other iatrogenic cause)\r\n• Presence of thyroid or adrenal auto-antibodies\r\n\r\nTesting for fragile X premutation and chromosome abnormalities are strongly recommended prior to genomic testing.\r\n\r\nThis panel should be used for individuals with raised FSH. If FSH is low, the Hypogonadotropic hypogonadism panel should be used.\r\n\r\nPlease also consider the Differences of Sex Development panel where appropriate depending on clinical features.", "status": "public", "version": "0.408", "version_created": "2026-03-27T17:02:19.488211+11:00", "relevant_disorders": [ "Premature ovarian insufficiency", "HP:0008209" ], "stats": { "number_of_genes": 163, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11199", "gene_name": "SRY-box 3", "omim_gene": [ "313430" ], "alias_name": null, "gene_symbol": "SOX3", "hgnc_symbol": "SOX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:139585152-139587225", "ensembl_id": "ENSG00000134595" } }, "GRch38": { "90": { "location": "X:140502985-140505116", "ensembl_id": "ENSG00000134595" } } }, "hgnc_date_symbol_changed": "1993-11-30" }, "entity_type": "str", "entity_name": "SOX3_PHPX_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12428212", "15800844", "33811808", "23505376", "19654509" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Intellectual disability, X-linked, with isolated growth hormone deficiency MIM#300123", "Panhypopituitarism, X-linked MIM#312000" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 139586482, 139586526 ], "grch38_coordinates": [ 140504317, 140504361 ], "normal_repeats": 15, "pathogenic_repeats": 22, "tags": [ "paediatric-onset" ], "panel": { "id": 3236, "hash_id": null, "name": "Pituitary hormone deficiency", "disease_group": "Endocrine disorders", "disease_sub_group": "Pituitary disorders", "description": "This panel contains genes associated with pituitary hormone deficiency. \r\nIncludes isolated hormone deficiency, combined hormone deficiencies, and panhypopituitarism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Pituitary hormone deficiency' panel V4.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.208", "version_created": "2026-04-02T15:15:10.893013+11:00", "relevant_disorders": [ "Hypopituitarism", "HP:0040075" ], "stats": { "number_of_genes": 118, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 12, "pathogenic_repeats": 14, "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HPE5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12873", "gene_name": "Zic family member 2", "omim_gene": [ "603073" ], "alias_name": [ "Zinc finger protein of the cerebellum 2" ], "gene_symbol": "ZIC2", "hgnc_symbol": "ZIC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:100634026-100639018", "ensembl_id": "ENSG00000043355" } }, "GRch38": { "90": { "location": "13:99981772-99986773", "ensembl_id": "ENSG00000043355" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "str", "entity_name": "ZIC2_HPE5_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11285244", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Holoprosencephaly 5 MIM#609637" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "13", "grch37_coordinates": [ 100637703, 100637747 ], "grch38_coordinates": [ 99985449, 99985493 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0838", "GLS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4331", "gene_name": "glutaminase", "omim_gene": [ "138280" ], "alias_name": null, "gene_symbol": "GLS", "hgnc_symbol": "GLS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:191745553-191830278", "ensembl_id": "ENSG00000115419" } }, "GRch38": { "90": { "location": "2:190880827-190965552", "ensembl_id": "ENSG00000115419" } } }, "hgnc_date_symbol_changed": "1989-02-07" }, "entity_type": "str", "entity_name": "GLS_GDPAG_GCA", "confidence_level": "3", "penetrance": null, "publications": [ "30970188" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCA", "chromosome": "2", "grch37_coordinates": [ 191745599, 191745646 ], "grch38_coordinates": [ 190880873, 190880920 ], "normal_repeats": 16, "pathogenic_repeats": 400, "tags": [], "panel": { "id": 3468, "hash_id": null, "name": "Miscellaneous Metabolic Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause miscellaneous metabolic disorders, that are not present on any of the more specific metabolic disorders panels (see the Metabolic Disorders Superpanel for the full list of panels). It contains, but is not limited to, the following groups of conditions:\r\n-Disorders of purine and pyrimidine metabolism\r\n-Organic acidurias, and other disorders of amino acid and peptide metabolism\r\n-Disorders of bile acid metabolism and transport, and other disorders of the metabolism of sterols\r\n-Disorders of nucleotide metabolism\r\n-Disorders of glucose transport, and