Ataxia - adult onset
STR: PRNP_CJD_octapeptide
NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: LiteratureCreated: 25 Apr 2025, 1:27 p.m.
Mode of inheritance
MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes
Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Publications
Variants in this STR are reported as part of current diagnostic practice
Clinically RelevantInterruptions in the repeated sequence are reported as part of standard diagnostic practise
Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
STR: PRNP_CJD_octapeptide was added STR: PRNP_CJD_octapeptide was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407 Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP_CJD_octapeptide was set to GREEN STR: PRNP_CJD_octapeptide was marked as clinically relevant STR: PRNP_CJD_octapeptide was marked as current diagnostic