Str Search List
Search STRs
GET /api/v1/strs/?format=api&page=3
{ "count": 259, "next": null, "previous": "https://panelapp-aus.org/api/v1/strs/?format=api&page=2", "results": [ { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11199", "gene_name": "SRY-box 3", "omim_gene": [ "313430" ], "alias_name": null, "gene_symbol": "SOX3", "hgnc_symbol": "SOX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:139585152-139587225", "ensembl_id": "ENSG00000134595" } }, "GRch38": { "90": { "location": "X:140502985-140505116", "ensembl_id": "ENSG00000134595" } } }, "hgnc_date_symbol_changed": "1993-11-30" }, "entity_type": "str", "entity_name": "SOX3_PHPX_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12428212", "15800844", "33811808", "23505376", "19654509" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Intellectual disability, X-linked, with isolated growth hormone deficiency MIM#300123", "Panhypopituitarism, X-linked MIM#312000" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 139586482, 139586526 ], "grch38_coordinates": [ 140504317, 140504361 ], "normal_repeats": 15, "pathogenic_repeats": 22, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PAB2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8565", "gene_name": "poly(A) binding protein nuclear 1", "omim_gene": [ "602279" ], "alias_name": null, "gene_symbol": "PABPN1", "hgnc_symbol": "PABPN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:23790498-23795394", "ensembl_id": "ENSG00000100836" } }, "GRch38": { "90": { "location": "14:23321289-23326185", "ensembl_id": "ENSG00000100836" } } }, "hgnc_date_symbol_changed": "1995-05-01" }, "entity_type": "str", "entity_name": "PABPN1_OPMD_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "9462747", "20301305" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Oculopharyngeal muscular dystrophy MIM#164300" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "repeated_sequence": "GCN", "chromosome": "14", "grch37_coordinates": [ 23790682, 23790711 ], "grch38_coordinates": [ 23321473, 23321502 ], "normal_repeats": 10, "pathogenic_repeats": 11, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TIP-2", "Hs.6454", "GIPC", "SEMCAP", "GLUT1CBP", "SYNECTIN", "NIP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1226", "gene_name": "GIPC PDZ domain containing family member 1", "omim_gene": [ "605072" ], "alias_name": null, "gene_symbol": "GIPC1", "hgnc_symbol": "GIPC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:14588572-14606944", "ensembl_id": "ENSG00000123159" } }, "GRch38": { "90": { "location": "19:14477760-14496149", "ensembl_id": "ENSG00000123159" } } }, "hgnc_date_symbol_changed": "2005-06-28" }, "entity_type": "str", "entity_name": "GIPC1_OPDM2_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "32413282", "33374016" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Oculopharyngodistal myopathy 2 MIM#618940" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "19", "grch37_coordinates": [ 14606854, 14606886 ], "grch38_coordinates": [ 14496042, 14496074 ], "normal_repeats": 32, "pathogenic_repeats": 70, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ39378" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26814", "gene_name": "Rab interacting lysosomal protein like 1", "omim_gene": [ "614092" ], "alias_name": null, "gene_symbol": "RILPL1", "hgnc_symbol": "RILPL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:123955925-124018265", "ensembl_id": "ENSG00000188026" } }, "GRch38": { "90": { "location": "12:123470054-123533718", "ensembl_id": "ENSG00000188026" } } }, "hgnc_date_symbol_changed": "2007-11-27" }, "entity_type": "str", "entity_name": "RILPL1_OPDM4_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "35148830", "35700120" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngodistal myopathy MONDO:0025193" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "12", "grch37_coordinates": [ 124018270, 124018296 ], "grch38_coordinates": [ 123533723, 123533749 ], "normal_repeats": 16, "pathogenic_repeats": 139, "tags": [], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CST6", "PME" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2482", "gene_name": "cystatin B", "omim_gene": [ "601145" ], "alias_name": [ "stefin B" ], "gene_symbol": "CSTB", "hgnc_symbol": "CSTB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:45192393-45196326", "ensembl_id": "ENSG00000160213" } }, "GRch38": { "90": { "location": "21:43772511-43776445", "ensembl_id": "ENSG00000160213" } } }, "hgnc_date_symbol_changed": "1996-12-12" }, "entity_type": "str", "entity_name": "CSTB_EPM1_CCCCGCCCCGCG", "confidence_level": "3", "penetrance": null, "publications": [ "29325606", "20301321", "9126745" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "CCCCGCCCCGCG", "chromosome": "21", "grch37_coordinates": [ 45196325, 45196360 ], "grch38_coordinates": [ 43776444, 43776479 ], "normal_repeats": 3, "pathogenic_repeats": 30, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ22215", "VWA-1", "WARP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30910", "gene_name": "von Willebrand factor A domain containing 1", "omim_gene": [ "611901" ], "alias_name": null, "gene_symbol": "VWA1", "hgnc_symbol": "VWA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:1370241-1378262", "ensembl_id": "ENSG00000179403" } }, "GRch38": { "90": { "location": "1:1434861-1442882", "ensembl_id": "ENSG00000179403" } } }, "hgnc_date_symbol_changed": "2005-07-18" }, "entity_type": "str", "entity_name": "VWA1_HMNMYO_GCGCGGAGCG", "confidence_level": "3", "penetrance": null, "publications": [ "33559681", "33459760" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neuropathy, hereditary motor, with myopathic features\tMIM#619216" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCGCGGAGCG", "chromosome": "1", "grch37_coordinates": [ 1371179, 1371198 ], "grch38_coordinates": [ 1435799, 1435818 ], "normal_repeats": 2, "pathogenic_repeats": 3, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TEB4", "MARCH-VI", "RNF176" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30550", "gene_name": "membrane associated ring-CH-type finger 6", "omim_gene": [ "613297" ], "alias_name": null, "gene_symbol": "MARCH6", "hgnc_symbol": "MARCH6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:10353815-10440500", "ensembl_id": "ENSG00000145495" } }, "GRch38": { "90": { "location": "5:10353703-10440388", "ensembl_id": "ENSG00000145495" } } }, "hgnc_date_symbol_changed": "2005-01-26" }, "entity_type": "str", "entity_name": "MARCHF6_FAME3_TTTCA", "confidence_level": "3", "penetrance": null, "publications": [ "31664039" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 3 MIM#613608" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "5", "grch37_coordinates": [ 10356451, 10356519 ], "grch38_coordinates": [ 