| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.13 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.12 | SHROOM3 | Zornitza Stark Marked gene: SHROOM3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.12 | SHROOM3 | Zornitza Stark Gene: shroom3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.12 | SHROOM3 | Chirag Patel Classified gene: SHROOM3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.12 | SHROOM3 | Chirag Patel Gene: shroom3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.12 | SHROOM3 | Chirag Patel Classified gene: SHROOM3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.12 | SHROOM3 | Chirag Patel Gene: shroom3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.11 | SHROOM3 | Chirag Patel Classified gene: SHROOM3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.11 | SHROOM3 | Chirag Patel Gene: shroom3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.10 | SHROOM3 |
Chirag Patel gene: SHROOM3 was added gene: SHROOM3 was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature Mode of inheritance for gene: SHROOM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SHROOM3 were set to PMID: 39875538 Phenotypes for gene: SHROOM3 were set to Craniofacial microsomia MONDO:0015397 Review for gene: SHROOM3 was set to AMBER Added comment: SHROOM3 has been implicated in facial development via GWAS, with association between SHROOM3 and HFM, cleft lip/palate, orofacial clefts, and neural tube defects. Human embryo expression data shows that SHROOM3 is mainly expressed in craniofacial mesoderm, neural progenitor cells, and somites in the head and trunk regions. Mouse Genome Informatics data shows that Shroom3 is expressed in various tissues during different stages of embryonic development, including the head mesenchyme, ear, eye, face, and nose. Li et al. (2025) performed SHROOM3 gene sequencing in 320 sporadic hemifacial microsomia patients. They identified 7 individuals with 7 deleterious missense variants (MAF <0.005, CADD >20, predicted deleterious with >3 silico tools). No in vitro/in vivo functional studies to assess the consequences of the variants and their role in HFM. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.9 | PLCB4 | Zornitza Stark Phenotypes for gene: PLCB4 were changed from Auriculocondylar syndrome 2, MIM# 614669 to Auriculocondylar syndrome 2A, MIM# 614669; Auriculocondylar syndrome 2B, MIM# 620458 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.8 | PLCB4 | Zornitza Stark edited their review of gene: PLCB4: Changed phenotypes: Auriculocondylar syndrome 2A, MIM# 614669, Auriculocondylar syndrome 2B, MIM# 620458 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.8 | VGLL2 | Zornitza Stark Marked gene: VGLL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.8 | VGLL2 | Zornitza Stark Gene: vgll2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.8 | VGLL2 | Zornitza Stark Phenotypes for gene: VGLL2 were changed from Syngnathia to Syngnathia, MONDO:0015409, VGLL2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.7 | VGLL2 | Chirag Patel Classified gene: VGLL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.7 | VGLL2 | Chirag Patel Gene: vgll2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.6 | VGLL2 |
Chirag Patel gene: VGLL2 was added gene: VGLL2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Other Mode of inheritance for gene: VGLL2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: VGLL2 were set to Syngnathia Review for gene: VGLL2 was set to GREEN Added comment: ESHG 2023: 4 families/7 affected individuals with isolated unilateral/bilateral syngnathia biallelic truncating variants in VGLL2 But not phenotype in KO mouse or zebrafish models Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.5 |
Zornitza Stark HPO terms changed from to Craniofacial dysostosis, HP:0004439 List of related panels changed from to Craniofacial dysostosis; HP:0004439 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.4 | FOXI3 | Zornitza Stark Marked gene: FOXI3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.4 | FOXI3 | Zornitza Stark Gene: foxi3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.4 | FOXI3 | Zornitza Stark Phenotypes for gene: FOXI3 were changed from Craniofacial microsomia to Dysostosis with predominant craniofacial involvement (MONDO:0800085) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.3 | FOXI3 | Zornitza Stark Mode of inheritance for gene: FOXI3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.2 | FOXI3 | Zornitza Stark Classified gene: FOXI3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.2 | FOXI3 | Zornitza Stark Gene: foxi3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.1 | FOXI3 | Paul De Fazio edited their review of gene: FOXI3: Changed phenotypes: Dysostosis with predominant craniofacial involvement (MONDO:0800085) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.1 | FOXI3 |
Paul De Fazio gene: FOXI3 was added gene: FOXI3 was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature Mode of inheritance for gene: FOXI3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FOXI3 were set to 36260083 Phenotypes for gene: FOXI3 were set to Craniofacial microsomia Penetrance for gene: FOXI3 were set to Incomplete Review for gene: FOXI3 was set to GREEN gene: FOXI3 was marked as current diagnostic Added comment: Ten affected individuals from 4 families reported with monoallelic variants, 2 with missense variants affecting the nuclear localisation sequence and 2 with frameshift variants. The missense variants were associated with isolated microtia with aural atresia and affected subcellular localisation of the protein, while the frameshift variants were associated with microtia and mandubular hypoplasia, suggesting dosage sensitivity. Rated green but CAUTION for incomplete penetrance. 