| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Ataxia - adult onset v1.52 | PRDX3 | Zornitza Stark Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.49 | THAP11_SCA51_CAG |
Bryony Thompson changed review comment from: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual. A 46/29 CAG THAP11 genotype has also been identified in an individual with ataxia of European ancestry, that also had a CACNA1A pathogenic expansion which causes SCA6. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease. Further probands/families are required to confirm the gene-disease association. Sources: Literature; to: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual and the number of CAA interruptions had been reduced from 5/6 to 3. Expanded alleles have been identified in individuals with neurodevelopmental phenotypes, other neurodegenerative phenotypes, and an individual with ataxia who also had a CACNA1A (SCA6) pathogenic expansion. However, all these individuals had 5/6 CAA interruptions instead of 3 that were reported in the initial Chinese families. Suggesting the number of CAA interruptions is associated with pathogenicity of the repeat expansion. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease. Further probands/families are required to confirm the gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.47 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to autosomal dominant cerebellar ataxia MONDO:0020380 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.45 | THAP11_SCA51_CAG |
Bryony Thompson STR: THAP11_SCA51_CAG was added STR: THAP11_SCA51_CAG was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for STR: THAP11_SCA51_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319 Phenotypes for STR: THAP11_SCA51_CAG were set to Spinocerebellar ataxia 51, MIM# 620947 Review for STR: THAP11_SCA51_CAG was set to AMBER Added comment: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual. A 46/29 CAG THAP11 genotype has also been identified in an individual with ataxia of European ancestry, that also had a CACNA1A pathogenic expansion which causes SCA6. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease. Further probands/families are required to confirm the gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.25 | PRNP_CJD_octapeptide |
Bryony Thompson STR: PRNP_CJD_octapeptide was added STR: PRNP_CJD_octapeptide was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407 Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP_CJD_octapeptide was set to GREEN STR: PRNP_CJD_octapeptide was marked as clinically relevant STR: PRNP_CJD_octapeptide was marked as current diagnostic Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.19 | SPTAN1 |
Bryony Thompson gene: SPTAN1 was added gene: SPTAN1 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: SPTAN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SPTAN1 were set to 36331550 Phenotypes for gene: SPTAN1 were set to Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813 Mode of pathogenicity for gene: SPTAN1 was set to Other Review for gene: SPTAN1 was set to GREEN gene: SPTAN1 was marked as current diagnostic Added comment: 15/31 individuals from 26 unrelated families carrying heterozygous variants in SPTAN1 manifested ataxia, usually with HSP. There were 2 patients with pure ataxia. Suggested that the mechanism of disease for these heterozygous variants was suspected to be dominant negative. Variable age of onset from paediatric to adult onset. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.17 | RFC1 | Bryony Thompson Added comment: Comment on list classification: At least 9 families reported with a LoF variant compound het with an expanded allele | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.12 | FDXR | Zornitza Stark changed review comment from: Multiple reports of individuals with extra-ocular features, including ID and regression; microcephaly. Ataxia reported in multiple individuals.; to: Multiple reports of individuals with extra-ocular features, including ID and regression; microcephaly. Ataxia reported in multiple individuals, though largely paediatric. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.12 | FDXR | Zornitza Stark edited their review of gene: FDXR: Added comment: Multiple reports of individuals with extra-ocular features, including ID and regression; microcephaly. Ataxia reported in multiple individuals.; Changed rating: AMBER; Changed publications: 30250212, 28965846, 29040572, 33348459, 37046037, 37481223; Changed phenotypes: Auditory neuropathy and optic atrophy, MIM#617717, Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.11 | TUBA4A |
Bryony Thompson gene: TUBA4A was added gene: TUBA4A was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: TUBA4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TUBA4A were set to 38884572; 37418012 Phenotypes for gene: TUBA4A were set to Hereditary ataxia MONDO:0100309, TUBA4A-related Review for gene: TUBA4A was set to GREEN Added comment: PMID: 38884572 - Multicentre cohort of 12 patients from 11 unrelated families presenting with ataxia age of onset 2-60 yrs (9 different missense variants). Spasticity was present in 7/12, 58.3%, cognitive decline in 4/12, 33,3%, and amyotrophy or upper limb muscular weakness in 2/12, 16.6%. 2 patients with p.Pro173Arg also had learning disabilities. 5 cases were confirmed de novo for the variants. Enrichment of rare missense in an ataxia cohort from UK 100k genomes - 6/1103 cases vs 2/20,904 controls, OR = 57.0847 [10.2- 576.7], p = 4.02e-7. Cultured fibroblasts from 3 patients harbouring distinct TUBA4A missense showed significant alterations in microtubule organisation and dynamics, suggestive of a dominant negative mechanism of disease. PMID: 37418012 - 2 Italian spastic ataxia families with p.Glu415Lys, one family segregating the variant in 11 affected individuals and one de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.9 | CHCHD10 |
Bryony Thompson gene: CHCHD10 was added gene: CHCHD10 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: CHCHD10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHCHD10 were set to 24934289 Phenotypes for gene: CHCHD10 were set to autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532 Review for gene: CHCHD10 was set to RED Added comment: A single family with ataxia as a feature of the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.7 | SCA4_ZFHX3_GGC |
