| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Early-onset Dementia v2.0 | ATN1_DRPLA_CAG | STR ATN1_DRPLA_CAG: gene migrated from ENSG00000111676 to ENSG00000111676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | NOTCH2NLC_NIID_GGC | STR NOTCH2NLC_NIID_GGC: gene migrated from ENSG00000286219 to ENSG00000286219 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TBP_SCA17_CAG | STR TBP_SCA17_CAG: gene migrated from ENSG00000112592 to ENSG00000112592 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PRNP_CJD_octapeptide | STR PRNP_CJD_octapeptide: gene migrated from ENSG00000171867 to ENSG00000171867 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | C9orf72_FTDALS_GGGGCC | STR C9orf72_FTDALS_GGGGCC: gene migrated from ENSG00000147894 to ENSG00000147894 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | JPH3_HDL2_CTG | STR JPH3_HDL2_CTG: gene migrated from ENSG00000154118 to ENSG00000154118 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | ATN1 | Gene migrated from ENSG00000111676 to ENSG00000111676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | C9orf72 | Gene migrated from ENSG00000147894 to ENSG00000147894 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PRKCH | Gene migrated from ENSG00000027075 to ENSG00000027075 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SPART | Gene migrated from ENSG00000133104 to ENSG00000133104 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | ALS2 | Gene migrated from ENSG00000003393 to ENSG00000003393 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | GSN | Gene migrated from ENSG00000148180 to ENSG00000148180 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TH | Gene migrated from ENSG00000180176 to ENSG00000180176 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | HTRA2 | Gene migrated from ENSG00000115317 to ENSG00000115317 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PPIA | Gene migrated from ENSG00000196262 to ENSG00000196262 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | ATP7B | Gene migrated from ENSG00000123191 to ENSG00000123191 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SOD1 | Gene migrated from ENSG00000142168 to ENSG00000142168 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SETX | Gene migrated from ENSG00000107290 to ENSG00000107290 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | GCH1 | Gene migrated from ENSG00000131979 to ENSG00000131979 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SNCB | Gene migrated from ENSG00000074317 to ENSG00000074317 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | UCHL1 | Gene migrated from ENSG00000154277 to ENSG00000154277 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | FIG4 | Gene migrated from ENSG00000112367 to ENSG00000112367 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | ANG | Gene migrated from ENSG00000214274 to ENSG00000214274 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TET2 | Gene migrated from ENSG00000168769 to ENSG00000168769 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | VAPB | Gene migrated from ENSG00000124164 to ENSG00000124164 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | FA2H | Gene migrated from ENSG00000103089 to ENSG00000103089 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | NR4A2 | Gene migrated from ENSG00000153234 to ENSG00000153234 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CYLD | Gene migrated from ENSG00000083799 to ENSG00000083799 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | POLG | Gene migrated from ENSG00000140521 to ENSG00000140521 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | COL4A2 | Gene migrated from ENSG00000134871 to ENSG00000134871 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | HNRNPA1 | Gene migrated from ENSG00000135486 to ENSG00000135486 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SORL1 | Gene migrated from ENSG00000137642 to ENSG00000137642 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | HNRNPA2B1 | Gene migrated from ENSG00000122566 to ENSG00000122566 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | RBMX | Gene migrated from ENSG00000147274 to ENSG00000147274 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CCNF | Gene migrated from ENSG00000162063 to ENSG00000162063 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | GBA1 | Gene symbol changed from GBA to GBA1 during gene set migration (ENSG00000177628 -> ENSG00000177628) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TAF15 | Gene migrated from ENSG00000270647 to ENSG00000270647 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SQSTM1 | Gene migrated from ENSG00000161011 to ENSG00000161011 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | KIF5A | Gene migrated from ENSG00000155980 to ENSG00000155980 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | MATR3 | Gene migrated from ENSG00000015479 to ENSG00000015479 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | APOE | Gene migrated from ENSG00000130203 to ENSG00000130203 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TIA1 | Gene migrated from ENSG00000116001 to ENSG00000116001 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | FUS | Gene migrated from ENSG00000089280 to ENSG00000089280 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | FTL | Gene migrated from ENSG00000087086 to ENSG00000087086 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CYP27A1 | Gene migrated from ENSG00000135929 to ENSG00000135929 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CHCHD10 | Gene migrated from ENSG00000250479 to ENSG00000250479 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | C19orf12 | Gene migrated from ENSG00000131943 to ENSG00000131943 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | ARSA | Gene migrated from ENSG00000100299 to ENSG00000100299 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | ATP13A2 | Gene migrated from ENSG00000159363 to ENSG00000159363 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SNCA | Gene migrated from ENSG00000145335 to ENSG00000145335 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | STUB1 | Gene migrated from ENSG00000103266 to ENSG00000103266 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CTSF | Gene migrated from ENSG00000174080 to ENSG00000174080 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | MAPT | Gene migrated from ENSG00000186868 to ENSG00000186868 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PRKN | Gene migrated from ENSG00000185345 to ENSG00000185345 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | VPS13A | Gene migrated from ENSG00000197969 to ENSG00000197969 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | VPS35 | Gene migrated from ENSG00000069329 to ENSG00000069329 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | WDR45 | Gene migrated from ENSG00000196998 to ENSG00000196998 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | RNF216 | Gene migrated from ENSG00000011275 to ENSG00000011275 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | HTRA1 | Gene migrated from ENSG00000166033 to ENSG00000166033 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CP | Gene migrated from ENSG00000047457 to ENSG00000047457 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PARK7 | Gene migrated from ENSG00000116288 to ENSG00000116288 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | ANXA11 | Gene migrated from ENSG00000122359 to ENSG00000122359 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SPG11 | Gene migrated from ENSG00000104133 to ENSG00000104133 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | DCTN1 | Gene migrated from ENSG00000204843 to ENSG00000204843 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | DNAJC5 | Gene migrated from ENSG00000101152 to ENSG00000101152 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CST3 | Gene migrated from ENSG00000101439 to ENSG00000101439 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CAPRIN1 | Gene migrated from ENSG00000135387 to ENSG00000135387 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SLC9A6 | Gene migrated from ENSG00000198689 to ENSG00000198689 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | GLA | Gene migrated from ENSG00000102393 to ENSG00000102393 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | NOTCH3 | Gene migrated from ENSG00000074181 to ENSG00000074181 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | COL4A1 | Gene migrated from ENSG00000187498 to ENSG00000187498 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TREX1 | Gene migrated from ENSG00000213689 to ENSG00000213689 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | VPS13C | Gene migrated from ENSG00000129003 to ENSG00000129003 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TUBA4A | Gene migrated from ENSG00000127824 to ENSG00000127824 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CHMP2B | Gene migrated from ENSG00000083937 to ENSG00000083937 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | OPTN | Gene migrated from ENSG00000123240 to ENSG00000123240 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PSEN2 | Gene migrated from ENSG00000143801 to ENSG00000143801 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TBK1 | Gene migrated from ENSG00000183735 to ENSG00000183735 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TARDBP | Gene migrated from ENSG00000120948 to ENSG00000120948 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TYROBP | Gene migrated from ENSG00000011600 to ENSG00000011600 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | NHLRC1 | Gene migrated from ENSG00000187566 to ENSG00000187566 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PLA2G6 | Gene migrated from ENSG00000184381 to ENSG00000184381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PANK2 | Gene migrated from ENSG00000125779 to ENSG00000125779 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PRNP | Gene migrated from ENSG00000171867 to ENSG00000171867 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | NPC2 | Gene migrated from ENSG00000119655 to ENSG00000119655 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PSEN1 | Gene migrated from ENSG00000080815 to ENSG00000080815 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | UBQLN2 | Gene migrated from ENSG00000188021 to ENSG00000188021 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | NPC1 | Gene migrated from ENSG00000141458 to ENSG00000141458 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | VCP | Gene migrated from ENSG00000165280 to ENSG00000165280 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | GRN | Gene migrated from ENSG00000030582 to ENSG00000030582 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | EPM2A | Gene migrated from ENSG00000112425 to ENSG00000112425 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | XK | Gene migrated from ENSG00000047597 to ENSG00000047597 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TREM2 | Gene migrated from ENSG00000095970 to ENSG00000095970 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | APP | Gene migrated from ENSG00000142192 to ENSG00000142192 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | ITM2B | Gene migrated from ENSG00000136156 to ENSG00000136156 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CLN6 | Gene migrated from ENSG00000128973 to ENSG00000128973 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | TTR | Gene migrated from ENSG00000118271 to ENSG00000118271 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | SPG21 | Gene migrated from ENSG00000090487 to ENSG00000090487 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | PINK1 | Gene migrated from ENSG00000158828 to ENSG00000158828 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | LRRK2 | Gene migrated from ENSG00000188906 to ENSG00000188906 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | DNMT1 | Gene migrated from ENSG00000130816 to ENSG00000130816 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | CSF1R | Gene migrated from ENSG00000182578 to ENSG00000182578 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v2.0 | Panel migrated to gene set Ensemblv115. Source version: v1.58 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.58 | RBMX | Zornitza Stark Marked gene: RBMX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.58 | RBMX | Zornitza Stark Gene: rbmx has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.58 | RBMX | Lucy Spencer Publications for gene: RBMX were set to 25256757; 34260915; 37277488; 39263607 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.57 | RBMX | Lucy Spencer Phenotypes for gene: RBMX were changed from Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238; Gustavson syndrome, MIM# 309555; Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related to Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.56 | Lucy Spencer Copied gene RBMX from panel Mendeliome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.56 | RBMX |
Lucy Spencer gene: RBMX was added gene: RBMX was added to Early-onset Dementia. Sources: Expert Review Amber,Expert Review Mode of inheritance for gene: RBMX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: RBMX were set to 25256757; 34260915; 37277488; 39263607 Phenotypes for gene: RBMX were set to Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238; Gustavson syndrome, MIM# 309555; Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.55 | SPG11 | Zornitza Stark Marked gene: SPG11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.55 | SPG11 | Zornitza Stark Gene: spg11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.55 | SPG11 | Zornitza Stark Publications for gene: SPG11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.54 | PRKCH | Zornitza Stark Marked gene: PRKCH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.54 | PRKCH | Zornitza Stark Gene: prkch has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.54 | PRKCH |
Zornitza Stark gene: PRKCH was added gene: PRKCH was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: PRKCH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PRKCH were set to 40591711 Phenotypes for gene: PRKCH were set to Alzheimer disease, MONDO:0004975, PRKCH-related Review for gene: PRKCH was set to RED Added comment: PMID 40591711 reports eight individuals from one family with a homozygous missense K65R variant Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.53 | SORL1 | Zornitza Stark Marked gene: SORL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.53 | SORL1 | Zornitza Stark Gene: sorl1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.53 | Zornitza Stark Copied gene SORL1 from panel Incidentalome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.53 | SORL1 |
Zornitza Stark gene: SORL1 was added gene: SORL1 was added to Early-onset Dementia. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: SORL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SORL1 were set to 27026413; 39226352; 40182695 Phenotypes for gene: SORL1 were set to Alzheimer disease, MONDO:0004975, SORL1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.52 | SQSTM1 | Krithika Murali Classified gene: SQSTM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.52 | SQSTM1 | Krithika Murali Gene: sqstm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.51 | SQSTM1 | Krithika Murali Classified gene: SQSTM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.51 | SQSTM1 | Krithika Murali Gene: sqstm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.51 | SQSTM1 | Krithika Murali Classified gene: SQSTM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.51 | SQSTM1 | Krithika Murali Gene: sqstm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.50 | SQSTM1 | Krithika Murali commented on gene: SQSTM1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.50 | TH | Zornitza Stark Phenotypes for gene: TH were changed from Segawa syndrome, recessive MIM#605407 to Segawa syndrome, recessive MIM#605407 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.50 | TH | Zornitza Stark Marked gene: TH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.50 | TH | Zornitza Stark Gene: th has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.50 | TH | Zornitza Stark Phenotypes for gene: TH were changed from to Segawa syndrome, recessive MIM#605407 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.49 | TH | Zornitza Stark Mode of inheritance for gene: TH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.48 | DNMT1 | chirag patel Publications for gene DNMT1 were changed from 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 to 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.47 | DNMT1 |
chirag patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DNMT1. Source Victorian Clinical Genetics Services was removed from DNMT1. Source ClinGen was added to DNMT1. Mode of inheritance for gene DNMT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DNMT1 were changed from to Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 Publications for gene DNMT1 were changed from 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457 to 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.46 | DCTN1 |