other disorders of carbohydrate metabolism (excluding glycogen storage disorders)\r\n-Disorders of zinc and manganese metabolism\r\n-Disorders of vitamins and cofactors\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.60", "version_created": "2026-01-15T15:39:27.439934+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 149, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11199", "gene_name": "SRY-box 3", "omim_gene": [ "313430" ], "alias_name": null, "gene_symbol": "SOX3", "hgnc_symbol": "SOX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:139585152-139587225", "ensembl_id": "ENSG00000134595" } }, "GRch38": { "90": { "location": "X:140502985-140505116", "ensembl_id": "ENSG00000134595" } } }, "hgnc_date_symbol_changed": "1993-11-30" }, "entity_type": "str", "entity_name": "SOX3_PHPX_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12428212", "15800844", "33811808", "23505376", "19654509" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Intellectual disability, X-linked, with isolated growth hormone deficiency MIM#300123", "Panhypopituitarism, X-linked MIM#312000" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 139586482, 139586526 ], "grch38_coordinates": [ 140504317, 140504361 ], "normal_repeats": 15, "pathogenic_repeats": 22, "tags": [ "paediatric-onset" ], "panel": { "id": 3471, "hash_id": null, "name": "Congenital hypothyroidism", "disease_group": "Endocrine disorders", "disease_sub_group": "Thyroid disorders", "description": "This panel contains genes associated with congenital hypothyroidism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'congenital hypothyroidism' panel V3.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.120", "version_created": "2026-04-02T11:51:29.895216+11:00", "relevant_disorders": [ "Hypothyroidism HP:0000821" ], "stats": { "number_of_genes": 63, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "DMK", "DM1PK", "MDPK", "MT-PK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2933", "gene_name": "DM1 protein kinase", "omim_gene": [ "605377" ], "alias_name": [ "dystrophia myotonica 1", "DM protein kinase", "myotonin protein kinase A", "myotonic dystrophy associated protein kinase", "thymopoietin homolog" ], "gene_symbol": "DMPK", "hgnc_symbol": "DMPK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:46272975-46285810", "ensembl_id": "ENSG00000104936" } }, "GRch38": { "90": { "location": "19:45769717-45782552", "ensembl_id": "ENSG00000104936" } } }, "hgnc_date_symbol_changed": "1997-10-10" }, "entity_type": "str", "entity_name": "DMPK_DM1_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301344", "29325606", "1546325" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 1 MIM#160900" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "19", "grch37_coordinates": [ 46273463, 46273522 ], "grch38_coordinates": [ 45770205, 45770264 ], "normal_repeats": 34, "pathogenic_repeats": 50, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "str", "entity_name": "FXN_FRDA_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "20301458", "8596916" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Friedreich ataxia MIM#229300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GAA", "chromosome": "9", "grch37_coordinates": [ 71652203, 71652220 ], "grch38_coordinates": [ 69037287, 69037304 ], "normal_repeats": 33, "pathogenic_repeats": 66, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MGC23980", "DENNL72" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28337", "gene_name": "chromosome 9 open reading frame 72", "omim_gene": [ "614260" ], "alias_name": null, "gene_symbol": "C9orf72", "hgnc_symbol": "C9orf72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:27546544-27573864", "ensembl_id": "ENSG00000147894" } }, "GRch38": { "90": { "location": "9:27546545-27573866", "ensembl_id": "ENSG00000147894" } } }, "hgnc_date_symbol_changed": "2004-01-06" }, "entity_type": "str", "entity_name": "C9orf72_FTDALS_GGGGCC", "confidence_level": "3", "penetrance": null, "publications": [ "25577942", "21944779", "21944778" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGGGCC", "chromosome": "9", "grch37_coordinates": [ 27573427, 27573544 ], "grch38_coordinates": [ 27573529, 27573546 ], "normal_repeats": 25, "pathogenic_repeats": 60, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PMP70", "ZWS2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:67", "gene_name": "ATP binding cassette subfamily D member 3", "omim_gene": [ "170995" ], "alias_name": null, "gene_symbol": "ABCD3", "hgnc_symbol": "ABCD3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:94883933-94984222", "ensembl_id": "ENSG00000117528" } }, "GRch38": { "90": { "location": "1:94418455-94518666", "ensembl_id": "ENSG00000117528" } } }, "hgnc_date_symbol_changed": "1992-03-03" }, "entity_type": "str", "entity_name": "ABCD3_OPDM_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "39068203" ], "evidence": [ "Expert Review Green", "Other" ], "phenotypes": [ "Oculopharyngodistal myopathy 5, MIM# 621446" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCC", "chromosome": "1", "grch37_coordinates": [ 94883977, 94883998 ], "grch38_coordinates": [ 94418421, 94418442 ], "normal_repeats": 50, "pathogenic_repeats": 118, "tags": [], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FMRP", "FRAXA", "MGC87458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3775", "gene_name": "fragile X mental retardation 1", "omim_gene": [ "309550" ], "alias_name": null, "gene_symbol": "FMR1", "hgnc_symbol": "FMR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:146993469-147032645", "ensembl_id": "ENSG00000102081" } }, "GRch38": { "90": { "location": "X:147911951-147951125", "ensembl_id": "ENSG00000102081" } } }, "hgnc_date_symbol_changed": "1992-01-17" }, "entity_type": "str", "entity_name": "FMR1_FXPOI_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "20301558", "9647544" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Premature ovarian failure 1 MIM#311360" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "repeated_sequence": "CGG", "chromosome": "X", "grch37_coordinates": [ 146993569, 146993628 ], "grch38_coordinates": [ 147912051, 147912110 ], "normal_repeats": 44, "pathogenic_repeats": 55, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FMRP", "FRAXA", "MGC87458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3775", "gene_name": "fragile X mental retardation 1", "omim_gene": [ "309550" ], "alias_name": null, "gene_symbol": "FMR1", "hgnc_symbol": "FMR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:146993469-147032645", "ensembl_id": "ENSG00000102081" } }, "GRch38": { "90": { "location": "X:147911951-147951125", "ensembl_id": "ENSG00000102081" } } }, "hgnc_date_symbol_changed": "1992-01-17" }, "entity_type": "str", "entity_name": "FMR1_FXS_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "33795824", "25227148", "1710175", "2031184" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Fragile X syndrome\tMIM#300624" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "repeated_sequence": "CGG", "chromosome": "X", "grch37_coordinates": [ 146993569, 146993628 ], "grch38_coordinates": [ 147912051, 147912110 ], "normal_repeats": 44, "pathogenic_repeats": 200, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FMRP", "FRAXA", "MGC87458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3775", "gene_name": "fragile X mental retardation 1", "omim_gene": [ "309550" ], "alias_name": null, "gene_symbol": "FMR1", "hgnc_symbol": "FMR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:146993469-147032645", "ensembl_id": "ENSG00000102081" } }, "GRch38": { "90": { "location": "X:147911951-147951125", "ensembl_id": "ENSG00000102081" } } }, "hgnc_date_symbol_changed": "1992-01-17" }, "entity_type": "str", "entity_name": "FMR1_FXTAS_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "23765048", "25227148", "11445641" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Fragile X tremor/ataxia syndrome MIM#300623" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "repeated_sequence": "CGG", "chromosome": "X", "grch37_coordinates": [ 146993569, 146993628 ], "grch38_coordinates": [ 147912051, 147912110 ], "normal_repeats": 44, "pathogenic_repeats": 55, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0838", "GLS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4331", "gene_name": "glutaminase", "omim_gene": [ "138280" ], "alias_name": null, "gene_symbol": "GLS", "hgnc_symbol": "GLS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:191745553-191830278", "ensembl_id": "ENSG00000115419" } }, "GRch38": { "90": { "location": "2:190880827-190965552", "ensembl_id": "ENSG00000115419" } } }, "hgnc_date_symbol_changed": "1989-02-07" }, "entity_type": "str", "entity_name": "GLS_GDPAG_GCA", "confidence_level": "3", "penetrance": null, "publications": [ "30970188" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCA", "chromosome": "2", "grch37_coordinates": [ 191745599, 191745646 ], "grch38_coordinates": [ 190880873, 190880920 ], "normal_repeats": 16, "pathogenic_repeats": 400, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "IT15" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4851", "gene_name": "huntingtin", "omim_gene": [ "613004" ], "alias_name": null, "gene_symbol": "HTT", "hgnc_symbol": "HTT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:3076408-3245676", "ensembl_id": "ENSG00000197386" } }, "GRch38": { "90": { "location": "4:3074681-3243959", "ensembl_id": "ENSG00000197386" } } }, "hgnc_date_symbol_changed": "2007-12-04" }, "entity_type": "str", "entity_name": "HTT_HD_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8458085", "20301482", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Huntington