Bryony Thompson STR: SCA4_ZFHX3_GGC was added STR: SCA4_ZFHX3_GGC was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for STR: SCA4_ZFHX3_GGC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA4_ZFHX3_GGC were set to 38035881; 38197134 Phenotypes for STR: SCA4_ZFHX3_GGC were set to spinocerebellar ataxia type 4 MONDO:0010847 Review for STR: SCA4_ZFHX3_GGC was set to GREEN STR: SCA4_ZFHX3_GGC was marked as clinically relevant Added comment: PMID: 38035881 - repeat expansion is identified in 5 Swedish ataxia families that developed balance and gait disturbances at 15 to 60 years of age and had sensory neuropathy and slow saccades. PMID: 38197134 - Poly-glycine GGC expansion in the last coding exon of ZFHX3 was identified in the original SCA4 Utah pedigree (Swedish origin) in the region of high linkage identified on 16q22. The expansion was also identified in an Iowa ataxia pedigree of Swedish ancestry. The expansion wasn’t identified in 11,258 exomes, 7,650 WGS probands without neurological phenotype, or 803 individuals with ataxia. Grch38 chr16:72787695–72787758 Normal allele <30 repeats, 21 repeats is the most common (derived from 33,094 individuals) Undefined pathogenic 30-48 repeats Definitive pathogenicity 48+ repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.5 | COQ4 |
Zornitza Stark gene: COQ4 was added gene: COQ4 was added to Ataxia - adult onset. Sources: Expert Review Mode of inheritance for gene: COQ4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COQ4 were set to 36047608; 38014483; 38013626 Phenotypes for gene: COQ4 were set to Spastic ataxia 10, autosomal recessive, MIM# 620666 Review for gene: COQ4 was set to GREEN Added comment: PMIDs 36047608;38014483;38013626: more than 10 families reported with more limited spastic ataxia phenotype, onset from infancy to adulthood. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.3 | SCA27B |
Bryony Thompson STR: SCA27B was added STR: SCA27B was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for STR: SCA27B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA27B were set to 37165652; 36516086; 36493768 Phenotypes for STR: SCA27B were set to Spinocerebellar ataxia type 27B MONDO:0012247; Spinocerebellar ataxia 50; late-onset cerebellar ataxias (LOCAs) Review for STR: SCA27B was set to GREEN STR: SCA27B was marked as clinically relevant Added comment: NM_175929.3(FGF14):c.208+239747CTT[X] Expansions of 250 or more GAA repeat units were associated with late-onset cerebellar ataxia in a French-Canadian (OR: 105.60 [95% CI=31.09-334.20], p<0.001) and a German (OR: 8.76 [95% CI=3.45-20.84], p<0.001) case-control series. Additionally, expanded alleles greater than (GAA)332 are pathogenic and fully penetrant in a combined Australian and German dataset (p = 6.0 × 10−8, OR = 72 [95% CI = 4.3–1,227]). Whereas, alleles in the range of (GAA)250-334 are likely to be pathogenic with reduced penetrance (p = 0.0015, OR = 3.6 [95% CI = 1.6–7.9]). 250-300 repeats in the incompletely penetrant range >300 is fully penetrant for ataxia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.1 | NPTX1 |
Ain Roesley gene: NPTX1 was added gene: NPTX1 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: NPTX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NPTX1 were set to 34788392; 35288776; 35285082; 35560436 Phenotypes for gene: NPTX1 were set to cerebellar ataxia MONDO#0000437, NPTX1-related Review for gene: NPTX1 was set to GREEN gene: NPTX1 was marked as current diagnostic Added comment: PMID:34788392 5 families with multigenerational segregations - late onset ataxia 4 families with p.(Gly389Arg) + 1x p.(Glu327Gly) functional studies done Note: case report of a family member published elsewhere (PMID:35288776) PMID:35285082 1x de novo in a male with late-onset, slowly progressive cerebellar ataxia, oculomotor apraxia, choreiform dyskinesias, and cerebellar cognitive affective syndrome p.(Arg143Leu) PMID:35560436 1x de novo in a female with early-onset ataxia and cerebellar atrophy since infancy p.(Gln370Arg) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.174 | NPC1 |
Bryony Thompson gene: NPC1 was added gene: NPC1 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: NPC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NPC1 were set to 10480349; 17003072; 25497598; 33228797 Phenotypes for gene: NPC1 were set to Niemann-Pick disease, type C1 MONDO:0009757; ataxia Review for gene: NPC1 was set to GREEN gene: NPC1 was marked as current diagnostic Added comment: Ataxia can be a prominent and presenting feature of Niemann-Pick disease. Both paediatric and adult-onset ataxia has been reported with high prevalence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.165 | CWH43 |
Anna Le Fevre gene: CWH43 was added gene: CWH43 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: CWH43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CWH43 were set to PMID: 33459505; 34380733 Phenotypes for gene: CWH43 were set to normal pressure hydrocephalus Penetrance for gene: CWH43 were set to Incomplete Review for gene: CWH43 was set to AMBER Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.164 | PNPT1 |
Zornitza Stark gene: PNPT1 was added gene: PNPT1 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: PNPT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PNPT1 were set to 35411967 Phenotypes for gene: PNPT1 were set to Spinocerebellar ataxia 25, MIM# 608703 Review for gene: PNPT1 was set to AMBER Added comment: Three families reported with heterozygous variants and SCA25. Incomplete penetrance in one of the families. In the third family, the variant was inherited from an asymptomatic 80+ year old. Note bi-allelic variants in this gene cause a mitochondrial disorder. Exact mechanism through which mono-allelic variants cause SCA25 not elucidated: authors speculate abnormal accumulation of mitochondrial RNA with subsequent leakage into the cytosol that may trigger a type 1 interferon response leading to neuroinflammation with neuronal dysfunction or neuronal loss. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.151 | ATP13A2 |
Bryony Thompson gene: ATP13A2 was added gene: ATP13A2 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: ATP13A2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATP13A2 were set to 21362476; 21696388; 31588715; 32559632; 33033738; 33091395; 34405108 Phenotypes for gene: ATP13A2 were set to Kufor-Rakeb syndrome MIM#606693 Review for gene: ATP13A2 was set to GREEN Added comment: At least 3 families with ataxia as a feature of the condition. Mainly adult-onset ataxia. Also, a Tibetan terrier with a homozygous frameshift variant had cerebellar ataxia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.147 | CHP1 |
