Activity

Filter

Cancel
Date Panel Item Activity
337 actions
Mandibulofacial Acrofacial dysostosis v2.0 EIF4A3_RCPS_complex STR EIF4A3_RCPS_complex: gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 TSR2 Gene migrated from ENSG00000158526 to ENSG00000158526 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 OTX2 Gene migrated from ENSG00000165588 to ENSG00000165588 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 RPL11 Gene migrated from ENSG00000142676 to ENSG00000142676 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 RPS26 Gene migrated from ENSG00000197728 to ENSG00000197728 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 RPL5 Gene migrated from ENSG00000122406 to ENSG00000122406 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 EDN1 Gene migrated from ENSG00000078401 to ENSG00000078401 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 SHROOM3 Gene migrated from ENSG00000138771 to ENSG00000138771 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 DHODH Gene migrated from ENSG00000102967 to ENSG00000102967 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 MTX2 Gene migrated from ENSG00000128654 to ENSG00000128654 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 POLR1A Gene migrated from ENSG00000068654 to ENSG00000068654 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 GNAI3 Gene migrated from ENSG00000065135 to ENSG00000065135 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 EIF4A3 Gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 PRRX1 Gene migrated from ENSG00000116132 to ENSG00000116132 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 TCOF1 Gene migrated from ENSG00000070814 to ENSG00000070814 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 POLR1D Gene migrated from ENSG00000186184 to ENSG00000186184 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 SF3B2 Gene migrated from ENSG00000087365 to ENSG00000087365 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 POLR1B Gene migrated from ENSG00000125630 to ENSG00000125630 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 RPS28 Gene migrated from ENSG00000233927 to ENSG00000233927 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 POLD1 Gene migrated from ENSG00000062822 to ENSG00000062822 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 POLR1C Gene migrated from ENSG00000171453 to ENSG00000171453 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 FOXI3 Gene migrated from ENSG00000214336 to ENSG00000214336 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 SF3B4 Gene migrated from ENSG00000143368 to ENSG00000143368 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 MYT1 Gene migrated from ENSG00000196132 to ENSG00000196132 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 TMCO1 Gene migrated from ENSG00000143183 to ENSG00000143183 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 VGLL2 Gene migrated from ENSG00000170162 to ENSG00000170162 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 EVC2 Gene migrated from ENSG00000173040 to ENSG00000173040 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 EVC Gene migrated from ENSG00000072840 to ENSG00000072840 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 SNRPB Gene migrated from ENSG00000125835 to ENSG00000125835 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 PBX1 Gene migrated from ENSG00000185630 to ENSG00000185630 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 EFTUD2 Gene migrated from ENSG00000108883 to ENSG00000108883 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 TXNL4A Gene migrated from ENSG00000141759 to ENSG00000141759 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 RBM10 Gene migrated from ENSG00000182872 to ENSG00000182872 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 GSC Gene migrated from ENSG00000133937 to ENSG00000133937 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 EDNRA Gene migrated from ENSG00000151617 to ENSG00000151617 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 PLCB4 Gene migrated from ENSG00000101333 to ENSG00000101333 (gene set migration)
Mandibulofacial Acrofacial dysostosis v2.0 Panel migrated to gene set Ensemblv115. Source version: v1.22
Mandibulofacial Acrofacial dysostosis v1.22 POLD1 Zornitza Stark Marked gene: POLD1 as ready
Mandibulofacial Acrofacial dysostosis v1.22 POLD1 Zornitza Stark Gene: pold1 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.22 POLD1 Zornitza Stark Phenotypes for gene: POLD1 were changed from Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, MIM# 615381; MONDO:0014157; Immunodeficiency 120, MIM# 620836 to Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, MIM# 615381
Mandibulofacial Acrofacial dysostosis v1.21 POLD1 Zornitza Stark Mode of inheritance for gene: POLD1 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v1.20 POLD1 Zornitza Stark Deleted their comment
Mandibulofacial Acrofacial dysostosis v1.20 POLD1 Zornitza Stark edited their review of gene: POLD1: Changed phenotypes: Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, MIM# 615381; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v1.20 Zornitza Stark Copied gene POLD1 from panel Mendeliome
Mandibulofacial Acrofacial dysostosis v1.20 POLD1 Zornitza Stark gene: POLD1 was added
gene: POLD1 was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: POLD1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: POLD1 were set to 31629014; 31449058; 23770608; 33618333; 33369179; 32826474; 30023403; 29199204; 28791128
Phenotypes for gene: POLD1 were set to Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, MIM# 615381; MONDO:0014157; Immunodeficiency 120, MIM# 620836
Mandibulofacial Acrofacial dysostosis v1.19 FOXI3 Zornitza Stark Phenotypes for gene: FOXI3 were changed from Dysostosis with predominant craniofacial involvement (MONDO:0800085) to Craniofacial microsomia 2, MIM# 620444
Mandibulofacial Acrofacial dysostosis v1.18 FOXI3 Zornitza Stark Publications for gene: FOXI3 were set to 36260083
Mandibulofacial Acrofacial dysostosis v1.17 FOXI3 Zornitza Stark reviewed gene: FOXI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 37041148; Phenotypes: Craniofacial microsomia 2, MIM# 620444; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v1.17 RPS28 Zornitza Stark Phenotypes for gene: RPS28 were changed from Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164 to Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164
Mandibulofacial Acrofacial dysostosis v1.16 RPS28 Zornitza Stark Publications for gene: RPS28 were set to 24942156
Mandibulofacial Acrofacial dysostosis v1.15 RPS28 Zornitza Stark Classified gene: RPS28 as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v1.15 RPS28 Zornitza Stark Gene: rps28 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.14 RPS28 Zornitza Stark edited their review of gene: RPS28: Added comment: PMID 40135709 reports a new individual with a heterozygous de novo start‑codon loss‑of‑function variant (c.2T>C) causing Diamond‑Blackfan anaemia and Pierre Robin sequence; Changed rating: GREEN; Changed publications: 24942156, 40135709; Changed phenotypes: Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.13 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Mandibulofacial Acrofacial dysostosis v1.12 SHROOM3 Zornitza Stark Marked gene: SHROOM3 as ready
Mandibulofacial Acrofacial dysostosis v1.12 SHROOM3 Zornitza Stark Gene: shroom3 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v1.12 SHROOM3 chirag patel Classified gene: SHROOM3 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v1.12 SHROOM3 chirag patel Gene: shroom3 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v1.12 SHROOM3 chirag patel Classified gene: SHROOM3 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v1.12 SHROOM3 chirag patel Gene: shroom3 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v1.11 SHROOM3 chirag patel Classified gene: SHROOM3 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v1.11 SHROOM3 chirag patel Gene: shroom3 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v1.10 SHROOM3 chirag patel gene: SHROOM3 was added
gene: SHROOM3 was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature
Mode of inheritance for gene: SHROOM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SHROOM3 were set to PMID: 39875538
Phenotypes for gene: SHROOM3 were set to Craniofacial microsomia MONDO:0015397
Review for gene: SHROOM3 was set to AMBER
Added comment: SHROOM3 has been implicated in facial development via GWAS, with association between SHROOM3 and HFM, cleft lip/palate, orofacial clefts, and neural tube defects. Human embryo expression data shows that SHROOM3 is mainly expressed in craniofacial mesoderm, neural progenitor cells, and somites in the head and trunk regions. Mouse Genome Informatics data shows that Shroom3 is expressed in various tissues during different stages of embryonic development, including the head mesenchyme, ear, eye, face, and nose.