chirag patel Phenotypes for gene: DCTN1 were changed from Perry syndrome, MIM# 168605 to Perry syndrome, MONDO:0008201 Publications for gene DCTN1 were changed from 20945553, 19136952, 24343258 to 20945553, 19136952, 24343258 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.45 | DCTN1 |
chirag patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DCTN1. Source Victorian Clinical Genetics Services was removed from DCTN1. Source Literature was added to DCTN1. Publications for gene DCTN1 were changed from 19136952, 24343258 to 19136952, 24343258 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.44 | DNAJC5 |
chirag patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DNAJC5. Source Victorian Clinical Genetics Services was removed from DNAJC5. Source Expert list was added to DNAJC5. Mode of inheritance for gene DNAJC5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DNAJC5 were changed from to Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 Publications for gene DNAJC5 were changed from 22978711; 21820099; 22235333; 31919451; 26659577 to 22978711; 21820099; 22235333; 31919451; 26659577 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.43 | SQSTM1 | Zornitza Stark Publications for gene: SQSTM1 were set to 22084127; 22972638 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.42 | SQSTM1 | Zornitza Stark Classified gene: SQSTM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.42 | SQSTM1 | Zornitza Stark Gene: sqstm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.41 | SQSTM1 | Chris Ciotta reviewed gene: SQSTM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27554286, 31362587, 28490746, 31859009, 23942205; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.41 | NOTCH2NLC_NIID_GGC | Bryony Thompson Gene: NOTCH2NL was changed to NOTCH2NLC. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.40 | CST3 | Zornitza Stark Phenotypes for gene: CST3 were changed from Cerebral amyloid angiopathy MIM#105150; leukodystrophy MONDO:0019046 to Cerebral amyloid angiopathy MIM#105150; Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.39 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson Marked STR: NOTCH2NLC_NIID_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson Str: notch2nlc_niid_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.37 | JPH3_HDL2_CTG | Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.36 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.35 | ATN1_DRPLA_CAG | Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Marked gene: CAPRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.33 | PRNP_CJD_octapeptide | Bryony Thompson CJD was changed to PRNP_CJD_octapeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.32 | SLC9A6 | Zornitza Stark Mode of inheritance for gene: SLC9A6 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.31 | SLC9A6 | Zornitza Stark edited their review of gene: SLC9A6: Changed phenotypes: Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.31 | SLC9A6 | Zornitza Stark Marked gene: SLC9A6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.31 | SLC9A6 | Zornitza Stark Gene: slc9a6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.31 | SLC9A6 | Zornitza Stark Classified gene: SLC9A6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.31 | SLC9A6 | Zornitza Stark Gene: slc9a6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.30 | SLC9A6 |
Zornitza Stark gene: SLC9A6 was added gene: SLC9A6 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: SLC9A6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SLC9A6 were set to 35198730; 39810750; 35198730; 31192222 Phenotypes for gene: SLC9A6 were set to Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142 Review for gene: SLC9A6 was set to GREEN Added comment: Multiple female carriers reported with adult-onset neurological phenotypes including neurodegerative disease and Parkinsonism. Some had affected sons with ID. Uncertain whether this is a separate entity or manifestation in female carriers of a XL condition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.29 | ANXA11 | Bryony Thompson Marked gene: ANXA11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.29 | ANXA11 | Bryony Thompson Gene: anxa11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.29 | ANXA11 | Bryony Thompson Classified gene: ANXA11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.29 | ANXA11 | Bryony Thompson Gene: anxa11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.28 | ANXA11 |
Bryony Thompson gene: ANXA11 was added gene: ANXA11 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: ANXA11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANXA11 were set to 36458208; 39755715; 38896345; 38896262 Phenotypes for gene: ANXA11 were set to amyotrophic lateral sclerosis type 23 MONDO:0027694 Mode of pathogenicity for gene: ANXA11 was set to Other Review for gene: ANXA11 was set to GREEN gene: ANXA11 was marked as current diagnostic Added comment: FTD can be a feature of the condition. ANXA11 is classified as a multisystem proteinopathy gene. Gain-of-function is the mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.27 | CAPRIN1 |
Shekeeb Mohammad gene: CAPRIN1 was added gene: CAPRIN1 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: CAPRIN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CAPRIN1 were set to 39878554 Phenotypes for gene: CAPRIN1 were set to Childhood Dementia; Myoclonus-Ataxia; Sensorimotor Neuropathy; cerebellar atrophy; cortical atrophy Penetrance for gene: CAPRIN1 were set to unknown Review for gene: CAPRIN1 was set to GREEN gene: CAPRIN1 was marked as current diagnostic Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.27 | KIF5A | Bryony Thompson Marked gene: KIF5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.27 | KIF5A | Bryony Thompson Gene: kif5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.27 | KIF5A | Bryony Thompson Classified gene: KIF5A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.27 | KIF5A | Bryony Thompson Gene: kif5a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.26 | KIF5A |
Bryony Thompson gene: KIF5A was added gene: KIF5A was added to Early-onset Dementia. Sources: Other Mode of inheritance for gene: KIF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KIF5A were set to 33077544; 36604770 Phenotypes for gene: KIF5A were set to Amyotrophic lateral sclerosis, susceptibility to, 25 MONDO:0060670 Mode of pathogenicity for gene: KIF5A was set to Other Review for gene: KIF5A was set to AMBER Added comment: ALS-FTD phenotype has been reported in two families with KIF5A variants. The mechanism of disease is likely gain of function. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.25 | TREM2 | Zornitza Stark Phenotypes for gene: TREM2 were changed from Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193 to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193; {Alzhieimer disease 17, susceptibility to}, MIM# 615080 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.24 | TREM2 | Zornitza Stark edited their review of gene: TREM2: Changed phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193, {Alzhieimer disease 17, susceptibility to}, MIM# 615080 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.24 | TUBA4A | Bryony Thompson Publications for gene: TUBA4A were set to 28069311; 25374358; 26675813 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.23 | TUBA4A | Bryony Thompson edited their review of gene: TUBA4A: Changed phenotypes: Inherited neurodegenerative disorder MONDO:0024237, TUBA4A-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.23 | TUBA4A | Bryony Thompson Classified gene: TUBA4A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.23 | TUBA4A | Bryony Thompson Gene: tuba4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.22 | TUBA4A | Bryony Thompson reviewed gene: TUBA4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25374358, 28069311, 35327632, 34169147, 38884572, 33760283; Phenotypes: amyotrophic lateral sclerosis type 22 MONDO:0014531; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.22 | GBA | Lauren Rogers reviewed gene: GBA: Rating: AMBER; Mode of pathogenicity: None; Publications: 36084847; Phenotypes: {Lewy body dementia, susceptibility to} (MIM# 127750); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.22 | POLG | Zornitza Stark Classified gene: POLG as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.22 | POLG | Zornitza Stark Gene: polg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.21 | COL4A2 | Zornitza Stark Classified gene: COL4A2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.21 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.20 | TREX1 | Bryony Thompson Marked gene: TREX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.20 | TREX1 | Bryony Thompson Gene: trex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.20 | TREX1 | Bryony Thompson Classified gene: TREX1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.20 | TREX1 | Bryony Thompson Gene: trex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.19 | POLG | Bryony Thompson Marked gene: POLG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.19 | POLG | Bryony Thompson Gene: polg has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.19 | POLG | Bryony Thompson Classified gene: POLG as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.19 | POLG | Bryony Thompson Gene: polg has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.18 | COL4A2 | Bryony Thompson Marked gene: COL4A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.18 | COL4A2 | Bryony Thompson Gene: col4a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.18 | COL4A2 | Bryony Thompson Classified gene: COL4A2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.18 | COL4A2 | Bryony Thompson Gene: col4a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.17 | COL4A1 | Bryony Thompson Marked gene: COL4A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.17 | COL4A1 | Bryony Thompson Gene: col4a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.17 | COL4A1 | Bryony Thompson Classified gene: COL4A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.17 | COL4A1 | Bryony Thompson Gene: col4a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.16 | GLA | Zornitza Stark Marked gene: GLA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.16 | GLA | Zornitza Stark Gene: gla has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.16 | GLA | Zornitza Stark Classified gene: GLA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.16 | GLA | Zornitza Stark Gene: gla has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.15 | GLA |
Lynn Tan gene: GLA was added gene: GLA was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: GLA was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: GLA were set to 36927868; 38254927; 9213072; 23949010; 32510623 Phenotypes for gene: GLA were set to Fabry disease MONDO:0010526 Review for gene: GLA was set to GREEN gene: GLA was marked as current diagnostic Added comment: PMID 36927868 (2023) Index patient with GLA T410A (α-Gal A activity 32%) developed dementia and died of stroke in her 70s PMID: 9213072 (1997) 47M biochemically confirmed Fabry’s with predominant manifestation being a dementing illness PMID: 23949010 (2014) Systematic review on cognitive dysfunction in Fabry's disease: patients with Fabry disease may be impaired in: executive functioning assessed by two standardised tests, the Stroop test and the Trail Making test part B, information processing speed and attention. Five case studies documenting neuropsychological impairment also described. PMID: 32510623 Prospective cohort study to describe cognitive function changes in Fabry's over a year. Eighty‐one patients were included of which 76 patients (94%) completed both assessments (age: 44 years, 34% men, 75% classical phenotype). Four patients (5.3%) showed reliable decrease in cognitive functioning, two women and one man with classical disease and one woman with non‐classical disease (age range: 19‐41 years). Changes were from excellent to good/average and from good to average. None had a history of stroke or extensive WMLs. Follow‐up CESD scores were similar in two patients (+0 and +1) and increased in two others (+6, +11). PMID: 38254927 (2023) "This vasculopathy, along with elevating the risk of cerebral ischemia and stroke, is likely the pathophysiological basis for cognitive impairments in FD patients. Nevertheless, there is currently insufficient evidence indicating a direct association between neuropsychological findings and alterations in morphology in the CNS of FD patients as determined by brain imaging techniques such as magnetic resonance imaging." Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.15 | NOTCH3 | Ain Roesley Mode of inheritance for gene: NOTCH3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | NOTCH3 | Ain Roesley reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | COL4A2 |
Lynn Tan edited their review of gene: COL4A2: Added comment: PMID: 35699195 The frequency of cognitive features in COL4A2 was 27% [11/41 individuals from 22 pedigrees]. These 11 patients all had developmental delay. PMID: 37272523 Ontario Neurodegenerative Disease Research Initiative (ONDRI) sample size 510: 8 patients with COL4A1/2 variants had Alzheimer's disease/mild cognitive impairment, 3 patients with COL4A1/2 variants had frontotemporal dementia PMID: 36300346 UK Biobank cohort study (n = 454 756): 2 patients with COL4A1/2 variants had vascular dementia, 8 patients with COL4A1/2 variants had all-cause dementia Dev delay vs early-onset dementia PMID: 37272523 and PMID: 36300346 -combined cohort with both COL4A1 and COL4A2 Sources: Literature; Changed rating: AMBER |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | POLG |
Lynn Tan gene: POLG was added gene: POLG was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: POLG was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLG were set to 15477547; 14694057; 16638794 Phenotypes for gene: POLG were set to Mitochondrial DNA depletion syndrome 4a MONDO:0008758 Review for gene: POLG was set to AMBER gene: POLG was marked as current diagnostic Added comment: PMID: 15477547 5 patients with "cognitive impairment" in their 30s-50s, one male "had mild cognitive decline in the fifth decade". PMID: 14694057 Biallelic POLG A467T variants: The 18-year-old patient is the elder son of nonconsanguineous parents, aged 45 and 41 years. The clinical features of myoclonus, seizure, axonal sensory ataxic neuropathy, and hepatotoxicity induced by valproate and mild cognitive decline and cardiomyopathy were indicative of a multisystem disorder and suggestive of mitochondrial disease. PMID: 16638794 We studied 26 patients belonging to 20 families with a disorder caused by biallelic mutations in the POLG gene. Mild cognitive abnormalities were clinically suspected in eight patients. In four a mild cognitive impairment was confirmed by neuropsychological examination. Cognitive impairment -developmental delay/regression/ID in childhood vs dementia (and decline from a baseline) later in life Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | COL4A2 |
Lynn Tan gene: COL4A2 was added gene: COL4A2 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: COL4A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: COL4A2 were set to 35699195; 37272523; 36300346 Phenotypes for gene: COL4A2 were set to Familial porencephaly MONDO:0020496 Review for gene: COL4A2 was set to GREEN gene: COL4A2 was marked as current diagnostic Added comment: PMID: 35699195 The frequency of cognitive features in COL4A2 was 27% [11/41 individuals from 22 pedigrees]. Developmental delay was present in over 80% of individuals with COL4A1/2 with cognitive features. PMID: 37272523 Ontario Neurodegenerative Disease Research Initiative (ONDRI) sample size 510: 8 patients with COL4A1/2 variants had Alzheimer's disease/mild cognitive impairment, 3 patients with COL4A1/2 variants had frontotemporal dementia PMID: 36300346 UK Biobank cohort study (n = 454 756): 2 patients with COL4A1/2 variants had vascular dementia, 8 patients with COL4A1/2 variants had all-cause dementia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | COL4A1 |
Lynn Tan gene: COL4A1 was added gene: COL4A1 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: COL4A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: COL4A1 were set to 35699195; 37272523; 36300346; 30413629 Phenotypes for gene: COL4A1 were set to Brain small vessel disease 1 with or without ocular anomalies MONDO:0008289; Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814 Review for gene: COL4A1 was set to GREEN gene: COL4A1 was marked as current diagnostic Added comment: PMID: 35699195 Systematic review: frequency of cognitive features in COL4A1 was 33% [128/390 individuals from 233 pedigrees]. Developmental delay was present in over 80% of individuals with COL4A1/2 with cognitive features. PMID: 37272523 Ontario Neurodegenerative Disease Research Initiative (ONDRI) sample size 510: 8 patients with COL4A1/2 variants had Alzheimer's disease/mild cognitive impairment, 3 patients with COL4A1/2 variants had frontotemporal dementia PMID: 36300346 UK Biobank cohort study (n = 454 756): 2 patients with COL4A1/2 variants had vascular dementia, 8 patients with COL4A1/2 variants had all-cause dementia PMID: 30413629 Child with COL4A1 p. G601S variant: developmental delay, moderate cognitive impairment, autism, and normal neurologic examination. Focal-onset drug-resistant seizures started at 11 years of age. 3-year-old girl with de novo COL4A1 p.G1239R: Surgical delivery was performed because prenatal hydrocephalus was suspected. The child developed microcephaly, severe cognitive impairment, and drug-resistant epileptic spasms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | TREX1 |