3 of the 4 families had unaffected carriers. Family 1 in particular had 25 genotyped individuals, of which 15 were carriers, of which 5 were affected. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.1 | SF3B2 | Zornitza Stark Phenotypes for gene: SF3B2 were changed from Craniofacial microsomia to Craniofacial microsomia, MIM#164210 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.0 | EIF4A3 | Zornitza Stark Tag STR tag was added to gene: EIF4A3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.0 | PRRX1 | Zornitza Stark edited their review of gene: PRRX1: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.0 | Zornitza Stark promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.105 | RPS26 | Zornitza Stark Classified gene: RPS26 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.105 | RPS26 | Zornitza Stark Gene: rps26 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.104 | RPS26 | Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb anomalies are a feature.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.104 | RPS26 | Zornitza Stark edited their review of gene: RPS26: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.104 | RPL5 | Zornitza Stark Classified gene: RPL5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.104 | RPL5 | Zornitza Stark Gene: rpl5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.103 | RPL5 | Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb anomalies are a feature.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.103 | RPL5 | Zornitza Stark edited their review of gene: RPL5: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.103 | RPL11 | Zornitza Stark Classified gene: RPL11 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.103 | RPL11 | Zornitza Stark Gene: rpl11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.102 | RPL11 | Zornitza Stark changed review comment from: Well established gene-disease association. Craniofacial and limb abnormalities are common.; to: Well established gene-disease association. Craniofacial and limb abnormalities are common, though not classically a facial dysostosis syndrome, included as Amber due to possible phenotypic overlap. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.102 | RPL11 | Zornitza Stark edited their review of gene: RPL11: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.100 | EVC2 | Zornitza Stark Marked gene: EVC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.100 | EVC2 | Zornitza Stark Gene: evc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.100 | EVC2 | Zornitza Stark Phenotypes for gene: EVC2 were changed from to Ellis-van Creveld syndrome, MIM# 225500; Weyers acrofacial dysostosis, MIM# 193530 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.99 | EVC2 | Zornitza Stark Publications for gene: EVC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.98 | EVC2 | Zornitza Stark Mode of inheritance for gene: EVC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.97 | EVC2 | Zornitza Stark reviewed gene: EVC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16404586, 19810119; Phenotypes: Ellis-van Creveld syndrome, MIM# 225500, Weyers acrofacial dysostosis, MIM# 193530; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.97 | EVC | Zornitza Stark Marked gene: EVC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.97 | EVC | Zornitza Stark Gene: evc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.97 | EVC | Zornitza Stark Phenotypes for gene: EVC were changed from to Weyers acrofacial dysostosis, MIM# 193530; Ellis-van Creveld syndrome, MIM# 225500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.96 | EVC | Zornitza Stark Publications for gene: EVC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.95 | EVC | Zornitza Stark Mode of inheritance for gene: EVC was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.94 | EVC | Zornitza Stark edited their review of gene: EVC: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.94 | EVC | Zornitza Stark reviewed gene: EVC: Rating: ; Mode of pathogenicity: None; Publications: 10700184, 23220543; Phenotypes: Weyers acrofacial dysostosis, MIM# 193530, Ellis-van Creveld syndrome, MIM# 225500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.94 | SNRPB |
Zornitza Stark Tag 5'UTR tag was added to gene: SNRPB. Tag deep intronic tag was added to gene: SNRPB. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.94 | SNRPB | Zornitza Stark Marked gene: SNRPB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.94 | SNRPB | Zornitza Stark Gene: snrpb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.94 | SNRPB | Zornitza Stark Phenotypes for gene: SNRPB were changed from to Cerebrocostomandibular syndrome, MIM# 117650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.93 | SNRPB | Zornitza Stark Publications for gene: SNRPB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.92 | SNRPB | Zornitza Stark Mode of inheritance for gene: SNRPB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.91 | SNRPB | Zornitza Stark reviewed gene: SNRPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25047197, 25504470, 26971886; Phenotypes: Cerebrocostomandibular syndrome, MIM# 117650; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.91 | Zornitza Stark removed gene:SCARF2 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.90 | RPS26 | Zornitza Stark Marked gene: RPS26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.90 | RPS26 | Zornitza Stark Gene: rps26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.90 | RPS26 | Zornitza Stark Phenotypes for gene: RPS26 were changed from to Diamond-Blackfan anemia 10, MIM# 613309; MONDO:0013217 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.89 | RPS26 | Zornitza Stark Publications for gene: RPS26 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.88 | RPS26 | Zornitza Stark Mode of inheritance for gene: RPS26 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.87 | RPS26 | Zornitza Stark changed review comment from: Well established gene-disease association.