Li et al. (2025) performed SHROOM3 gene sequencing in 320 sporadic hemifacial microsomia patients. They identified 7 individuals with 7 deleterious missense variants (MAF <0.005, CADD >20, predicted deleterious with >3 silico tools). No in vitro/in vivo functional studies to assess the consequences of the variants and their role in HFM.
Sources: Literature
Mandibulofacial Acrofacial dysostosis v1.9 PLCB4 Zornitza Stark Phenotypes for gene: PLCB4 were changed from Auriculocondylar syndrome 2, MIM# 614669 to Auriculocondylar syndrome 2A, MIM# 614669; Auriculocondylar syndrome 2B, MIM# 620458
Mandibulofacial Acrofacial dysostosis v1.8 PLCB4 Zornitza Stark edited their review of gene: PLCB4: Changed phenotypes: Auriculocondylar syndrome 2A, MIM# 614669, Auriculocondylar syndrome 2B, MIM# 620458
Mandibulofacial Acrofacial dysostosis v1.8 VGLL2 Zornitza Stark Marked gene: VGLL2 as ready
Mandibulofacial Acrofacial dysostosis v1.8 VGLL2 Zornitza Stark Gene: vgll2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.8 VGLL2 Zornitza Stark Phenotypes for gene: VGLL2 were changed from Syngnathia to Syngnathia, MONDO:0015409, VGLL2-related
Mandibulofacial Acrofacial dysostosis v1.7 VGLL2 chirag patel Classified gene: VGLL2 as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v1.7 VGLL2 chirag patel Gene: vgll2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.6 VGLL2 chirag patel gene: VGLL2 was added
gene: VGLL2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Other
Mode of inheritance for gene: VGLL2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VGLL2 were set to Syngnathia
Review for gene: VGLL2 was set to GREEN
Added comment: ESHG 2023:
4 families/7 affected individuals with isolated unilateral/bilateral syngnathia
biallelic truncating variants in VGLL2
But not phenotype in KO mouse or zebrafish models
Sources: Other
Mandibulofacial Acrofacial dysostosis v1.5 Zornitza Stark HPO terms changed from to Craniofacial dysostosis, HP:0004439
List of related panels changed from to Craniofacial dysostosis; HP:0004439
Mandibulofacial Acrofacial dysostosis v1.4 FOXI3 Zornitza Stark Marked gene: FOXI3 as ready
Mandibulofacial Acrofacial dysostosis v1.4 FOXI3 Zornitza Stark Gene: foxi3 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.4 FOXI3 Zornitza Stark Phenotypes for gene: FOXI3 were changed from Craniofacial microsomia to Dysostosis with predominant craniofacial involvement (MONDO:0800085)
Mandibulofacial Acrofacial dysostosis v1.3 FOXI3 Zornitza Stark Mode of inheritance for gene: FOXI3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v1.2 FOXI3 Zornitza Stark Classified gene: FOXI3 as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v1.2 FOXI3 Zornitza Stark Gene: foxi3 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.1 FOXI3 Paul De Fazio edited their review of gene: FOXI3: Changed phenotypes: Dysostosis with predominant craniofacial involvement (MONDO:0800085)
Mandibulofacial Acrofacial dysostosis v1.1 FOXI3 Paul De Fazio gene: FOXI3 was added
gene: FOXI3 was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature
Mode of inheritance for gene: FOXI3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FOXI3 were set to 36260083
Phenotypes for gene: FOXI3 were set to Craniofacial microsomia
Penetrance for gene: FOXI3 were set to Incomplete
Review for gene: FOXI3 was set to GREEN
gene: FOXI3 was marked as current diagnostic
Added comment: Ten affected individuals from 4 families reported with monoallelic variants, 2 with missense variants affecting the nuclear localisation sequence and 2 with frameshift variants.

The missense variants were associated with isolated microtia with aural atresia and affected subcellular localisation of the protein, while the frameshift variants were associated with microtia and mandubular hypoplasia, suggesting dosage sensitivity.

Rated green but CAUTION for incomplete penetrance. 3 of the 4 families had unaffected carriers. Family 1 in particular had 25 genotyped individuals, of which 15 were carriers, of which 5 were affected.
Sources: Literature
Mandibulofacial Acrofacial dysostosis v1.1 SF3B2 Zornitza Stark Phenotypes for gene: SF3B2 were changed from Craniofacial microsomia to Craniofacial microsomia, MIM#164210
Mandibulofacial Acrofacial dysostosis v1.0 EIF4A3 Zornitza Stark Tag STR tag was added to gene: EIF4A3.
Mandibulofacial Acrofacial dysostosis v1.0 PRRX1 Zornitza Stark edited their review of gene: PRRX1: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v1.0 Zornitza Stark promoted panel to version 1.0
Mandibulofacial Acrofacial dysostosis v0.105 RPS26 Zornitza Stark Classified gene: RPS26 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.105 RPS26 Zornitza Stark Gene: rps26 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.104 RPS26 Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb anomalies are a feature.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap.
