Activity

Filter

Cancel
Date Panel Item Activity
1058 actions
Early-onset Parkinson disease v2.49 TENM4 Bryony Thompson Phenotypes for gene: TENM4 were changed from Neurodevelopmental disorder, MONDO:0700092; tremor, hereditary essential, 5 MONDO:0014756; first branchial cleft anomaly MONDO:0015376 to tremor, hereditary essential, 5 MONDO:0014756
Early-onset Parkinson disease v2.48 TENM4 Bryony Thompson changed review comment from: TENM4 encodes a type II transmembrane teneurin involved in neuronal development and oligodendrocyte maturation.

Amber for essential tremor - 2 families with rare missense and supporting segregation evidence, plus mouse & zebrafish models. 2 other GDAs have limited evidence.
PMID 26188006 - 3 families reported with essential tremor with incomplete segregation. 2 of the variants (p.Ala1442Thr and p.Val1138Met) are more common than expected in gnomAD. p.Thr1367Asn is a rare missense and segregates with ET over 3 generations (2 unaffected carriers under the average age of onset). Functional assays demonstrate dominant‑negative effects in oligodendrocyte precursor cells and zebrafish axon‑guidance defects for all 3 variants.
 PMID 36689009 - rare heterozygous missense (p.P421L) segregating in 5 affected individuals with ET in a single family
 PMID 29249217 -  a case with hereditary tremor‑like syndrome with palatal tremor but no description of the TENM4 variant in the paper.
PMID 22915103 - myelination of small-diameter axons was dramatically reduced, and differentiation of oligodendrocytes, the myelin-forming cells in the CNS, was inhibited in null mouse model.

PMID 34589676 - 2 rare missense in 2 patients with first branchial cleft anomalies. No other evidence. Multiple missense in different genes in one of the patients. - limited evidence for gene-disease association

PMID 41449293 - rare splice variant identified in a single family (segregates in 6 individuals) with childhood‑onset intellectual disability with epilepsy. Splice‑site‑mediated exon 10 skipping leading to seizures in a mouse model, supporting a pathogenic role. - single family reported
Sources: Literature; to: TENM4 encodes a type II transmembrane teneurin involved in neuronal development and oligodendrocyte maturation.
Amber for essential tremor - 2 families with rare missense and supporting segregation evidence, plus mouse & zebrafish models. 2 other GDAs have limited evidence.
PMID 26188006 - 3 families reported with essential tremor with incomplete segregation. 2 of the variants (p.Ala1442Thr and p.Val1138Met) are more common than expected in gnomAD. p.Thr1367Asn is a rare missense and segregates with ET over 3 generations (2 unaffected carriers under the average age of onset). Functional assays demonstrate dominant‑negative effects in oligodendrocyte precursor cells and zebrafish axon‑guidance defects for all 3 variants.
 PMID 36689009 - rare heterozygous missense (p.P421L) segregating in 5 affected individuals with ET in a single family
 PMID 29249217 -  a case with hereditary tremor‑like syndrome with palatal tremor but no description of the TENM4 variant in the paper.
PMID 22915103 - myelination of small-diameter axons was dramatically reduced, and differentiation of oligodendrocytes, the myelin-forming cells in the CNS, was inhibited in null mouse model.
Sources: Literature
Early-onset Parkinson disease v2.48 Bryony Thompson Copied gene TENM4 from panel Mendeliome
Early-onset Parkinson disease v2.48 TENM4 Bryony Thompson gene: TENM4 was added
gene: TENM4 was added to Early-onset Parkinson disease. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: TENM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TENM4 were set to 41449293; 36689009; 26188006; 29249217; 34589676; 22915103
Phenotypes for gene: TENM4 were set to Neurodevelopmental disorder, MONDO:0700092; tremor, hereditary essential, 5 MONDO:0014756; first branchial cleft anomaly MONDO:0015376
Early-onset Parkinson disease v2.47 DAGLB Zornitza Stark Marked gene: DAGLB as ready
Early-onset Parkinson disease v2.47 DAGLB Zornitza Stark Gene: daglb has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.47 DAGLB Zornitza Stark Phenotypes for gene: DAGLB were changed from to Parkinson disease, MONDO:0005180, DALGB-related
Early-onset Parkinson disease v2.46 DAGLB Zornitza Stark edited their review of gene: DAGLB: Changed phenotypes: Parkinson disease, MONDO:0005180, DALGB-related
Early-onset Parkinson disease v2.46 DAGLB Zornitza Stark Classified gene: DAGLB as Green List (high evidence)
Early-onset Parkinson disease v2.46 DAGLB Zornitza Stark Gene: daglb has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.45 DAGLB Zornitza Stark gene: DAGLB was added
gene: DAGLB was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: DAGLB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DAGLB were set to 35715418; 40244389
Review for gene: DAGLB was set to GREEN
Added comment: PMID 35715418 reports 6 individuals from 4 families and PMID 40244389 reports 3 individuals from 3 families, together comprising 9 individuals from 7 unrelated families with biallelic loss-of-function DAGLB variants causing early‑onset Parkinsonism (onset 27‑52 years) characterized by resting tremor, bradykinesia, rigidity, postural instability and good levodopa response. Functional studies (Western blot loss of DAGLB protein, CRISPR‑SaCas9 knock‑down in mouse nigral dopaminergic neurons reducing 2‑AG levels, and rescue of motor deficits by MAGL inhibition) support loss‑of‑function as the disease mechanism.
Sources: Literature
Early-onset Parkinson disease v2.44 MT-ND6 Zornitza Stark Marked gene: MT-ND6 as ready
Early-onset Parkinson disease v2.44 MT-ND6 Zornitza Stark Gene: mt-nd6 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v2.44 MT-ND6 Zornitza Stark Classified gene: MT-ND6 as Red List (low evidence)
Early-onset Parkinson disease v2.44 MT-ND6 Zornitza Stark Gene: mt-nd6 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v2.43 MT-ND6 Zornitza Stark edited their review of gene: MT-ND6: Changed rating: RED
Early-onset Parkinson disease v2.43 MT-ND6 Zornitza Stark reviewed gene: MT-ND6: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Early-onset Parkinson disease v2.43 GBA Zornitza Stark Tag new gene name tag was added to gene: GBA.