Chirag Patel gene: CHP1 was added gene: CHP1 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: CHP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHP1 were set to PMID: 29379881, 32787936 Phenotypes for gene: CHP1 were set to Spastic ataxia 9, autosomal recessive, OMIM #618438 Review for gene: CHP1 was set to GREEN Added comment: 2 different consanguineous families with 2 affected siblings with ataxia (1 paediatric onset, 1 adult onset). 3 of the patients had cerebellar atrophy. WES identified homozygous variants in CHP1 gene in both families (K19del and Arg91Cys), which segregated with the disorder in the family. Decreased CHP1 protein on IHC of cerebellar tissue in family with Arg91Cys variant. In vitro functional expression studies in HEK293 cells showed that the K19del mutation resulted in decreased protein expression, with normal levels of transcript, suggesting defects in protein stability. The mutant protein formed massive protein aggregates in transfected neuronal cell bodies and neurite-like projections, whereas the wildtype protein showed a more uniform distribution. The mutant protein altered CHP1 association into functional complexes and impaired membrane localization of the Na+/H+ transporter NHE1. The findings indicated that the CHP1 mutation likely causes ataxia in an NHE1-dependent manner, resembling the mechanism observed in the Chp1 vacillator mutant mouse. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.143 | PRPS1 |
Chern Lim edited their review of gene: PRPS1: Added comment: PMID: 25491489: Heterozygous missense variant, loss of function - PRS enzyme deficiency showed. Proband and her mother have various degrees of ataxia (examinations at 34yrs and 70yrs, respectively), peripheral neuropathy and hearing loss beyond the ophthalmological symptoms, whereas the phenotype of the affected older sister (36yo) is currently confined to the eye and milder.; Changed publications: 33898739, 28967191, 25491489 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.141 | PRPS1 |
Chern Lim commented on gene: PRPS1: PMID: 28967191 in one of the families, heterozygous variants in proband with hearing loss and ataxia developed in the proband in her forties, and ocular manifestations of retinal changes and disc pallor were first confirmed in the two affected daughters in their twenties. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.141 | PRPS1 |
Chern Lim gene: PRPS1 was added gene: PRPS1 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: PRPS1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: PRPS1 were set to PMID: 33898739 Phenotypes for gene: PRPS1 were set to Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy Review for gene: PRPS1 was set to AMBER gene: PRPS1 was marked as current diagnostic Added comment: PMID: 33898739: Heterozygous de novo missense variant in a 30yo female individual, presented with a 5-year history of progressive ataxia. She also had congenital strabismus, infantile-onset hearing loss, and a retinal dystrophy with progressive visual loss for the past 10 years. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.139 | SCA12 |
Bryony Thompson STR: SCA12 was added STR: SCA12 was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA12 were set to 27864267; 33811808 Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326 Review for STR: SCA12 was set to GREEN STR: SCA12 was marked as clinically relevant Added comment: NM_181675.3:c.27CAG[X] Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase Normal: ≤32 repeats Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12 Established pathogenic (used as diagnostic cut-off): ≥51 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.136 | PRDX3 |
Zornitza Stark gene: PRDX3 was added gene: PRDX3 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: PRDX3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PRDX3 were set to 33889951 Phenotypes for gene: PRDX3 were set to Cerebellar ataxia (early onset, mild to moderate, progressive) Review for gene: PRDX3 was set to GREEN Added comment: Biallelic variants in 5 unrelated families with early onset (median 21 years , range 13-22 years) with ataxia with variable additional hyper- and hypokinetic movement disorders, and severe early-onset cerebellar atrophy (seen on MRI), and involvement of the brainstem, medullary olive and parietal cortex. Evolution of the disease was gait ataxia leading to upper limb ataxia, then dysarthria and then dysphagia, all within a decade. For some of these patients, the phenotype included myoclonus, dystonia and / or tremor. Mild classical mitochondrial features were seen in one of the patients, namely ptosis and COX-negative fibres. The variants were homozygous nonsense, homozygous frameshift, homozygous missense, and a compound heterozygote with a splice variant and missense, all leading to complete loss of the protein. Oxidative stress and mitochondrial dysfunction was indicated as the disease mechanism. The families originated from Germany, France, India and two from eastern Turkey. The two families from Turkey were seemingly unrelated to each other but had the same homozygous missense. Patient fibroblasts from each of the five probands showed lack of protein (via Western blot) and decreased glutathione peroxidase activity and decreased mitochondrial maximal respiratory capacity. PRDX3 encodes peroxiredoxin 3, a mitochondrial antioxidant protein, that catalyses the reduction of hydrogen peroxide. It localises in the mitochondria, where most hydrogen peroxide is generated. Functional studies: PRDX3 knockdown (induced by silencing RNA against PRDX3) in cerebellar medulloblastoma cells showed significantly decreased cell viability, increased hydrogen peroxide levels and increased susceptibility to apoptosis triggered by reactive oxygen species. In addition, induced knockdown drosophila (in vivo animal model) had aberrant locomotor phenotypes and reduced lifespans, while immunolabelling of the brain showed increased cell death after exposure to oxidative stress. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.131 | SDHA |
Zornitza Stark gene: SDHA was added gene: SDHA was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for gene: SDHA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SDHA were set to 10976639; 27683074 Phenotypes for gene: SDHA were set to Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259 Review for gene: SDHA was set to AMBER Added comment: NDAXOA and mono-allelic variants: 5 individuals from two unrelated families reported in PMIDs: 10976639;27683074. Most affected individuals presented in mid-adulthood with slowly progressive cerebellar and gait ataxia, optic atrophy, and myopathy or myalgia. Some had a childhood history of neurologic features, including limited extraocular movements. Additional features reported included cardiomyopathy, psychiatric disturbances, and peripheral sensory impairment. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.129 | CANVAS_ACAGG | Bryony Thompson Added comment: Comment on list classification: Used the pathogenic cut-off of 400 repeats from original CANVAS repeat | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.128 | CANVAS_ACAGG |