Mandibulofacial Acrofacial dysostosis v0.104 RPS26 Zornitza Stark edited their review of gene: RPS26: Changed rating: AMBER
Mandibulofacial Acrofacial dysostosis v0.104 RPL5 Zornitza Stark Classified gene: RPL5 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.104 RPL5 Zornitza Stark Gene: rpl5 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.103 RPL5 Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb anomalies are a feature.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap.
Mandibulofacial Acrofacial dysostosis v0.103 RPL5 Zornitza Stark edited their review of gene: RPL5: Changed rating: AMBER
Mandibulofacial Acrofacial dysostosis v0.103 RPL11 Zornitza Stark Classified gene: RPL11 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.103 RPL11 Zornitza Stark Gene: rpl11 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.102 RPL11 Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb abnormalities are common.; to: Well established gene-disease association. Craniofacial and limb abnormalities are common, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap.
Mandibulofacial Acrofacial dysostosis v0.102 RPL11 Zornitza Stark edited their review of gene: RPL11: Changed rating: AMBER
Mandibulofacial Acrofacial dysostosis v0.100 EVC2 Zornitza Stark Marked gene: EVC2 as ready
Mandibulofacial Acrofacial dysostosis v0.100 EVC2 Zornitza Stark Gene: evc2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.100 EVC2 Zornitza Stark Phenotypes for gene: EVC2 were changed from to Ellis-van Creveld syndrome, MIM# 225500; Weyers acrofacial dysostosis, MIM# 193530
Mandibulofacial Acrofacial dysostosis v0.99 EVC2 Zornitza Stark Publications for gene: EVC2 were set to
Mandibulofacial Acrofacial dysostosis v0.98 EVC2 Zornitza Stark Mode of inheritance for gene: EVC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.97 EVC2 Zornitza Stark reviewed gene: EVC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16404586, 19810119; Phenotypes: Ellis-van Creveld syndrome, MIM# 225500, Weyers acrofacial dysostosis, MIM# 193530; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.97 EVC Zornitza Stark Marked gene: EVC as ready
Mandibulofacial Acrofacial dysostosis v0.97 EVC Zornitza Stark Gene: evc has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.97 EVC Zornitza Stark Phenotypes for gene: EVC were changed from to Weyers acrofacial dysostosis, MIM# 193530; Ellis-van Creveld syndrome, MIM# 225500
Mandibulofacial Acrofacial dysostosis v0.96 EVC Zornitza Stark Publications for gene: EVC were set to
Mandibulofacial Acrofacial dysostosis v0.95 EVC Zornitza Stark Mode of inheritance for gene: EVC was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.94 EVC Zornitza Stark edited their review of gene: EVC: Changed rating: GREEN
Mandibulofacial Acrofacial dysostosis v0.94 EVC Zornitza Stark reviewed gene: EVC: Rating: ; Mode of pathogenicity: None; Publications: 10700184, 23220543; Phenotypes: Weyers acrofacial dysostosis, MIM# 193530, Ellis-van Creveld syndrome, MIM# 225500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.94 SNRPB Zornitza Stark Tag 5'UTR tag was added to gene: SNRPB.
Tag deep intronic tag was added to gene: SNRPB.
Mandibulofacial Acrofacial dysostosis v0.94 SNRPB Zornitza Stark Marked gene: SNRPB as ready
Mandibulofacial Acrofacial dysostosis v0.94 SNRPB Zornitza Stark Gene: snrpb has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.94 SNRPB Zornitza Stark Phenotypes for gene: SNRPB were changed from to Cerebrocostomandibular syndrome, MIM# 117650
Mandibulofacial Acrofacial dysostosis v0.93 SNRPB Zornitza Stark Publications for gene: SNRPB were set to
Mandibulofacial Acrofacial dysostosis v0.92 SNRPB Zornitza Stark Mode of inheritance for gene: SNRPB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.91 SNRPB Zornitza Stark reviewed gene: SNRPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25047197, 25504470, 26971886; Phenotypes: Cerebrocostomandibular syndrome, MIM# 117650; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.91 Zornitza Stark removed gene:SCARF2 from the panel
Mandibulofacial Acrofacial dysostosis v0.90 RPS26 Zornitza Stark Marked gene: RPS26 as ready
Mandibulofacial Acrofacial dysostosis v0.90 RPS26 Zornitza Stark Gene: rps26 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.90 RPS26 Zornitza Stark Phenotypes for gene: RPS26 were changed from to Diamond-Blackfan anemia 10, MIM# 613309; MONDO:0013217
Mandibulofacial Acrofacial dysostosis v0.89 RPS26 Zornitza Stark Publications for gene: RPS26 were set to
Mandibulofacial Acrofacial dysostosis v0.88 RPS26 Zornitza Stark Mode of inheritance for gene: RPS26 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.87 RPS26 Zornitza Stark changed review comment from: Well established gene-disease association.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature.
Mandibulofacial Acrofacial dysostosis v0.87 RPL5 Zornitza Stark Marked gene: RPL5 as ready
Mandibulofacial Acrofacial dysostosis v0.87 RPL5 Zornitza Stark Gene: rpl5 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.87 RPL5 Zornitza Stark Phenotypes for gene: RPL5 were changed from to Diamond-Blackfan anemia 6, MIM# 612561; MONDO:0012937
Mandibulofacial Acrofacial dysostosis v0.86 RPL5 Zornitza Stark Publications for gene: RPL5 were set to
Mandibulofacial Acrofacial dysostosis v0.85 RPL5 Zornitza Stark Mode of inheritance for gene: RPL5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.84 RPL5 Zornitza Stark changed review comment from: Well established gene-disease association.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature.