Early-onset Parkinson disease v2.43 DNAJC6 Chirag Patel Publications for gene DNAJC6 were changed from 22563501, 23211418, 26528954, 33983693 to 22563501, 23211418, 26528954, 33983693
Early-onset Parkinson disease v2.42 DNAJC6 Chirag Patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DNAJC6.
Source Victorian Clinical Genetics Services was removed from DNAJC6.
Source Expert list was added to DNAJC6.
Phenotypes for gene: DNAJC6 were changed from juvenile onset Parkinson disease 19A MONDO:0014231 to Parkinson disease 19a, juvenile-onset - MIM#615528; Parkinson disease 19b, early-onset - MIM#615528
Early-onset Parkinson disease v2.41 DCTN1 Chirag Patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DCTN1.
Source Victorian Clinical Genetics Services was removed from DCTN1.
Source Expert list was added to DCTN1.
Phenotypes for gene: DCTN1 were changed from Perry syndrome MONDO:0008201 to Perry syndrome, MONDO:0008201
Publications for gene DCTN1 were changed from 20945553, 19136952, 24343258 to 20945553, 19136952, 24343258
Early-onset Parkinson disease v2.40 DNAJC5 Chirag Patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DNAJC5.
Source Victorian Clinical Genetics Services was removed from DNAJC5.
Source Expert list was added to DNAJC5.
Phenotypes for gene: DNAJC5 were changed from Ceroid lipofuscinosis, neuronal, 4, Parry type, MIM# 162350 to Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083
Early-onset Parkinson disease v2.39 PTPA Zornitza Stark Phenotypes for gene: PTPA were changed from Intellectual disability, MONDO: 36073231, PTPA-related; Parkisonism to Intellectual disability, MONDO: 36073231, PTPA-related; Parkinson disease MONDO:0005180, PTPA-related
Early-onset Parkinson disease v2.38 PTPA Zornitza Stark edited their review of gene: PTPA: Changed phenotypes: Intellectual disability, MONDO: 36073231, PTPA-related, Parkinson disease MONDO:0005180, PTPA-related
Early-onset Parkinson disease v2.38 KCNJ15 Zornitza Stark Marked gene: KCNJ15 as ready
Early-onset Parkinson disease v2.38 KCNJ15 Zornitza Stark Gene: kcnj15 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v2.38 KCNJ15 Zornitza Stark gene: KCNJ15 was added
gene: KCNJ15 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: KCNJ15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNJ15 were set to 40566643
Phenotypes for gene: KCNJ15 were set to Parkinson disease, MONDO:0005180, KCNJ15-related
Review for gene: KCNJ15 was set to RED
Added comment: Single multiplex family reported with a missense variant and functional data.
Sources: Literature
Early-onset Parkinson disease v2.37 POLR3A Zornitza Stark Phenotypes for gene: POLR3A were changed from Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694; POLR3A Leukoencephalopathy; Parkinsonism; Ocular and dental abnormality; Hypogonadism to POLR3A-related disorder MONDO:0700276
Early-onset Parkinson disease v2.36 POLR3A Zornitza Stark edited their review of gene: POLR3A: Changed phenotypes: POLR3A-related disorder MONDO:0700276
Early-onset Parkinson disease v2.36 NOTCH2NLC_NIID_GGC Bryony Thompson Gene: NOTCH2NL was changed to NOTCH2NLC.
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Marked STR: TBP_SCA17_CAG as ready
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Classified STR: TBP_SCA17_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.34 TBP_SCA17_CAG Bryony Thompson STR: TBP_SCA17_CAG was added
STR: TBP_SCA17_CAG was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for STR: TBP_SCA17_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: TBP_SCA17_CAG were set to 10484774; 20301611; 29325606; 27172828; 14638975; 11313753; 11914409
Phenotypes for STR: TBP_SCA17_CAG were set to Spinocerebellar ataxia 17 MIM#607136
Review for STR: TBP_SCA17_CAG was set to GREEN
STR: TBP_SCA17_CAG was marked as clinically relevant
STR: TBP_SCA17_CAG was marked as current diagnostic
Added comment: NM_003194.4:c.172_174[X]
Mechanism of disease expected to be gain of function
Normal: ≤ 40 CAG/CAA repeats
Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms.
Full-penetrance: ≥49 CAG/CAA repeats
Sources: Expert list
Early-onset Parkinson disease v2.33 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Marked STR: ATXN8OS_SCA8_CTG as ready
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Classified STR: ATXN8OS_SCA8_CTG as Green List (high evidence)
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.31 ATXN8OS_SCA8_CTG Bryony Thompson STR: ATXN8OS_SCA8_CTG was added
STR: ATXN8OS_SCA8_CTG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN8OS_SCA8_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN8OS_SCA8_CTG were set to 24285970; 20301445; 10192387
Phenotypes for STR: ATXN8OS_SCA8_CTG were set to Spinocerebellar ataxia 8 MIM#608768
Review for STR: ATXN8OS_SCA8_CTG was set to GREEN
STR: ATXN8OS_SCA8_CTG was marked as clinically relevant
STR: ATXN8OS_SCA8_CTG was marked as current diagnostic
Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X]
ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n
Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism
Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats
Alleles of questionable significance: 50-70 repeats.
Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes
Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not.
