Activity

Filter

Cancel
Date Panel Item Activity
15 actions
Early-onset Dementia v2.0 PRNP_CJD_octapeptide STR PRNP_CJD_octapeptide: gene migrated from ENSG00000171867 to ENSG00000171867 (gene set migration)
Early-onset Dementia v2.0 PRNP Gene migrated from ENSG00000171867 to ENSG00000171867 (gene set migration)
Early-onset Dementia v1.33 PRNP_CJD_octapeptide Bryony Thompson CJD was changed to PRNP_CJD_octapeptide
Early-onset Dementia v0.204 PRNP Zornitza Stark Marked gene: PRNP as ready
Early-onset Dementia v0.204 PRNP Zornitza Stark Gene: prnp has been classified as Green List (High Evidence).
Early-onset Dementia v0.204 PRNP Zornitza Stark Phenotypes for gene: PRNP were changed from to Prion Disease (MIM#176640); Creutzfeldt-Jakob disease (MIM#123400)
Early-onset Dementia v0.203 PRNP Zornitza Stark Publications for gene: PRNP were set to
Early-onset Dementia v0.202 PRNP Zornitza Stark Mode of inheritance for gene: PRNP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.179 PRNP Sangavi Sivagnanasundram reviewed gene: PRNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 27910931, 19571725, 20301407, 6351815; Phenotypes: Prion Disease (MIM#176640), Creutzfeldt-Jakob disease (MIM#123400); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.147 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Early-onset Dementia v0.146 Bryony Thompson removed STR:PRNP from the panel
Early-onset Dementia v0.72 PRNP Bryony Thompson Classified STR: PRNP as Green List (high evidence)
Early-onset Dementia v0.72 PRNP Bryony Thompson Str: prnp has been classified as Green List (High Evidence).
Early-onset Dementia v0.71 PRNP Bryony Thompson STR: PRNP was added
STR: PRNP was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: PRNP.
Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP were set to 20301407
Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP was set to GREEN
STR: PRNP was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Early-onset Dementia v0.0 PRNP Zornitza Stark gene: PRNP was added
gene: PRNP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PRNP was set to Unknown