Mandibulofacial Acrofacial dysostosis v0.84 RBM10 Zornitza Stark Marked gene: RBM10 as ready
Mandibulofacial Acrofacial dysostosis v0.84 RBM10 Zornitza Stark Gene: rbm10 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.84 RBM10 Zornitza Stark Phenotypes for gene: RBM10 were changed from to TARP syndrome, MIM# 311900
Mandibulofacial Acrofacial dysostosis v0.83 RBM10 Zornitza Stark Publications for gene: RBM10 were set to
Mandibulofacial Acrofacial dysostosis v0.82 RBM10 Zornitza Stark Mode of inheritance for gene: RBM10 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mandibulofacial Acrofacial dysostosis v0.81 RBM10 Zornitza Stark reviewed gene: RBM10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20451169, 24259342, 30450804, 30189253, 33340101; Phenotypes: TARP syndrome, MIM# 311900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mandibulofacial Acrofacial dysostosis v0.81 Zornitza Stark removed gene:PUF60 from the panel
Mandibulofacial Acrofacial dysostosis v0.80 OTX2 Zornitza Stark Marked gene: OTX2 as ready
Mandibulofacial Acrofacial dysostosis v0.80 OTX2 Zornitza Stark Gene: otx2 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.80 OTX2 Zornitza Stark Classified gene: OTX2 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.80 OTX2 Zornitza Stark Gene: otx2 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.79 OTX2 Zornitza Stark gene: OTX2 was added
gene: OTX2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert Review
Mode of inheritance for gene: OTX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: OTX2 were set to 24167467; 25589041; 31969185
Phenotypes for gene: OTX2 were set to Otocephaly-dysgnathia complex
Review for gene: OTX2 was set to AMBER
Added comment: Three families reported with variants in OTX2 and otocyephaly-dysgnathia. Note variants were inherited in two of the families: in one family, from mother with microphthalmia (recognised OTX2 phenotype) and the other from an unaffected father. Lamb animal model reported.
Sources: Expert Review
Mandibulofacial Acrofacial dysostosis v0.78 PRRX1 Zornitza Stark Phenotypes for gene: PRRX1 were changed from Agnathia-otocephaly complex, MIM# 202650 to Agnathia-otocephaly complex, MIM# 202650
Mandibulofacial Acrofacial dysostosis v0.77 PRRX1 Zornitza Stark Marked gene: PRRX1 as ready
Mandibulofacial Acrofacial dysostosis v0.77 PRRX1 Zornitza Stark Gene: prrx1 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.77 PRRX1 Zornitza Stark Phenotypes for gene: PRRX1 were changed from to Agnathia-otocephaly complex, MIM# 202650
Mandibulofacial Acrofacial dysostosis v0.77 PRRX1 Zornitza Stark Publications for gene: PRRX1 were set to 21294718; 22211708; 22674740; 23444262
Mandibulofacial Acrofacial dysostosis v0.76 PRRX1 Zornitza Stark Publications for gene: PRRX1 were set to
Mandibulofacial Acrofacial dysostosis v0.76 PRRX1 Zornitza Stark Mode of inheritance for gene: PRRX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.75 PRRX1 Zornitza Stark reviewed gene: PRRX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21294718, 22211708, 22674740, 23444262; Phenotypes: Agnathia-otocephaly complex, MIM# 202650; Mode of inheritance: None
Mandibulofacial Acrofacial dysostosis v0.75 POLR1D Zornitza Stark edited their review of gene: POLR1D: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.75 POLR1D Zornitza Stark Mode of inheritance for gene: POLR1D was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.74 POLR1D Zornitza Stark Marked gene: POLR1D as ready
Mandibulofacial Acrofacial dysostosis v0.74 POLR1D Zornitza Stark Gene: polr1d has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.74 POLR1D Zornitza Stark Phenotypes for gene: POLR1D were changed from to Treacher Collins syndrome 2, MIM# 613717
Mandibulofacial Acrofacial dysostosis v0.73 POLR1D Zornitza Stark Publications for gene: POLR1D were set to
Mandibulofacial Acrofacial dysostosis v0.72 POLR1D Zornitza Stark Mode of inheritance for gene: POLR1D was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.71 POLR1D Zornitza Stark reviewed gene: POLR1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 21131976, 24603435, 27448281, 25790162; Phenotypes: Treacher Collins syndrome 2, MIM# 613717; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.71 RPL11 Zornitza Stark Marked gene: RPL11 as ready
Mandibulofacial Acrofacial dysostosis v0.71 RPL11 Zornitza Stark Gene: rpl11 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.71 RPL11 Zornitza Stark Phenotypes for gene: RPL11 were changed from to Diamond-Blackfan anemia 7, MIM# 612562; MONDO:0012938
Mandibulofacial Acrofacial dysostosis v0.70 RPL11 Zornitza Stark Publications for gene: RPL11 were set to
Mandibulofacial Acrofacial dysostosis v0.69 RPL11 Zornitza Stark Mode of inheritance for gene: RPL11 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.68 RPL11 Zornitza Stark changed review comment from: Well established gene-disease association.; to: Well established gene-disease association. Craniofacial and limb abnormalities are common.
Mandibulofacial Acrofacial dysostosis v0.68 POLR1C Zornitza Stark Marked gene: POLR1C as ready
Mandibulofacial Acrofacial dysostosis v0.68 POLR1C Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.68 POLR1C Zornitza Stark Phenotypes for gene: POLR1C were changed from to Treacher Collins syndrome 3, MIM# 248390
Mandibulofacial Acrofacial dysostosis v0.67 POLR1C Zornitza Stark Publications for gene: POLR1C were set to
Mandibulofacial Acrofacial dysostosis v0.66 POLR1C Zornitza Stark Mode of inheritance for gene: POLR1C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.65 POLR1C Zornitza Stark reviewed gene: POLR1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 21131976, 30957429; Phenotypes: Treacher Collins syndrome 3, MIM# 248390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.65 SF3B4 Zornitza Stark Marked gene: SF3B4 as ready
Mandibulofacial Acrofacial dysostosis v0.65 SF3B4 Zornitza Stark Gene: sf3b4 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.65 SF3B4 Zornitza Stark Phenotypes for gene: SF3B4 were changed from to Acrofacial dysostosis 1, Nager type, MIM# 154400
Mandibulofacial Acrofacial dysostosis v0.64 SF3B4 Zornitza Stark Publications for gene: SF3B4 were set to
Mandibulofacial Acrofacial dysostosis v0.63 SF3B4 Zornitza Stark Mode of inheritance for gene: SF3B4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.62 SF3B4 Zornitza Stark reviewed gene: SF3B4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22541558, 23568615, 24003905; Phenotypes: Acrofacial dysostosis 1, Nager type, MIM# 154400; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.62 TMCO1 Zornitza Stark Marked gene: TMCO1 as ready
Mandibulofacial Acrofacial dysostosis v0.62 TMCO1 Zornitza Stark Gene: tmco1 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.62 TMCO1 Zornitza Stark Phenotypes for gene: TMCO1 were changed from to Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome, MIM# 213980
Mandibulofacial Acrofacial dysostosis v0.61 TMCO1 Zornitza Stark Publications for gene: TMCO1 were set to
Mandibulofacial Acrofacial dysostosis v0.60 TMCO1 Zornitza Stark Mode of inheritance for gene: TMCO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.59 TMCO1 Zornitza Stark changed review comment from: Clinical features include severe intellectual disability, as well as distinctive craniofacial features, including brachycephaly, synophrys, arched eyebrows, "cupid's bow" upper lip, and microdontia. In addition, nonspecific skeletal anomalies are common, including bifid ribs, scoliosis, and spinal fusion.