Bryony Thompson STR: CANVAS_ACAGG was added STR: CANVAS_ACAGG was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for STR: CANVAS_ACAGG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CANVAS_ACAGG were set to 33103729 Phenotypes for STR: CANVAS_ACAGG were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome; fasciculations; elevated serum creatine kinase levels; denervation Review for STR: CANVAS_ACAGG was set to AMBER Added comment: A novel RFC1 repeat expansion motif, (ACAGG)exp, identified in three affected individuals from 2 families in an Asian-Pacific cohort for CANVAS. Southern blot was used to identify the repeat was ~1000kb in one of the cases, equivalent to ~1000 repeats. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.127 | CANVAS |
Bryony Thompson changed review comment from: Simple tandem repeat (AAAAG)11 replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Sources: Expert list; to: Simple tandem repeat (AAAAG)11 replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Maori population-specific CANVAS configuration (AAAGG)10-25(AAGGG)exp. (AAAGG)n repeat alone is not pathogenic. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.110 | ERCC4 |
Zornitza Stark gene: ERCC4 was added gene: ERCC4 was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for gene: ERCC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERCC4 were set to 29403087; 28431612; 29892709 Phenotypes for gene: ERCC4 were set to Cerebellar ataxia; Xeroderma pigmentosum, group F, MIM# 278760 Review for gene: ERCC4 was set to GREEN Added comment: Bi-allelic variants in ERCC4 cause a range of phenotypes, including xeroderma pigmentosum complementation group F (XP-F), Cockayne syndrome, and Fanconi anaemia. Seven unrelated individuals reported with slowly progressive cerebellar ataxia and cognitive decline with choreiform involuntary movement, with onset in adolescence/adulthood. Brain MRIs demonstrated atrophy that included the cerebellum and brainstem. Of note, cutaneous symptoms were very mild in 5/7: there was normal to very mild pigmentation of exposed skin areas and/or an equivocal history of pathological sunburn. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.108 | PEX7 |
Zornitza Stark gene: PEX7 was added gene: PEX7 was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for gene: PEX7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX7 were set to 25851898 Phenotypes for gene: PEX7 were set to Peroxisome biogenesis disorder 9B, MIM# 614879 Review for gene: PEX7 was set to GREEN Added comment: Three individuals reported where ataxia was part of the phenotype, onset in young adulthood. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.103 | LMNB1 |
Bryony Thompson changed review comment from: Four unrelated families reported with adult onset cerebellar ataxia as a feature of the condition. Sources: Expert list; to: Four unrelated families reported with adult onset cerebellar ataxia as a feature of the condition. CNV is the only reported cause of the condition. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.102 | SCA31 |
Bryony Thompson STR: SCA31 was added STR: SCA31 was added to Ataxia - adult onset. Sources: Literature STR tags were added to STR: SCA31. Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA31 were set to 19878914; 31755042 Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210 Review for STR: SCA31 was set to GREEN Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested. 2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.100 | SCA37 |
Bryony Thompson STR: SCA37 was added STR: SCA37 was added to Ataxia - adult onset. Sources: Literature STR tags were added to STR: SCA37. Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA37 were set to 28686858; 31145571 Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945 Review for STR: SCA37 was set to GREEN STR: SCA37 was marked as clinically relevant Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90] Located in a 5'UTR intron, flanked by (ATTTT)n on both sides Non-pathogenic allele: (ATTTT)7–400 Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90] Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.98 | CANVAS |
Bryony Thompson STR: CANVAS was added STR: CANVAS was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: CANVAS. Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CANVAS were set to 30926972 Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Review for STR: CANVAS was set to GREEN STR: CANVAS was marked as clinically relevant Added comment: Simple tandem repeat (AAAAG)11 replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.96 | EPM1 |
Bryony Thompson STR: EPM1 was added STR: EPM1 was added to Ataxia - adult onset. Sources: Literature STR tags were added to STR: EPM1. Mode of inheritance for STR: EPM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EPM1 were set to 29325606; 20301321 Phenotypes for STR: EPM1 were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Review for STR: EPM1 was set to GREEN STR: EPM1 was marked as clinically relevant Added comment: NM_000100.4:c.-179CCCCGCCCCGCG[X] Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME. Normal: 2-3 dodecamer repeats Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized) Pathogenic (full penetrance): ≥30 dodecamer repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.95 | FMR1 | Bryony Thompson Added comment: Comment on list classification: CCG repeat expansion is the only reported cause of ataxia (FXTAS). The SNVs are associated with intellectual disability in FXS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.93 | FRDA |
Bryony Thompson STR: FRDA was added STR: FRDA was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: FRDA. Mode of inheritance for STR: FRDA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: FRDA were set to 20301458 Phenotypes for STR: FRDA were set to Friedreich ataxia MIM#229300 Review for STR: FRDA was set to GREEN STR: FRDA was marked as clinically relevant Added comment: NM_000144.4:c.165+1340GAA[X] Loss of function is the mechanism of disease Normal: 5-33 repeats Mutable normal (premutation): 34-65 repeats Borderline: 44-66 repeats Full-penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.91 | SCA36 |
Bryony Thompson STR: SCA36 was added STR: SCA36 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA36. Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA36 were set to 25101480 Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153 Review for STR: SCA36 was set to GREEN STR: SCA36 was marked as clinically relevant Added comment: NM_006392.3:c.3+71GGCCTG[X] Toxic RNA effect is suggested mechanism of disease Normal: 3-14 repeats Uncertain significance: 15-650 repeats Pathogenic: ≥650 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.90 | NOP56 | Bryony Thompson Added comment: Comment on list classification: A hexanucleotide (GGCCTG) repeat expansion in the first intron of the NOP56 gene is the only reported cause of disease. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.86 | SCA12 |