disease MIM#143100" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "4", "grch37_coordinates": [ 3076604, 3076666 ], "grch38_coordinates": [ 3074877, 3074939 ], "normal_repeats": 26, "pathogenic_repeats": 40, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "JP-3", "CAGL237", "HDL2", "JP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14203", "gene_name": "junctophilin 3", "omim_gene": [ "605268" ], "alias_name": null, "gene_symbol": "JPH3", "hgnc_symbol": "JPH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:87635441-87731762", "ensembl_id": "ENSG00000154118" } }, "GRch38": { "90": { "location": "16:87601835-87698156", "ensembl_id": "ENSG00000154118" } } }, "hgnc_date_symbol_changed": "2000-12-08" }, "entity_type": "str", "entity_name": "JPH3_HDL2_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "11558794", "20301701" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Huntington disease-like 2 MIM#606438" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "16", "grch37_coordinates": [ 87637894, 87637935 ], "grch38_coordinates": [ 87604288, 87604329 ], "normal_repeats": 28, "pathogenic_repeats": 40, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN1", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239538, 27239585 ], "grch38_coordinates": [ 27199919, 27199966 ], "normal_repeats": 16, "pathogenic_repeats": 22, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN2", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239445, 27239480 ], "grch38_coordinates": [ 27199826, 27199861 ], "normal_repeats": 12, "pathogenic_repeats": 18, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ39458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31750", "gene_name": "sterile alpha motif domain containing 12", "omim_gene": null, "alias_name": null, "gene_symbol": "SAMD12", "hgnc_symbol": "SAMD12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:119201698-119634234", "ensembl_id": "ENSG00000177570" } }, "GRch38": { "90": { "location": "8:118189459-118621995", "ensembl_id": "ENSG00000177570" } } }, "hgnc_date_symbol_changed": "2004-07-15" }, "entity_type": "str", "entity_name": "SAMD12_FAME1_TTTCA", "confidence_level": "3", "penetrance": null, "publications": [ "30194086", "29507423" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 1 MIM#601068" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "repeated_sequence": "TTTCA", "chromosome": "8", "grch37_coordinates": [ 119379055, 119379157 ], "grch38_coordinates": [ 118366816, 118366918 ], "normal_repeats": 0, "pathogenic_repeats": 100, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Phox2b", "NBPhox" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9143", "gene_name": "paired like homeobox 2b", "omim_gene": [ "603851" ], "alias_name": null, "gene_symbol": "PHOX2B", "hgnc_symbol": "PHOX2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:41746099-41750987", "ensembl_id": "ENSG00000109132" } }, "GRch38": { "90": { "location": "4:41744082-41748970", "ensembl_id": "ENSG00000109132" } } }, "hgnc_date_symbol_changed": "2003-02-14" }, "entity_type": "str", "entity_name": "PHOX2B_CCHS_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12640453", "34012823", "20301600", "18798833" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "4", "grch37_coordinates": [ 41747989, 41748048 ], "grch38_coordinates": [ 41745972, 41746031 ], "normal_repeats": 20, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "GTT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18063", "gene_name": "StAR related lipid transfer domain containing 7", "omim_gene": [ "616712" ], "alias_name": null, "gene_symbol": "STARD7", "hgnc_symbol": "STARD7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:96850597-96874563", "ensembl_id": "ENSG00000084090" } }, "GRch38": { "90": { "location": "2:96184859-96208825", "ensembl_id": "ENSG00000084090" } } }, "hgnc_date_symbol_changed": "2002-01-24" }, "entity_type": "str", "entity_name": "STARD7_FAME2_ATTTC", "confidence_level": "3", "penetrance": null, "publications": [ "31664034" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 2 MIM#607876" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTTC", "chromosome": "2", "grch37_coordinates": [ 96862805, 96862859 ], "grch38_coordinates": [ 96197067, 96197121 ], "normal_repeats": 0, "pathogenic_repeats": 661, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "SEF2-1B", "ITF2", "bHLHb19", "E2-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11634", "gene_name": "transcription factor 4", "omim_gene": [ "602272" ], "alias_name": null, "gene_symbol": "TCF4", "hgnc_symbol": "TCF4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:52889562-53332018", "ensembl_id": "ENSG00000196628" } }, "GRch38": { "90": { "location": "18:55222331-55664787", "ensembl_id": "ENSG00000196628" } } }, "hgnc_date_symbol_changed": "1990-10-16" }, "entity_type": "str", "entity_name": "TCF4_FECD3_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "25722209", "24255041" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Corneal dystrophy, Fuchs endothelial, 3 MIM#613267" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "18", "grch37_coordinates": [ 53253387, 53253458 ], "grch38_coordinates": [ 55586156, 55586227 ], "normal_repeats": 31, "pathogenic_repeats": 51, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HRIHFB2206", "CTG-B45d", "CTG-B43a" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23194", "gene_name": "THAP domain containing 11", "omim_gene": [ "609119" ], "alias_name": null, "gene_symbol": "THAP11", "hgnc_symbol": "THAP11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:67876213-67878097", "ensembl_id": "ENSG00000168286" } }, "GRch38": { "90": { "location": "16:67842082-67844195", "ensembl_id": "ENSG00000168286" } } }, "hgnc_date_symbol_changed": "2003-10-08" }, "entity_type": "str", "entity_name": "THAP11_SCA51_CAG", "confidence_level": "2", "penetrance": null, "publications": [ "15368101", "24677642", "34165550", "38113319", "40459937", "39651830", "37148549" ], "evidence": [ "Expert Review Amber", "Other" ], "phenotypes": [ "Spinocerebellar ataxia 51 MONDO:0975800" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "16", "grch37_coordinates": [ 67876766, 67876853 ], "grch38_coordinates": [ 67842863, 67842950 ], "normal_repeats": 39, "pathogenic_repeats": 47, "tags": [], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "AIBP", "MGC119143", "MGC119144", "MGC119145", "YJEFN1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18453", "gene_name": "NAD(P)HX epimerase", "omim_gene": [ "608862" ], "alias_name": [ "apoA-I binding protein", "NAD(P)H-hydrate epimerase" ], "gene_symbol": "NAXE", "hgnc_symbol": "NAXE", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:156561554-156564091", "ensembl_id": "ENSG00000163382" } }, "GRch38": { "90": { "location": "1:156591762-156594299", "ensembl_id": "ENSG00000163382" } } }, "hgnc_date_symbol_changed": "2016-03-09" }, "entity_type": "str", "entity_name": "NAXE_NME_GGGCC", "confidence_level": "2", "penetrance": null, "publications": [ "39455596" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 1 MONDO:0020781" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GGGCC", "chromosome": "1", "grch37_coordinates": [ 156561557, 156561575 ], "grch38_coordinates": [ 156591765, 156591783 ], "normal_repeats": 7, "pathogenic_repeats": 200, "tags": [], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "DKFZP434A139", "SMS", "KIAA1820", "MGC12824" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9834", "gene_name": "retinoic acid induced 1", "omim_gene": [ "607642" ], "alias_name": null, "gene_symbol": "RAI1", "hgnc_symbol": "RAI1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:17584787-17714767", "ensembl_id": "ENSG00000108557" } }, "GRch38": { "90": { "location": "17:17681473-17811453", "ensembl_id": "ENSG00000108557" } } }, "hgnc_date_symbol_changed": "1999-04-16" }, "entity_type": "str", "entity_name": "RAI1_FAME8_TTTCA", "confidence_level": "1", "penetrance": null, "publications": [ "37994247" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "benign adult familial myoclonic epilepsy MONDO:0019448" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "17", "grch37_coordinates": [ 17711672, 17711774 ], "grch38_coordinates": [ 17808358, 17808460 ], "normal_repeats": 0, "pathogenic_repeats": 9, "tags": [], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FRAXE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3776", "gene_name": "AF4/FMR2 family member 2", "omim_gene": [ "300806" ], "alias_name": null, "gene_symbol": "AFF2", "hgnc_symbol": "AFF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:147582139-148082193", "ensembl_id": "ENSG00000155966" } }, "GRch38": { "90": { "location": "X:148500619-149000663", "ensembl_id": "ENSG00000155966" } } }, "hgnc_date_symbol_changed": "2005-06-27" }, "entity_type": "str", "entity_name": "AFF2_FRAXE_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "8334699", "8673085", "11388762" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Intellectual developmental disorder, X-linked 109 MIM#309548" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCC", "chromosome": "X", "grch37_coordinates": [ 147582158, 147582202 ], "grch38_coordinates": [ 148500638, 148500682 ], "normal_repeats": 44, "pathogenic_repeats": 200, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } } ] }