More than 20 individuals reported.; to: Clinical features include severe intellectual disability, as well as distinctive craniofacial features, including brachycephaly, synophrys, arched eyebrows, "cupid's bow" upper lip, and microdontia. In addition, nonspecific skeletal anomalies are common, including bifid ribs, scoliosis, and spinal fusion.

More than 20 individuals reported. c.292_293del (p.Ser98*) variant has been identified in multiple individuals from different ethnicities.
Mandibulofacial Acrofacial dysostosis v0.59 TMCO1 Zornitza Stark reviewed gene: TMCO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20018682, 23320496, 17351359, 30556256, 31102500; Phenotypes: Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome, MIM# 213980; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.59 SF3B2 Zornitza Stark Marked gene: SF3B2 as ready
Mandibulofacial Acrofacial dysostosis v0.59 SF3B2 Zornitza Stark Gene: sf3b2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.59 SF3B2 Zornitza Stark Classified gene: SF3B2 as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v0.59 SF3B2 Zornitza Stark Gene: sf3b2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.58 SF3B2 Zornitza Stark gene: SF3B2 was added
gene: SF3B2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature
Mode of inheritance for gene: SF3B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SF3B2 were set to 34344887
Phenotypes for gene: SF3B2 were set to Craniofacial microsomia
Review for gene: SF3B2 was set to GREEN
Added comment: Twenty individuals from seven families reported with de novo or transmitted haploinsufficient variants in SF3B2. Affected individuals had mandibular hypoplasia, microtia, facial and preauricular tags, epibulbar dermoids, lateral oral clefts in addition to skeletal and cardiac abnormalities.

Targeted morpholino knockdown of SF3B2 in Xenopus resulted in disruption of cranial neural crest precursor formation and subsequent craniofacial cartilage defects, supporting a link between spliceosome mutations and impaired neural crest development in congenital craniofacial disease.

The families were ascertained from a cohort and the authors suggest that haploinsufficient variants in SF3B2 are the most prevalent genetic cause of CFM, explaining ~3% of sporadic and ~25% of familial cases.
Sources: Literature
Mandibulofacial Acrofacial dysostosis v0.57 PLCB4 Zornitza Stark Marked gene: PLCB4 as ready
Mandibulofacial Acrofacial dysostosis v0.57 PLCB4 Zornitza Stark Gene: plcb4 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.57 PLCB4 Zornitza Stark Phenotypes for gene: PLCB4 were changed from to Auriculocondylar syndrome 2, MIM# 614669
Mandibulofacial Acrofacial dysostosis v0.56 PLCB4 Zornitza Stark Publications for gene: PLCB4 were set to
Mandibulofacial Acrofacial dysostosis v0.55 PLCB4 Zornitza Stark Mode of pathogenicity for gene: PLCB4 was changed from to Other
Mandibulofacial Acrofacial dysostosis v0.54 PLCB4 Zornitza Stark Mode of inheritance for gene: PLCB4 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.53 PLCB4 Zornitza Stark reviewed gene: PLCB4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22560091, 23315542, 33131036, 32201334, 28328130, 27007857, 23913798; Phenotypes: Auriculocondylar syndrome 2, MIM# 614669; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.53 PBX1 Zornitza Stark Marked gene: PBX1 as ready
Mandibulofacial Acrofacial dysostosis v0.53 PBX1 Zornitza Stark Gene: pbx1 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.53 PBX1 Zornitza Stark Phenotypes for gene: PBX1 were changed from to Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, MIM# 617641
Mandibulofacial Acrofacial dysostosis v0.52 PBX1 Zornitza Stark Publications for gene: PBX1 were set to
Mandibulofacial Acrofacial dysostosis v0.51 PBX1 Zornitza Stark Mode of inheritance for gene: PBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.50 PBX1 Zornitza Stark reviewed gene: PBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28566479, 29036646; Phenotypes: Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, MIM# 617641; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.49 EDN1 Zornitza Stark Marked gene: EDN1 as ready
Mandibulofacial Acrofacial dysostosis v0.49 EDN1 Zornitza Stark Gene: edn1 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.49 GSC Zornitza Stark Marked gene: GSC as ready
Mandibulofacial Acrofacial dysostosis v0.49 GSC Zornitza Stark Gene: gsc has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.49 GSC Zornitza Stark Phenotypes for gene: GSC were changed from to Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities, MIM# 602471
Mandibulofacial Acrofacial dysostosis v0.48 GSC Zornitza Stark Publications for gene: GSC were set to
Mandibulofacial Acrofacial dysostosis v0.47 GSC Zornitza Stark Mode of inheritance for gene: GSC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.46 GSC Zornitza Stark reviewed gene: GSC: Rating: GREEN; Mode of pathogenicity: None; Publications: 24290375; Phenotypes: Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities, MIM# 602471; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.46 GNAI3 Zornitza Stark Marked gene: GNAI3 as ready