10356347, 10356411 ], "normal_repeats": 0, "pathogenic_repeats": 660, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "RNF163", "ZCCHC22", "CNBP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13164", "gene_name": "CCHC-type zinc finger nucleic acid binding protein", "omim_gene": [ "116955" ], "alias_name": null, "gene_symbol": "CNBP", "hgnc_symbol": "CNBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:128888327-128902765", "ensembl_id": "ENSG00000169714" } }, "GRch38": { "90": { "location": "3:129169484-129183922", "ensembl_id": "ENSG00000169714" } } }, "hgnc_date_symbol_changed": "2006-06-29" }, "entity_type": "str", "entity_name": "CNBP_DM2_CCTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301639", "11486088" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Myotonic dystrophy 2 MIM#602668" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCTG", "chromosome": "3", "grch37_coordinates": [ 128891420, 128891499 ], "grch38_coordinates": [ 129172577, 129172656 ], "normal_repeats": 26, "pathogenic_repeats": 75, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HPE5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12873", "gene_name": "Zic family member 2", "omim_gene": [ "603073" ], "alias_name": [ "Zinc finger protein of the cerebellum 2" ], "gene_symbol": "ZIC2", "hgnc_symbol": "ZIC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:100634026-100639018", "ensembl_id": "ENSG00000043355" } }, "GRch38": { "90": { "location": "13:99981772-99986773", "ensembl_id": "ENSG00000043355" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "str", "entity_name": "ZIC2_HPE5_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11285244", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Holoprosencephaly 5 MIM#609637" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "13", "grch37_coordinates": [ 100637703, 100637747 ], "grch38_coordinates": [ 99985449, 99985493 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:13997", "gene_name": "PR/SET domain 12", "omim_gene": [ "616458" ], "alias_name": [ "PR-domain containing protein 12", "PR-domain zinc finger protein 12" ], "gene_symbol": "PRDM12", "hgnc_symbol": "PRDM12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:133539981-133558368", "ensembl_id": "ENSG00000130711" } }, "GRch38": { "90": { "location": "9:130664594-130682981", "ensembl_id": "ENSG00000130711" } } }, "hgnc_date_symbol_changed": "2000-11-28" }, "entity_type": "str", "entity_name": "PRDM12_HSAN8_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "26005867" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCC", "chromosome": "9", "grch37_coordinates": [ 133556993, 133557026 ], "grch38_coordinates": [ 130681606, 130681639 ], "normal_repeats": 14, "pathogenic_repeats": 18, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "XT-I", "PXYLT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15516", "gene_name": "xylosyltransferase 1", "omim_gene": [ "608124" ], "alias_name": [ "protein xylosyltransferase 1" ], "gene_symbol": "XYLT1", "hgnc_symbol": "XYLT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:17195626-17564738", "ensembl_id": "ENSG00000103489" } }, "GRch38": { "90": { "location": "16:17101769-17470881", "ensembl_id": "ENSG00000103489" } } }, "hgnc_date_symbol_changed": "2001-04-06" }, "entity_type": "str", "entity_name": "XYLT1_DBQD2_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "30554721" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Desbuquois dysplasia 2 MIM#615777" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 17564765, 17564779 ], "grch38_coordinates": [ 17470908, 17470922 ], "normal_repeats": 20, "pathogenic_repeats": 120, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MED", "THBS5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2227", "gene_name": "cartilage oligomeric matrix protein", "omim_gene": [ "600310" ], "alias_name": [ "thrombospondin-5" ], "gene_symbol": "COMP", "hgnc_symbol": "COMP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:18893583-18902123", "ensembl_id": "ENSG00000105664" } }, "GRch38": { "90": { "location": "19:18782773-18791314", "ensembl_id": "ENSG00000105664" } } }, "hgnc_date_symbol_changed": "1994-05-24" }, "entity_type": "str", "entity_name": "COMP_MEDPSACH_GAC", "confidence_level": "3", "penetrance": null, "publications": [ "9887340", "17133256", "21922596" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Epiphyseal dysplasia, multiple, 1 MIM#132400", "Pseudoachondroplasia MIM#177170" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GAC", "chromosome": "19", "grch37_coordinates": [ 18896844, 18896859 ], "grch38_coordinates": [ 18786034, 18786049 ], "normal_repeats": 5, "pathogenic_repeats": 6, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "S3-12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29393", "gene_name": "perilipin 4", "omim_gene": [ "613247" ], "alias_name": null, "gene_symbol": "PLIN4", "hgnc_symbol": "PLIN4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:4502204-4517716", "ensembl_id": "ENSG00000167676" } }, "GRch38": { "90": { "location": "19:4502180-4518465", "ensembl_id": "ENSG00000167676" } } }, "hgnc_date_symbol_changed": "2009-08-12" }, "entity_type": "str", "entity_name": "PLIN4_MRUPAV_33-mer", "confidence_level": "3", "penetrance": null, "publications": [ "32451610", "37145156", "36151849", "35499779" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "myopathy, distal, with rimmed vacuoles MONDO:0014945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC", "chromosome": "19", "grch37_coordinates": [ 4510975, 4511073 ], "grch38_coordinates": [ 4510963, 4511061 ], "normal_repeats": 31, "pathogenic_repeats": 39, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "BPES1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1092", "gene_name": "forkhead box L2", "omim_gene": [ "605597" ], "alias_name": null, "gene_symbol": "FOXL2", "hgnc_symbol": "FOXL2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:138663066-138665982", "ensembl_id": "ENSG00000183770" } }, "GRch38": { "90": { "location": "3:138944224-138947140", "ensembl_id": "ENSG00000183770" } } }, "hgnc_date_symbol_changed": "1992-02-28" }, "entity_type": "str", "entity_name": "FOXL2_BPES_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11468277", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100", "Premature ovarian failure 3 MIM#608996" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "repeated_sequence": "GCN", "chromosome": "3", "grch37_coordinates": [ 138664863, 138664904 ], "grch38_coordinates": [ 138946021, 138946062 ], "normal_repeats": 14, "pathogenic_repeats": 19, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ISSX", "CT121", "EIEE1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18060", "gene_name": "aristaless related