Bryony Thompson STR: SCA12 was added STR: SCA12 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA12. Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA12 were set to 29325606; 20301381 Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326 Review for STR: SCA12 was set to GREEN STR: SCA12 was marked as clinically relevant Added comment: NM_181675.3:c.27CAG[X] Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase Normal: ≤32 repeats Reduced penetrance: ~40-66 repeats Full penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.84 | SCA10 |
Bryony Thompson STR: SCA10 was added STR: SCA10 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA10. Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA10 were set to 20301354 Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516 STR: SCA10 was marked as clinically relevant Added comment: NM_013236.2:c.1430+54822ATTCT[X] Toxic RNA gain-of-function mechanism of disease Normal alleles: 10-32 ATTCT repeats Alleles of questionable significance: 33-280 ATTCT repeats Reduced-penetrance alleles: 33-850 repeats Full-penetrance alleles: 800-4,500 ATTCT repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.82 | SCA8 |
Bryony Thompson STR: SCA8 was added STR: SCA8 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA8. Mode of inheritance for STR: SCA8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA8 were set to 20301445 Phenotypes for STR: SCA8 were set to Spinocerebellar ataxia 8 MIM#608768 Review for STR: SCA8 was set to GREEN STR: SCA8 was marked as clinically relevant Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X] ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats Alleles of questionable significance: 50-70 repeats. Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.80 | SCA17 |
Bryony Thompson STR: SCA17 was added STR: SCA17 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA17. Mode of inheritance for STR: SCA17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA17 were set to 20301611; 29325606 Phenotypes for STR: SCA17 were set to Spinocerebellar ataxia 17 MIM#607136 Review for STR: SCA17 was set to GREEN STR: SCA17 was marked as clinically relevant Added comment: NM_003194.4:c.172_174[X] Mechanism of disease expected to be gain of function Normal: ≤ 40 CAG/CAA repeats Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms. Full-penetrance: ≥49 CAG/CAA repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.78 | SCA7 |
Bryony Thompson STR: SCA7 was added STR: SCA7 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA7. Mode of inheritance for STR: SCA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA7 were set to 29325606; 20301433 Phenotypes for STR: SCA7 were set to Spinocerebellar ataxia 7 MIM#164500 Review for STR: SCA7 was set to GREEN STR: SCA7 was marked as clinically relevant Added comment: NM_000333.3:c.89_91AGC[X] Gain of function mechanism of disease Normal: ≤27 repeats Mutable normal: 28-33 repeats, meiotically unstable, but not associated with an abnormal phenotype. Pathogenic reduced penetrance: 34-36 repeats, when manifestations occur, they are more likely to be later onset and milder than average Pathogenic full penetrance: 37-460 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.76 | SCA6 |
Bryony Thompson STR: SCA6 was added STR: SCA6 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA6. Mode of inheritance for STR: SCA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA6 were set to 20301319; 29325606 Phenotypes for STR: SCA6 were set to Spinocerebellar ataxia 6 MIM#183086; Episodic ataxia, type 2 MIM#108500 Review for STR: SCA6 was set to GREEN STR: SCA6 was marked as clinically relevant Added comment: NM_023035.2:c.6929_6931CAG[X] PolyQ expansion alters gene binding, impairs transcription factor function, and is toxic to cells expressing the α1ACT – effects consistent with a loss of function Normal: ≤18 repeats Questionable significance: 19 CAG repeats Full penetrance: ≥20 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.74 | SCA3 |
Bryony Thompson STR: SCA3 was added STR: SCA3 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA3. Mode of inheritance for STR: SCA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA3 were set to 20301375; 29325606 Phenotypes for STR: SCA3 were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3 Review for STR: SCA3 was set to GREEN STR: SCA3 was marked as clinically relevant Added comment: NM_004993.5:c.886_888CAG[X] Toxic aggregation and mislocalization in neurons is mechanism of disease Normal: ≤44 repeats, mostly <31 repeats Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3 Pathogenic (full penetrance): ≥60 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.72 | SCA2 |
Bryony Thompson STR: SCA2 was added STR: SCA2 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA2. Mode of inheritance for STR: SCA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA2 were set to 29325606; 20301452 Phenotypes for STR: SCA2 were set to Spinocerebellar ataxia 2 MIM#183090 Review for STR: SCA2 was set to GREEN STR: SCA2 was marked as clinically relevant Added comment: NM_002973.3:c.496_498CAG[X] Toxic protein aggregation is mechanism of disease Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2) Uncertain: 32 repeats ALS risk allele: 30-32 repeats Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life Full penetrance: ≥35 repeats Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.70 | SCA1 |
Bryony Thompson changed review comment from: NM_000332.3:c.589_591CAG[X] Toxic protein aggregation is mechanism of disease Sources: Expert list; to: NM_000332.3:c.589_591CAG[X] Toxic protein aggregation is mechanism of disease Normal: ≤35 CAG repeats or 36-44 CAG repeats with CAT interruptions Mutable normal (intermediate): 36-38 CAG repeats without CAT interruptions Full-penetrance: ≥39 CAG repeats without CAT interruptions or ≥46 uninterrupted CAG repeats with CAT interruptions and additional CAGs Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.70 | SCA1 |
Bryony Thompson STR: SCA1 was added STR: SCA1 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA1. Mode of inheritance for STR: SCA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA1 were set to 29325606; 20301363 Phenotypes for STR: SCA1 were set to Spinocerebellar ataxia 1 MIM#164400 Review for STR: SCA1 was set to GREEN STR: SCA1 was marked as clinically relevant Added comment: NM_000332.3:c.589_591CAG[X] Toxic protein aggregation is mechanism of disease Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.68 | DRPLA |
