| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Ataxia - adult onset v1.26 | PRNP_CJD_octapeptide | Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.26 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.26 | PRNP_CJD_octapeptide | Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.26 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v1.25 | PRNP_CJD_octapeptide |
Bryony Thompson STR: PRNP_CJD_octapeptide was added STR: PRNP_CJD_octapeptide was added to Ataxia - adult onset. Sources: Literature Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407 Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP_CJD_octapeptide was set to GREEN STR: PRNP_CJD_octapeptide was marked as clinically relevant STR: PRNP_CJD_octapeptide was marked as current diagnostic Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.176 | PRNP | Bryony Thompson Marked gene: PRNP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.176 | PRNP | Bryony Thompson Gene: prnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.176 | PRNP | Bryony Thompson Publications for gene: PRNP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.175 | PRNP | Bryony Thompson reviewed gene: PRNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 2564168, 34324063, 20301407; Phenotypes: Inherited Creutzfeldt-Jakob disease MONDO:0007403, ataxia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.0 | PRNP |
Bryony Thompson gene: PRNP was added gene: PRNP was added to Ataxia - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: PRNP were set to Multiple allelic disorders reported; Huntington disease-like 1; Autosomal Dominant Ataxia; Gerstmann-Straussler disease; Insomnia, fatal familial; Creutzfeldt-Jakob disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||