homeobox", "omim_gene": [ "300382" ], "alias_name": [ "cancer/testis antigen 121" ], "gene_symbol": "ARX", "hgnc_symbol": "ARX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:25021811-25034065", "ensembl_id": "ENSG00000004848" } }, "GRch38": { "90": { "location": "X:25003694-25016420", "ensembl_id": "ENSG00000004848" } } }, "hgnc_date_symbol_changed": "2002-02-11" }, "entity_type": "str", "entity_name": "ARX_EIEE1_GCN2", "confidence_level": "3", "penetrance": null, "publications": [ "11889467", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Developmental and epileptic encephalopathy 1 MIM#308350", "Intellectual disability, X-linked 29 and others MIM#300419", "Partington syndrome MIM#309510" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 25031647, 25031682 ], "grch38_coordinates": [ 25013530, 25013565 ], "normal_repeats": 12, "pathogenic_repeats": 20, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ISSX", "CT121", "EIEE1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18060", "gene_name": "aristaless related homeobox", "omim_gene": [ "300382" ], "alias_name": [ "cancer/testis antigen 121" ], "gene_symbol": "ARX", "hgnc_symbol": "ARX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:25021811-25034065", "ensembl_id": "ENSG00000004848" } }, "GRch38": { "90": { "location": "X:25003694-25016420", "ensembl_id": "ENSG00000004848" } } }, "hgnc_date_symbol_changed": "2002-02-11" }, "entity_type": "str", "entity_name": "ARX_EIEE1_GCN1", "confidence_level": "3", "penetrance": null, "publications": [ "11889467", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Developmental and epileptic encephalopathy 1 MIM#308350", "Intellectual disability, X-linked 29 and others MIM#300419", "Partington syndrome MIM#309510" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCN", "chromosome": "X", "grch37_coordinates": [ 25031767, 25031814 ], "grch38_coordinates": [ 25013650, 25013697 ], "normal_repeats": 16, "pathogenic_repeats": 23, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "B37" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3033", "gene_name": "atrophin 1", "omim_gene": [ "607462" ], "alias_name": null, "gene_symbol": "ATN1", "hgnc_symbol": "ATN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:7033626-7051484", "ensembl_id": "ENSG00000111676" } }, "GRch38": { "90": { "location": "12:6924463-6942321", "ensembl_id": "ENSG00000111676" } } }, "hgnc_date_symbol_changed": "2005-03-17" }, "entity_type": "str", "entity_name": "ATN1_DRPLA_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8136840", "8136826", "29325606", "20301664" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Dentatorubral-pallidoluysian atrophy MIM#125370" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 7045892, 7045936 ], "grch38_coordinates": [ 6936729, 6936773 ], "normal_repeats": 35, "pathogenic_repeats": 48, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "D6S504E", "ATX1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10548", "gene_name": "ataxin 1", "omim_gene": [ "601556" ], "alias_name": null, "gene_symbol": "ATXN1", "hgnc_symbol": "ATXN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:16299343-16761722", "ensembl_id": "ENSG00000124788" } }, "GRch38": { "90": { "location": "6:16299112-16761491", "ensembl_id": "ENSG00000124788" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN1_SCA1_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8358429", "29325606", "20301363" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 1 MIM#164400" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 16327918, 16327953 ], "grch38_coordinates": [ 16327687, 16327722 ], "normal_repeats": 35, "pathogenic_repeats": 39, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "E46L", "FLJ37990" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10549", "gene_name": "ataxin 10", "omim_gene": [ "611150" ], "alias_name": null, "gene_symbol": "ATXN10", "hgnc_symbol": "ATXN10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:46067678-46241187", "ensembl_id": "ENSG00000130638" } }, "GRch38": { "90": { "location": "22:45671798-45845307", "ensembl_id": "ENSG00000130638" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "str", "entity_name": "ATXN10_SCA10_ATTCT", "confidence_level": "3", "penetrance": null, "publications": [ "20301354", "11017075" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 10 MIM#603516" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTCT", "chromosome": "22", "grch37_coordinates": [ 46191235, 46191304 ], "grch38_coordinates": [ 45795355, 45795424 ], "normal_repeats": 32, "pathogenic_repeats": 800, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PR55-BETA", "PR52B", "B55beta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9305", "gene_name": "protein phosphatase 2 regulatory subunit Bbeta", "omim_gene": [ "604325" ], "alias_name": [ "PP2A subunit B isoform beta" ], "gene_symbol": "PPP2R2B", "hgnc_symbol": "PPP2R2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:145967936-146464347", "ensembl_id": "ENSG00000156475" } }, "GRch38": { "90": { "location": "5:146581146-147084784", "ensembl_id": "ENSG00000156475" } } }, "hgnc_date_symbol_changed": "1993-01-25" }, "entity_type": "str", "entity_name": "PPP2R2B_SCA12_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "27864267", "33811808", "10581021" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 12 MIM#604326" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "5", "grch37_coordinates": [ 146258292, 146258321 ], "grch38_coordinates": [ 146878729, 146878758 ], "normal_repeats": 32, "pathogenic_repeats": 51, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "TFIID" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11588", "gene_name": "TATA-box binding protein", "omim_gene": [ "600075" ], "alias_name": null, "gene_symbol": "TBP", "hgnc_symbol": "TBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:170863390-170881958", "ensembl_id": "ENSG00000112592" } }, "GRch38": { "90": { "location": "6:170554302-170572870", "ensembl_id": "ENSG00000112592" } } }, "hgnc_date_symbol_changed": "1993-05-26" }, "entity_type": "str", "entity_name": "TBP_SCA17_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "10484774", "20301611", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 17 MIM#607136" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "6", "grch37_coordinates": [ 170870996, 170871109 ], "grch38_coordinates": [ 170561908, 170562021 ], "normal_repeats": 40, "pathogenic_repeats": 49, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10555", "gene_name": "ataxin 2", "omim_gene": [ "601517" ], "alias_name": [ "trinucleotide repeat containing 