Bryony Thompson STR: DRPLA was added STR: DRPLA was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: DRPLA. Mode of inheritance for STR: DRPLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DRPLA were set to 29325606; 20301664 Phenotypes for STR: DRPLA were set to Dentatorubral-pallidoluysian atrophy MIM#125370 Review for STR: DRPLA was set to GREEN STR: DRPLA was marked as clinically relevant Added comment: NM_001007026.1:c.1462_1464CAG[X] Toxic gain of function mechanism of disease Benign: ≤35 repeats Mutable normal: 20-35 repeats Pathogenic: ≥48 repeats Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FXTAS |
Bryony Thompson changed review comment from: HGVS nomenclature - NM_002024.5:c.-129CGG[X] RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats Sources: Expert list; to: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FMR1 | Bryony Thompson Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FMR1 | Bryony Thompson Added comment: Comment on list classification: Ataxia is caused by the premutation repeat expansion. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.65 | FXTAS |
Bryony Thompson STR: FXTAS was added STR: FXTAS was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FXTAS were set to 23765048; 25227148 Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623 Review for STR: FXTAS was set to GREEN STR: FXTAS was marked as clinically relevant Added comment: HGVS nomenclature - NM_002024.5:c.-129CGG[X] RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.57 | SLC1A3 |
Bryony Thompson gene: SLC1A3 was added gene: SLC1A3 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: SLC1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC1A3 were set to Episodic ataxia, type 6 MIM#612656 Review for gene: SLC1A3 was set to GREEN Added comment: Onset mostly in infancy and childhood, but adult onset has been reported Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.56 | LMNB1 |
Bryony Thompson changed review comment from: Four unrelated families reported with cerebellar ataxia as a feature of the condition. Sources: Expert list; to: Four unrelated families reported with adult onset cerebellar ataxia as a feature of the condition. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.55 | LMNB1 |
Bryony Thompson gene: LMNB1 was added gene: LMNB1 was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for gene: LMNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LMNB1 were set to 31695592 Phenotypes for gene: LMNB1 were set to Leukodystrophy, adult-onset, autosomal dominant MIM#169500 Review for gene: LMNB1 was set to GREEN Added comment: Four unrelated families reported with cerebellar ataxia as a feature of the condition. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.53 | CACNA1A | Bryony Thompson Added comment: Comment on list classification: Ataxia can be caused by a triplet repeat expansion in this gene, which is not detectable with current WES/WGS technologies. However, SNVs have also been reported as disease-causing. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.52 | TBP | Bryony Thompson Added comment: Comment on list classification: Note: the trinucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.51 | TBP |
Bryony Thompson gene: TBP was added gene: TBP was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for gene: TBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TBP were set to 10484774; 11448935 Phenotypes for gene: TBP were set to Spinocerebellar ataxia 17 MIM#607136 Mode of pathogenicity for gene: TBP was set to Other Review for gene: TBP was set to GREEN Added comment: Ataxia caused by an abnormal (CAG)n expansion in TBP to a range of 47 to 55 repeats. Identified in Japanese families. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.50 | PPP2R2B | Bryony Thompson Added comment: Comment on list classification: Note: the trinucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.49 | PPP2R2B |
Bryony Thompson gene: PPP2R2B was added gene: PPP2R2B was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: PPP2R2B. Mode of inheritance for gene: PPP2R2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2R2B were set to 10581021; 16138911 Phenotypes for gene: PPP2R2B were set to Spinocerebellar ataxia 12 MIM#604326 Mode of pathogenicity for gene: PPP2R2B was set to Other Review for gene: PPP2R2B was set to GREEN Added comment: Ataxia cause by CAG repeat. Normal CAG repeat length is 7 to 32 triplets, and pathogenic CAG repeat length is 51 to 78 triplets Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.48 | DAB1 | Bryony Thompson Added comment: Comment on list classification: Note: the pentanucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.47 | DAB1 |
Bryony Thompson gene: DAB1 was added gene: DAB1 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: DAB1. Mode of inheritance for gene: DAB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DAB1 were set to 28686858 Phenotypes for gene: DAB1 were set to Spinocerebellar ataxia 37 MIM#615945 Mode of pathogenicity for gene: DAB1 was set to Other Review for gene: DAB1 was set to GREEN Added comment: In 35 affected individuals from 3 large, multigenerational kindreds from southern Portugal with ataxia had expansion of a heterozygous 5-bp ATTTC(n) insertion in the 5-prime UTR intron 3 of the DAB1 gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.46 | ATXN10 | Bryony Thompson Added comment: Comment on list classification: Note: the pentanucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.45 | ATXN10 |
Bryony Thompson gene: ATXN10 was added gene: ATXN10 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: ATXN10. Mode of inheritance for gene: ATXN10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN10 were set to 11017075; 15127363 Phenotypes for gene: ATXN10 were set to Spinocerebellar ataxia 10 MIM#603516 Mode of pathogenicity for gene: ATXN10 was set to Other Review for gene: ATXN10 was set to GREEN Added comment: Ataxia in 5 Mexican families, caused by an expansion of a pentanucleotide (ATTCT) repeat in intron 9 of the ATXN10 gene. There was an inverse correlation between the expansion size, up to 22.5 kb larger than the normal allele, and the age of onset. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.44 | ATXN8 | Bryony Thompson Added comment: Comment on list classification: Note: the trinucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.43 | ATXN8 |
Bryony Thompson gene: ATXN8 was added gene: ATXN8 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: ATXN8. Mode of inheritance for gene: ATXN8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN8 were set to 16804541 Phenotypes for gene: ATXN8 were set to Spinocerebellar ataxia 8 MIM#608768 Mode of pathogenicity for gene: ATXN8 was set to Other Review for gene: ATXN8 was set to GREEN Added comment: Adult onset cerebellar ataxia caused by expanded CAG repeat. Normal alleles contain 15 to 50 repeats, and pathogenic alleles contain 71 to 1,300 repeats. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.42 | ATXN7 | Bryony Thompson Added comment: Comment on list classification: Note: the trinucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.41 | ATXN7 |
