Activity

Filter

Cancel
Date Panel Item Activity
15 actions
Pierre Robin Sequence v1.0 EIF4A3_RCPS_complex STR EIF4A3_RCPS_complex: gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Pierre Robin Sequence v1.0 EIF4A3 Gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.48 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Pierre Robin Sequence. Sources: Literature
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Pierre Robin Sequence v0.41 EIF4A3 Zornitza Stark Tag STR tag was added to gene: EIF4A3.
Pierre Robin Sequence v0.35 EIF4A3 Zornitza Stark Marked gene: EIF4A3 as ready
Pierre Robin Sequence v0.35 EIF4A3 Zornitza Stark Gene: eif4a3 has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.35 EIF4A3 Zornitza Stark Phenotypes for gene: EIF4A3 were changed from to Robin sequence with cleft mandible and limb anomalies, MIM# 268305; Richieri-Costa-Pereira syndrome
Pierre Robin Sequence v0.34 EIF4A3 Zornitza Stark Publications for gene: EIF4A3 were set to
Pierre Robin Sequence v0.33 EIF4A3 Zornitza Stark Mode of inheritance for gene: EIF4A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Pierre Robin Sequence v0.32 EIF4A3 Zornitza Stark reviewed gene: EIF4A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360810; Phenotypes: Robin sequence with cleft mandible and limb anomalies, MIM# 268305, Richieri-Costa-Pereira syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Pierre Robin Sequence v0.0 EIF4A3 Zornitza Stark gene: EIF4A3 was added
gene: EIF4A3 was added to Pierre Robin sequence _VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EIF4A3 was set to Unknown