13" ], "gene_symbol": "ATXN2", "hgnc_symbol": "ATXN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:111890018-112037480", "ensembl_id": "ENSG00000204842" } }, "GRch38": { "90": { "location": "12:111452214-111599676", "ensembl_id": "ENSG00000204842" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN2_SCA2_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8896555", "29325606", "20301452" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 2 MIM#183090" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "12", "grch37_coordinates": [ 112036755, 112036823 ], "grch38_coordinates": [ 111598951, 111599019 ], "normal_repeats": 31, "pathogenic_repeats": 35, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FHF4", "SCA27" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3671", "gene_name": "fibroblast growth factor 14", "omim_gene": [ "601515" ], "alias_name": null, "gene_symbol": "FGF14", "hgnc_symbol": "FGF14", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:102372134-103054124", "ensembl_id": "ENSG00000102466" } }, "GRch38": { "90": { "location": "13:101710804-102402457", "ensembl_id": "ENSG00000102466" } } }, "hgnc_date_symbol_changed": "1996-12-18" }, "entity_type": "str", "entity_name": "FGF14_SCA27B_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "37165652", "36516086", "36493768" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spinocerebellar ataxia type 27B MONDO:0012247", "Spinocerebellar ataxia 50", "late-onset cerebellar ataxias (LOCAs)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GAA", "chromosome": "13", "grch37_coordinates": [ 102813926, 102814076 ], "grch38_coordinates": [ 102161576, 102161726 ], "normal_repeats": 249, "pathogenic_repeats": 300, "tags": [], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ATX3", "JOS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7106", "gene_name": "ataxin 3", "omim_gene": [ "607047" ], "alias_name": null, "gene_symbol": "ATXN3", "hgnc_symbol": "ATXN3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:92524896-92572965", "ensembl_id": "ENSG00000066427" } }, "GRch38": { "90": { "location": "14:92038652-92106621", "ensembl_id": "ENSG00000066427" } } }, "hgnc_date_symbol_changed": "2004-08-13" }, "entity_type": "str", "entity_name": "ATXN3_SCA3_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "7874163", "20301375", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Machado-Joseph disease MIM#109150", "Spinocerebellar ataxia type 3" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "14", "grch37_coordinates": [ 92537355, 92537396 ], "grch38_coordinates": [ 92071011, 92071052 ], "normal_repeats": 44, "pathogenic_repeats": 60, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:24160", "gene_name": "brain expressed associated with NEDD4 1", "omim_gene": [ "612051" ], "alias_name": null, "gene_symbol": "BEAN1", "hgnc_symbol": "BEAN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:66461200-66527432", "ensembl_id": "ENSG00000166546" } }, "GRch38": { "90": { "location": "16:66427297-66493529", "ensembl_id": "ENSG00000166546" } } }, "hgnc_date_symbol_changed": "2010-10-05" }, "entity_type": "str", "entity_name": "BEAN1_SCA31_TGGAA", "confidence_level": "3", "penetrance": null, "publications": [ "19878914", "31755042" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 31 MIM#117210" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TGGAA", "chromosome": "16", "grch37_coordinates": [ 66524301, 66524302 ], "grch38_coordinates": [ 66490398, 66490399 ], "normal_repeats": 22, "pathogenic_repeats": 80, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "SCA36" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15911", "gene_name": "NOP56 ribonucleoprotein", "omim_gene": [ "614154" ], "alias_name": [ "spinocerebellar ataxia 36" ], "gene_symbol": "NOP56", "hgnc_symbol": "NOP56", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:2632791-2639039", "ensembl_id": "ENSG00000101361" } }, "GRch38": { "90": { "location": "20:2652145-2658393", "ensembl_id": "ENSG00000101361" } } }, "hgnc_date_symbol_changed": "2009-01-13" }, "entity_type": "str", "entity_name": "NOP56_SCA36_GGCCTG", "confidence_level": "3", "penetrance": null, "publications": [ "21683323" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 36 MIM#614153" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGCCTG", "chromosome": "20", "grch37_coordinates": [ 2633380, 2633403 ], "grch38_coordinates": [ 2652734, 2652757 ], "normal_repeats": 14, "pathogenic_repeats": 650, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2661", "gene_name": "DAB1, reelin adaptor protein", "omim_gene": [ "603448" ], "alias_name": null, "gene_symbol": "DAB1", "hgnc_symbol": "DAB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:57460451-59012406", "ensembl_id": "ENSG00000173406" } }, "GRch38": { "90": { "location": "1:56994778-58546734", "ensembl_id": "ENSG00000173406" } } }, "hgnc_date_symbol_changed": "1998-06-12" }, "entity_type": "str", "entity_name": "DAB1_SCA37_ATTTC", "confidence_level": "3", "penetrance": null, "publications": [ "28686858", "31145571" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 37 MIM#615945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ATTTC", "chromosome": "1", "grch37_coordinates": [ 57832716, 57832797 ], "grch38_coordinates": [ 57367044, 57367121 ], "normal_repeats": 0, "pathogenic_repeats": 31, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ZNF927" ], "biotype": "protein_coding", "hgnc_id": "HGNC:777", "gene_name": "zinc finger homeobox 3", "omim_gene": [ "104155" ], "alias_name": null, "gene_symbol": "ZFHX3", "hgnc_symbol": "ZFHX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:72816784-73093597", "ensembl_id": "ENSG00000140836" } }, "GRch38": { "90": { "location": "16:72782885-73144447", "ensembl_id": "ENSG00000140836" } } }, "hgnc_date_symbol_changed": "2007-08-09" }, "entity_type": "str", "entity_name": "ZFHX3_SCA4_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "38035881", "38197134" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "spinocerebellar ataxia type 4 MONDO:0010847" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "16", "grch37_coordinates": [ 72821594, 72821657 ], "grch38_coordinates": [ 72787695, 72787758 ], "normal_repeats": 30, "pathogenic_repeats": 48, "tags": [], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Cav2.1", "EA2", "APCA", "HPCA", "FHM" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1388", "gene_name": "calcium voltage-gated channel subunit alpha1 A", "omim_gene": [ "601011" ], "alias_name": null, "gene_symbol": "CACNA1A", "hgnc_symbol": "CACNA1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:13317256-13734804", "ensembl_id": "ENSG00000141837" } }, "GRch38": { "90": { "location": "19:13206442-13633025", "ensembl_id": "ENSG00000141837" } } }, "hgnc_date_symbol_changed": "1996-06-18" }, "entity_type": "str", "entity_name": "CACNA1A_SCA6_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8988170", "20301319", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 