Mandibulofacial Acrofacial dysostosis v0.46 GNAI3 Zornitza Stark Gene: gnai3 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.46 GNAI3 Zornitza Stark Phenotypes for gene: GNAI3 were changed from to Auriculocondylar syndrome 1, OMIM #602483
Mandibulofacial Acrofacial dysostosis v0.45 GNAI3 Zornitza Stark Publications for gene: GNAI3 were set to
Mandibulofacial Acrofacial dysostosis v0.44 GNAI3 Zornitza Stark Mode of inheritance for gene: GNAI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.43 GNAI3 Zornitza Stark reviewed gene: GNAI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 22560091; Phenotypes: Auriculocondylar syndrome 1, OMIM #602483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.43 EIF4A3 Zornitza Stark Marked gene: EIF4A3 as ready
Mandibulofacial Acrofacial dysostosis v0.43 EIF4A3 Zornitza Stark Gene: eif4a3 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.43 EIF4A3 Zornitza Stark Phenotypes for gene: EIF4A3 were changed from to Robin sequence with cleft mandible and limb anomalies, MIM# 268305; Richieri-Costa-Pereira syndrome
Mandibulofacial Acrofacial dysostosis v0.42 EIF4A3 Zornitza Stark Publications for gene: EIF4A3 were set to
Mandibulofacial Acrofacial dysostosis v0.41 EIF4A3 Zornitza Stark Mode of inheritance for gene: EIF4A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.40 EIF4A3 Zornitza Stark reviewed gene: EIF4A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360810; Phenotypes: Robin sequence with cleft mandible and limb anomalies, MIM# 268305, Richieri-Costa-Pereira syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.40 MYT1 Zornitza Stark Marked gene: MYT1 as ready
Mandibulofacial Acrofacial dysostosis v0.40 MYT1 Zornitza Stark Gene: myt1 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.40 MYT1 Zornitza Stark Phenotypes for gene: MYT1 were changed from to Craniofacial microsomia; OAV spectrum
Mandibulofacial Acrofacial dysostosis v0.39 MYT1 Zornitza Stark Publications for gene: MYT1 were set to
Mandibulofacial Acrofacial dysostosis v0.38 MYT1 Zornitza Stark Mode of inheritance for gene: MYT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.37 MYT1 Zornitza Stark reviewed gene: MYT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28612832, 32871052, 27358179; Phenotypes: Craniofacial microsomia, OAV spectrum; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.37 EDNRA Zornitza Stark Marked gene: EDNRA as ready
Mandibulofacial Acrofacial dysostosis v0.37 EDNRA Zornitza Stark Gene: ednra has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.37 EDNRA Zornitza Stark Phenotypes for gene: EDNRA were changed from to Mandibulofacial dysostosis with alopecia, MIM# 616367
Mandibulofacial Acrofacial dysostosis v0.36 EDNRA Zornitza Stark Publications for gene: EDNRA were set to
Mandibulofacial Acrofacial dysostosis v0.35 EDNRA Zornitza Stark Mode of inheritance for gene: EDNRA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.34 EDNRA Zornitza Stark reviewed gene: EDNRA: Rating: GREEN; Mode of pathogenicity: None; Publications: 25772936, 27671791; Phenotypes: Mandibulofacial dysostosis with alopecia, MIM# 616367; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.34 EDN1 Zornitza Stark Phenotypes for gene: EDN1 were changed from to Auriculocondylar syndrome 3, MIM# 615706
Mandibulofacial Acrofacial dysostosis v0.33 EDN1 Zornitza Stark Publications for gene: EDN1 were set to 23315542; 23913798; 24268655
Mandibulofacial Acrofacial dysostosis v0.33 EDN1 Zornitza Stark Publications for gene: EDN1 were set to
Mandibulofacial Acrofacial dysostosis v0.32 EDN1 Zornitza Stark Mode of inheritance for gene: EDN1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.31 EDN1 Zornitza Stark Classified gene: EDN1 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.31 EDN1 Zornitza Stark Gene: edn1 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.30 EDN1 Zornitza Stark reviewed gene: EDN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 23315542, 23913798, 24268655; Phenotypes: Auriculocondylar syndrome 3, MIM# 615706; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.30 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Mandibulofacial Acrofacial dysostosis v0.29 EFTUD2 Zornitza Stark Marked gene: EFTUD2 as ready
Mandibulofacial Acrofacial dysostosis v0.29 EFTUD2 Zornitza Stark Gene: eftud2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.29 EFTUD2 Zornitza Stark Phenotypes for gene: EFTUD2 were changed from to Mandibulofacial dysostosis, Guion-Almeida type, MIM# 610536; Mandibulofacial dysostosis-microcephaly syndrome MONDO:0012516
Mandibulofacial Acrofacial dysostosis v0.28 EFTUD2 Zornitza Stark Publications for gene: EFTUD2 were set to
Mandibulofacial Acrofacial dysostosis v0.27 EFTUD2 Zornitza Stark Mode of inheritance for gene: EFTUD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.26 EFTUD2 Zornitza Stark reviewed gene: EFTUD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22305528, 23188108, 33601405, 33262786, 26507355; Phenotypes: Mandibulofacial dysostosis, Guion-Almeida type, MIM# 610536, Mandibulofacial dysostosis-microcephaly syndrome MONDO:0012516; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.26 TXNL4A Zornitza Stark Tag SV/CNV tag was added to gene: TXNL4A.
Tag 5'UTR tag was added to gene: TXNL4A.