Sources: Literature
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Marked STR: PPP2R2B_SCA12_CAG as ready
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Classified STR: PPP2R2B_SCA12_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.29 PPP2R2B_SCA12_CAG Bryony Thompson STR: PPP2R2B_SCA12_CAG was added
STR: PPP2R2B_SCA12_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: PPP2R2B_SCA12_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PPP2R2B_SCA12_CAG were set to 31286011; 27864267; 33811808; 10581021
Phenotypes for STR: PPP2R2B_SCA12_CAG were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: PPP2R2B_SCA12_CAG was set to GREEN
STR: PPP2R2B_SCA12_CAG was marked as clinically relevant
STR: PPP2R2B_SCA12_CAG was marked as current diagnostic
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead affects the expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Literature
Early-onset Parkinson disease v2.28 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Marked STR: JPH3_HDL2_CTG as ready
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Classified STR: JPH3_HDL2_CTG as Green List (high evidence)
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.26 JPH3_HDL2_CTG Bryony Thompson changed review comment from: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29
Sources: Literature; to: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included
Full penetrance: ≥40 repeats
Early-onset Parkinson disease v2.26 JPH3_HDL2_CTG Bryony Thompson STR: JPH3_HDL2_CTG was added
STR: JPH3_HDL2_CTG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: JPH3_HDL2_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: JPH3_HDL2_CTG were set to 11558794; 20301701
Phenotypes for STR: JPH3_HDL2_CTG were set to Huntington disease-like 2 MIM#606438
Review for STR: JPH3_HDL2_CTG was set to GREEN
STR: JPH3_HDL2_CTG was marked as clinically relevant
STR: JPH3_HDL2_CTG was marked as current diagnostic
Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29
Sources: Literature
Early-onset Parkinson disease v2.25 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Early-onset Parkinson disease v2.24 FMR1_FXTAS_CGG Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG
Early-onset Parkinson disease v2.23 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Marked STR: ATXN3_SCA3_CAG as ready
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Classified STR: ATXN3_SCA3_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.21 ATXN3_SCA3_CAG Bryony Thompson STR: ATXN3_SCA3_CAG was added
STR: ATXN3_SCA3_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN3_SCA3_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN3_SCA3_CAG were set to 11176969; 7574470; 7874163; 20301375; 29325606
Phenotypes for STR: ATXN3_SCA3_CAG were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3
Review for STR: ATXN3_SCA3_CAG was set to GREEN
STR: ATXN3_SCA3_CAG was marked as clinically relevant
STR: ATXN3_SCA3_CAG was marked as current diagnostic
Added comment: NM_004993​.5:c.886_888CAG[X]
Toxic aggregation and mislocalization in neurons is mechanism of disease
Normal: ≤44 repeats, mostly <31 repeats
Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3
Pathogenic (full penetrance): ≥60 repeats
Sources: Literature
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Marked STR: ATXN2_SCA2_CAG as ready
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Classified STR: ATXN2_SCA2_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.19 ATXN2_SCA2_CAG Bryony Thompson STR: ATXN2_SCA2_CAG was added
STR: ATXN2_SCA2_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN2_SCA2_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN2_SCA2_CAG were set to 11761482; 17923635; 8896555; 29325606; 20301452
Phenotypes for STR: ATXN2_SCA2_CAG were set to Spinocerebellar ataxia 2 MIM#183090
Review for STR: ATXN2_SCA2_CAG was set to GREEN
STR: ATXN2_SCA2_CAG was marked as clinically relevant
STR: ATXN2_SCA2_CAG was marked as current diagnostic
Added comment: NM_002973​.3:c.496_498CAG[X]
Toxic protein aggregation is mechanism of disease
Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2)
Uncertain: 32 repeats
ALS risk allele: 30-32 repeats
Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life
Full penetrance: ≥35 repeats
Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat
Sources: Literature
Early-onset Parkinson disease v2.18 ATXN1_SCA1_CAG Bryony Thompson ATXN1_CAG was changed to ATXN1_SCA1_CAG
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Classified gene: ATXN10 as Red List (low evidence)
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Added comment: Comment on list classification: Only a single family reported
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Gene: atxn10 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence)
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.15 PRNP_CJD_octapeptide Bryony Thompson STR: PRNP_CJD_octapeptide was added
STR: PRNP_CJD_octapeptide was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407
Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP_CJD_octapeptide was set to GREEN
STR: PRNP_CJD_octapeptide was marked as clinically relevant
STR: PRNP_CJD_octapeptide was marked as current diagnostic
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Literature
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Classified STR: RFC1_CANVAS_ANNGN as Green List (high evidence)
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.13 RFC1_CANVAS_ANNGN Bryony Thompson STR: RFC1_CANVAS_ANNGN was added
STR: RFC1_CANVAS_ANNGN was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: RFC1_CANVAS_ANNGN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RFC1_CANVAS_ANNGN were set to 39833204; 39152783; 38789445; 36705320; 35013364
Phenotypes for STR: RFC1_CANVAS_ANNGN were set to Parkinson disease MONDO:0005180
Review for STR: RFC1_CANVAS_ANNGN was set to GREEN
STR: RFC1_CANVAS_ANNGN was marked as clinically relevant
STR: RFC1_CANVAS_ANNGN was marked as current diagnostic
Added comment: Biallelic RFC1 expansions have been identified as a rare cause of Parkinson's disease, without ataxia or neuropathy.
Sources: Literature
Early-onset Parkinson disease v2.12 SLC9A6 Zornitza Stark Marked gene: SLC9A6 as ready
Early-onset Parkinson disease v2.12 SLC9A6 Zornitza Stark Gene: slc9a6 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.12 SLC9A6 Zornitza Stark Classified gene: SLC9A6 as Green List (high evidence)
Early-onset Parkinson disease v2.12 SLC9A6 Zornitza Stark Gene: slc9a6 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.11 SLC9A6 Zornitza Stark gene: SLC9A6 was added
gene: SLC9A6 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: SLC9A6 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: SLC9A6 were set to 35198730; 39810750; 35198730; 31192222
Phenotypes for gene: SLC9A6 were set to Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142
Review for gene: SLC9A6 was set to GREEN
Added comment: Multiple female carriers reported with adult-onset neurological phenotypes including neurodegerative disease and Parkinsonism. Some had affected sons with ID. Uncertain whether this is a separate entity or manifestation in female carriers of a XL condition.