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.87 | RPL5 | Zornitza Stark Marked gene: RPL5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.87 | RPL5 | Zornitza Stark Gene: rpl5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.87 | RPL5 | Zornitza Stark Phenotypes for gene: RPL5 were changed from to Diamond-Blackfan anemia 6, MIM# 612561; MONDO:0012937 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.86 | RPL5 | Zornitza Stark Publications for gene: RPL5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.85 | RPL5 | Zornitza Stark Mode of inheritance for gene: RPL5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.84 | RPL5 | Zornitza Stark changed review comment from: Well established gene-disease association.; to: Well established gene-disease association. Craniofacial and limb anomalies are a feature. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.84 | RBM10 | Zornitza Stark Marked gene: RBM10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.84 | RBM10 | Zornitza Stark Gene: rbm10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.84 | RBM10 | Zornitza Stark Phenotypes for gene: RBM10 were changed from to TARP syndrome, MIM# 311900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.83 | RBM10 | Zornitza Stark Publications for gene: RBM10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.82 | RBM10 | Zornitza Stark Mode of inheritance for gene: RBM10 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.81 | RBM10 | Zornitza Stark reviewed gene: RBM10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20451169, 24259342, 30450804, 30189253, 33340101; Phenotypes: TARP syndrome, MIM# 311900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.81 | Zornitza Stark removed gene:PUF60 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.80 | OTX2 | Zornitza Stark Marked gene: OTX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.80 | OTX2 | Zornitza Stark Gene: otx2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.80 | OTX2 | Zornitza Stark Classified gene: OTX2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.80 | OTX2 | Zornitza Stark Gene: otx2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.79 | OTX2 |
Zornitza Stark gene: OTX2 was added gene: OTX2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert Review Mode of inheritance for gene: OTX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: OTX2 were set to 24167467; 25589041; 31969185 Phenotypes for gene: OTX2 were set to Otocephaly-dysgnathia complex Review for gene: OTX2 was set to AMBER Added comment: Three families reported with variants in OTX2 and otocyephaly-dysgnathia. Note variants were inherited in two of the families: in one family, from mother with microphthalmia (recognised OTX2 phenotype) and the other from an unaffected father. Lamb animal model reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.78 | PRRX1 | Zornitza Stark Phenotypes for gene: PRRX1 were changed from Agnathia-otocephaly complex, MIM# 202650 to Agnathia-otocephaly complex, MIM# 202650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.77 | PRRX1 | Zornitza Stark Marked gene: PRRX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.77 | PRRX1 | Zornitza Stark Gene: prrx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.77 | PRRX1 | Zornitza Stark Phenotypes for gene: PRRX1 were changed from to Agnathia-otocephaly complex, MIM# 202650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.77 | PRRX1 | Zornitza Stark Publications for gene: PRRX1 were set to 21294718; 22211708; 22674740; 23444262 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.76 | PRRX1 | Zornitza Stark Publications for gene: PRRX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.76 | PRRX1 | Zornitza Stark Mode of inheritance for gene: PRRX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.75 | PRRX1 | Zornitza Stark reviewed gene: PRRX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21294718, 22211708, 22674740, 23444262; Phenotypes: Agnathia-otocephaly complex, MIM# 202650; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.75 | POLR1D | Zornitza Stark edited their review of gene: POLR1D: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.75 | POLR1D | Zornitza Stark Mode of inheritance for gene: POLR1D was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.74 | POLR1D | Zornitza Stark Marked gene: POLR1D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.74 | POLR1D | Zornitza Stark Gene: polr1d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.74 | POLR1D | Zornitza Stark Phenotypes for gene: POLR1D were changed from to Treacher Collins syndrome 2, MIM# 613717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.73 | POLR1D | Zornitza Stark Publications for gene: POLR1D were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.72 | POLR1D | Zornitza Stark Mode of inheritance for gene: POLR1D was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.71 | POLR1D | Zornitza Stark reviewed gene: POLR1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 21131976, 24603435, 27448281, 25790162; Phenotypes: Treacher Collins syndrome 2, MIM# 613717; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.71 | RPL11 | Zornitza Stark Marked gene: RPL11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.71 | RPL11 | Zornitza Stark Gene: rpl11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.71 | RPL11 | Zornitza Stark Phenotypes for gene: RPL11 were changed from to Diamond-Blackfan anemia 7, MIM# 612562; MONDO:0012938 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.70 | RPL11 | Zornitza Stark Publications for gene: RPL11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.69 | RPL11 | Zornitza Stark Mode of inheritance for gene: RPL11 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.68 | RPL11 | Zornitza Stark changed review comment from: Well established gene-disease association.; to: Well established gene-disease association. Craniofacial and limb abnormalities are common. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.68 | POLR1C | Zornitza Stark Marked gene: POLR1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.68 | POLR1C | Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.68 | POLR1C | Zornitza Stark Phenotypes for gene: POLR1C were changed from to Treacher Collins syndrome 3, MIM# 248390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.67 | POLR1C | Zornitza Stark Publications for gene: POLR1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.66 | POLR1C | Zornitza Stark Mode of inheritance for gene: POLR1C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.65 | POLR1C | Zornitza Stark reviewed gene: POLR1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 21131976, 30957429; Phenotypes: Treacher Collins syndrome 3, MIM# 248390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.65 | SF3B4 | Zornitza Stark Marked gene: SF3B4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.65 | SF3B4 | Zornitza Stark Gene: sf3b4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.65 | SF3B4 | Zornitza Stark Phenotypes for gene: SF3B4 were changed from to Acrofacial dysostosis 1, Nager type, MIM# 154400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.64 | SF3B4 | Zornitza Stark Publications for gene: SF3B4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.63 | SF3B4 | Zornitza Stark Mode of inheritance for gene: SF3B4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.62 | SF3B4 | Zornitza Stark reviewed gene: SF3B4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22541558, 23568615, 24003905; Phenotypes: Acrofacial dysostosis 1, Nager type, MIM# 154400; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.62 | TMCO1 | Zornitza Stark Marked gene: TMCO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.62 | TMCO1 | Zornitza Stark Gene: tmco1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.62 | TMCO1 | Zornitza Stark Phenotypes for gene: TMCO1 were changed from to Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome, MIM# 213980 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.61 | TMCO1 | Zornitza Stark Publications for gene: TMCO1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.60 | TMCO1 | Zornitza Stark Mode of inheritance for gene: TMCO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.59 | TMCO1 |
Zornitza Stark changed review comment from: Clinical features include severe intellectual disability, as well as distinctive craniofacial features, including brachycephaly, synophrys, arched eyebrows, "cupid's bow" upper lip, and microdontia. In addition, nonspecific skeletal anomalies are common, including bifid ribs, scoliosis, and spinal fusion. More than 20 individuals reported.; to: Clinical features include severe intellectual disability, as well as distinctive craniofacial features, including brachycephaly, synophrys, arched eyebrows, "cupid's bow" upper lip, and microdontia. In addition, nonspecific skeletal anomalies are common, including bifid ribs, scoliosis, and spinal fusion. More than 20 individuals reported. c.292_293del (p.Ser98*) variant has been identified in multiple individuals from different ethnicities. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.59 | TMCO1 | Zornitza Stark reviewed gene: TMCO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20018682, 23320496, 17351359, 30556256, 31102500; Phenotypes: Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome, MIM# 213980; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.59 | SF3B2 | Zornitza Stark Marked gene: SF3B2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.59 | SF3B2 | Zornitza Stark Gene: sf3b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.59 | SF3B2 | Zornitza Stark Classified gene: SF3B2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.59 | SF3B2 | Zornitza Stark Gene: sf3b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.58 | SF3B2 |
Zornitza Stark gene: SF3B2 was added gene: SF3B2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature Mode of inheritance for gene: SF3B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SF3B2 were set to 34344887 Phenotypes for gene: SF3B2 were set to Craniofacial microsomia Review for gene: SF3B2 was set to GREEN Added comment: Twenty individuals from seven families reported with de novo or transmitted haploinsufficient variants in SF3B2. Affected individuals had mandibular hypoplasia, microtia, facial and preauricular tags, epibulbar dermoids, lateral oral clefts in addition to skeletal and cardiac abnormalities. Targeted morpholino knockdown of SF3B2 in Xenopus resulted in disruption of cranial neural crest precursor formation and subsequent craniofacial cartilage defects, supporting a link between spliceosome mutations and impaired neural crest development in congenital craniofacial disease. The families were ascertained from a cohort and the authors suggest that haploinsufficient variants in SF3B2 are the most prevalent genetic cause of CFM, explaining ~3% of sporadic and ~25% of familial cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.57 | PLCB4 | Zornitza Stark Marked gene: PLCB4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.57 | PLCB4 | Zornitza Stark Gene: plcb4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.57 | PLCB4 | Zornitza Stark Phenotypes for gene: PLCB4 were changed from to Auriculocondylar syndrome 2, MIM# 614669 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.56 | PLCB4 | Zornitza Stark Publications for gene: PLCB4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.55 | PLCB4 | Zornitza Stark Mode of pathogenicity for gene: PLCB4 was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.54 | PLCB4 | Zornitza Stark Mode of inheritance for gene: PLCB4 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.53 | PLCB4 | Zornitza Stark reviewed gene: PLCB4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22560091, 23315542, 33131036, 32201334, 28328130, 27007857, 23913798; Phenotypes: Auriculocondylar syndrome 2, MIM# 614669; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.53 | PBX1 | Zornitza Stark Marked gene: PBX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.53 | PBX1 | Zornitza Stark Gene: pbx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.53 | PBX1 | Zornitza Stark Phenotypes for gene: PBX1 were changed from to Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, MIM# 617641 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.52 | PBX1 | Zornitza Stark Publications for gene: PBX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.51 | PBX1 | Zornitza Stark Mode of inheritance for gene: PBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.50 | PBX1 | Zornitza Stark reviewed gene: PBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28566479, 29036646; Phenotypes: Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, MIM# 617641; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.49 | EDN1 | Zornitza Stark Marked gene: EDN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.49 | EDN1 | Zornitza Stark Gene: edn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.49 | GSC | Zornitza Stark Marked gene: GSC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.49 | GSC | Zornitza Stark Gene: gsc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.49 | GSC | Zornitza Stark Phenotypes for gene: GSC were changed from to Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities, MIM# 602471 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.48 | GSC | Zornitza Stark Publications for gene: GSC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.47 | GSC | Zornitza Stark Mode of inheritance for gene: GSC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.46 | GSC | Zornitza Stark reviewed gene: GSC: Rating: GREEN; Mode of pathogenicity: None; Publications: 24290375; Phenotypes: Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities, MIM# 602471; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.46 | GNAI3 | Zornitza Stark Marked gene: GNAI3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.46 | GNAI3 | Zornitza Stark Gene: gnai3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.46 | GNAI3 | Zornitza Stark Phenotypes for gene: GNAI3 were changed from to Auriculocondylar syndrome 1, OMIM #602483 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.45 | GNAI3 | Zornitza Stark Publications for gene: GNAI3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.44 | GNAI3 | Zornitza Stark Mode of inheritance for gene: GNAI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.43 | GNAI3 | Zornitza Stark reviewed gene: GNAI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 22560091; Phenotypes: Auriculocondylar syndrome 1, OMIM #602483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.43 | EIF4A3 | Zornitza Stark Marked gene: EIF4A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.43 | EIF4A3 | Zornitza Stark Gene: eif4a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.43 | EIF4A3 | Zornitza Stark Phenotypes for gene: EIF4A3 were changed from to Robin sequence with cleft mandible and limb anomalies, MIM# 268305; Richieri-Costa-Pereira syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.42 | EIF4A3 | Zornitza Stark Publications for gene: EIF4A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.41 | EIF4A3 | Zornitza Stark Mode of inheritance for gene: EIF4A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.40 | EIF4A3 | Zornitza Stark reviewed gene: EIF4A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360810; Phenotypes: Robin sequence with cleft mandible and limb anomalies, MIM# 268305, Richieri-Costa-Pereira syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.40 | MYT1 | Zornitza Stark Marked gene: MYT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.40 | MYT1 | Zornitza Stark Gene: myt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.40 | MYT1 | Zornitza Stark Phenotypes for gene: MYT1 were changed from to Craniofacial microsomia; OAV spectrum | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.39 | MYT1 | Zornitza Stark Publications for gene: MYT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.38 | MYT1 | Zornitza Stark Mode of inheritance for gene: MYT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.37 | MYT1 | Zornitza Stark reviewed gene: MYT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28612832, 32871052, 27358179; Phenotypes: Craniofacial microsomia, OAV spectrum; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.37 | EDNRA | Zornitza Stark Marked gene: EDNRA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.37 | EDNRA | Zornitza Stark Gene: ednra has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.37 | EDNRA | Zornitza Stark Phenotypes for gene: EDNRA were changed from to Mandibulofacial dysostosis with alopecia, MIM# 616367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.36 | EDNRA | Zornitza Stark Publications for gene: EDNRA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.35 | EDNRA | Zornitza Stark Mode of inheritance for gene: EDNRA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.34 | EDNRA | Zornitza Stark reviewed gene: EDNRA: Rating: GREEN; Mode of pathogenicity: None; Publications: 25772936, 27671791; Phenotypes: Mandibulofacial dysostosis with alopecia, MIM# 616367; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.34 | EDN1 | Zornitza Stark Phenotypes for gene: EDN1 were changed from to Auriculocondylar syndrome 3, MIM# 615706 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.33 | EDN1 | Zornitza Stark