Bryony Thompson gene: ATXN7 was added gene: ATXN7 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: ATXN7. Mode of inheritance for gene: ATXN7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ATXN7 were set to 9288099 Phenotypes for gene: ATXN7 were set to Spinocerebellar ataxia 7 MIM#164500 Mode of pathogenicity for gene: ATXN7 was set to Other Review for gene: ATXN7 was set to GREEN Added comment: Adult onset progressive cerebellar ataxia associated with pigmental macular dystrophy, caused by a highly unstable CAG repeat expansion. On mutated alleles, CAG repeat size was highly variable, ranging from 38 to 130 repeats, whereas on normal alleles it ranged from 7 to 17 repeats. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.40 | ATXN3 | Bryony Thompson Added comment: Comment on list classification: Note: the trinucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.39 | ATXN3 |
Bryony Thompson gene: ATXN3 was added gene: ATXN3 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: ATXN3. Mode of inheritance for gene: ATXN3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN3 were set to 7874163 Phenotypes for gene: ATXN3 were set to Machado-Joseph disease MIM#109150; spindocerebellar ataxia 3 Mode of pathogenicity for gene: ATXN3 was set to Other Review for gene: ATXN3 was set to GREEN Added comment: Adult onset ataxia: caused by an expansion of a (CAG)n repeat in the ATXN3 gene. In normal individuals, the gene contains between 13 and 36 CAG repeats, whereas most patients with clinically diagnosed MJD showed expansion of the repeat number in the range of 68 to 79 copies. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.38 | ATXN2 | Bryony Thompson Added comment: Comment on list classification: Note: the trinucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.37 | ATXN2 |
Bryony Thompson gene: ATXN2 was added gene: ATXN2 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: ATXN2. Mode of inheritance for gene: ATXN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN2 were set to 8896555; 8896556 Phenotypes for gene: ATXN2 were set to Spinocerebellar ataxia 2 MIM#183090 Mode of pathogenicity for gene: ATXN2 was set to Other Review for gene: ATXN2 was set to GREEN Added comment: Mean age of onset of ataxia in third decade: (CAG)n repeat located in the 5-prime end of the coding region of the ATXN2 gene. SCA2 patient chromosomes usually contain expanded repeats ranging in size from 35 to 59 units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.36 | ATXN1 |
Bryony Thompson changed review comment from: From OMIM: The cause of spinocerebellar ataxia-1 is an expansion of a (CAG)n repeat in the gene encoding ataxin-1 located on 6p. Alleles with 36 to 38 triplets were present in individuals with ataxia but without additional characteristic features of SCA1. SCA1 phenotypes were found for patients with 41 and 43 triplets. Sources: Expert list; to: Adult onset ataxia. From OMIM: The cause of spinocerebellar ataxia-1 is an expansion of a (CAG)n repeat in the gene encoding ataxin-1 located on 6p. Alleles with 36 to 38 triplets were present in individuals with ataxia but without additional characteristic features of SCA1. SCA1 phenotypes were found for patients with 41 and 43 triplets. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.36 | ATXN1 | Bryony Thompson Added comment: Comment on list classification: Note: the trinucleotide repeat is the only cause of ataxia for this gene, which is not detected by current WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.35 | ATXN1 |
Bryony Thompson gene: ATXN1 was added gene: ATXN1 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: ATXN1. Mode of inheritance for gene: ATXN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN1 were set to 8358429; 11973625 Phenotypes for gene: ATXN1 were set to Spinocerebellar ataxia 1 MIM#164400 Mode of pathogenicity for gene: ATXN1 was set to Other Review for gene: ATXN1 was set to GREEN Added comment: From OMIM: The cause of spinocerebellar ataxia-1 is an expansion of a (CAG)n repeat in the gene encoding ataxin-1 located on 6p. Alleles with 36 to 38 triplets were present in individuals with ataxia but without additional characteristic features of SCA1. SCA1 phenotypes were found for patients with 41 and 43 triplets. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.34 | ATN1 | Bryony Thompson Added comment: Comment on list classification: Note: trinucleotide repeat is the only cause of ataxia for this gene. STRs are currently not detectable in WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.32 | ATN1 |
Bryony Thompson gene: ATN1 was added gene: ATN1 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to gene: ATN1. Mode of inheritance for gene: ATN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATN1 were set to 7633415 Phenotypes for gene: ATN1 were set to Dentatorubral-pallidoluysian atrophy MIM#125370 Mode of pathogenicity for gene: ATN1 was set to Other Review for gene: ATN1 was set to GREEN Added comment: DRPLA contains various combinations of myoclonus, seizures, ataxia, choreoathetosis, and dementia, and is only caused by trinucleotide repeat expansion. Mean age of onset is 30 years of age. From OMIM: In 22 patients unstable expansion of a CAG unit in the DRPLA gene was identified. Each patient was a heterozygote with 1 allele in the normal range (8-25 repeat units) and a second expanded allele with the range of 54-68 repeat units. There were no overlaps in the number of CAG repeat units between control chromosomes and DRPLA chromosomes. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.31 | FXN | Bryony Thompson Added comment: Comment on list classification: Both repeat and SNV can cause disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.25 | RFC1 | Bryony Thompson Added comment: Comment on list classification: CANVAS is associated with expansion of an intronic pentanucleotide repeat. Not detectable with WES testing. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.22 | MME | Bryony Thompson reviewed gene: MME: Rating: RED; Mode of pathogenicity: None; Publications: 27583304; Phenotypes: Spinocerebellar ataxia 43 MIM#617018; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.22 | BEAN1 | Bryony Thompson Added comment: Comment on list classification: Repeat is the only reported cause of condition, which cannot be detected with current NGS technology. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.20 | MTCL1 |