Sources: Literature
Early-onset Parkinson disease v2.10 PPP2R5D Ain Roesley Phenotypes for gene: PPP2R5D were changed from Early onset Parkinsonism; Houge-Janssens syndrome 1, MIM#616355 to Early onset Parkinsonism; Houge-Janssens syndrome 1, MIM#616355
Early-onset Parkinson disease v2.10 PPP2R5D Ain Roesley Phenotypes for gene: PPP2R5D were changed from Early onset Parkinsonism; Mental retardation, autosomal dominant 35, MIM# 616355 to Early onset Parkinsonism; Houge-Janssens syndrome 1, MIM#616355
Early-onset Parkinson disease v2.9 PNPLA6 Bryony Thompson Marked gene: PNPLA6 as ready
Early-onset Parkinson disease v2.9 PNPLA6 Bryony Thompson Gene: pnpla6 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v2.9 PNPLA6 Bryony Thompson Classified gene: PNPLA6 as Amber List (moderate evidence)
Early-onset Parkinson disease v2.9 PNPLA6 Bryony Thompson Gene: pnpla6 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v2.8 PNPLA6 Bryony Thompson gene: PNPLA6 was added
gene: PNPLA6 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PNPLA6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PNPLA6 were set to 32623594; 36825042
Phenotypes for gene: PNPLA6 were set to PNPLA6-related spastic paraplegia with or without ataxia MONDO:0100149
Review for gene: PNPLA6 was set to AMBER
Added comment: Parkinsonism is a part of the phenotype in at least 2 families, both compound hets including the same missense variant (PNPLA6 c.4003C>T p.Pro1335Ser).
Sources: Literature
Early-onset Parkinson disease v2.7 RAB32 Zornitza Stark Phenotypes for gene: RAB32 were changed from Parkinson disease MONDO:0005180 to {Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923
Early-onset Parkinson disease v2.6 RAB32 Zornitza Stark Publications for gene: RAB32 were set to 38614108; 38858457
Early-onset Parkinson disease v2.5 RAB32 Zornitza Stark Publications for gene: RAB32 were set to 38614108
Early-onset Parkinson disease v2.4 RAB32 Zornitza Stark Classified gene: RAB32 as Amber List (moderate evidence)
Early-onset Parkinson disease v2.4 RAB32 Zornitza Stark Gene: rab32 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v2.3 RAB32 Zornitza Stark reviewed gene: RAB32: Rating: AMBER; Mode of pathogenicity: None; Publications: 38858457; Phenotypes: {Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v2.3 PSMF1 Zornitza Stark Marked gene: PSMF1 as ready
Early-onset Parkinson disease v2.3 PSMF1 Zornitza Stark Gene: psmf1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.3 PSMF1 Zornitza Stark Classified gene: PSMF1 as Green List (high evidence)
Early-onset Parkinson disease v2.3 PSMF1 Zornitza Stark Gene: psmf1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.2 PSMF1 Zornitza Stark gene: PSMF1 was added
gene: PSMF1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PSMF1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSMF1 were set to https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1
Phenotypes for gene: PSMF1 were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related
Review for gene: PSMF1 was set to GREEN
Added comment: 22 individuals from 15 families reported with a range of neurological phenotypes ranging from early-onset Parkinson's disease; childhood conditions typified by ID and a range of movement disorders; through to perinatal lethal presentations with arthrogryposis multiplex. Genotype-phenotype correlation: biallelic missense variants resulted in the milder phenotypes, while bi-allelic LoF variants in the more severe phenotypes. Supportive functional data.
Sources: Literature
Early-onset Parkinson disease v2.1 RAB32 Bryony Thompson Marked gene: RAB32 as ready
Early-onset Parkinson disease v2.1 RAB32 Bryony Thompson Gene: rab32 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v2.1 RAB32 Bryony Thompson changed review comment from: A single variant in RAB32 - c.213C>G p.(Ser71Arg) with a significant association with PD (odds ratio [OR] 13.17, 95% CI 2.15-87.23; p=0.0055, 6,043 PD cases and 62,549 controls).
The variant cosegregated with autosomal dominant PD in 3 families (9 affected individuals), with incomplete penetrance. In vitro studies demonstrate that RAB32 Ser71Arg activates LRRK2 kinase.
Sources: Literature; to: A single variant in RAB32 - c.213C>G p.(Ser71Arg) with a significant association with PD (odds ratio [OR] 13.17, 95% CI 2.15-87.23; p=0.0055, 6,043 PD cases and 62,549 controls).
The variant cosegregated with autosomal dominant PD in 3 families (9 affected individuals), with incomplete penetrance. In vitro studies demonstrate that RAB32 Ser71Arg activates LRRK2 kinase.
The variant is reported as a novel reduced penetrance PD risk factor. The 95% CI for the OR estimate are very wide. A confirmatory study is required for this variant.
Sources: Literature
Early-onset Parkinson disease v2.1 RAB32 Bryony Thompson edited their review of gene: RAB32: Changed rating: RED
Early-onset Parkinson disease v2.1 RAB32 Bryony Thompson gene: RAB32 was added
gene: RAB32 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: RAB32 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB32 were set to 38614108
Phenotypes for gene: RAB32 were set to Parkinson disease MONDO:0005180
Mode of pathogenicity for gene: RAB32 was set to Other
Review for gene: RAB32 was set to AMBER
Added comment: A single variant in RAB32 - c.213C>G p.(Ser71Arg) with a significant association with PD (odds ratio [OR] 13.17, 95% CI 2.15-87.23; p=0.0055, 6,043 PD cases and 62,549 controls).
The variant cosegregated with autosomal dominant PD in 3 families (9 affected individuals), with incomplete penetrance. In vitro studies demonstrate that RAB32 Ser71Arg activates LRRK2 kinase.