Lynn Tan gene: TREX1 was added gene: TREX1 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: TREX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TREX1 were set to 29380913; 35699195; 36586737; 35307828 Phenotypes for gene: TREX1 were set to Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations MONDO:0008641 Review for gene: TREX1 was set to GREEN gene: TREX1 was marked as current diagnostic Added comment: PMID: 35699195 Systematic review: frequency of cognitive features in TREX1 was 29% [36/123 individuals from 34 pedigrees] PMID: 29380913 Symptoms for this disorder start in adulthood and frequently include rapid loss of vision, multifocal strokes and dementia. PMID: 36586737 1. Female patient displayed the first symptoms at a very early-age, 57 years old, and originated from Serbia. She presented with mild cognitive impairment. 2. 53-year old Dutch patient who displayed presenile dementia 3. 39-year old Finnish patient presenting migrane without aura, severe and pervasive cognitive impairment PMID: 35307828 First stroke at age 39, diagnosed with severe amyloid angiopathy, and he also started suffering from migraines without aura and was later diagnosed with cognitive impairment Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | VPS13C | Bryony Thompson Marked gene: VPS13C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | VPS13C | Bryony Thompson Gene: vps13c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | VPS13C | Bryony Thompson Classified gene: VPS13C as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | VPS13C | Bryony Thompson Gene: vps13c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | VPS13C | Bryony Thompson Classified gene: VPS13C as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.14 | VPS13C | Bryony Thompson Gene: vps13c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.13 | VPS13C |
Bryony Thompson gene: VPS13C was added gene: VPS13C was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: VPS13C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS13C were set to 33579389; 37330543; 34875562 Phenotypes for gene: VPS13C were set to autosomal recessive early-onset Parkinson disease 23 MONDO:0014796 Review for gene: VPS13C was set to GREEN gene: VPS13C was marked as current diagnostic Added comment: Multiple cases with biallelic variants and dementia with Lewy bodies have been reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.12 | CST3 | Bryony Thompson Phenotypes for gene: CST3 were changed from Cerebral amyloid angiopathy MIM#105150 to Cerebral amyloid angiopathy MIM#105150; leukodystrophy MONDO:0019046 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.11 | CST3 | Bryony Thompson Publications for gene: CST3 were set to 22435454; 8866434; 2602413; 8108423 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.10 | CST3 | Bryony Thompson Classified gene: CST3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.10 | CST3 | Bryony Thompson Added comment: Comment on list classification: Cognitive decline is a feature of CST3-leukodystrophy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.10 | CST3 | Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.9 | CST3 | Bryony Thompson edited their review of gene: CST3: Added comment: New gene-disease association: 16 patients from 8 leukodystrophy families carrying one of four different stop-gain or frameshift dominant variants in the C-terminal (in the NMD-exclusion zone) of the CST3 gene. Suggested mechanism of disease by rendering the protein more prone to aggregation. The clinical phenotype consists of recurrent episodes of hemiplegic migraine associated with transient unilateral focal deficits and slowly progressing motor symptoms and cognitive decline in mid-old adult ages. Clinical & radiological features differ from Cerebral Amyloid Angiopathy.; Changed publications: 22435454, 8866434, 2602413, 8108423, 38489591; Changed phenotypes: Cerebral amyloid angiopathy MIM#105150, leukodystrophy MONDO:0019046 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.9 | APP | Bryony Thompson Marked gene: APP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.9 | APP | Bryony Thompson Gene: app has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.9 | APP | Bryony Thompson Mode of pathogenicity for gene: APP was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.8 | APP | Bryony Thompson Publications for gene: APP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.7 | APP | Bryony Thompson Phenotypes for gene: APP were changed from to Alzheimer disease MONDO:0007088 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.6 | APP | Bryony Thompson Mode of inheritance for gene: APP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.5 | CCNF | Zornitza Stark edited their review of gene: CCNF: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.5 | CHMP2B | Bryony Thompson Marked gene: CHMP2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.5 | CHMP2B | Bryony Thompson Gene: chmp2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.5 | CHMP2B | Bryony Thompson Phenotypes for gene: CHMP2B were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795; MONDO:0010936) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.4 | CHMP2B | Bryony Thompson Publications for gene: CHMP2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.3 | CHMP2B | Bryony Thompson Mode of pathogenicity for gene: CHMP2B was changed from Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.2 | CHMP2B | Bryony Thompson Mode of pathogenicity for gene: CHMP2B was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.1 | CHMP2B | Bryony Thompson Mode of inheritance for gene: CHMP2B was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.1 | CHMP2B | Bryony Thompson Mode of inheritance for gene: CHMP2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.0 | Bryony Thompson promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.221 | NR4A2 | Bryony Thompson Marked gene: NR4A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.221 | NR4A2 | Bryony Thompson Gene: nr4a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.221 | HTRA2 | Bryony Thompson Marked gene: HTRA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.221 | HTRA2 | Bryony Thompson Gene: htra2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.221 | TIA1 | Bryony Thompson Marked gene: TIA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.221 | TIA1 | Bryony Thompson Gene: tia1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.221 | TIA1 | Bryony Thompson Classified gene: TIA1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.221 | TIA1 | Bryony Thompson Gene: tia1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.220 | TIA1 |
Bryony Thompson gene: TIA1 was added gene: TIA1 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: TIA1 was set to Other Publications for gene: TIA1 were set to 36861178; 29599744; 29457785 Phenotypes for gene: TIA1 were set to Multisystem proteinopathy Review for gene: TIA1 was set to AMBER Added comment: Digenic variants in SQSTM1 and TIA1 have been reported in multisystem proteinopathy which includes clinical combinations of inclusion body myopathy (IBM), neurodegeneration [motor neuron disorder (MND)/frontotemporal dementia (FTD)], and Paget disease of bone (PDB). FTD has reported in at least one individual with FTD as a feature of the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.219 | HNRNPA1 | Bryony Thompson Classified gene: HNRNPA1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.219 | HNRNPA1 | Bryony Thompson Added comment: Comment on list classification: Included as an amber gene because the gene is associated with multisystem proteinopathy, which FTD can be a feature. No FTD has been reported in association with this gene. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.219 | HNRNPA1 | Bryony Thompson Gene: hnrnpa1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | GCH1 | Bryony Thompson Marked gene: GCH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | GCH1 | Bryony Thompson Gene: gch1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | FIG4 | Bryony Thompson Marked gene: FIG4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | FIG4 | Bryony Thompson Gene: fig4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | ANG | Bryony Thompson Marked gene: ANG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | ANG | Bryony Thompson Gene: ang has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | ALS2 | Bryony Thompson Marked gene: ALS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | ALS2 | Bryony Thompson Gene: als2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | SCA17 | Bryony Thompson Classified STR: SCA17 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.218 | SCA17 | Bryony Thompson Str: sca17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.217 | SCA17 | Bryony Thompson Marked STR: SCA17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.217 | SCA17 | Bryony Thompson Str: sca17 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.217 | SCA17 |
Bryony Thompson STR: SCA17 was added STR: SCA17 was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for STR: SCA17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA17 were set to 10484774; 20301611 Phenotypes for STR: SCA17 were set to Spinocerebellar ataxia 17 MIM#607136 Review for STR: SCA17 was set to GREEN STR: SCA17 was marked as clinically relevant Added comment: NM_003194.4:c.172_174[X] Mechanism of disease expected to be gain of function Normal: ≤ 40 CAG/CAA repeats Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms. Full-penetrance: ≥49 CAG/CAA repeats Dementia is a feature of the condition Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.216 | XK | Sangavi Sivagnanasundram Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.216 | XK |
Sangavi Sivagnanasundram edited their review of gene: XK: Added comment: McLeod Syndrome (MLS) is multisystem disorder with central nervous system (CNS), neuromuscular, cardiovascular, and hematologic manifestations in males. Dementia is not a typical feature of MLS but cognitive impairment has been identified in multiple individuals with MLS. PMID: 12899725 Reported in one individual with McLeod Syndrome (MLS) who developed mild dementia during disease progression (age of onset was later in life). Testing confirmed he has a complete deletion of exon 2. PMID: 11761473 Approx 15 individuals identified with neurological impact to the central nervous system resulting in cognitive impairment.; Changed rating: GREEN; Changed publications: 12899725, 11761473 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.216 | CCNF | Bryony Thompson edited their review of gene: CCNF: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.216 | NHLRC1 | Zornitza Stark Marked gene: NHLRC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.216 | NHLRC1 | Zornitza Stark Gene: nhlrc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.216 | NHLRC1 | Zornitza Stark Phenotypes for gene: NHLRC1 were changed from to Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.215 | NHLRC1 | Zornitza Stark Publications for gene: NHLRC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.214 | NHLRC1 | Zornitza Stark Mode of inheritance for gene: NHLRC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.213 | NPC2 | Zornitza Stark Marked gene: NPC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.213 | NPC2 | Zornitza Stark Gene: npc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.213 | NPC2 | Zornitza Stark Phenotypes for gene: NPC2 were changed from to Niemann-pick disease, type C2 MIM#607625 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.212 | NPC2 | Zornitza Stark Publications for gene: NPC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.211 | NPC2 | Zornitza Stark Mode of inheritance for gene: NPC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.210 | OPTN | Zornitza Stark Marked gene: OPTN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.210 | OPTN | Zornitza Stark Gene: optn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.210 | OPTN | Zornitza Stark Phenotypes for gene: OPTN were changed from to Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.209 | OPTN | Zornitza Stark Publications for gene: OPTN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.208 | OPTN | Zornitza Stark Mode of inheritance for gene: OPTN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.207 | PANK2 | Zornitza Stark Marked gene: PANK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.207 | PANK2 | Zornitza Stark Gene: pank2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.207 | PANK2 | Zornitza Stark Phenotypes for gene: PANK2 were changed from to Neurodegeneration with brain iron accumulation 1 (MIM#234200) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.206 | PANK2 | Zornitza Stark Publications for gene: PANK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.205 | PANK2 | Zornitza Stark Mode of inheritance for gene: PANK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.204 | PRNP | Zornitza Stark Marked gene: PRNP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.204 | PRNP | Zornitza Stark Gene: prnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.204 | PRNP | Zornitza Stark Phenotypes for gene: PRNP were changed from to Prion Disease (MIM#176640); Creutzfeldt-Jakob disease (MIM#123400) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.203 | PRNP | Zornitza Stark Publications for gene: PRNP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.202 | PRNP | Zornitza Stark Mode of inheritance for gene: PRNP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.201 | PSEN1 | Zornitza Stark Marked gene: PSEN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.201 | PSEN1 | Zornitza Stark Gene: psen1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.201 | PSEN1 | Zornitza Stark Phenotypes for gene: PSEN1 were changed from to Alzheimer disease, type 3 (MIM#607822; MONDO:0011913) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.200 | PSEN1 | Zornitza Stark Publications for gene: PSEN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.199 | PSEN1 | Zornitza Stark Mode of inheritance for gene: PSEN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.198 | PSEN2 | Zornitza Stark Marked gene: PSEN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.198 | PSEN2 | Zornitza Stark Gene: psen2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.198 | PSEN2 | Zornitza Stark Phenotypes for gene: PSEN2 were changed from to Alzheimer disease-4 (MIM#606889) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.197 | PSEN2 | Zornitza Stark Publications for gene: PSEN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.196 | PSEN2 | Zornitza Stark Mode of inheritance for gene: PSEN2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.195 | SQSTM1 | Zornitza Stark Marked gene: SQSTM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.195 | SQSTM1 | Zornitza Stark Gene: sqstm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.195 | SQSTM1 | Zornitza Stark Phenotypes for gene: SQSTM1 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.194 | SQSTM1 | Zornitza Stark Publications for gene: SQSTM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.193 | SQSTM1 | Zornitza Stark Mode of inheritance for gene: SQSTM1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.192 | SQSTM1 | Zornitza Stark Classified gene: SQSTM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.192 | SQSTM1 | Zornitza Stark Gene: sqstm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.191 | TARDBP | Zornitza Stark Marked gene: TARDBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.191 | TARDBP | Zornitza Stark Gene: tardbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.191 | TARDBP | Zornitza Stark Phenotypes for gene: TARDBP were changed from to Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.190 | TARDBP | Zornitza Stark Publications for gene: TARDBP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.189 | TARDBP | Zornitza Stark Mode of inheritance for gene: TARDBP was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.188 | TBK1 | Zornitza Stark Marked gene: TBK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.188 | TBK1 | Zornitza Stark Gene: tbk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.188 | TBK1 | Zornitza Stark Phenotypes for gene: TBK1 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 