Publications for gene: EDN1 were set to 23315542; 23913798; 24268655 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.33 | EDN1 | Zornitza Stark Publications for gene: EDN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.32 | EDN1 | Zornitza Stark Mode of inheritance for gene: EDN1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.31 | EDN1 | Zornitza Stark Classified gene: EDN1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.31 | EDN1 | Zornitza Stark Gene: edn1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.30 | EDN1 | Zornitza Stark reviewed gene: EDN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 23315542, 23913798, 24268655; Phenotypes: Auriculocondylar syndrome 3, MIM# 615706; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.30 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.29 | EFTUD2 | Zornitza Stark Marked gene: EFTUD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.29 | EFTUD2 | Zornitza Stark Gene: eftud2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.29 | EFTUD2 | Zornitza Stark Phenotypes for gene: EFTUD2 were changed from to Mandibulofacial dysostosis, Guion-Almeida type, MIM# 610536; Mandibulofacial dysostosis-microcephaly syndrome MONDO:0012516 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.28 | EFTUD2 | Zornitza Stark Publications for gene: EFTUD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.27 | EFTUD2 | Zornitza Stark Mode of inheritance for gene: EFTUD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.26 | EFTUD2 | Zornitza Stark reviewed gene: EFTUD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22305528, 23188108, 33601405, 33262786, 26507355; Phenotypes: Mandibulofacial dysostosis, Guion-Almeida type, MIM# 610536, Mandibulofacial dysostosis-microcephaly syndrome MONDO:0012516; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.26 | TXNL4A |
Zornitza Stark Tag SV/CNV tag was added to gene: TXNL4A. Tag 5'UTR tag was added to gene: TXNL4A. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.26 | TXNL4A | Zornitza Stark Marked gene: TXNL4A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.26 | TXNL4A | Zornitza Stark Gene: txnl4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.26 | TXNL4A | Zornitza Stark Phenotypes for gene: TXNL4A were changed from to Burn-McKeown syndrome, MIM# 608572; Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.25 | TXNL4A | Zornitza Stark Publications for gene: TXNL4A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.24 | TXNL4A | Zornitza Stark Mode of inheritance for gene: TXNL4A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.23 | TXNL4A | Zornitza Stark reviewed gene: TXNL4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25434003; Phenotypes: Burn-McKeown syndrome, MIM# 608572, Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.23 | DHODH | Zornitza Stark Marked gene: DHODH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.23 | DHODH | Zornitza Stark Gene: dhodh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.23 | DHODH | Zornitza Stark Phenotypes for gene: DHODH were changed from to Miller syndrome, MIM# 263750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.22 | DHODH | Zornitza Stark Publications for gene: DHODH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.21 | DHODH | Zornitza Stark Mode of inheritance for gene: DHODH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.20 | DHODH | Zornitza Stark reviewed gene: DHODH: Rating: GREEN; Mode of pathogenicity: None; Publications: 19915526, 20220176, 33262786, 27370710; Phenotypes: Miller syndrome, MIM# 263750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.20 | POLR1A | Zornitza Stark Marked gene: POLR1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.20 | POLR1A | Zornitza Stark Gene: polr1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.20 | POLR1A | Zornitza Stark Phenotypes for gene: POLR1A were changed from to Acrofacial dysostosis, Cincinnati type, MIM# 616462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.19 | POLR1A | Zornitza Stark Publications for gene: POLR1A were set to 25913037 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.19 | POLR1A | Zornitza Stark Publications for gene: POLR1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.18 | POLR1A | Zornitza Stark Mode of inheritance for gene: POLR1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.17 | POLR1A | Zornitza Stark reviewed gene: POLR1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25913037; Phenotypes: Acrofacial dysostosis, Cincinnati type, MIM# 616462; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.17 | MTX2 | Zornitza Stark Phenotypes for gene: MTX2 were changed from Mandibuloacral dysplasia; lipodystrophy; arterial calcification to Mandibuloacral dysplasia progeroid syndrome, MIM# 619127; Mandibuloacral dysplasia; lipodystrophy; arterial calcification | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.16 | MTX2 | Zornitza Stark edited their review of gene: MTX2: Changed phenotypes: Mandibuloacral dysplasia progeroid syndrome, MIM# 619127, Mandibuloacral dysplasia, lipodystrophy, arterial calcification | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.16 | MTX2 | Zornitza Stark Marked gene: MTX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.16 | MTX2 | Zornitza Stark Gene: mtx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.16 | MTX2 | Zornitza Stark Classified gene: MTX2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.16 | MTX2 | Zornitza Stark Gene: mtx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.15 | MTX2 |