Sources: Literature
Early-onset Parkinson disease v2.0 Bryony Thompson promoted panel to version 2.0
Early-onset Parkinson disease v1.0 Bryony Thompson promoted panel to version 1.0
Early-onset Parkinson disease v0.347 WDR45 Bryony Thompson Marked gene: WDR45 as ready
Early-onset Parkinson disease v0.347 WDR45 Bryony Thompson Gene: wdr45 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.347 WDR45 Bryony Thompson Phenotypes for gene: WDR45 were changed from to X-linked complex neurodevelopmental disorder MONDO:0100148
Early-onset Parkinson disease v0.346 WDR45 Bryony Thompson Publications for gene: WDR45 were set to
Early-onset Parkinson disease v0.345 WDR45 Bryony Thompson Mode of inheritance for gene: WDR45 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Parkinson disease v0.344 VPS13A Bryony Thompson Marked gene: VPS13A as ready
Early-onset Parkinson disease v0.344 VPS13A Bryony Thompson Gene: vps13a has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.344 VPS13A Bryony Thompson Phenotypes for gene: VPS13A were changed from to chorea-acanthocytosis MONDO:0008695
Early-onset Parkinson disease v0.343 VPS13A Bryony Thompson Publications for gene: VPS13A were set to
Early-onset Parkinson disease v0.342 VPS13A Bryony Thompson Mode of inheritance for gene: VPS13A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.341 TUBB4A Bryony Thompson Mode of inheritance for gene: TUBB4A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.340 TUBB4A Bryony Thompson Marked gene: TUBB4A as ready
Early-onset Parkinson disease v0.340 TUBB4A Bryony Thompson Gene: tubb4a has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.340 TUBB4A Bryony Thompson Classified gene: TUBB4A as Red List (low evidence)
Early-onset Parkinson disease v0.340 TUBB4A Bryony Thompson Added comment: Comment on list classification: More suitable for the dystonia panel
Early-onset Parkinson disease v0.340 TUBB4A Bryony Thompson Gene: tubb4a has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.339 TH Bryony Thompson Marked gene: TH as ready
Early-onset Parkinson disease v0.339 TH Bryony Thompson Gene: th has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.339 TH Bryony Thompson Phenotypes for gene: TH were changed from to Tyrosine hydroxylase deficiency MONDO:0100064
Early-onset Parkinson disease v0.338 TH Bryony Thompson Publications for gene: TH were set to 20301334; 20301610
Early-onset Parkinson disease v0.337 TH Bryony Thompson Publications for gene: TH were set to
Early-onset Parkinson disease v0.336 TH Bryony Thompson Mode of inheritance for gene: TH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.335 SPR Bryony Thompson Marked gene: SPR as ready
Early-onset Parkinson disease v0.335 SPR Bryony Thompson Gene: spr has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.335 SPR Bryony Thompson Phenotypes for gene: SPR were changed from to Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994
Early-onset Parkinson disease v0.334 SPR Bryony Thompson Publications for gene: SPR were set to
Early-onset Parkinson disease v0.333 SPR Bryony Thompson Mode of inheritance for gene: SPR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.332 SLC30A10 Bryony Thompson Marked gene: SLC30A10 as ready
Early-onset Parkinson disease v0.332 SLC30A10 Bryony Thompson Gene: slc30a10 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.332 SLC30A10 Bryony Thompson Mode of inheritance for gene: SLC30A10 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.332 SLC30A10 Bryony Thompson Mode of inheritance for gene: SLC30A10 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.331 SLC30A10 Bryony Thompson Publications for gene: SLC30A10 were set to
Early-onset Parkinson disease v0.330 SLC30A10 Bryony Thompson Phenotypes for gene: SLC30A10 were changed from to cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome MONDO:0013208
Early-onset Parkinson disease v0.329 SPG11 Bryony Thompson Marked gene: SPG11 as ready
Early-onset Parkinson disease v0.329 SPG11 Bryony Thompson Gene: spg11 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.329 SPG11 Bryony Thompson Mode of inheritance for gene: SPG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.328 SPG11 Bryony Thompson Publications for gene: SPG11 were set to
Early-onset Parkinson disease v0.328 SPG11 Bryony Thompson Phenotypes for gene: SPG11 were changed from hereditary spastic paraplegia 11 MONDO:0011445 to hereditary spastic paraplegia 11 MONDO:0011445
Early-onset Parkinson disease v0.327 SPG11 Bryony Thompson Phenotypes for gene: SPG11 were changed from hereditary spastic paraplegia 11 MONDO:0011445 to hereditary spastic paraplegia 11 MONDO:0011445
Early-onset Parkinson disease v0.327 SPG11 Bryony Thompson Phenotypes for gene: SPG11 were changed from to hereditary spastic paraplegia 11 MONDO:0011445
Early-onset Parkinson disease v0.326 RAB39B Bryony Thompson Marked gene: RAB39B as ready
Early-onset Parkinson disease v0.326 RAB39B Bryony Thompson Gene: rab39b has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.326 RAB39B Bryony Thompson Mode of inheritance for gene: RAB39B was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Early-onset Parkinson disease v0.325 RAB39B Bryony Thompson Publications for gene: RAB39B were set to
Early-onset Parkinson disease v0.324 RAB39B Bryony Thompson Phenotypes for gene: RAB39B were changed from to Early-onset parkinsonism-intellectual disability syndrome MONDO:0010709
Early-onset Parkinson disease v0.323 PSEN1 Bryony Thompson Marked gene: PSEN1 as ready
Early-onset Parkinson disease v0.323 PSEN1 Bryony Thompson Gene: psen1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.323 PSEN1 Bryony Thompson Mode of inheritance for gene: PSEN1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.322 PSEN1 Bryony Thompson Mode of inheritance for gene: PSEN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.321 PSEN1 Bryony Thompson Publications for gene: PSEN1 were set to