4, MIM# 616439 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.187 | TBK1 | Zornitza Stark Publications for gene: TBK1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.186 | TBK1 | Zornitza Stark Mode of inheritance for gene: TBK1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.185 | TYROBP | Zornitza Stark Marked gene: TYROBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.185 | TYROBP | Zornitza Stark Gene: tyrobp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.185 | TYROBP | Zornitza Stark Phenotypes for gene: TYROBP were changed from to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.184 | TYROBP | Zornitza Stark Publications for gene: TYROBP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.183 | TYROBP | Zornitza Stark Mode of inheritance for gene: TYROBP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.182 | PLA2G6 | Zornitza Stark Marked gene: PLA2G6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.182 | PLA2G6 | Zornitza Stark Gene: pla2g6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.182 | PLA2G6 | Zornitza Stark Phenotypes for gene: PLA2G6 were changed from to Parkinson disease 14, autosomal recessive, MIM# 612953 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.181 | PLA2G6 | Zornitza Stark Publications for gene: PLA2G6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.180 | PLA2G6 | Zornitza Stark Mode of inheritance for gene: PLA2G6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | PLA2G6 | Sangavi Sivagnanasundram reviewed gene: PLA2G6: Rating: AMBER; Mode of pathogenicity: None; Publications: 25634434, 26836416, 22406380, 20938027; Phenotypes: Parkinson disease 14, autosomal recessive 612953; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | TYROBP | Sangavi Sivagnanasundram reviewed gene: TYROBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301376; Phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | TBK1 | Sangavi Sivagnanasundram reviewed gene: TBK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301623; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 4 616439; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | TARDBP | Sangavi Sivagnanasundram reviewed gene: TARDBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301761, 21803454; Phenotypes: Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | SQSTM1 | Sangavi Sivagnanasundram reviewed gene: SQSTM1: Rating: AMBER; Mode of pathogenicity: None; Publications: 22084127, 22972638; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | PSEN2 | Sangavi Sivagnanasundram reviewed gene: PSEN2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 22503161, 20301340, 25323700, 35491795; Phenotypes: Alzheimer disease-4 (MIM#606889); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | PSEN1 | Sangavi Sivagnanasundram reviewed gene: PSEN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22503161, 20301340; Phenotypes: Alzheimer disease, type 3 (MIM#607822, MONDO:0011913); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | PRNP | Sangavi Sivagnanasundram reviewed gene: PRNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 27910931, 19571725, 20301407, 6351815; Phenotypes: Prion Disease (MIM#176640), Creutzfeldt-Jakob disease (MIM#123400); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | PANK2 | Sangavi Sivagnanasundram reviewed gene: PANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24600523, 23447832, 19480328; Phenotypes: Neurodegeneration with brain iron accumulation 1 (MIM#234200); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | OPTN | Sangavi Sivagnanasundram reviewed gene: OPTN: Rating: GREEN; Mode of pathogenicity: None; Publications: 31838784, 20428114, 20301623; Phenotypes: Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | NPC2 | Sangavi Sivagnanasundram reviewed gene: NPC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27792009, 20525256; Phenotypes: Niemann-pick disease, type C2 MIM#607625; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | NPC1 | Sangavi Sivagnanasundram edited their review of gene: NPC1: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | NPC1 |
Sangavi Sivagnanasundram changed review comment from: NPC is a slowly progressive lysosomal disorder with subtle cognitive impairment in affected individuals at first which progresses to dementia during the disease course. LoF is the mechanism of disease. PMID: 11182931 reported in one individual with NPC and dementia as a phenotype.; to: NPC is a slowly progressive lysosomal disorder with subtle cognitive impairment in affected individuals at first which progresses to dementia during the disease course. NPC type 1 is also known as "juvenile alzheimers disease". LoF is the mechanism of disease. PMID: 11182931 reported in one individual with NPC and dementia as a phenotype. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | NPC1 | Sangavi Sivagnanasundram edited their review of gene: NPC1: Changed rating: GREEN; Changed publications: 20301473, 11182931, 22495346 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | NHLRC1 | Sangavi Sivagnanasundram reviewed gene: NHLRC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28556688, 34117373; Phenotypes: Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | NPC1 | Zornitza Stark Marked gene: NPC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | NPC1 | Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.179 | NPC1 | Zornitza Stark Phenotypes for gene: NPC1 were changed from to Niemann-Pick disease, type C1 (MIM#257220; MONDO:0009757) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.178 | NPC1 | Zornitza Stark Publications for gene: NPC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.177 | NPC1 | Zornitza Stark Mode of inheritance for gene: NPC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.176 | UBQLN2 | Zornitza Stark Phenotypes for gene: UBQLN2 were changed from Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857) to Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.175 | UBQLN2 | Zornitza Stark Marked gene: UBQLN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.175 | UBQLN2 | Zornitza Stark Gene: ubqln2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.175 | UBQLN2 | Zornitza Stark Phenotypes for gene: UBQLN2 were changed from to Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.174 | UBQLN2 | Zornitza Stark Publications for gene: UBQLN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.173 | UBQLN2 | Zornitza Stark Mode of inheritance for gene: UBQLN2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.172 | VCP | Zornitza Stark Marked gene: VCP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.172 | VCP | Zornitza Stark Gene: vcp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.172 | VCP | Zornitza Stark Phenotypes for gene: VCP were changed from to Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320); Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.171 | VCP | Zornitza Stark Publications for gene: VCP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.170 | VCP | Zornitza Stark Mode of inheritance for gene: VCP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.169 | XK | Zornitza Stark Marked gene: XK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.169 | XK | Zornitza Stark Gene: xk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.169 | XK | Zornitza Stark Phenotypes for gene: XK were changed from to McLeod syndrome with or without chronic granulomatous disease (MIM#300842) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.168 | XK | Zornitza Stark Publications for gene: XK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.167 | XK | Zornitza Stark Mode of inheritance for gene: XK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.166 | XK | Zornitza Stark reviewed gene: XK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: McLeod syndrome with or without chronic granulomatous disease (MIM#300842); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.166 | GRN | Zornitza Stark Marked gene: GRN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.166 | GRN | Zornitza Stark Gene: grn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.166 | GRN | Zornitza Stark Phenotypes for gene: GRN were changed from to frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.165 | GRN | Zornitza Stark Publications for gene: GRN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.164 | GRN | Zornitza Stark Mode of inheritance for gene: GRN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.163 | EPM2A | Zornitza Stark Marked gene: EPM2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.163 | EPM2A | Zornitza Stark Gene: epm2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.163 | EPM2A | Zornitza Stark Phenotypes for gene: EPM2A were changed from to Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.162 | EPM2A | Zornitza Stark Publications for gene: EPM2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.161 | EPM2A | Zornitza Stark Mode of inheritance for gene: EPM2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | NPC1 | Sangavi Sivagnanasundram reviewed gene: NPC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 20301473, 11182931; Phenotypes: Niemann-Pick disease, type C1 (MIM#257220, MONDO:0009757); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | UBQLN2 | Sangavi Sivagnanasundram reviewed gene: UBQLN2: Rating: AMBER; Mode of pathogenicity: None; Publications: 20301623, 31319884, 21857683, 30348461; Phenotypes: Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857); Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | VCP | Sangavi Sivagnanasundram reviewed gene: VCP: Rating: GREEN; Mode of pathogenicity: None; Publications: 15034582, 30103325, 21145000; Phenotypes: Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320), Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | XK | Sangavi Sivagnanasundram reviewed gene: XK: Rating: RED; Mode of pathogenicity: None; Publications: 12899725; Phenotypes: McLeod syndrome with or without chronic granulomatous disease (MIM#300842); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | GRN | Sangavi Sivagnanasundram reviewed gene: GRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301545, 17436289; Phenotypes: frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | EPM2A | Sangavi Sivagnanasundram reviewed gene: EPM2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 12019207; Phenotypes: Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | DNMT1 | Sangavi Sivagnanasundram reviewed gene: DNMT1: Rating: AMBER; Mode of pathogenicity: None; Publications: 21532572; Phenotypes: Neuropathy, hereditary sensory, type IE (MIM#614116); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | DNAJC5 | Sangavi Sivagnanasundram reviewed gene: DNAJC5: Rating: GREEN; Mode of pathogenicity: None; Publications: 6153706, 11489285, 12112194, 12790899; Phenotypes: Ceroid lipofuscinosis, neuronal, 4 (Kufs type), autosomal dominant (MIM#162350); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | CSF1R | Sangavi Sivagnanasundram reviewed gene: CSF1R: Rating: GREEN; Mode of pathogenicity: Other; Publications: 22934315, 24336230; Phenotypes: Leukoencephalopathy, diffuse hereditary, with spheroids 1 (MIM#221820); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | CHMP2B | Sangavi Sivagnanasundram reviewed gene: CHMP2B: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 20301378, 16041373; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795, MONDO:0010936); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | APP | Sangavi Sivagnanasundram reviewed gene: APP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301340, 1671712, 1678058, 1908231, 1302033; Phenotypes: Alzheimer disease (MIM#104300, MONDO:0007088); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | CCNF | Bryony Thompson Classified gene: CCNF as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | CCNF | Bryony Thompson Added comment: Comment on list classification: Limited gene-disease validity assessment by ClinGen ALS spectrum disorders GCEP - 05/04/2022 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.160 | CCNF | Bryony Thompson Gene: ccnf has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.159 |
Zornitza Stark HPO terms changed from to Cognitive impairment, HP:0100543 List of related panels changed from to Cognitive impairment; HP:0100543 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.158 | ITM2B | Bryony Thompson Marked gene: ITM2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.158 | ITM2B | Bryony Thompson Gene: itm2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.158 | ITM2B | Bryony Thompson Phenotypes for gene: ITM2B were changed from to Cerebral amyloid angiopathy MONDO:0005620 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.157 | ITM2B | Bryony Thompson Publications for gene: ITM2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.156 | ITM2B | Bryony Thompson Mode of inheritance for gene: ITM2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.155 | ITM2B | Bryony Thompson reviewed gene: ITM2B: Rating: GREEN; Mode of pathogenicity: Other; Publications: 10391242, 10781099, 20385796, 33814452; Phenotypes: Cerebral amyloid angiopathy MONDO:0005620; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.155 | APOE | Zornitza Stark Classified gene: APOE as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.155 | APOE | Zornitza Stark Gene: apoe has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.154 | APOE | Zornitza Stark changed review comment from: E4 allele association with late-onset AD.; to: E4 allele association with late-onset AD. Susceptibility allele. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.154 | APOE | Zornitza Stark edited their review of gene: APOE: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.154 | APOE | Elena Savva reviewed gene: APOE: Rating: AMBER; Mode of pathogenicity: Other; Publications: PMID: 33679311; Phenotypes: Alzheimer disease 2 MIM#104310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.154 | CLN6 | Bryony Thompson Marked gene: CLN6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.154 | CLN6 | Bryony Thompson Gene: cln6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.154 | CLN6 | Bryony Thompson Classified gene: CLN6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.154 | CLN6 | Bryony Thompson Gene: cln6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.153 | PPIA | Seb Lunke Marked gene: PPIA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.153 | PPIA | Seb Lunke Gene: ppia has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.153 | PPIA | Seb Lunke Phenotypes for gene: PPIA were changed from amyotrophic lateral sclerosis, MONDO:0004976 to amyotrophic lateral sclerosis, MONDO:0004976, PPIA-associated | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.152 | PPIA |
Seb Lunke gene: PPIA was added gene: PPIA was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: PPIA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPIA were set to 34972208 Phenotypes for gene: PPIA were set to amyotrophic lateral sclerosis, MONDO:0004976 Review for gene: PPIA was set to RED Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.151 | MATR3 | Bryony Thompson Marked gene: MATR3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.151 | MATR3 | Bryony Thompson Gene: matr3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.151 | MATR3 | Bryony Thompson Phenotypes for gene: MATR3 were changed from Amyotrophic lateral sclerosis 21 MIM#606070 to Amyotrophic lateral sclerosis 21 MIM#606070; frontotemporal dementia; multisystem proteinopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.150 | MATR3 | Bryony Thompson Publications for gene: MATR3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.149 | MATR3 | Bryony Thompson Mode of inheritance for gene: MATR3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | MATR3 | Bryony Thompson edited their review of gene: MATR3: Changed phenotypes: Amyotrophic lateral sclerosis 21 MIM#606070, frontotemporal dementia, multisystem proteinopathy; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | MATR3 | Bryony Thompson changed review comment from: One family with ALS-FTD has been reported so far. A rat primary neuron model showed neurons were bidirectionally vulnerable to MATR3 levels, with pathogenic MATR3 mutants displaying enhanced toxicity.; to: Two cases/families with ALS-FTD has been reported with missense variants. An early-onset bvFTD case has been reported with a MATR3 variant 5 retrotransposition of uncertain significance. A rat primary neuron model showed neurons were bidirectionally vulnerable to MATR3 levels, with pathogenic MATR3 mutants displaying enhanced toxicity. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | MATR3 | Bryony Thompson edited their review of gene: MATR3: Changed publications: 24686783, 30015619, 28029397, 33408686; Changed phenotypes: Amyotrophic lateral sclerosis 21 MIM#606070, frontotemporal dementia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Marked STR: CJD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Classified STR: CJD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.147 | CJD |