6 MIM#183086", "Episodic ataxia, type 2 MIM#108500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "19", "grch37_coordinates": [ 13318673, 13318691 ], "grch38_coordinates": [ 13207859, 13207897 ], "normal_repeats": 18, "pathogenic_repeats": 20, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "OPCA3", "ADCAII" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10560", "gene_name": "ataxin 7", "omim_gene": [ "607640" ], "alias_name": null, "gene_symbol": "ATXN7", "hgnc_symbol": "ATXN7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:63850233-63989138", "ensembl_id": "ENSG00000163635" } }, "GRch38": { "90": { "location": "3:63864557-64003462", "ensembl_id": "ENSG00000163635" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "str", "entity_name": "ATXN7_SCA7_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "8908515", "29325606", "20301433" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 7 MIM#164500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "3", "grch37_coordinates": [ 63898362, 63898391 ], "grch38_coordinates": [ 63912686, 63912715 ], "normal_repeats": 27, "pathogenic_repeats": 37, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NCRNA00003" ], "biotype": "antisense_RNA", "hgnc_id": "HGNC:10561", "gene_name": "ATXN8 opposite strand (non-protein coding)", "omim_gene": [ "603680" ], "alias_name": [ "non-protein coding RNA 3" ], "gene_symbol": "ATXN8OS", "hgnc_symbol": "ATXN8OS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:70681345-70713561", "ensembl_id": "ENSG00000230223" } }, "GRch38": { "90": { "location": "13:70107213-70139429", "ensembl_id": "ENSG00000230223" } } }, "hgnc_date_symbol_changed": "2006-07-18" }, "entity_type": "str", "entity_name": "ATXN8OS_SCA8_CTG", "confidence_level": "3", "penetrance": null, "publications": [ "20301445", "10192387" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 8 MIM#608768" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CTG", "chromosome": "13", "grch37_coordinates": [ 70713486, 70713560 ], "grch38_coordinates": [ 70139354, 70139428 ], "normal_repeats": 50, "pathogenic_repeats": 80, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5136", "gene_name": "homeobox D13", "omim_gene": [ "142989" ], "alias_name": null, "gene_symbol": "HOXD13", "hgnc_symbol": "HOXD13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:176957619-176960666", "ensembl_id": "ENSG00000128714" } }, "GRch38": { "90": { "location": "2:176092891-176095938", "ensembl_id": "ENSG00000128714" } } }, "hgnc_date_symbol_changed": "1991-05-08" }, "entity_type": "str", "entity_name": "HOXD13_SPD1_GCG", "confidence_level": "3", "penetrance": null, "publications": [ "8817328", "33811808", "33533119" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Synpolydactyly 1 MIM#186000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCG", "chromosome": "2", "grch37_coordinates": [ 176957787, 176957831 ], "grch38_coordinates": [ 176093059, 176093103 ], "normal_repeats": 15, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CATCH22" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11592", "gene_name": "T-box 1", "omim_gene": [ "602054" ], "alias_name": null, "gene_symbol": "TBX1", "hgnc_symbol": "TBX1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:19744226-19771116", "ensembl_id": "ENSG00000184058" } }, "GRch38": { "90": { "location": "22:19756703-19783593", "ensembl_id": "ENSG00000184058" } } }, "hgnc_date_symbol_changed": "1997-05-15" }, "entity_type": "str", "entity_name": "TBX1_TOF_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "19948535", "11748311" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Tetralogy of Fallot MIM#187500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "22", "grch37_coordinates": [ 19754285, 19754330 ], "grch38_coordinates": [ 19766762, 19766807 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NSCL2", "TAFII250", "KAT4", "DYT3/TAF1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11535", "gene_name": "TATA-box binding protein associated factor 1", "omim_gene": [ "313650" ], "alias_name": null, "gene_symbol": "TAF1", "hgnc_symbol": "TAF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:70586114-70752224", "ensembl_id": "ENSG00000147133" } }, "GRch38": { "90": { "location": "X:71366239-71532374", "ensembl_id": "ENSG00000147133" } } }, "hgnc_date_symbol_changed": "2001-12-07" }, "entity_type": "str", "entity_name": "TAF1_XDP_CCCTCT", "confidence_level": "3", "penetrance": null, "publications": [ "17273961", "29229810" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Dystonia-Parkinsonism, X-linked MIM#314250" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "CCCTCT", "chromosome": "X", "grch37_coordinates": [ 70672905, 70672979 ], "grch38_coordinates": [ 71453055, 71453129 ], "normal_repeats": 13, "pathogenic_repeats": 30, "tags": [ "founder", "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "A1", "PO-GA", "RFC140", "MHCBFB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9969", "gene_name": "replication factor C subunit 1", "omim_gene": [ "102579" ], "alias_name": null, "gene_symbol": "RFC1", "hgnc_symbol": "RFC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:39289076-39367995", "ensembl_id": "ENSG00000035928" } }, "GRch38": { "90": { "location": "4:39287456-39366375", "ensembl_id": "ENSG00000035928" } } }, "hgnc_date_symbol_changed": "1994-10-14" }, "entity_type": "str", "entity_name": "RFC1_CANVAS_ANNGN", "confidence_level": "3", "penetrance": null, "publications": [ "30926972", "32851396", "33237689", "31230722", "33237689", "32694621", "33103729", "35355059" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "ANNGN", "chromosome": "4", "grch37_coordinates": [ 39350045, 39350103 ], "grch38_coordinates": [ 39348425, 39348483 ], "normal_repeats": 0, "pathogenic_repeats": 400, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "ST7", "FLJ12929" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31708", "gene_name": "LDL receptor related protein 12", "omim_gene": null, "alias_name": null, "gene_symbol": "LRP12", "hgnc_symbol": "LRP12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:105501459-105601252", "ensembl_id": "ENSG00000147650" } }, "GRch38": { "90": { "location": "8:104489231-104589024", "ensembl_id": "ENSG00000147650" } } }, "hgnc_date_symbol_changed": "2004-07-06" }, "entity_type": "str", "entity_name": "LRP12_OPDM1_CGG", "confidence_level": "3", "penetrance": null, "publications": [ "31332380", "34047774", "37339631" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Oculopharyngodistal myopathy 1 MIM#164310", "Amyotrophic lateral sclerosis MONDO:0004976" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "8", "grch37_coordinates": [ 105601201, 105601227 ], "grch38_coordinates": [ 