Early-onset Parkinson disease v0.320 PSEN1 Bryony Thompson Phenotypes for gene: PSEN1 were changed from to Alzheimer disease 3 MONDO:0011913
Early-onset Parkinson disease v0.319 PRKN Bryony Thompson Marked gene: PRKN as ready
Early-onset Parkinson disease v0.319 PRKN Bryony Thompson Gene: prkn has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.319 PRKN Bryony Thompson Phenotypes for gene: PRKN were changed from to autosomal recessive juvenile Parkinson disease 2 MONDO:0010820
Early-onset Parkinson disease v0.318 PRKN Bryony Thompson Mode of inheritance for gene: PRKN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.317 PARK7 Bryony Thompson Marked gene: PARK7 as ready
Early-onset Parkinson disease v0.317 PARK7 Bryony Thompson Gene: park7 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.317 PARK7 Bryony Thompson Phenotypes for gene: PARK7 were changed from to autosomal recessive early-onset Parkinson disease 7 MONDO:0011658
Early-onset Parkinson disease v0.316 PARK7 Bryony Thompson Publications for gene: PARK7 were set to
Early-onset Parkinson disease v0.315 PARK7 Bryony Thompson Mode of inheritance for gene: PARK7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.314 ANG Bryony Thompson Marked gene: ANG as ready
Early-onset Parkinson disease v0.314 ANG Bryony Thompson Gene: ang has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.314 ANG Bryony Thompson gene: ANG was added
gene: ANG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: ANG was set to Unknown
Publications for gene: ANG were set to 33875291; 25386690
Phenotypes for gene: ANG were set to Parkinson disease MONDO:0005180
Review for gene: ANG was set to RED
Added comment: Multiple large studies not finding an association with PD
Sources: Literature
Early-onset Parkinson disease v0.313 FUS Bryony Thompson changed review comment from: A single family reported p.Gln290* segregating (incomplete penetrance) with essential tremor, also two missense variants reported in 2 probands which are too common in gnomAD and have been classified as LB in ClinVar. A reported ET risk variant Met392Ile in a Chinese population - set 1 odds ratio = 4.72 [95% confidence interval = 1.90-11.71], p = 0.0037). Validation set 2 (joint analysis odds ratio = 3.92 [95% confidence interval = 1.57-9.82], p = 8.6 × 10(-4). This variant has been classified as LB in ClinVar.
Sources: Literature; to: A single family reported p.Gln290* segregating (incomplete penetrance) with essential tremor, also two missense variants reported in 2 probands which are too common in gnomAD and have been classified as LB in ClinVar. One of these (Pro431Leu) was also reported in an Italian family. A reported ET risk variant Met392Ile in a Chinese population - set 1 odds ratio = 4.72 [95% confidence interval = 1.90-11.71], p = 0.0037). Validation set 2 (joint analysis odds ratio = 3.92 [95% confidence interval = 1.57-9.82], p = 8.6 × 10(-4). This variant has been classified as LB in ClinVar.
Sources: Literature
Early-onset Parkinson disease v0.313 FUS Bryony Thompson edited their review of gene: FUS: Changed publications: 22863194, 23834483, 23825177, 38626532
Early-onset Parkinson disease v0.313 FUS Bryony Thompson Publications for gene: FUS were set to 22863194
Early-onset Parkinson disease v0.312 FUS Bryony Thompson Marked gene: FUS as ready
Early-onset Parkinson disease v0.312 FUS Bryony Thompson Gene: fus has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.312 FUS Bryony Thompson gene: FUS was added
gene: FUS was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: FUS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FUS were set to 22863194
Phenotypes for gene: FUS were set to tremor, hereditary essential, 4 MONDO:0013888
Review for gene: FUS was set to RED
Added comment: A single family reported p.Gln290* segregating (incomplete penetrance) with essential tremor, also two missense variants reported in 2 probands which are too common in gnomAD and have been classified as LB in ClinVar. A reported ET risk variant Met392Ile in a Chinese population - set 1 odds ratio = 4.72 [95% confidence interval = 1.90-11.71], p = 0.0037). Validation set 2 (joint analysis odds ratio = 3.92 [95% confidence interval = 1.57-9.82], p = 8.6 × 10(-4). This variant has been classified as LB in ClinVar.
Sources: Literature
Early-onset Parkinson disease v0.311 MAPT Bryony Thompson Marked gene: MAPT as ready
Early-onset Parkinson disease v0.311 MAPT Bryony Thompson Gene: mapt has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.311 MAPT Bryony Thompson Phenotypes for gene: MAPT were changed from to late-onset Parkinson disease MONDO:0008199
Early-onset Parkinson disease v0.310 MAPT Bryony Thompson Mode of inheritance for gene: MAPT was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.309 MAPT Bryony Thompson Mode of inheritance for gene: MAPT was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.308 MAPT Bryony Thompson Publications for gene: MAPT were set to
Early-onset Parkinson disease v0.307 VCP Bryony Thompson Marked gene: VCP as ready
Early-onset Parkinson disease v0.307 VCP Bryony Thompson Gene: vcp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.307 VCP Bryony Thompson Classified gene: VCP as Green List (high evidence)
Early-onset Parkinson disease v0.307 VCP Bryony Thompson Gene: vcp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.306 VCP Bryony Thompson gene: VCP was added
gene: VCP was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: VCP were set to 38283104; 38145206
Phenotypes for gene: VCP were set to Inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507
Mode of pathogenicity for gene: VCP was set to Other
Review for gene: VCP was set to GREEN
gene: VCP was marked as current diagnostic
Added comment: Parkinsonism is a rare feature of VCP-related multisystem proteinopathy, but has been reported in at least 15 individuals with VCP variants.