Bryony Thompson STR: CJD was added STR: CJD was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CJD were set to 2159587; 20301407 Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: CJD was set to GREEN STR: CJD was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.146 | Bryony Thompson removed STR:PRNP from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.145 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.145 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.144 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Early-onset Dementia. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.143 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.142 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.142 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.142 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.142 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.141 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Early-onset Dementia. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.140 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.139 | FTDALS | Bryony Thompson Marked STR: FTDALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.139 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.139 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.139 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.138 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 25577942; 21944779; 21944778 Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.137 | Bryony Thompson removed STR:C9orf72 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.136 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.136 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.136 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.136 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.135 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Early-onset Dementia. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[(66_517)] Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.134 | CST3 | Zornitza Stark Classified gene: CST3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.134 | CST3 | Zornitza Stark Gene: cst3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.133 | CST3 | Zornitza Stark Tag founder tag was added to gene: CST3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.133 | CST3 | Zornitza Stark reviewed gene: CST3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.133 | CLN6 |
Bryony Thompson gene: CLN6 was added gene: CLN6 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: CLN6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CLN6 were set to 30561534 Phenotypes for gene: CLN6 were set to Ceroid lipofuscinosis, neuronal, Kufs type, adult onset MIM#204300 Review for gene: CLN6 was set to GREEN gene: CLN6 was marked as current diagnostic Added comment: Dementia or cognitive decline was a feature of the condition in 15/20 cases from 13 unrelated families with Kufs type ceroid lipofuscinosis caused by biallelic CLN6 variants. In some cases, this was the initial presenting feature of the condition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.132 | CCNF | Zornitza Stark Phenotypes for gene: CCNF were changed from amyotrophic lateral sclerosis with/without frontotemporal dementia to Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.131 | CCNF | Zornitza Stark reviewed gene: CCNF: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.131 | CYLD | Zornitza Stark Phenotypes for gene: CYLD were changed from Frontotemporal dementia; Amyotrophic lateral sclerosis to Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.130 | CYLD | Zornitza Stark edited their review of gene: CYLD: Changed phenotypes: Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.130 | ATP7B | Bryony Thompson edited their review of gene: ATP7B: Changed publications: 26758278, 25988284 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.130 | SNCA | Zornitza Stark Marked gene: SNCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.130 | SNCA | Zornitza Stark Gene: snca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.130 | SNCA | Zornitza Stark Phenotypes for gene: SNCA were changed from to Dementia, Lewy body (MIM#127750); Parkinson disease 1 (MIM#168601); Parkinson disease 4 (MIM#605543) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.129 | SNCA | Zornitza Stark Publications for gene: SNCA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.128 | SNCA | Zornitza Stark Mode of inheritance for gene: SNCA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.127 | SNCA | Zornitza Stark reviewed gene: SNCA: Rating: GREEN; Mode of pathogenicity: None; Publications: 32849182, 26858591, 32740728; Phenotypes: Dementia, Lewy body (MIM#127750), Parkinson disease 1 (MIM#168601), Parkinson disease 4 (MIM#605543); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.127 | STUB1 | Bryony Thompson Classified gene: STUB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.127 | STUB1 | Bryony Thompson Gene: stub1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.126 | STUB1 | Bryony Thompson edited their review of gene: STUB1: Changed phenotypes: Spinocerebellar ataxia 48 MIM#618093, cognitive impairment, Spinocerebellar ataxia, autosomal recessive 16 MIM#615768; Set current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.126 | STUB1 |
Bryony Thompson gene: STUB1 was added gene: STUB1 was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: STUB1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: STUB1 were set to 32713943 Phenotypes for gene: STUB1 were set to Spinocerebellar ataxia 48 MIM#618093; cognitive impairment; Spinocerebellar ataxia, autosomal recessive 16 MIM#615768 Review for gene: STUB1 was set to GREEN Added comment: Cognitive impairment can be a feature of conditions caused by this gene. Cognitive impairment, mostly dysexecutive, was observed and sometimes predominant in 54% (26/48) of cases with dominant (mainly) or recessive ataxia and pathogenic variants in STUB1. No STUB1 variants were found in 115 patients with FTD. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.125 | C9orf72 | Bryony Thompson Classified gene: C9orf72 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.125 | C9orf72 | Bryony Thompson Gene: c9orf72 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.124 | ATN1 | Bryony Thompson Classified gene: ATN1 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.124 | ATN1 | Bryony Thompson Gene: atn1 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.123 | DRPLA | Bryony Thompson Marked STR: DRPLA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.123 | DRPLA | Bryony Thompson Str: drpla has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.123 | DRPLA | Bryony Thompson Classified STR: DRPLA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.123 | DRPLA | Bryony Thompson Str: drpla has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.122 | DRPLA |
Bryony Thompson STR: DRPLA was added STR: DRPLA was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: DRPLA. Mode of inheritance for STR: DRPLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DRPLA were set to 29325606; 20301664 Phenotypes for STR: DRPLA were set to Dentatorubral-pallidoluysian atrophy MIM#125370 Review for STR: DRPLA was set to GREEN STR: DRPLA was marked as clinically relevant Added comment: NM_001007026.1:c.1462_1464CAG[X] Toxic gain of function mechanism of disease Benign: ≤35 repeats Mutable normal: 20-35 repeats Pathogenic: ≥48 repeats Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.121 | TUBA4A | Zornitza Stark Marked gene: TUBA4A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.121 | TUBA4A | Zornitza Stark Gene: tuba4a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.121 | TUBA4A | Zornitza Stark Phenotypes for gene: TUBA4A were changed from to Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.120 | TUBA4A | Zornitza Stark Publications for gene: TUBA4A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.119 | TUBA4A | Zornitza Stark Mode of inheritance for gene: TUBA4A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.118 | TUBA4A | Zornitza Stark Classified gene: TUBA4A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.118 | TUBA4A | Zornitza Stark Gene: tuba4a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.117 | TUBA4A | Zornitza Stark reviewed gene: TUBA4A: Rating: AMBER; Mode of pathogenicity: None; Publications: 28069311, 25374358, 26675813; Phenotypes: Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.117 | CHCHD10 | Zornitza Stark Publications for gene: CHCHD10 were set to 24934289; 31690696; 30877432; 32369233 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.116 | CHCHD10 |
Zornitza Stark changed review comment from: CHCHD10 is a small protein of the mitochondrial intermembrane space that is enriched at cristae junctions. It is predicted to be involved in oxidative phosphorylation or in maintenance of cristae morphology. Variants have been associated with a broad spectrum of neurological/neuromuscular phenotypes. Several large multiplex families described segregating different neurological disorders, ranging from dementia, to SMA, to myopathy. GOF mechanism has been proposed for FTD/ALS association based on a mouse model. Two families reported with p.Ser59Leu variant and predominantly a dementia phenotype. Variant segregated with disease in 8 family members in one of the families. No variants in this gene identified in an Australian cohort study, PMID 31690696; however, good functional data including from mouse model supports gene-disease association.; to: CHCHD10 is a small protein of the mitochondrial intermembrane space that is enriched at cristae junctions. It is predicted to be involved in oxidative phosphorylation or in maintenance of cristae morphology. Variants have been associated with a broad spectrum of neurological/neuromuscular phenotypes. Several large multiplex families described segregating different neurological disorders, ranging from dementia, to SMA, to myopathy. GOF mechanism has been proposed for FTD/ALS association based on a mouse model. Two families reported with p.Ser59Leu variant, and one with a truncating variant and predominantly a dementia phenotype. Variant segregated with disease in 8 family members in one of the families. No variants in this gene identified in an Australian cohort study, PMID 31690696; however, good functional data including from mouse model supports gene-disease association. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.116 | CHCHD10 | Zornitza Stark edited their review of gene: CHCHD10: Changed publications: 24934289, 31690696, 30877432, 32369233, 28069311 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.116 | TTR | Zornitza Stark Marked gene: TTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.116 | TTR | Zornitza Stark Gene: ttr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.116 | TTR | Zornitza Stark Phenotypes for gene: TTR were changed from to Amyloidosis, hereditary, transthyretin-related, MIM# 105210 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.115 | TTR | Zornitza Stark Publications for gene: TTR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.114 | TTR | Zornitza Stark Mode of inheritance for gene: TTR was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.113 | TTR | Zornitza Stark reviewed gene: TTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301373; Phenotypes: Amyloidosis, hereditary, transthyretin-related, MIM# 105210; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.113 | TREM2 | Zornitza Stark Marked gene: TREM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.113 | TREM2 | Zornitza Stark Gene: trem2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.113 | TREM2 | Zornitza Stark Phenotypes for gene: TREM2 were changed from to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.112 | TREM2 | Zornitza Stark Publications for gene: TREM2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.111 | TREM2 | Zornitza Stark Mode of inheritance for gene: TREM2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.110 | TREM2 | Zornitza Stark reviewed gene: TREM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 12080485, 15883308; Phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.110 | SPG21 |
Zornitza Stark changed review comment from: Mast syndrome is an autosomal recessive complicated form of hereditary spastic paraplegia in which progressive spastic paraparesis is associated in more advanced cases with cognitive decline, dementia, and other neurologic abnormalities. Symptom onset usually occurs in adulthood, and the disorder is progressive with variable severity. Brain imaging shows thinning of the corpus callosum. The disorder occurs with high frequency in the Old Order Amish. Founder variant in Amish, two additional families and a mouse model.; to: Mast syndrome is an autosomal recessive complicated form of hereditary spastic paraplegia in which progressive spastic paraparesis is associated in more advanced cases with cognitive decline, dementia, and other neurologic abnormalities. Symptom onset usually occurs in adulthood, and the disorder is progressive with variable severity. Brain imaging shows thinning of the corpus callosum. The disorder occurs with high frequency in the Old Order Amish. Founder variant in Amish, two additional families and a mouse model. New HGNC approved gene name is ACP33 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.110 | SPG21 | Zornitza Stark Tag new gene name tag was added to gene: SPG21. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.110 | SPG21 | Zornitza Stark Marked gene: SPG21 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.110 | SPG21 | Zornitza Stark Gene: spg21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.110 | SPG21 | Zornitza Stark Phenotypes for gene: SPG21 were changed from to Mast syndrome, MIM# 248900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.109 | SPG21 | Zornitza Stark Publications for gene: SPG21 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.108 | SPG21 | Zornitza Stark Mode of inheritance for gene: SPG21 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.107 | SPG21 | Zornitza Stark edited their review of gene: SPG21: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.107 | SPG21 | Zornitza Stark edited their review of gene: SPG21: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.107 | SPG21 | Zornitza Stark reviewed gene: SPG21: Rating: ; Mode of pathogenicity: None; Publications: 14564668, 24451228, 28752238, 26978163; Phenotypes: Mast syndrome, MIM# 248900; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.107 | SNCB | Zornitza Stark Tag disputed tag was added to gene: SNCB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.107 | SNCB | Zornitza Stark Marked gene: SNCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.107 | SNCB | Zornitza Stark Gene: sncb has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.107 | SNCB | Zornitza Stark Phenotypes for gene: SNCB were changed from to Dementia, Lewy body, MIM#127750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.106 | SNCB | Zornitza Stark Publications for gene: SNCB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.105 | SNCB | Zornitza Stark Mode of inheritance for gene: SNCB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.104 | SNCB | Zornitza Stark Classified gene: SNCB as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.104 | SNCB | Zornitza Stark Gene: sncb has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.103 | SNCB | Zornitza Stark reviewed gene: SNCB: Rating: RED; Mode of pathogenicity: None; Publications: 15365127, 20697047; Phenotypes: Dementia, Lewy body, 127750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.103 | FUS | Zornitza Stark Marked gene: FUS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.103 | FUS | Zornitza Stark Gene: fus has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.103 | FUS | Zornitza Stark Phenotypes for gene: FUS were changed from to Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.102 | FUS | Zornitza Stark Publications for gene: FUS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.101 | FUS | Zornitza Stark Mode of inheritance for gene: FUS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.100 | FUS | Zornitza Stark reviewed gene: FUS: Rating: GREEN; Mode of pathogenicity: None; Publications: 32941707, 32770214; Phenotypes: Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.100 | FTL | Zornitza Stark Marked gene: FTL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.100 | FTL | Zornitza Stark Gene: ftl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.100 | FTL | Zornitza Stark Phenotypes for gene: FTL were changed from to Neurodegeneration with brain iron accumulation 3, MIM# 606159 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.99 | FTL | Zornitza Stark Publications for gene: FTL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.98 | FTL | Zornitza Stark Mode of inheritance for gene: FTL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.97 | FTL | Zornitza Stark reviewed gene: FTL: Rating: GREEN; Mode of pathogenicity: None; Publications: 11438811, 18854324, 15099026, 15173247; Phenotypes: Neurodegeneration with brain iron accumulation 3, MIM# 606159; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.97 | FA2H | Zornitza Stark Marked gene: FA2H as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.97 | FA2H | Zornitza Stark Gene: fa2h has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.97 | FA2H | Zornitza Stark Phenotypes for gene: FA2H were changed from to Spastic paraplegia 35, autosomal recessive, MIM# 612319 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.96 | FA2H | Zornitza Stark Mode of inheritance for gene: FA2H was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.95 | FA2H | Zornitza Stark Classified gene: FA2H as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.95 | FA2H | Zornitza Stark Gene: fa2h has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.94 | FA2H | Zornitza Stark reviewed gene: FA2H: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 35, autosomal recessive, MIM# 612319; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.94 | DCTN1 | Zornitza Stark Marked gene: DCTN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.94 | DCTN1 | Zornitza Stark Gene: dctn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.94 | DCTN1 | Zornitza Stark Phenotypes for gene: DCTN1 were changed from to Perry syndrome, MIM# 168605 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.93 | DCTN1 | Zornitza Stark Publications for gene: DCTN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.92 | DCTN1 | Zornitza Stark Mode of inheritance for gene: DCTN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.91 | DCTN1 | Zornitza Stark reviewed gene: DCTN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19136952; Phenotypes: Perry syndrome, MIM# 168605; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.91 | CYP27A1 | Zornitza Stark Marked gene: CYP27A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.91 | CYP27A1 | Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.91 | CYP27A1 | Zornitza Stark Phenotypes for gene: CYP27A1 were changed from to Cerebrotendinous xanthomatosis, MIM# 213700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.90 | CYP27A1 | Zornitza Stark Mode of inheritance for gene: CYP27A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.89 | CYP27A1 | Zornitza Stark reviewed gene: CYP27A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebrotendinous xanthomatosis, MIM# 213700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.89 | CHCHD10 | Zornitza Stark Marked gene: CHCHD10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.89 | CHCHD10 | Zornitza Stark Gene: chchd10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.89 | CHCHD10 | Zornitza Stark Phenotypes for gene: CHCHD10 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.88 | CHCHD10 | Zornitza Stark Publications for gene: CHCHD10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.87 | CHCHD10 | Zornitza Stark Mode of inheritance for gene: CHCHD10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.86 | CHCHD10 | Zornitza Stark reviewed gene: CHCHD10: Rating: GREEN; Mode of pathogenicity: None; Publications: 24934289, 31690696, 30877432, 32369233; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.86 | C19orf12 | Zornitza Stark Marked gene: C19orf12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.86 | C19orf12 | Zornitza Stark Gene: c19orf12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.86 | C19orf12 | Zornitza Stark Phenotypes for gene: C19orf12 were changed from to Neurodegeneration with brain iron accumulation 4, MIM# 614298 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.85 | C19orf12 | Zornitza Stark Publications for gene: C19orf12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.84 | C19orf12 | Zornitza Stark Mode of inheritance for gene: C19orf12 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.83 | C19orf12 | Zornitza Stark reviewed gene: C19orf12: Rating: GREEN; Mode of pathogenicity: None; Publications: 23278385, 21981780, 23269600; Phenotypes: Neurodegeneration with brain iron accumulation 4, MIM# 614298; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.83 | ATP13A2 | Zornitza Stark Marked gene: ATP13A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.83 | ATP13A2 | Zornitza Stark Gene: atp13a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.83 | ATP13A2 | Zornitza Stark Phenotypes for gene: ATP13A2 were changed from to Kufor-Rakeb syndrome, MIM# 606693 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.82 | ATP13A2 | Zornitza Stark Mode of inheritance for gene: ATP13A2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.81 | ATP13A2 | Zornitza Stark reviewed gene: ATP13A2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kufor-Rakeb syndrome, MIM# 606693; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.81 | ARSA | Zornitza Stark Marked gene: ARSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.81 | ARSA | Zornitza Stark Gene: arsa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.81 | ARSA | Zornitza Stark Phenotypes for gene: ARSA were changed from to Metachromatic leukodystrophy, MIM# 250100, adult-onset | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.80 | ARSA | Zornitza Stark Publications for gene: ARSA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.79 | ARSA | Zornitza Stark Mode of inheritance for gene: ARSA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.78 | ARSA | Zornitza Stark reviewed gene: ARSA: Rating: GREEN; Mode of pathogenicity: None; Publications: 29486463, 26890752, 15710861; Phenotypes: Metachromatic leukodystrophy, MIM# 250100, adult-onset; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.78 | APOE | Zornitza Stark Marked gene: APOE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.78 | APOE | Zornitza Stark Gene: apoe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.78 | APOE | Zornitza Stark Phenotypes for gene: APOE were changed from to Alzheimer disease 2, MIM# 104310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.77 | APOE | Zornitza Stark Mode of inheritance for gene: APOE was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.76 | APOE | Zornitza Stark reviewed gene: APOE: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alzheimer disease 2, MIM# 104310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.76 | NOTCH3 | Zornitza Stark Marked gene: NOTCH3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.76 | NOTCH3 | Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.76 | NOTCH3 | Zornitza Stark Phenotypes for gene: NOTCH3 were changed from to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.75 | NOTCH3 | Zornitza Stark Publications for gene: NOTCH3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.74 | NOTCH3 | Zornitza Stark Mode of inheritance for gene: NOTCH3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.73 | NOTCH3 | Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31960911; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.73 | TET2 | Zornitza Stark Marked gene: TET2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.73 | TET2 | Zornitza Stark Gene: tet2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.73 | TET2 |
Zornitza Stark gene: TET2 was added gene: TET2 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: TET2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TET2 were set to 32330418; 31943063 Phenotypes for gene: TET2 were set to Dementia Review for gene: TET2 was set to RED Added comment: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution. PMID: 31943063 - Li et al 2020 - functional studies in mice show that Tet2 depletion in the hippocampus exacerbates Alzheimer disease pathology and cognitive dysfunction at early disease stages. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.72 | PRNP | Bryony Thompson Classified STR: PRNP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.72 | PRNP | Bryony Thompson Str: prnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.71 | PRNP |
Bryony Thompson STR: PRNP was added STR: PRNP was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: PRNP. Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP were set to 20301407 Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP was set to GREEN STR: PRNP was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.70 | C9orf72 | Bryony Thompson Classified STR: C9orf72 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.70 | C9orf72 | Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.69 | C9orf72 |
Bryony Thompson STR: C9orf72 was added STR: C9orf72 was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: C9orf72. Mode of inheritance for STR: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: C9orf72 were set to 25577942 Phenotypes for STR: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: C9orf72 was set to GREEN STR: C9orf72 was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.68 | C9orf72 | Bryony Thompson Classified gene: C9orf72 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.68 | C9orf72 | Bryony Thompson Added comment: Comment on list classification: Only reported cause of disease is a hexanucleotide repeat (GGGGCC) located between the noncoding exons 1a and 1b. RNA toxicity or proteotoxicity is the expected mechanism of disease. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.68 | C9orf72 | Bryony Thompson Gene: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.67 | HDL2 | Bryony Thompson Classified STR: HDL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.67 | HDL2 | Bryony Thompson Str: hdl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.66 | HDL2 |
Bryony Thompson STR: HDL2 was added STR: HDL2 was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: HDL2. Mode of inheritance for STR: HDL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HDL2 were set to 20301701 Phenotypes for STR: HDL2 were set to Huntington disease-like 2 MIM#606438 Review for STR: HDL2 was set to GREEN STR: HDL2 was marked as clinically relevant Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included Full penetrance: ≥40 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.65 | C9orf72 | Zornitza Stark Marked gene: C9orf72 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.65 | C9orf72 | Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.65 | C9orf72 | Zornitza Stark Classified gene: C9orf72 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.65 | C9orf72 | Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.64 | C9orf72 |
Zornitza Stark gene: C9orf72 was added gene: C9orf72 was added to Early-onset Dementia. Sources: Expert list STR tags were added to gene: C9orf72. Mode of inheritance for gene: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: C9orf72 were set to 31779815; 21944778; 21944779 Phenotypes for gene: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for gene: C9orf72 was set to GREEN Added comment: Well established gene-disease association. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.63 | HNRNPA2B1 | Bryony Thompson Marked gene: HNRNPA2B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.63 | HNRNPA2B1 | Bryony Thompson Gene: hnrnpa2b1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.63 | HNRNPA2B1 | Bryony Thompson Classified gene: HNRNPA2B1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.63 | HNRNPA2B1 | Bryony Thompson Gene: hnrnpa2b1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.62 | HNRNPA2B1 |
Bryony Thompson gene: HNRNPA2B1 was added gene: HNRNPA2B1 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: HNRNPA2B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HNRNPA2B1 were set to 23455423; 30279180; 29358076; 26744327; 23635965 Phenotypes for gene: HNRNPA2B1 were set to Inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 2 MIM#615422 Review for gene: HNRNPA2B1 was set to AMBER Added comment: One family reported that segregates cognitive impairment as part of the phenotype, and extensive functional analysis of protein, including a drosophila model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.61 | HNRNPA1 | Bryony Thompson Marked gene: HNRNPA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.61 | HNRNPA1 | Bryony Thompson Gene: hnrnpa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.61 | HNRNPA1 |
Bryony Thompson gene: HNRNPA1 was added gene: HNRNPA1 was added to Early-onset Dementia. Sources: Other Mode of inheritance for gene: HNRNPA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HNRNPA1 were set to 24612671; 24119545; 23455423 Phenotypes for gene: HNRNPA1 were set to Inclusion body myopathy with early-onset Paget disease without frontotemporal dementia 3 MIM#615424; Amyotrophic lateral sclerosis 20 MIM#615426 Review for gene: HNRNPA1 was set to RED Added comment: I cannot find any evidence that pathogenic variants in this gene cause dementia. The conditions associated with the gene are a pure ALS without FTD and myopathy. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.60 | CST3 | Bryony Thompson Marked gene: CST3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.60 | CST3 | Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.60 | GSN | Bryony Thompson Marked gene: GSN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.60 | GSN | Bryony Thompson Gene: gsn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.60 | GSN |
Bryony Thompson gene: GSN was added gene: GSN was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: GSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GSN were set to Amyloidosis, Finnish type MIM#105120 Review for gene: GSN was set to RED Added comment: I could not find any evidence of a gene-disease association with dementia. Hereditary motor and sensory neuropathy is reported as the neurological phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.59 | CST3 | Bryony Thompson Classified gene: CST3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.59 | CST3 | Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.58 | CST3 |
Bryony Thompson changed review comment from: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but there is modest risk associated with the homozygote (rs1064039) minor allele geneotype, combined OR 1.6. Sources: Expert list; to: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but there is modest risk associated with the homozygote (rs1064039) minor allele genotype, combined OR 1.6. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.58 | CST3 |
Bryony Thompson changed review comment from: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but the combined OR for the homozygote (rs1064039) minor allele is modest risk at 1.6. Sources: Expert list; to: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but there is modest risk associated with the homozygote (rs1064039) minor allele geneotype, combined OR 1.6. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.58 | CST3 |
Bryony Thompson gene: CST3 was added gene: CST3 was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: CST3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CST3 were set to 22435454; 8866434; 2602413; 8108423 Phenotypes for gene: CST3 were set to Cerebral amyloid angiopathy MIM#105150 Mode of pathogenicity for gene: CST3 was set to Other Review for gene: CST3 was set to GREEN Added comment: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but the combined OR for the homozygote (rs1064039) minor allele is modest risk at 1.6. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.57 | CYLD | Bryony Thompson Classified gene: CYLD as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.57 | CYLD | Bryony Thompson Gene: cyld has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.56 | CYLD | Bryony Thompson reviewed gene: CYLD: Rating: AMBER; Mode of pathogenicity: None; Publications: 32666117, 32666099, 32185393; Phenotypes: frontotemporal dementia, amyotrophic lateral sclerosis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.56 | MAPT | Zornitza Stark Marked gene: MAPT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.56 | MAPT | Zornitza Stark Gene: mapt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.56 | MAPT | Zornitza Stark Phenotypes for gene: MAPT were changed from to Supranuclear palsy, progressive (MIM# 601104) AD; Supranuclear palsy, progressive atypical (MIM# 260540) AR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.55 | MAPT | Zornitza Stark Publications for gene: MAPT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.54 | MAPT | Zornitza Stark Mode of inheritance for gene: MAPT was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.53 | MAPT | Ain Roesley reviewed gene: MAPT: Rating: GREEN; Mode of pathogenicity: None; Publications: 20838030, 11220749; Phenotypes: Supranuclear palsy, progressive (MIM# 601104) AD, Supranuclear palsy, progressive atypical (MIM# 260540) AR; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.53 | ATN1 | Bryony Thompson Tag STR tag was added to gene: ATN1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.53 | CTSF | Zornitza Stark Classified gene: CTSF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.53 | CTSF | Zornitza Stark Gene: ctsf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.53 | CTSF | Zornitza Stark Marked gene: CTSF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.53 | CTSF | Zornitza Stark Gene: ctsf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.53 | CTSF | Zornitza Stark Classified gene: CTSF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.53 | CTSF | Zornitza Stark Gene: ctsf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.52 | CTSF |