104588973, 104588999 ], "normal_repeats": 45, "pathogenic_repeats": 85, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "AIS", "NR3C4", "SMAX1", "HUMARA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:644", "gene_name": "androgen receptor", "omim_gene": [ "313700" ], "alias_name": [ "testicular feminization", "Kennedy disease" ], "gene_symbol": "AR", "hgnc_symbol": "AR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:66764465-66950461", "ensembl_id": "ENSG00000169083" } }, "GRch38": { "90": { "location": "X:67544032-67730619", "ensembl_id": "ENSG00000169083" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "AR_SBMA_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "2062380", "20301508", "29325606" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinal and bulbar muscular atrophy of Kennedy MIM#313200" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "CAG", "chromosome": "X", "grch37_coordinates": [ 66765160, 66765225 ], "grch38_coordinates": [ 67545318, 67545383 ], "normal_repeats": 34, "pathogenic_repeats": 38, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "AML3", "PEBP2A1", "PEBP2aA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10472", "gene_name": "runt related transcription factor 2", "omim_gene": [ "600211" ], "alias_name": null, "gene_symbol": "RUNX2", "hgnc_symbol": "RUNX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:45295894-45632086", "ensembl_id": "ENSG00000124813" } }, "GRch38": { "90": { "location": "6:45328157-45664349", "ensembl_id": "ENSG00000124813" } } }, "hgnc_date_symbol_changed": "1994-11-02" }, "entity_type": "str", "entity_name": "RUNX2_CCD_GCN", "confidence_level": "2", "penetrance": null, "publications": [ "9182765", "33811808", "20560987", "26220009", "25852448" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Cleidocranial dysplasia MIM#119600" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "6", "grch37_coordinates": [ 45390488, 45390538 ], "grch38_coordinates": [ 45422751, 45422801 ], "normal_repeats": 18, "pathogenic_repeats": 20, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "BMD", "DXS142", "DXS164", "DXS206", "DXS230", "DXS239", "DXS268", "DXS269", "DXS270", "DXS272" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2928", "gene_name": "dystrophin", "omim_gene": [ "300377" ], "alias_name": [ "muscular dystrophy, Duchenne and Becker types" ], "gene_symbol": "DMD", "hgnc_symbol": "DMD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:31115794-33357558", "ensembl_id": "ENSG00000198947" } }, "GRch38": { "90": { "location": "X:31097677-33339441", "ensembl_id": "ENSG00000198947" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "DMD_DMD_GAA", "confidence_level": "2", "penetrance": null, "publications": [ "27417533", "36048237" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Duchenne muscular dystrophy MIM#310200", "Becker muscular dystrophy MIM#300376" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "repeated_sequence": "GAA", "chromosome": "X", "grch37_coordinates": [ 31302674, 31302722 ], "grch38_coordinates": [ 31284557, 31284605 ], "normal_repeats": 33, "pathogenic_repeats": 59, "tags": [ "adult-onset", "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "PDZ-GEF1", "RA-GEF", "DKFZP586O1422", "KIAA0313" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16854", "gene_name": "Rap guanine nucleotide exchange factor 2", "omim_gene": [ "609530" ], "alias_name": [ "Rap GEP" ], "gene_symbol": "RAPGEF2", "hgnc_symbol": "RAPGEF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:160025330-160281321", "ensembl_id": "ENSG00000109756" } }, "GRch38": { "90": { "location": "4:159104178-159360169", "ensembl_id": "ENSG00000109756" } } }, "hgnc_date_symbol_changed": "2004-03-01" }, "entity_type": "str", "entity_name": "RAPGEF2_FAME7_TTTCA", "confidence_level": "2", "penetrance": null, "publications": [ "29507423", "30351492", "33791773" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 7 MIM#618075" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "4", "grch37_coordinates": [ 160263679, 160263768 ], "grch38_coordinates": [ 159342527, 159342616 ], "normal_repeats": 0, "pathogenic_repeats": 1, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA1463", "FLJ34278" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29284", "gene_name": "disco interacting protein 2 homolog B", "omim_gene": [ "611379" ], "alias_name": null, "gene_symbol": "DIP2B", "hgnc_symbol": "DIP2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:50898768-51142450", "ensembl_id": "ENSG00000066084" } }, "GRch38": { "90": { "location": "12:50504985-50748667", "ensembl_id": "ENSG00000066084" } } }, "hgnc_date_symbol_changed": "2006-01-13" }, "entity_type": "str", "entity_name": "DIP2B_FRA12A_CGG", "confidence_level": "2", "penetrance": null, "publications": [ "17236128", "33510257", "39854091", "41028987" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "intellectual disability, FRA12A type MONDO:0007634" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "12", "grch37_coordinates": [ 50898787, 50898807 ], "grch38_coordinates": [ 50505004, 50505024 ], "normal_repeats": 23, "pathogenic_repeats": 280, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MLLT2-like" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6473", "gene_name": "AF4/FMR2 family member 3", "omim_gene": [ "601464" ], "alias_name": null, "gene_symbol": "AFF3", "hgnc_symbol": "AFF3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:100162323-100759201", "ensembl_id": "ENSG00000144218" } }, "GRch38": { "90": { "location": "2:99545419-100142739", "ensembl_id": "ENSG00000144218" } } }, "hgnc_date_symbol_changed": "2005-06-27" }, "entity_type": "str", "entity_name": "AFF3_FRA2A_CGG", "confidence_level": "2", "penetrance": null, "publications": [ "24763282", "39313615", "33510257" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Neurodevelopmental delay" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "2", "grch37_coordinates": [ 100721262, 100721285 ], "grch38_coordinates": [ 100104800, 100104823 ], "normal_repeats": 20, "pathogenic_repeats": 300, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ39963" ], "biotype": "protein_coding", "hgnc_id": "HGNC:22043", "gene_name": "zinc finger protein 713", "omim_gene": [ "616181" ], "alias_name": null, "gene_symbol": "ZNF713", "hgnc_symbol": "ZNF713", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:55955169-56009918", "ensembl_id": "ENSG00000178665" } }, "GRch38": { "90": { "location": "7:55887475-55942225", "ensembl_id": "ENSG00000178665" } } }, "hgnc_date_symbol_changed": "2006-01-20" }, "entity_type": "str", "entity_name": "ZNF713_FRA7A_CGG", "confidence_level": "2", "penetrance": null, "publications": [ "25196122" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Autism spectrum