Sources: Literature
Early-onset Parkinson disease v0.305 LYST Bryony Thompson Marked gene: LYST as ready
Early-onset Parkinson disease v0.305 LYST Bryony Thompson Gene: lyst has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.305 LYST Bryony Thompson Publications for gene: LYST were set to
Early-onset Parkinson disease v0.304 LYST Bryony Thompson Phenotypes for gene: LYST were changed from to Chediak-Higashi syndrome MONDO:0008963
Early-onset Parkinson disease v0.303 LYST Bryony Thompson Mode of inheritance for gene: LYST was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.302 LYST Bryony Thompson Classified gene: LYST as Green List (high evidence)
Early-onset Parkinson disease v0.302 LYST Bryony Thompson Added comment: Comment on list classification: Parkinsonism is a feature of the condition
Early-onset Parkinson disease v0.302 LYST Bryony Thompson Gene: lyst has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.301 EPM2A Bryony Thompson Publications for gene: EPM2A were set to PMID: 27574708
Early-onset Parkinson disease v0.300 KIF5A Bryony Thompson Phenotypes for gene: KIF5A were changed from to Spastic paraplegia 10, autosomal dominant MIM#604187
Early-onset Parkinson disease v0.299 KIF5A Bryony Thompson Publications for gene: KIF5A were set to
Early-onset Parkinson disease v0.298 KIF5A Bryony Thompson Mode of inheritance for gene: KIF5A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.297 NHLRC1 Bryony Thompson Publications for gene: NHLRC1 were set to PMID: 22425593
Early-onset Parkinson disease v0.296 LRRK2 Zornitza Stark Mode of inheritance for gene: LRRK2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.295 LRRK2 Sangavi Sivagnanasundram reviewed gene: LRRK2: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 1626954, https://search.clinicalgenome.org/CCID:005305; Phenotypes: Parkinson disease (MONDO:0005180); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.295 PTRHD1 Zornitza Stark Phenotypes for gene: PTRHD1 were changed from early-onset parkinsonism; intellectual disability to Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747
Early-onset Parkinson disease v0.294 PTRHD1 Zornitza Stark reviewed gene: PTRHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.294 FTL Bryony Thompson Publications for gene: FTL were set to 23447832; 20301320
Early-onset Parkinson disease v0.293 FTL Bryony Thompson Publications for gene: FTL were set to
Early-onset Parkinson disease v0.292 FTL Bryony Thompson Mode of inheritance for gene: FTL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.291 FTL Bryony Thompson Classified gene: FTL as Green List (high evidence)
Early-onset Parkinson disease v0.291 FTL Bryony Thompson Added comment: Comment on list classification: Parkinsonism can be a presenting feature of the condition
Early-onset Parkinson disease v0.291 FTL Bryony Thompson Gene: ftl has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.291 FTL Bryony Thompson Classified gene: FTL as Green List (high evidence)
Early-onset Parkinson disease v0.291 FTL Bryony Thompson Added comment: Comment on list classification: Parkinsonism can be a presenting feature of the condition
Early-onset Parkinson disease v0.291 FTL Bryony Thompson Gene: ftl has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.290 TAF1 Bryony Thompson Tag STR tag was added to gene: TAF1.
Early-onset Parkinson disease v0.290 FBXO7 Bryony Thompson Marked gene: FBXO7 as ready
Early-onset Parkinson disease v0.290 FBXO7 Bryony Thompson Gene: fbxo7 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.290 FBXO7 Bryony Thompson Publications for gene: FBXO7 were set to
Early-onset Parkinson disease v0.289 FBXO7 Bryony Thompson Phenotypes for gene: FBXO7 were changed from to parkinsonian-pyramidal syndrome MONDO:0009830
Early-onset Parkinson disease v0.288 FBXO7 Bryony Thompson Mode of inheritance for gene: FBXO7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.287 DNAJC6 Bryony Thompson Marked gene: DNAJC6 as ready
Early-onset Parkinson disease v0.287 DNAJC6 Bryony Thompson Gene: dnajc6 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.287 DNAJC6 Bryony Thompson Phenotypes for gene: DNAJC6 were changed from to juvenile onset Parkinson disease 19A MONDO:0014231
Early-onset Parkinson disease v0.286 DNAJC6 Bryony Thompson Publications for gene: DNAJC6 were set to
Early-onset Parkinson disease v0.285 DNAJC6 Bryony Thompson Mode of inheritance for gene: DNAJC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.284 DCTN1 Bryony Thompson Marked gene: DCTN1 as ready
Early-onset Parkinson disease v0.284 DCTN1 Bryony Thompson Gene: dctn1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.284 DCTN1 Bryony Thompson Phenotypes for gene: DCTN1 were changed from Perry syndrome MONDO:0008201 to Perry syndrome MONDO:0008201
Early-onset Parkinson disease v0.283 DCTN1 Bryony Thompson Phenotypes for gene: DCTN1 were changed from to Perry syndrome MONDO:0008201
Early-onset Parkinson disease v0.282 DCTN1 Bryony Thompson Publications for gene: DCTN1 were set to 20945553
Early-onset Parkinson disease v0.282 DCTN1 Bryony Thompson Publications for gene: DCTN1 were set to
Early-onset Parkinson disease v0.281 DCTN1 Bryony Thompson Mode of inheritance for gene: DCTN1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.281 DCTN1 Bryony Thompson Mode of inheritance for gene: DCTN1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.280 DCTN1 Bryony Thompson Mode of inheritance for gene: DCTN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.280 DCTN1 Bryony Thompson Classified gene: DCTN1 as Green List (high evidence)
Early-onset Parkinson disease v0.280 DCTN1 Bryony Thompson Added comment: Comment on list classification: Parkinsonism is a characteristic feature of Perry syndrome
Early-onset Parkinson disease v0.280 DCTN1 Bryony Thompson Gene: dctn1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.279 CSF1R Bryony Thompson Marked gene: CSF1R as ready
Early-onset Parkinson disease v0.279 CSF1R Bryony Thompson Gene: csf1r has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.279 CSF1R Bryony Thompson Phenotypes for gene: CSF1R were changed from to leukoencephalopathy, diffuse hereditary, with spheroids 1 MONDO:0800027