Mandibulofacial Acrofacial dysostosis v0.26 TXNL4A Zornitza Stark Marked gene: TXNL4A as ready
Mandibulofacial Acrofacial dysostosis v0.26 TXNL4A Zornitza Stark Gene: txnl4a has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.26 TXNL4A Zornitza Stark Phenotypes for gene: TXNL4A were changed from to Burn-McKeown syndrome, MIM# 608572; Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064
Mandibulofacial Acrofacial dysostosis v0.25 TXNL4A Zornitza Stark Publications for gene: TXNL4A were set to
Mandibulofacial Acrofacial dysostosis v0.24 TXNL4A Zornitza Stark Mode of inheritance for gene: TXNL4A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.23 TXNL4A Zornitza Stark reviewed gene: TXNL4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25434003; Phenotypes: Burn-McKeown syndrome, MIM# 608572, Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.23 DHODH Zornitza Stark Marked gene: DHODH as ready
Mandibulofacial Acrofacial dysostosis v0.23 DHODH Zornitza Stark Gene: dhodh has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.23 DHODH Zornitza Stark Phenotypes for gene: DHODH were changed from to Miller syndrome, MIM# 263750
Mandibulofacial Acrofacial dysostosis v0.22 DHODH Zornitza Stark Publications for gene: DHODH were set to
Mandibulofacial Acrofacial dysostosis v0.21 DHODH Zornitza Stark Mode of inheritance for gene: DHODH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.20 DHODH Zornitza Stark reviewed gene: DHODH: Rating: GREEN; Mode of pathogenicity: None; Publications: 19915526, 20220176, 33262786, 27370710; Phenotypes: Miller syndrome, MIM# 263750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mandibulofacial Acrofacial dysostosis v0.20 POLR1A Zornitza Stark Marked gene: POLR1A as ready
Mandibulofacial Acrofacial dysostosis v0.20 POLR1A Zornitza Stark Gene: polr1a has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.20 POLR1A Zornitza Stark Phenotypes for gene: POLR1A were changed from to Acrofacial dysostosis, Cincinnati type, MIM# 616462
Mandibulofacial Acrofacial dysostosis v0.19 POLR1A Zornitza Stark Publications for gene: POLR1A were set to 25913037
Mandibulofacial Acrofacial dysostosis v0.19 POLR1A Zornitza Stark Publications for gene: POLR1A were set to
Mandibulofacial Acrofacial dysostosis v0.18 POLR1A Zornitza Stark Mode of inheritance for gene: POLR1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.17 POLR1A Zornitza Stark reviewed gene: POLR1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25913037; Phenotypes: Acrofacial dysostosis, Cincinnati type, MIM# 616462; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.17 MTX2 Zornitza Stark Phenotypes for gene: MTX2 were changed from Mandibuloacral dysplasia; lipodystrophy; arterial calcification to Mandibuloacral dysplasia progeroid syndrome, MIM# 619127; Mandibuloacral dysplasia; lipodystrophy; arterial calcification
Mandibulofacial Acrofacial dysostosis v0.16 MTX2 Zornitza Stark edited their review of gene: MTX2: Changed phenotypes: Mandibuloacral dysplasia progeroid syndrome, MIM# 619127, Mandibuloacral dysplasia, lipodystrophy, arterial calcification
Mandibulofacial Acrofacial dysostosis v0.16 MTX2 Zornitza Stark Marked gene: MTX2 as ready
Mandibulofacial Acrofacial dysostosis v0.16 MTX2 Zornitza Stark Gene: mtx2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.16 MTX2 Zornitza Stark Classified gene: MTX2 as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v0.16 MTX2 Zornitza Stark Gene: mtx2 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.15 MTX2 Zornitza Stark gene: MTX2 was added
gene: MTX2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature
Mode of inheritance for gene: MTX2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MTX2 were set to 32917887
Phenotypes for gene: MTX2 were set to Mandibuloacral dysplasia; lipodystrophy; arterial calcification
Review for gene: MTX2 was set to GREEN
Added comment: Seven individuals from 5 unrelated families reported with severe progeroid form of MAD with growth retardation, small viscerocranium with mandibular underdevelopment, distal acro-osteolyses, lipodystrophy, altered skin pigmentation, renal focal glomerulosclerosis, and extremely severe hypertension in most cases, eventually associated with disseminated arterial calcification. Loss of MTX2 in patients' primary fibroblasts led to loss of Metaxin-1 (MTX1) and mitochondrial dysfunction, including network fragmentation and oxidative phosphorylation impairment. Furthermore, patients' fibroblasts were resistant to induced apoptosis, leading to increased cell senescence and mitophagy and reduced proliferation.
Sources: Literature
Mandibulofacial Acrofacial dysostosis v0.14 TSR2 Zornitza Stark Marked gene: TSR2 as ready
Mandibulofacial Acrofacial dysostosis v0.14 TSR2 Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence).
Mandibulofacial Acrofacial dysostosis v0.14 TSR2 Zornitza Stark Phenotypes for gene: TSR2 were changed from to Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946
Mandibulofacial Acrofacial dysostosis v0.13 TSR2 Zornitza Stark Publications for gene: TSR2 were set to
Mandibulofacial Acrofacial dysostosis v0.12 TSR2 Zornitza Stark Mode of inheritance for gene: TSR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mandibulofacial Acrofacial dysostosis v0.11 TSR2 Zornitza Stark Classified gene: TSR2 as Red List (low evidence)
Mandibulofacial Acrofacial dysostosis v0.11 TSR2 Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence).
Mandibulofacial Acrofacial dysostosis v0.10 TSR2 Zornitza Stark reviewed gene: TSR2: Rating: RED; Mode of pathogenicity: None; Publications: 24942156; Phenotypes: Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mandibulofacial Acrofacial dysostosis v0.10 RPS28 Zornitza Stark Marked gene: RPS28 as ready
Mandibulofacial Acrofacial dysostosis v0.10 RPS28 Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.10 RPS28 Zornitza Stark Phenotypes for gene: RPS28 were changed from to Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164
Mandibulofacial Acrofacial dysostosis v0.9 RPS28 Zornitza Stark Publications for gene: RPS28 were set to
Mandibulofacial Acrofacial dysostosis v0.8 RPS28 Zornitza Stark Mode of inheritance for gene: RPS28 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.7 RPS28 Zornitza Stark Classified gene: RPS28 as Amber List (moderate evidence)
Mandibulofacial Acrofacial dysostosis v0.7 RPS28 Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence).
