| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.15 | PRNP_CJD_octapeptide |
Bryony Thompson STR: PRNP_CJD_octapeptide was added STR: PRNP_CJD_octapeptide was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407 Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP_CJD_octapeptide was set to GREEN STR: PRNP_CJD_octapeptide was marked as clinically relevant STR: PRNP_CJD_octapeptide was marked as current diagnostic Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.246 | PRNP | Zornitza Stark Marked gene: PRNP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.246 | PRNP | Zornitza Stark Gene: prnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.246 | PRNP | Zornitza Stark Phenotypes for gene: PRNP were changed from to inherited Creutzfeldt-Jakob disease MONDO:0007403; Gerstmann-Straussler-Scheinker syndrome MONDO:0007656 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.245 | PRNP | Zornitza Stark Publications for gene: PRNP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.244 | PRNP | Zornitza Stark Mode of inheritance for gene: PRNP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.243 | PRNP | Kaitlyn Dianna Weldon reviewed gene: PRNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301407; Phenotypes: inherited Creutzfeldt-Jakob disease MONDO:0007403, Gerstmann-Straussler-Scheinker syndrome MONDO:0007656; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.0 | PRNP |
Zornitza Stark gene: PRNP was added gene: PRNP was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PRNP was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||