Elena Savva gene: CTSF was added gene: CTSF was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: CTSF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CTSF were set to PMID: 28749476; 27668283; 27524508 Phenotypes for gene: CTSF were set to Ceroid lipofuscinosis, neuronal, 13, Kufs type 615362 Review for gene: CTSF was set to GREEN Added comment: OMIM: Cathepsin is a member of the papain family of cysteine proteases. These enzymes represent a major component of the lysosomal proteolytic system. PMID: 28749476 - 1 chet patient (missense, CNV) with FTD, onset at 37 years old. PMID: 27668283 - 2 families with adult-onset neuronal ceroid lipofuscinosis and FTD. Onset in 20s-30s. Light and electron microscopy shows swollen neuronal perikarya and intraneuronal storage of polymorphic lipofuscin-like inclusions PMID: 27524508 - 1 hom family (PTC) with early-onset Alzheimer disease Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.52 | GBA | Zornitza Stark Marked gene: GBA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.52 | GBA | Zornitza Stark Gene: gba has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.52 | GBA | Zornitza Stark Phenotypes for gene: GBA were changed from to {Lewy body dementia, susceptibility to} (MIM# 127750) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.51 | GBA | Zornitza Stark Publications for gene: GBA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.50 | GBA | Zornitza Stark Mode of inheritance for gene: GBA was changed from Unknown to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.49 | GBA | Zornitza Stark Classified gene: GBA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.49 | GBA | Zornitza Stark Gene: gba has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.48 | GBA | Ain Roesley reviewed gene: GBA: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 23588557, 32439597, 31010158; Phenotypes: {Lewy body dementia, susceptibility to} (MIM# 127750); Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.48 | CYLD | Zornitza Stark Marked gene: CYLD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.48 | CYLD | Zornitza Stark Gene: cyld has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.48 | CYLD |
Zornitza Stark gene: CYLD was added gene: CYLD was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: CYLD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CYLD were set to 32185393 Phenotypes for gene: CYLD were set to Frontotemporal dementia; Amyotrophic lateral sclerosis Review for gene: CYLD was set to RED Added comment: Recent report of a missense variant segregating in 1 family with frontotemporal dementia and amyotrophic lateral sclerosis. Functional studies showed that the variant resulted in a gain of ubiquitinase function, opposite from the mechanism causing the well-documented cutaneous phenotypes Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.47 | ATN1 | Bryony Thompson Classified gene: ATN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.47 | ATN1 | Bryony Thompson Added comment: Comment on list classification: Note: trinucleotide repeat is the only cause of dementia for this gene. STRs are currently not detectable in WES/WGS technologies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.47 | ATN1 | Bryony Thompson Gene: atn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.46 | ATN1 | Bryony Thompson Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.46 | ATN1 | Bryony Thompson Classified gene: ATN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.46 | ATN1 | Bryony Thompson Added comment: Comment on list classification: STR only cause of dementia for this gene | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.46 | ATN1 | Bryony Thompson Gene: atn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.45 | ATN1 |
Bryony Thompson gene: ATN1 was added gene: ATN1 was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: ATN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATN1 were set to 7633415 Phenotypes for gene: ATN1 were set to Dentatorubral-pallidoluysian atrophy MIM#125370 Mode of pathogenicity for gene: ATN1 was set to Other Review for gene: ATN1 was set to GREEN Added comment: DRPLA contains various combinations of myoclonus, seizures, ataxia, choreoathetosis, and dementia, and is only caused by trinucleotide repeat expansion. Mean age of onset is 30 years of age. From OMIM: In 22 patients unstable expansion of a CAG unit in the DRPLA gene was identified. Each patient was a heterozygote with 1 allele in the normal range (8-25 repeat units) and a second expanded allele with the range of 54-68 repeat units. There were no overlaps in the number of CAG repeat units between control chromosomes and DRPLA chromosomes. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.44 | CCNF | Bryony Thompson Marked gene: CCNF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.44 | CCNF | Bryony Thompson Gene: ccnf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.44 | CCNF | Bryony Thompson Classified gene: CCNF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.44 | CCNF | Bryony Thompson Gene: ccnf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.43 | CCNF |
Bryony Thompson gene: CCNF was added gene: CCNF was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: CCNF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CCNF were set to 27080313 Phenotypes for gene: CCNF were set to amyotrophic lateral sclerosis with/without frontotemporal dementia Review for gene: CCNF was set to GREEN Added comment: Four cases, within three families with FTD with/without ALS. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.40 | Bryony Thompson Panel types changed to Victorian Clinical Genetics Services; Melbourne Genomics; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.38 | PINK1 | Bryony Thompson Mode of inheritance for gene: PINK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.37 | PRKN | Bryony Thompson Marked gene: PRKN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.37 | PRKN | Bryony Thompson Gene: prkn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.37 | PRKN | Bryony Thompson Phenotypes for gene: PRKN were changed from to Parkinson disease, juvenile, type 2 MIM#600116 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.36 | PRKN | Bryony Thompson Mode of inheritance for gene: PRKN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.35 | SPG11 | Bryony Thompson Phenotypes for gene: SPG11 were changed from to Spastic paraplegia 11, autosomal recessive MIM#604360; Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668; Amyotrophic lateral sclerosis 5, juvenile MIM#602099 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.34 | SPG11 | Bryony Thompson Mode of inheritance for gene: SPG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.33 | VPS13A | Bryony Thompson Phenotypes for gene: VPS13A were changed from to Choreoacanthocytosis MIM#200150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.33 | VPS13A | Bryony Thompson Mode of inheritance for gene: VPS13A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.32 | VPS35 | Bryony Thompson Mode of inheritance for gene: VPS35 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.31 | VPS35 | Bryony Thompson Phenotypes for gene: VPS35 were changed from to {Parkinson disease 17} MIM#614203; Cognitive decline | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.30 | VAPB | Bryony Thompson Phenotypes for gene: VAPB were changed from to Amyotrophic lateral sclerosis 8 MIM#608627; Spinal muscular atrophy, late-onset, Finkel type MIM#182980 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.29 | MATR3 | Bryony Thompson Marked gene: MATR3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.29 | MATR3 | Bryony Thompson Gene: matr3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.29 | MATR3 | Bryony Thompson Phenotypes for gene: MATR3 were changed from to Amyotrophic lateral sclerosis 21 MIM#606070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.28 | MATR3 | Bryony Thompson Mode of inheritance for gene: MATR3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.27 | PARK7 | Bryony Thompson Mode of inheritance for gene: PARK7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.26 | LRRK2 | Bryony Thompson Mode of inheritance for gene: LRRK2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.25 | TAF15 | Bryony Thompson Classified gene: TAF15 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.25 | TAF15 | Bryony Thompson Gene: taf15 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.24 | RNF216 | Bryony Thompson Classified gene: RNF216 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.24 | RNF216 | Bryony Thompson Gene: rnf216 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.24 | RNF216 | Bryony Thompson Classified gene: RNF216 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.24 | RNF216 | Bryony Thompson Gene: rnf216 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.23 | RNF216 | Bryony Thompson Marked gene: RNF216 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.23 | RNF216 | Bryony Thompson Gene: rnf216 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.23 | CP | Bryony Thompson Classified gene: CP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.23 | CP | Bryony Thompson Gene: cp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.22 | MATR3 | Bryony Thompson Classified gene: MATR3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.22 | MATR3 | Bryony Thompson Gene: matr3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.21 | GCH1 | Bryony Thompson Classified gene: GCH1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.21 | GCH1 | Bryony Thompson Gene: gch1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.20 | FIG4 | Bryony Thompson Classified gene: FIG4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.20 | FIG4 | Bryony Thompson Added comment: Comment on list classification: ALS-FTD not a prominent phenotype | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.20 | FIG4 | Bryony Thompson Gene: fig4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.19 | ATP7B | Bryony Thompson Marked gene: ATP7B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.19 | ATP7B | Bryony Thompson Gene: atp7b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.19 | ATP7B | Bryony Thompson Classified gene: ATP7B as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.19 | ATP7B | Bryony Thompson Gene: atp7b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.18 | ANG | Bryony Thompson Classified gene: ANG as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.18 | ANG | Bryony Thompson Added comment: Comment on list classification: Not a prominent ALS-FTD phenotype | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.18 | ANG | Bryony Thompson Gene: ang has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.17 | WDR45 | Bryony Thompson Classified gene: WDR45 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.17 | WDR45 | Bryony Thompson Gene: wdr45 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.16 | WDR45 |
Bryony Thompson changed review comment from: De novo variants identified in 5 cases with static encephalopathy of childhood with neurodegeneration in adulthood (SENDA), which included dementia as a feature. Sources: Expert list; to: De novo variants identified in 5 female cases with static encephalopathy of childhood with neurodegeneration in adulthood (SENDA), which included dementia as a feature. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.16 | WDR45 |
Bryony Thompson gene: WDR45 was added gene: WDR45 was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: WDR45 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: WDR45 were set to 23435086 Phenotypes for gene: WDR45 were set to Neurodegeneration with brain iron accumulation 5 MIM#300894 Review for gene: WDR45 was set to GREEN Added comment: De novo variants identified in 5 cases with static encephalopathy of childhood with neurodegeneration in adulthood (SENDA), which included dementia as a feature. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.15 | VPS35 | Bryony Thompson reviewed gene: VPS35: Rating: ; Mode of pathogenicity: None; Publications: 31686421, 22105352; Phenotypes: {Parkinson disease 17} MIM#614203; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.15 | VPS13A | Bryony Thompson reviewed gene: VPS13A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26813249, 15824261, 30140251, 31192303; Phenotypes: Choreoacanthocytosis MIM#200150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.15 | VAPB | Bryony Thompson Classified gene: VAPB as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.15 | VAPB | Bryony Thompson Gene: vapb has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.14 | VAPB | Bryony Thompson reviewed gene: VAPB: Rating: RED; Mode of pathogenicity: None; Publications: 31873036, 31089860; Phenotypes: Amyotrophic lateral sclerosis 8 MIM#608627, Spinal muscular atrophy, late-onset, Finkel type MIM#182980; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.14 | UCHL1 | Bryony Thompson Classified gene: UCHL1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.14 | UCHL1 | Bryony Thompson Gene: uchl1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.13 | UCHL1 | Bryony Thompson reviewed gene: UCHL1: Rating: RED; Mode of pathogenicity: None; Publications: 27231703, 15297154; Phenotypes: Spastic paraplegia 79, autosomal recessive MIM#615491; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.13 | TH | Bryony Thompson Classified gene: TH as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.13 | TH | Bryony Thompson Gene: th has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.12 | TH | Bryony Thompson reviewed gene: TH: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Segawa syndrome, recessive MIM#605407; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.12 | TAF15 |
Bryony Thompson gene: TAF15 was added gene: TAF15 was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: TAF15 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TAF15 were set to 28889094 Phenotypes for gene: TAF15 were set to Amyotrophic lateral sclerosis; Frontotemporal dementia Review for gene: TAF15 was set to AMBER Added comment: Two missense variants identified in two unrelated cases with a similar phenotype which included low motor neuron predominant signs, behavioural variant FTD and movement disorders, and in one patient, neuropathology showed a frontotemporal lobar degeneration pattern. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.11 | SPG11 | Bryony Thompson reviewed gene: SPG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 27318863, 28237315, 18079167; Phenotypes: Spastic paraplegia 11, autosomal recessive MIM#604360, Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668, Amyotrophic lateral sclerosis 5, juvenile MIM#602099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.11 | SPART | Bryony Thompson Classified gene: SPART as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.11 | SPART | Bryony Thompson Gene: spart has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.10 | SPART | Bryony Thompson reviewed gene: SPART: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Troyer syndrome MIM#275900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.10 | SOD1 | Bryony Thompson Classified gene: SOD1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.10 | SOD1 | Bryony Thompson Gene: sod1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.9 | SOD1 | Bryony Thompson reviewed gene: SOD1: Rating: RED; Mode of pathogenicity: None; Publications: 19252762, 20577002; Phenotypes: Amyotrophic lateral sclerosis 1 MIM#105400, Spastic tetraplegia and axial hypotonia, progressive MIM#618598; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.9 | SETX | Bryony Thompson Classified gene: SETX as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.9 | SETX | Bryony Thompson Gene: setx has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.8 | SETX | Bryony Thompson reviewed gene: SETX: Rating: RED; Mode of pathogenicity: None; Publications: 24694197; Phenotypes: Amyotrophic lateral sclerosis 4, juvenile MIM#602433, Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.8 | RNF216 |