Bryony Thompson gene: MTCL1 was added gene: MTCL1 was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for gene: MTCL1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: MTCL1 were set to 30548255; 28283581 Phenotypes for gene: MTCL1 were set to spinocerebellar ataxia Review for gene: MTCL1 was set to AMBER Added comment: Single case with a homozygous loss of function variant in a Polish study of early-onset cerebellar ataxia, and a single family with a single heterozygous missense (p.Val1435Met) identified in two family members with adult-onset spinocerebellar ataxia. Mtcl1 gene disruption in mice results in abnormal motor coordination with Purkinje cell degeneration Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.19 | MARS2 | Bryony Thompson Added comment: Comment on list classification: Only large duplications have been reported in ataxia. WES is not a suitable method of detection for SV/CNVs. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.16 | CSF1R |
Bryony Thompson gene: CSF1R was added gene: CSF1R was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: CSF1R was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CSF1R were set to 24198292; 25563800; 25935893 Phenotypes for gene: CSF1R were set to Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820; ataxia Review for gene: CSF1R was set to GREEN Added comment: At least 6 reported cases where ataxia is a feature of the condition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.15 | IFRD1 |
Bryony Thompson gene: IFRD1 was added gene: IFRD1 was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for gene: IFRD1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: IFRD1 were set to 29362493; 28601596; 19409521 Phenotypes for gene: IFRD1 were set to Spinocerebellar ataxia 18 MIM#607458 Review for gene: IFRD1 was set to RED Added comment: The variant (c.514 A>G, p.I172V) was identified in a 5-generation American family of Irish ancestry with sensorimotor neuropathy with ataxia in two affected individuals sequenced. It is too common (0.3%) for a dominant condition in the African population in gnomAD. The same variant segregated with slowly progressing gait ataxia, pyramidal tract signs and peripheral neuropathy in three siblings from a Chinese family. No functional analyses of the variant has been conducted. A different variant (c.4C>G p.Pro2Ala) in the gene has been identified in a case with isolated palatal tremor, with no ataxia in the case or reported in the family. SCA18 is currently mapped to the genomic region on OMIM, not this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.12 | TSEN54 |
Bryony Thompson gene: TSEN54 was added gene: TSEN54 was added to Ataxia - adult onset_RMH. Sources: Expert list Mode of inheritance for gene: TSEN54 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TSEN54 were set to 24938831 Phenotypes for gene: TSEN54 were set to adult-onset cerebellar ataxia Review for gene: TSEN54 was set to RED Added comment: One family with adult-onset hereditary ataxia reported to segregate a heterozygous missense variant in this gene. Biallelic variants are associated with various forms of pontocerebellar hyploplasia where affected individuals do not live past childhood. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.11 | SEPSECS |
Bryony Thompson gene: SEPSECS was added gene: SEPSECS was added to Ataxia - adult onset_RMH. Sources: Expert list Mode of inheritance for gene: SEPSECS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SEPSECS were set to 29464431 Phenotypes for gene: SEPSECS were set to Pontocerebellar hypoplasia type 2D, 613811; cerebellar ataxia and cognitive impairment Review for gene: SEPSECS was set to RED Added comment: Ataxia not a prominent feature of the phenotype. A single report of a 23-year-old woman with slowly progressive cerebellar ataxia and cognitive impairment, with a homozygous missense mutation. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.10 | RFC1 |
Bryony Thompson gene: RFC1 was added gene: RFC1 was added to Ataxia - adult onset_RMH. Sources: Expert list Mode of inheritance for gene: RFC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RFC1 were set to 30926972 Phenotypes for gene: RFC1 were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome, 614575; CANVAS Review for gene: RFC1 was set to RED Added comment: CANVAS is associated with expansion of an intronic pentanucleotide repeat. Not detectable with WES testing. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.7 | CAPN1 |
Bryony Thompson gene: CAPN1 was added gene: CAPN1 was added to Ataxia - adult onset_RMH. Sources: Expert list Mode of inheritance for gene: CAPN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CAPN1 were set to 27320912; 29678961; 30572172; 31023339; 31104286 Phenotypes for gene: CAPN1 were set to Spastic paraplegia 76, autosomal recessive, 616907 Review for gene: CAPN1 was set to GREEN Added comment: Homozygous or compound heterozygotes reported in 4 independent families with cerebellar ataxia and knockout mouse exhibit ataxia (PMID: 27320912). Multiple reports of homozygous cases with hereditary spastic paraparesis and spastic ataxia (PMID: 29678961, 30572172, 31023339, 31104286). Onset in young adulthood. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.6 | FDXR |
Bryony Thompson gene: FDXR was added gene: FDXR was added to Ataxia - adult onset_RMH. Sources: Expert list Mode of inheritance for gene: FDXR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FDXR were set to Auditory neuropathy and optic atrophy, 617717 Review for gene: FDXR was set to RED Added comment: Ataxia is not a reported feature of the phenotype for this condition. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.5 | BEAN1 |
Bryony Thompson gene: BEAN1 was added gene: BEAN1 was added to Ataxia - adult onset_RMH. Sources: Expert list Mode of inheritance for gene: BEAN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: BEAN1 were set to Spinocerebellar ataxia 31, 117210; autosomal dominant cerebellar ataxia type III Review for gene: BEAN1 was set to RED Added comment: Pentanucleotide repeat causes disease, which is not detectable with WES testing. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.4 | MARS2 |
Bryony Thompson gene: MARS2 was added gene: MARS2 was added to Ataxia - adult onset_RMH. Sources: Expert list SV/CNV tags were added to gene: MARS2. Mode of inheritance for gene: MARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MARS2 were set to Spastic ataxia 3, autosomal recessive, 611390 Review for gene: MARS2 was set to RED Added comment: Only large duplications have been reported in ataxia. WES is not a suitable method of detection for SV/CNVs. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.0 | MME |
Bryony Thompson gene: MME was added gene: MME was added to Ataxia - adult onset_RMH. Sources: Expert Review Red,GeneReviews,Royal Melbourne Hospital Mode of inheritance for gene: MME was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MME were set to 27583304 Phenotypes for gene: MME were set to ?Spinocerebellar ataxia type 43, 617018 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||