Zornitza Stark gene: MTX2 was added gene: MTX2 was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature Mode of inheritance for gene: MTX2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MTX2 were set to 32917887 Phenotypes for gene: MTX2 were set to Mandibuloacral dysplasia; lipodystrophy; arterial calcification Review for gene: MTX2 was set to GREEN Added comment: Seven individuals from 5 unrelated families reported with severe progeroid form of MAD with growth retardation, small viscerocranium with mandibular underdevelopment, distal acro-osteolyses, lipodystrophy, altered skin pigmentation, renal focal glomerulosclerosis, and extremely severe hypertension in most cases, eventually associated with disseminated arterial calcification. Loss of MTX2 in patients' primary fibroblasts led to loss of Metaxin-1 (MTX1) and mitochondrial dysfunction, including network fragmentation and oxidative phosphorylation impairment. Furthermore, patients' fibroblasts were resistant to induced apoptosis, leading to increased cell senescence and mitophagy and reduced proliferation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.14 | TSR2 | Zornitza Stark Marked gene: TSR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.14 | TSR2 | Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.14 | TSR2 | Zornitza Stark Phenotypes for gene: TSR2 were changed from to Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.13 | TSR2 | Zornitza Stark Publications for gene: TSR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.12 | TSR2 | Zornitza Stark Mode of inheritance for gene: TSR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.11 | TSR2 | Zornitza Stark Classified gene: TSR2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.11 | TSR2 | Zornitza Stark Gene: tsr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.10 | TSR2 | Zornitza Stark reviewed gene: TSR2: Rating: RED; Mode of pathogenicity: None; Publications: 24942156; Phenotypes: Diamond-Blackfan anemia 14 with mandibulofacial dysostosis, MIM# 300946; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.10 | RPS28 | Zornitza Stark Marked gene: RPS28 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.10 | RPS28 | Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.10 | RPS28 | Zornitza Stark Phenotypes for gene: RPS28 were changed from to Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.9 | RPS28 | Zornitza Stark Publications for gene: RPS28 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.8 | RPS28 | Zornitza Stark Mode of inheritance for gene: RPS28 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.7 | RPS28 | Zornitza Stark Classified gene: RPS28 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.7 | RPS28 | Zornitza Stark Gene: rps28 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.6 | RPS28 | Zornitza Stark reviewed gene: RPS28: Rating: AMBER; Mode of pathogenicity: None; Publications: 24942156; Phenotypes: Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM# 606164; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.6 | TCOF1 | Zornitza Stark Marked gene: TCOF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.6 | TCOF1 | Zornitza Stark Gene: tcof1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.6 | TCOF1 | Zornitza Stark Phenotypes for gene: TCOF1 were changed from to Treacher Collins syndrome 1, MIM# 154500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.5 | TCOF1 | Zornitza Stark Publications for gene: TCOF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.4 | TCOF1 | Zornitza Stark Mode of inheritance for gene: TCOF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.3 | TCOF1 | Melanie Marty changed review comment from: The majority of the variants reported are PTCs that lead to truncation or NMD (PMID: 21951868). More than 60% cases arise from de novo variants (PMID: 15150774, 21951868). Penetrance of the genetic variants causing TCS is thought to be very high. However, extreme inter- and intra- familial phenotypic variation has been reported (PMID: 15150774).; to: The majority of the variants reported are PTCs that lead to truncation or NMD, only a few missense have been reported (ClinVar; PMID: 21951868). More than 60% cases arise from de novo variants (PMID: 15150774, 21951868). Penetrance of the genetic variants causing TCS is thought to be very high. However, extreme inter- and intra- familial phenotypic variation has been reported (PMID: 15150774). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.3 | TCOF1 | Melanie Marty changed review comment from: The majority of the variants reported are PTCs that lead to truncation or NMD (PMID: 21951868). More than 60% cases arise from de novo variants (PMID: 15150774, 21951868). Penetrance of the genetic variants causing TCS is thought to be very high. However, extreme inter- and intra- familial phenotypic variation has been reported (PMID: 15150774).; to: The majority of the variants reported are PTCs that lead to truncation or NMD (PMID: 21951868). More than 60% cases arise from de novo variants (PMID: 15150774, 21951868). Penetrance of the genetic variants causing TCS is thought to be very high. However, extreme inter- and intra- familial phenotypic variation has been reported (PMID: 15150774). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.3 | TCOF1 | Melanie Marty reviewed gene: TCOF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12444270, 15150774, 21951868; Phenotypes: Treacher Collins syndrome 1 154500; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.3 | POLR1B | Zornitza Stark Marked gene: POLR1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.3 | POLR1B | Zornitza Stark Gene: polr1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.3 | POLR1B | Zornitza Stark Classified gene: POLR1B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.3 | POLR1B | Zornitza Stark Gene: polr1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.2 | POLR1B |