disorder" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CGG", "chromosome": "7", "grch37_coordinates": [ 55955295, 55955330 ], "grch38_coordinates": [ 55887602, 55887637 ], "normal_repeats": 22, "pathogenic_repeats": 450, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ39458" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31750", "gene_name": "sterile alpha motif domain containing 12", "omim_gene": null, "alias_name": null, "gene_symbol": "SAMD12", "hgnc_symbol": "SAMD12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:119201698-119634234", "ensembl_id": "ENSG00000177570" } }, "GRch38": { "90": { "location": "8:118189459-118621995", "ensembl_id": "ENSG00000177570" } } }, "hgnc_date_symbol_changed": "2004-07-15" }, "entity_type": "str", "entity_name": "SAMD12_FAME1_TTTGA", "confidence_level": "1", "penetrance": null, "publications": [ "31483537" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "familial cortical myoclonic tremor with epilepsy" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTGA", "chromosome": "8", "grch37_coordinates": [ 119379055, 119379157 ], "grch38_coordinates": [ 118366816, 118366918 ], "normal_repeats": 0, "pathogenic_repeats": 100, "tags": [], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ10201", "FLJ12841", "FLJ13308", "KIAA1197" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25489", "gene_name": "YEATS domain containing 2", "omim_gene": [ "613373" ], "alias_name": null, "gene_symbol": "YEATS2", "hgnc_symbol": "YEATS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:183415606-183530413", "ensembl_id": "ENSG00000163872" } }, "GRch38": { "90": { "location": "3:183697818-183812625", "ensembl_id": "ENSG00000163872" } } }, "hgnc_date_symbol_changed": "2004-08-18" }, "entity_type": "str", "entity_name": "YEATS2_FAME4_TTTCA", "confidence_level": "1", "penetrance": null, "publications": [ "31539032" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Epilepsy, myoclonic, familial adult, 4 MIM#615127" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "3", "grch37_coordinates": [ 183429976, 183430010 ], "grch38_coordinates": [ 183712188, 183712222 ], "normal_repeats": 0, "pathogenic_repeats": 192, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "CAGH26", "KIAA1460", "GW182" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11969", "gene_name": "trinucleotide repeat containing 6A", "omim_gene": [ "610739" ], "alias_name": null, "gene_symbol": "TNRC6A", "hgnc_symbol": "TNRC6A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:24741016-24838953", "ensembl_id": "ENSG00000090905" } }, "GRch38": { "90": { "location": "16:24610209-24827632", "ensembl_id": "ENSG00000090905" } } }, "hgnc_date_symbol_changed": "2004-12-17" }, "entity_type": "str", "entity_name": "TNRC6A_FAME6_TTTCA", "confidence_level": "1", "penetrance": null, "publications": [ "29507423" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Epilepsy, familial adult myoclonic, 6 MIM#618074" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "TTTCA", "chromosome": "16", "grch37_coordinates": [ 24624761, 24624850 ], "grch38_coordinates": [ 24613440, 24613529 ], "normal_repeats": 0, "pathogenic_repeats": 1, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FLJ22531", "TOPOVIBL" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26197", "gene_name": "chromosome 11 open reading frame 80", "omim_gene": [ "616109" ], "alias_name": null, "gene_symbol": "C11orf80", "hgnc_symbol": "C11orf80", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:66511922-66610987", "ensembl_id": "ENSG00000173715" } }, "GRch38": { "90": { "location": "11:66744451-66843328", "ensembl_id": "ENSG00000173715" } } }, "hgnc_date_symbol_changed": "2007-03-13" }, "entity_type": "str", "entity_name": "C11orf80_FRA11A_CGG", "confidence_level": "1", "penetrance": null, "publications": [ "18160775", "453198" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Intellectual disability" ], "mode_of_inheritance": "Unknown", "repeated_sequence": "CGG", "chromosome": "11", "grch37_coordinates": [ 66512291, 66512316 ], "grch38_coordinates": [ 66744820, 66744845 ], "normal_repeats": 11, "pathogenic_repeats": 500, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "RNF55", "c-Cbl" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1541", "gene_name": "Cbl proto-oncogene", "omim_gene": [ "165360" ], "alias_name": [ "oncogene CBL2" ], "gene_symbol": "CBL", "hgnc_symbol": "CBL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:119076752-119178859", "ensembl_id": "ENSG00000110395" } }, "GRch38": { "90": { "location": "11:119206276-119313926", "ensembl_id": "ENSG00000110395" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "str", "entity_name": "CBL_FRA11B_CCG", "confidence_level": "1", "penetrance": null, "publications": [ "7881408", "7603564", "9508241", "9927483", "10767345", "11076037", "19267933" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Jacobsen syndrome MIM#147791" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCG", "chromosome": "11", "grch37_coordinates": [ 119076999, 119077032 ], "grch38_coordinates": [ 119206289, 119206322 ], "normal_repeats": 79, "pathogenic_repeats": 101, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FRAXF" ], "biotype": null, "hgnc_id": "HGNC:17125", "gene_name": "transmembrane protein 185A", "omim_gene": [ "300031" ], "alias_name": null, "gene_symbol": "TMEM185A", "hgnc_symbol": "TMEM185A", "hgnc_release": "2017-11-03", "ensembl_genes": {}, "hgnc_date_symbol_changed": "2007-02-05" }, "entity_type": "str", "entity_name": "TMEM185A_FRAXF_GCC", "confidence_level": "1", "penetrance": null, "publications": [ "7874164", "10094554", "8651274" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Intellectual disability" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCC", "chromosome": "X", "grch37_coordinates": [ 148713390, 148713437 ], "grch38_coordinates": [ 149631714, 149631781 ], "normal_repeats": 29, "pathogenic_repeats": 900, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "MGC35570" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17043", "gene_name": "non imprinted in Prader-Willi/Angelman syndrome 1", "omim_gene": [ "608145" ], "alias_name": null, "gene_symbol": "NIPA1", "hgnc_symbol": "NIPA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:23043277-23100005", "ensembl_id": "ENSG00000170113" } }, "GRch38": { "90": { "location": "15:22773063-22829791", "ensembl_id": "ENSG00000170113" } } }, "hgnc_date_symbol_changed": "2004-01-23" }, "entity_type": "str", "entity_name": "NIPA1_ALS_GCG", "confidence_level": "1", "penetrance": null, "publications": [ "30342764", "22378146" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Amyotrophic lateral sclerosis" ], "mode_of_inheritance": "Unknown", "repeated_sequence": "GCG", "chromosome": "15", "grch37_coordinates": [ 