Bryony Thompson gene: RNF216 was added gene: RNF216 was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: RNF216 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNF216 were set to 23656588; 25841028; 27995769 Phenotypes for gene: RNF216 were set to Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 Review for gene: RNF216 was set to GREEN Added comment: At least 3 families reported with dementia as a feature of the condition. Mouse model has deficits in spatial learning and memory. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.7 | PRKN | Bryony Thompson edited their review of gene: PRKN: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.7 | PRKN | Bryony Thompson reviewed gene: PRKN: Rating: ; Mode of pathogenicity: None; Publications: 29644727; Phenotypes: Parkinson disease, juvenile, type 2 MIM#600116; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.7 | PINK1 | Bryony Thompson reviewed gene: PINK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29644727, 15955953; Phenotypes: Parkinson disease 6, early onset MIM#605909; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.7 | PARK7 | Bryony Thompson reviewed gene: PARK7: Rating: GREEN; Mode of pathogenicity: None; Publications: 16240358, 27085187, 29644727; Phenotypes: Parkinson disease 7, autosomal recessive early-onset MIM#606324; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.7 | NR4A2 | Bryony Thompson Classified gene: NR4A2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.7 | NR4A2 | Bryony Thompson Gene: nr4a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.6 | NR4A2 | Bryony Thompson reviewed gene: NR4A2: Rating: RED; Mode of pathogenicity: None; Publications: 12756136, 9092472; Phenotypes: ; Mode of inheritance: Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.6 | MATR3 | Bryony Thompson reviewed gene: MATR3: Rating: AMBER; Mode of pathogenicity: None; Publications: 24686783, 30015619; Phenotypes: Amyotrophic lateral sclerosis 21 MIM#606070; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.6 | LRRK2 | Bryony Thompson reviewed gene: LRRK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17060595, 31038182, 27521182, 28487191; Phenotypes: Parkinson disease 8 MIM#607060; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.6 | ALS2 | Bryony Thompson Classified gene: ALS2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.6 | ALS2 | Bryony Thompson Gene: als2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.5 | ALS2 | Bryony Thompson Classified gene: ALS2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.5 | ALS2 | Bryony Thompson Gene: als2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.5 | HTRA2 | Bryony Thompson Classified gene: HTRA2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.5 | HTRA2 | Bryony Thompson Gene: htra2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.4 | HTRA2 | Bryony Thompson reviewed gene: HTRA2: Rating: RED; Mode of pathogenicity: None; Publications: 18800009; Phenotypes: Parkinson disease 13 MIM#610297, 3-methylglutaconic aciduria, type VIII MIM#617248; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.4 | HTRA1 | Bryony Thompson Classified gene: HTRA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.4 | HTRA1 | Bryony Thompson Gene: htra1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.4 | HTRA1 | Bryony Thompson Classified gene: HTRA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.4 | HTRA1 | Bryony Thompson Gene: htra1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.3 | HTRA1 |
Bryony Thompson gene: HTRA1 was added gene: HTRA1 was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: HTRA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: HTRA1 were set to 29895533; 26063658; 19387015 Phenotypes for gene: HTRA1 were set to CARASIL syndrome MIM#600142; Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2 MIM#616779 Review for gene: HTRA1 was set to GREEN Added comment: Dementia or cognitive decline have been reported in >3 cases with recessive and dominant disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.2 | GCH1 | Bryony Thompson reviewed gene: GCH1: Rating: RED; Mode of pathogenicity: None; Publications: 29948246; Phenotypes: Dystonia, DOPA-responsive, with or without hyperphenylalaninemia MIM#128230, Hyperphenylalaninemia, BH4-deficient, B MIM#233910; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.2 | FIG4 | Bryony Thompson reviewed gene: FIG4: Rating: RED; Mode of pathogenicity: None; Publications: 28889094, 19118816; Phenotypes: Amyotrophic lateral sclerosis 11 MIM#612577, Charcot-Marie-Tooth disease, type 4J MIM#611228; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.2 | CP |
Bryony Thompson gene: CP was added gene: CP was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for gene: CP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CP were set to 7539672; https://doi.org/10.1093/qjmed/89.5.355; 28874056; 28012953 Phenotypes for gene: CP were set to Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290 Review for gene: CP was set to GREEN Added comment: >3 cases have been reported with dementia/cognitive decline as a feature of the condition. Cp-/- mice have increased memory impairment and iron accumulation and high expression of CP could have a protective role in Alzheimer's disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.1 | ATP7B | Bryony Thompson reviewed gene: ATP7B: Rating: RED; Mode of pathogenicity: None; Publications: 26758278, 25988284, 26758278; Phenotypes: Wilson disease MIM#277900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.1 | ANG | Bryony Thompson reviewed gene: ANG: Rating: RED; Mode of pathogenicity: None; Publications: 19153377; Phenotypes: Amyotrophic lateral sclerosis 9 MIM#611895; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.1 | ALS2 | Bryony Thompson reviewed gene: ALS2: Rating: RED; Mode of pathogenicity: None; Publications: 31405128, 12145748, 24562058; Phenotypes: Amyotrophic lateral sclerosis 2, juvenile MIM#205100, Primary lateral sclerosis, juvenile MIM#606353, Spastic paralysis, infantile onset ascending MIM#607225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.1 |
Zornitza Stark Panel name changed from Early-onset Dementia_MGHA_VCGS to Early-onset Dementia Panel types changed to Victorian Clinical Genetics Services; Melbourne Genomics |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | XK |
Zornitza Stark gene: XK was added gene: XK was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: XK was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | VPS35 |
Zornitza Stark gene: VPS35 was added gene: VPS35 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: VPS35 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | VPS13A |
Zornitza Stark gene: VPS13A was added gene: VPS13A was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: VPS13A was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | VCP |
Zornitza Stark gene: VCP was added gene: VCP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: VCP was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | VAPB |
Zornitza Stark gene: VAPB was added gene: VAPB was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: VAPB was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | UCHL1 |
Zornitza Stark gene: UCHL1 was added gene: UCHL1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: UCHL1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | UBQLN2 |
Zornitza Stark gene: UBQLN2 was added gene: UBQLN2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: UBQLN2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | TYROBP |
Zornitza Stark gene: TYROBP was added gene: TYROBP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: TYROBP was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | TUBA4A |
Zornitza Stark gene: TUBA4A was added gene: TUBA4A was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: TUBA4A was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | TTR |
Zornitza Stark gene: TTR was added gene: TTR was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: TTR was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | TREM2 |
Zornitza Stark gene: TREM2 was added gene: TREM2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: TREM2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | TH |
Zornitza Stark gene: TH was added gene: TH was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: TH was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | TBK1 |
Zornitza Stark gene: TBK1 was added gene: TBK1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: TBK1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | TARDBP |
Zornitza Stark gene: TARDBP was added gene: TARDBP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: TARDBP was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | SQSTM1 |
Zornitza Stark gene: SQSTM1 was added gene: SQSTM1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: SQSTM1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | SPG21 |
Zornitza Stark gene: SPG21 was added gene: SPG21 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: SPG21 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | SPG11 |
Zornitza Stark gene: SPG11 was added gene: SPG11 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: SPG11 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | SPART |
Zornitza Stark gene: SPART was added gene: SPART was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: SPART was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | SOD1 |
Zornitza Stark gene: SOD1 was added gene: SOD1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: SOD1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | SNCB |
Zornitza Stark gene: SNCB was added gene: SNCB was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: SNCB was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | SNCA |
Zornitza Stark gene: SNCA was added gene: SNCA was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: SNCA was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | SETX |
Zornitza Stark gene: SETX was added gene: SETX was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: SETX was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | PSEN2 |
Zornitza Stark gene: PSEN2 was added gene: PSEN2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PSEN2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | PSEN1 |
Zornitza Stark gene: PSEN1 was added gene: PSEN1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PSEN1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | PRNP |
Zornitza Stark gene: PRNP was added gene: PRNP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PRNP was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | PRKN |
Zornitza Stark gene: PRKN was added gene: PRKN was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PRKN was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | PLA2G6 |
Zornitza Stark gene: PLA2G6 was added gene: PLA2G6 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PLA2G6 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | PINK1 |
Zornitza Stark gene: PINK1 was added gene: PINK1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PINK1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | PARK7 |
Zornitza Stark gene: PARK7 was added gene: PARK7 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PARK7 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | PANK2 |
Zornitza Stark gene: PANK2 was added gene: PANK2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: PANK2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | OPTN |
Zornitza Stark gene: OPTN was added gene: OPTN was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: OPTN was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | NR4A2 |
Zornitza Stark gene: NR4A2 was added gene: NR4A2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: NR4A2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | NPC2 |
Zornitza Stark gene: NPC2 was added gene: NPC2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: NPC2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | NPC1 |
Zornitza Stark gene: NPC1 was added gene: NPC1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: NPC1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | NOTCH3 |
Zornitza Stark gene: NOTCH3 was added gene: NOTCH3 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: NOTCH3 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | NHLRC1 |
Zornitza Stark gene: NHLRC1 was added gene: NHLRC1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: NHLRC1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | MATR3 |
Zornitza Stark gene: MATR3 was added gene: MATR3 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: MATR3 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | MAPT |
Zornitza Stark gene: MAPT was added gene: MAPT was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: MAPT was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | LRRK2 |
Zornitza Stark gene: LRRK2 was added gene: LRRK2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: LRRK2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | ITM2B |
Zornitza Stark gene: ITM2B was added gene: ITM2B was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: ITM2B was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | HTRA2 |
Zornitza Stark gene: HTRA2 was added gene: HTRA2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: HTRA2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | GRN |
Zornitza Stark gene: GRN was added gene: GRN was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: GRN was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | GCH1 |
Zornitza Stark gene: GCH1 was added gene: GCH1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: GCH1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | GBA |
Zornitza Stark gene: GBA was added gene: GBA was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: GBA was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | FUS |
Zornitza Stark gene: FUS was added gene: FUS was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: FUS was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | FTL |
Zornitza Stark gene: FTL was added gene: FTL was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: FTL was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | FIG4 |
Zornitza Stark gene: FIG4 was added gene: FIG4 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: FIG4 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | FA2H |
Zornitza Stark gene: FA2H was added gene: FA2H was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: FA2H was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | EPM2A |
Zornitza Stark gene: EPM2A was added gene: EPM2A was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: EPM2A was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | DNMT1 |
Zornitza Stark gene: DNMT1 was added gene: DNMT1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: DNMT1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | DNAJC5 |
Zornitza Stark gene: DNAJC5 was added gene: DNAJC5 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: DNAJC5 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | DCTN1 |
Zornitza Stark gene: DCTN1 was added gene: DCTN1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: DCTN1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | CYP27A1 |
Zornitza Stark gene: CYP27A1 was added gene: CYP27A1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: CYP27A1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | CSF1R |
Zornitza Stark gene: CSF1R was added gene: CSF1R was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: CSF1R was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | CHMP2B |
Zornitza Stark gene: CHMP2B was added gene: CHMP2B was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: CHMP2B was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | CHCHD10 |
Zornitza Stark gene: CHCHD10 was added gene: CHCHD10 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: CHCHD10 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | C19orf12 |
Zornitza Stark gene: C19orf12 was added gene: C19orf12 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: C19orf12 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | ATP7B |
Zornitza Stark gene: ATP7B was added gene: ATP7B was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: ATP7B was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | ATP13A2 |
Zornitza Stark gene: ATP13A2 was added gene: ATP13A2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: ATP13A2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | ARSA |
Zornitza Stark gene: ARSA was added gene: ARSA was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: ARSA was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | APP |
Zornitza Stark gene: APP was added gene: APP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: APP was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | APOE |
Zornitza Stark gene: APOE was added gene: APOE was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: APOE was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | ANG |
Zornitza Stark gene: ANG was added gene: ANG was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: ANG was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | ALS2 |
Zornitza Stark gene: ALS2 was added gene: ALS2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship Mode of inheritance for gene: ALS2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.0 | Zornitza Stark Added panel Early-onset Dementia_MGHA_VCGS | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||