Zornitza Stark gene: POLR1B was added gene: POLR1B was added to Mandibulofacial Acrofacial dysostosis. Sources: Literature Mode of inheritance for gene: POLR1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: POLR1B were set to 31649276 Phenotypes for gene: POLR1B were set to Treacher-Collins syndrome type 4 Review for gene: POLR1B was set to GREEN Added comment: Five unrelated families and a zebrafish model, variant inherited in two of the families, once from affected parent and once from mosaic parent. Note four of the families had missense variants affecting same residue, p.Arg1003 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.1 |
Zornitza Stark Panel name changed from Mandibulofacial Acrofacial dysostosis_VCGS to Mandibulofacial Acrofacial dysostosis Panel types changed to Victorian Clinical Genetics Services |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | TXNL4A |
Zornitza Stark gene: TXNL4A was added gene: TXNL4A was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: TXNL4A was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | TSR2 |
Zornitza Stark gene: TSR2 was added gene: TSR2 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: TSR2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | TMCO1 |
Zornitza Stark gene: TMCO1 was added gene: TMCO1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: TMCO1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | TCOF1 |
Zornitza Stark gene: TCOF1 was added gene: TCOF1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: TCOF1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | SNRPB |
Zornitza Stark gene: SNRPB was added gene: SNRPB was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: SNRPB was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | SF3B4 |
Zornitza Stark gene: SF3B4 was added gene: SF3B4 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: SF3B4 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | SCARF2 |
Zornitza Stark gene: SCARF2 was added gene: SCARF2 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: SCARF2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | RPS28 |
Zornitza Stark gene: RPS28 was added gene: RPS28 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: RPS28 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | RPS26 |
Zornitza Stark gene: RPS26 was added gene: RPS26 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: RPS26 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | RPL5 |
Zornitza Stark gene: RPL5 was added gene: RPL5 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: RPL5 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | RPL11 |
Zornitza Stark gene: RPL11 was added gene: RPL11 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: RPL11 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | RBM10 |
Zornitza Stark gene: RBM10 was added gene: RBM10 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: RBM10 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | PUF60 |
Zornitza Stark gene: PUF60 was added gene: PUF60 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: PUF60 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | PRRX1 |
Zornitza Stark gene: PRRX1 was added gene: PRRX1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: PRRX1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | POLR1D |
Zornitza Stark gene: POLR1D was added gene: POLR1D was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: POLR1D was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | POLR1C |
Zornitza Stark gene: POLR1C was added gene: POLR1C was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: POLR1C was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | POLR1A |
Zornitza Stark gene: POLR1A was added gene: POLR1A was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: POLR1A was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | PLCB4 |
Zornitza Stark gene: PLCB4 was added gene: PLCB4 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: PLCB4 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | PBX1 |
Zornitza Stark gene: PBX1 was added gene: PBX1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: PBX1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | MYT1 |
Zornitza Stark gene: MYT1 was added gene: MYT1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: MYT1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | GSC |
Zornitza Stark gene: GSC was added gene: GSC was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: GSC was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | GNAI3 |
Zornitza Stark gene: GNAI3 was added gene: GNAI3 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: GNAI3 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | EVC2 |
Zornitza Stark gene: EVC2 was added gene: EVC2 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: EVC2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | EVC |
Zornitza Stark gene: EVC was added gene: EVC was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: EVC was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | EIF4A3 |
Zornitza Stark gene: EIF4A3 was added gene: EIF4A3 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: EIF4A3 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | EFTUD2 |
Zornitza Stark gene: EFTUD2 was added gene: EFTUD2 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: EFTUD2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | EDNRA |
Zornitza Stark gene: EDNRA was added gene: EDNRA was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: EDNRA was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | EDN1 |
Zornitza Stark gene: EDN1 was added gene: EDN1 was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: EDN1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | DHODH |
Zornitza Stark gene: DHODH was added gene: DHODH was added to Mandibulofacial Acrofacial dysostosis_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: DHODH was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v0.0 | Zornitza Stark Added panel Mandibulofacial Acrofacial dysostosis_VCGS | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||