23086366, 23086390 ], "grch38_coordinates": [ 22786677, 22786701 ], "normal_repeats": 8, "pathogenic_repeats": 9, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "antisense_RNA", "hgnc_id": "HGNC:51204", "gene_name": "NUTM2B antisense RNA 1", "omim_gene": null, "alias_name": null, "gene_symbol": "NUTM2B-AS1", "hgnc_symbol": "NUTM2B-AS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:81563813-81586350", "ensembl_id": "ENSG00000225484" } }, "GRch38": { "90": { "location": "10:79663088-79826594", "ensembl_id": "ENSG00000225484" } } }, "hgnc_date_symbol_changed": "2014-08-07" }, "entity_type": "str", "entity_name": "NUTM2B-AS1_OPDM_CCG", "confidence_level": "3", "penetrance": null, "publications": [ "31332380" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CCG", "chromosome": "10", "grch37_coordinates": [ 81586142, 81586159 ], "grch38_coordinates": [ 79826386, 79826403 ], "normal_repeats": 16, "pathogenic_repeats": 35, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HTX", "ZNF203" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12874", "gene_name": "Zic family member 3", "omim_gene": [ "300265" ], "alias_name": null, "gene_symbol": "ZIC3", "hgnc_symbol": "ZIC3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:136648301-136659850", "ensembl_id": "ENSG00000156925" } }, "GRch38": { "90": { "location": "X:137566142-137577691", "ensembl_id": "ENSG00000156925" } } }, "hgnc_date_symbol_changed": "1993-11-16" }, "entity_type": "str", "entity_name": "ZIC3_VACTERLX_GCC", "confidence_level": "1", "penetrance": null, "publications": [ "20452998", "32639022" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "VACTERL association, X-linked MIM#314390" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "repeated_sequence": "GCC", "chromosome": "X", "grch37_coordinates": [ 136648986, 136649015 ], "grch38_coordinates": [ 137566827, 137566856 ], "normal_repeats": 10, "pathogenic_repeats": 11, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 12, "pathogenic_repeats": 14, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5136", "gene_name": "homeobox D13", "omim_gene": [ "142989" ], "alias_name": null, "gene_symbol": "HOXD13", "hgnc_symbol": "HOXD13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:176957619-176960666", "ensembl_id": "ENSG00000128714" } }, "GRch38": { "90": { "location": "2:176092891-176095938", "ensembl_id": "ENSG00000128714" } } }, "hgnc_date_symbol_changed": "1991-05-08" }, "entity_type": "str", "entity_name": "HOXD13_SPD1_GCG", "confidence_level": "3", "penetrance": null, "publications": [ "8817328", "33811808", "33533119" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Synpolydactyly 1 MIM#186000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCG", "chromosome": "2", "grch37_coordinates": [ 176957787, 176957831 ], "grch38_coordinates": [ 176093059, 176093103 ], "normal_repeats": 15, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 3729, "hash_id": null, "name": "Hand and foot malformations", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel contains non-syndromic and syndromic causes of hand and foot malformations, including: brachydactyly, syndactyly, clinodactyly, ectrodactyly, and oligodactyly. Genes that cause polydactyly and synpolydactyly are excluded and can be found on the Polydactyly panel.", "status": "public", "version": "0.85", "version_created": "2026-03-26T15:53:21.747538+11:00", "relevant_disorders": [ "Abnormal hand morphology", "HP:0005922; Abnormal foot morphology", "HP:0001760" ], "stats": { "number_of_genes": 101, "number_of_strs": 1, "number_of_regions": 4 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "HPE5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12873", "gene_name": "Zic family member 2", "omim_gene": [ "603073" ], "alias_name": [ "Zinc finger protein of the cerebellum 2" ], "gene_symbol": "ZIC2", "hgnc_symbol": "ZIC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:100634026-100639018", "ensembl_id": "ENSG00000043355" } }, "GRch38": { "90": { "location": "13:99981772-99986773", "ensembl_id": "ENSG00000043355" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "str", "entity_name": "ZIC2_HPE5_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11285244", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Holoprosencephaly 5 MIM#609637" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "13", "grch37_coordinates": [ 100637703, 100637747 ], "grch38_coordinates": [ 99985449, 99985493 ], "normal_repeats": 15, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Phox2b", "NBPhox" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9143", "gene_name": "paired like homeobox 2b", "omim_gene": [ "603851" ], "alias_name": null, "gene_symbol": "PHOX2B", "hgnc_symbol": "PHOX2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:41746099-41750987", "ensembl_id": "ENSG00000109132" } }, "GRch38": { "90": { "location": "4:41744082-41748970", "ensembl_id": "ENSG00000109132" } } }, "hgnc_date_symbol_changed": "2003-02-14" }, "entity_type": "str", "entity_name": "PHOX2B_CCHS_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12640453", "34012823", "20301600", "18798833" ], "evidence": [ "Expert list", "Expert Review Green", "Expert list" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "4", "grch37_coordinates": [ 41747989, 41748048 ], "grch38_coordinates": [ 41745972, 41746031 ], "normal_repeats": 20, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0838", "GLS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4331", "gene_name": "glutaminase", "omim_gene": [ "138280" ], "alias_name": null, "gene_symbol": "GLS", "hgnc_symbol": "GLS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:191745553-191830278", "ensembl_id": "ENSG00000115419" } }, "GRch38": { "90": { "location": "2:190880827-190965552", "ensembl_id": "ENSG00000115419" } } }, "hgnc_date_symbol_changed": "1989-02-07" }, "entity_type": "str", "entity_name": "GLS_GDPAG_GCA", "confidence_level": "3", "penetrance": null, "publications": [ "30970188" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCA", "chromosome": "2", "grch37_coordinates": [ 191745599, 191745646 ], "grch38_coordinates": [ 190880873, 190880920 ], "normal_repeats": 16, "pathogenic_repeats": 400, "tags": [], "panel": { "id": 3929, "hash_id": null, "name": "Aminoacidopathy", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes associated with inborn errors in the metabolism of amino acids. It has been aligned with the classifications by the ClinGen Aminoacidopathy GCEP.\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.143", "version_created": "2026-04-01T10:30:06.755640+11:00", "relevant_disorders": [ "Abnormality of amino acid metabolism", "HP:0004337" ], "stats": { "number_of_genes": 134, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } } ] }