Mandibulofacial Acrofacial dysostosis v0.6 RPS28 Zornitza Stark reviewed gene: RPS28: Rating: AMBER; Mode of pathogenicity: None; Publications: 24942156; Phenotypes: Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.6 TCOF1 Zornitza Stark Marked gene: TCOF1 as ready
Mandibulofacial Acrofacial dysostosis v0.6 TCOF1 Zornitza Stark Gene: tcof1 has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.6 TCOF1 Zornitza Stark Phenotypes for gene: TCOF1 were changed from to Treacher Collins syndrome 1, MIM# 154500
Mandibulofacial Acrofacial dysostosis v0.5 TCOF1 Zornitza Stark Publications for gene: TCOF1 were set to
Mandibulofacial Acrofacial dysostosis v0.4 TCOF1 Zornitza Stark Mode of inheritance for gene: TCOF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.3 TCOF1 Melanie Marty changed review comment from: The majority of the variants reported are PTCs that lead to truncation or NMD (PMID: 21951868). More than 60% cases arise from de novo variants (PMID: 15150774, 21951868). Penetrance of the genetic variants causing TCS is thought to be very high. However, extreme inter- and intra- familial phenotypic variation has been reported (PMID: 15150774).; to: The majority of the variants reported are PTCs that lead to truncation or NMD, only a few missense have been reported (ClinVar; PMID: 21951868). More than 60% cases arise from de novo variants (PMID: 15150774, 21951868). Penetrance of the genetic variants causing TCS is thought to be very high. However, extreme inter- and intra- familial phenotypic variation has been reported (PMID: 15150774).
Mandibulofacial Acrofacial dysostosis v0.3 TCOF1 Melanie Marty changed review comment from: The majority of the variants reported are PTCs that lead to truncation or NMD (PMID: 21951868). More than 60% cases arise from de novo variants (PMID: 15150774, 21951868). Penetrance of the genetic variants causing TCS is thought to be very high. However, extreme inter- and intra- familial phenotypic variation has been reported (PMID: 15150774).; to: The majority of the variants reported are PTCs that lead to truncation or NMD (PMID: 21951868). More than 60% cases arise from de novo variants (PMID: 15150774, 21951868). Penetrance of the genetic variants causing TCS is thought to be very high. However, extreme inter- and intra- familial phenotypic variation has been reported (PMID: 15150774).
Mandibulofacial Acrofacial dysostosis v0.3 TCOF1 Melanie Marty reviewed gene: TCOF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12444270, 15150774, 21951868; Phenotypes: Treacher Collins syndrome 1 154500; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mandibulofacial Acrofacial dysostosis v0.3 POLR1B Zornitza Stark Marked gene: POLR1B as ready
Mandibulofacial Acrofacial dysostosis v0.3 POLR1B Zornitza Stark Gene: polr1b has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.3 POLR1B Zornitza Stark Classified gene: POLR1B as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v0.3 POLR1B Zornitza Stark Gene: polr1b has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v0.2 POLR1B Zornitza Stark gene: POLR1B was added
gene: POLR1B was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature
Mode of inheritance for gene: POLR1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: POLR1B were set to 31649276
Phenotypes for gene: POLR1B were set to Treacher-Collins syndrome type 4
Review for gene: POLR1B was set to GREEN
Added comment: Five unrelated families and a zebrafish model, variant inherited in two of the families, once from affected parent and once from mosaic parent. Note four of the families had missense variants affecting same residue, p.Arg1003
Sources: Literature
Mandibulofacial Acrofacial dysostosis v0.1 Zornitza Stark Panel name changed from Mandibulofacial Acrofacial dysostosis_VCGS to Mandibulofacial Acrofacial dysostosis
Panel types changed to Victorian Clinical Genetics Services
Mandibulofacial Acrofacial dysostosis v0.0 TXNL4A Zornitza Stark gene: TXNL4A was added
gene: TXNL4A was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: TXNL4A was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 TSR2 Zornitza Stark gene: TSR2 was added
gene: TSR2 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: TSR2 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 TMCO1 Zornitza Stark gene: TMCO1 was added
gene: TMCO1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: TMCO1 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 TCOF1 Zornitza Stark gene: TCOF1 was added
gene: TCOF1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: TCOF1 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 SNRPB Zornitza Stark gene: SNRPB was added
gene: SNRPB was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: SNRPB was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 SF3B4 Zornitza Stark gene: SF3B4 was added
gene: SF3B4 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: SF3B4 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 SCARF2 Zornitza Stark gene: SCARF2 was added
gene: SCARF2 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: SCARF2 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 RPS28 Zornitza Stark gene: RPS28 was added
gene: RPS28 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: RPS28 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 RPS26 Zornitza Stark gene: RPS26 was added
gene: RPS26 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: RPS26 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 RPL5 Zornitza Stark gene: RPL5 was added
gene: RPL5 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: RPL5 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 RPL11 Zornitza Stark gene: RPL11 was added
gene: RPL11 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: RPL11 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 RBM10 Zornitza Stark gene: RBM10 was added
gene: RBM10 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: RBM10 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 PUF60 Zornitza Stark gene: PUF60 was added
gene: PUF60 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: PUF60 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 PRRX1 Zornitza Stark gene: PRRX1 was added
gene: PRRX1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: PRRX1 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 POLR1D Zornitza Stark gene: POLR1D was added
gene: POLR1D was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: POLR1D was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 POLR1C Zornitza Stark gene: POLR1C was added
gene: POLR1C was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: POLR1C was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 POLR1A Zornitza Stark gene: POLR1A was added
gene: POLR1A was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: POLR1A was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 PLCB4 Zornitza Stark gene: PLCB4 was added
gene: PLCB4 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: PLCB4 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 PBX1 Zornitza Stark gene: PBX1 was added
gene: PBX1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: PBX1 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 MYT1 Zornitza Stark gene: MYT1 was added
gene: MYT1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: MYT1 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 GSC Zornitza Stark gene: GSC was added
gene: GSC was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: GSC was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 GNAI3 Zornitza Stark gene: GNAI3 was added
gene: GNAI3 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: GNAI3 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 EVC2 Zornitza Stark gene: EVC2 was added
gene: EVC2 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EVC2 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 EVC Zornitza Stark gene: EVC was added
gene: EVC was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EVC was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 EIF4A3 Zornitza Stark gene: EIF4A3 was added
gene: EIF4A3 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EIF4A3 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 EFTUD2 Zornitza Stark gene: EFTUD2 was added
gene: EFTUD2 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EFTUD2 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 EDNRA Zornitza Stark gene: EDNRA was added
gene: EDNRA was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EDNRA was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 EDN1 Zornitza Stark gene: EDN1 was added
gene: EDN1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: EDN1 was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 DHODH Zornitza Stark gene: DHODH was added
gene: DHODH was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: DHODH was set to Unknown
Mandibulofacial Acrofacial dysostosis v0.0 Zornitza Stark Added panel Mandibulofacial Acrofacial dysostosis_VCGS