Early-onset Parkinson disease v0.278 CSF1R Bryony Thompson Publications for gene: CSF1R were set to
Early-onset Parkinson disease v0.277 CSF1R Bryony Thompson Mode of inheritance for gene: CSF1R was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.276 CSF1R Bryony Thompson Classified gene: CSF1R as Green List (high evidence)
Early-onset Parkinson disease v0.276 CSF1R Bryony Thompson Added comment: Comment on list classification: Parkinsonian signs can be a feature on the condition
Early-onset Parkinson disease v0.276 CSF1R Bryony Thompson Gene: csf1r has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.275 C19orf12 Bryony Thompson Marked gene: C19orf12 as ready
Early-onset Parkinson disease v0.275 C19orf12 Bryony Thompson Gene: c19orf12 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.275 C19orf12 Bryony Thompson Phenotypes for gene: C19orf12 were changed from to neurodegeneration with brain iron accumulation 4 MONDO:0013674
Early-onset Parkinson disease v0.274 C19orf12 Bryony Thompson Publications for gene: C19orf12 were set to
Early-onset Parkinson disease v0.273 C19orf12 Bryony Thompson Mode of inheritance for gene: C19orf12 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.272 ATP1A3 Bryony Thompson Marked gene: ATP1A3 as ready
Early-onset Parkinson disease v0.272 ATP1A3 Bryony Thompson Gene: atp1a3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.272 ATP1A3 Bryony Thompson Phenotypes for gene: ATP1A3 were changed from to ATP1A3-associated neurological disorder MONDO:0700002
Early-onset Parkinson disease v0.271 ATP1A3 Bryony Thompson Publications for gene: ATP1A3 were set to
Early-onset Parkinson disease v0.270 ATP1A3 Bryony Thompson Mode of inheritance for gene: ATP1A3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.269 ATP1A3 Bryony Thompson Classified gene: ATP1A3 as Green List (high evidence)
Early-onset Parkinson disease v0.269 ATP1A3 Bryony Thompson Added comment: Comment on list classification: Parkinsonism is a major feature of the condition
Early-onset Parkinson disease v0.269 ATP1A3 Bryony Thompson Gene: atp1a3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.268 ATP13A2 Bryony Thompson Marked gene: ATP13A2 as ready
Early-onset Parkinson disease v0.268 ATP13A2 Bryony Thompson Gene: atp13a2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.268 ATP13A2 Bryony Thompson Phenotypes for gene: ATP13A2 were changed from to parkinsonism due to ATP13A2 deficiency MONDO:0017809
Early-onset Parkinson disease v0.267 ATP13A2 Bryony Thompson Publications for gene: ATP13A2 were set to
Early-onset Parkinson disease v0.266 ATP13A2 Bryony Thompson Mode of inheritance for gene: ATP13A2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.265 OPA3 Bryony Thompson Marked gene: OPA3 as ready
Early-onset Parkinson disease v0.265 OPA3 Bryony Thompson Gene: opa3 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.265 OPA3 Bryony Thompson Classified gene: OPA3 as Red List (low evidence)
Early-onset Parkinson disease v0.265 OPA3 Bryony Thompson Gene: opa3 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.264 WDR45 Kaitlyn Dianna Weldon reviewed gene: WDR45: Rating: GREEN; Mode of pathogenicity: None; Publications: 28211668; Phenotypes: neurodegeneration with brain iron accumulation 5 MONDO:0010476, X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Parkinson disease v0.264 VPS13A Kaitlyn Dianna Weldon reviewed gene: VPS13A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301561, 37636221; Phenotypes: chorea-acanthocytosis MONDO:0008695; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.264 TUBB4A Kaitlyn Dianna Weldon reviewed gene: TUBB4A: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.264 TH Kaitlyn Dianna Weldon reviewed gene: TH: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301334, 20301610; Phenotypes: TH-deficient dopa-responsive dystonia MONDO:0011551, tyrosine hydroxylase deficiency MONDO:0100064; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.264 SPR Claire Fryer-Smith reviewed gene: SPR: Rating: AMBER; Mode of pathogenicity: None; Publications: 22522443, 11920285, 14663042, 16443856, 21782285, 32813147; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency (MIM# 612716); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.264 SPG11 Claire Fryer-Smith reviewed gene: SPG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 35036589, 23121729, 21381113, 27217339; Phenotypes: Amyotrophic lateral sclerosis 5, juvenile (MIM# 602099), Charcot-Marie-Tooth disease, axonal, type 2X (MIM# 616668), Spastic paraplegia 11, autosomal recessive (MIM# 604360); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.264 SLC30A10 Claire Fryer-Smith reviewed gene: SLC30A10: Rating: GREEN; Mode of pathogenicity: None; Publications: 22341971, 22341972; Phenotypes: Hypermanganesemia with dystonia 1 (MIM# 613280); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.264 SLC39A14 Zornitza Stark Marked gene: SLC39A14 as ready
Early-onset Parkinson disease v0.264 SLC39A14 Zornitza Stark Gene: slc39a14 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.264 SLC39A14 Zornitza Stark Phenotypes for gene: SLC39A14 were changed from to Hypermanganesemia with dystonia 2 (MIM# 617013)
Early-onset Parkinson disease v0.263 SLC39A14 Zornitza Stark Publications for gene: SLC39A14 were set to
Early-onset Parkinson disease v0.262 SLC39A14 Zornitza Stark Mode of inheritance for gene: SLC39A14 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.261 SLC39A14 Zornitza Stark Mode of inheritance for gene: SLC39A14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.260 SLC39A14 Claire Fryer-Smith reviewed gene: SLC39A14: Rating: GREEN; Mode of pathogenicity: None; Publications: 27231142, 32626807, 29685658, 30232769; Phenotypes: Hypermanganesemia with dystonia 2 (MIM# 617013); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.260 RAB39B Claire Fryer-Smith reviewed gene: RAB39B: Rating: GREEN; Mode of pathogenicity: None; Publications: 25434005, 26399558, 26739247; Phenotypes: Waisman syndrome (MIM#311510), Intellectual developmental disorder, X-linked 72 (MIM#300271); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Early-onset Parkinson disease v0.260 PANK2 Zornitza Stark Phenotypes for gene: PANK2 were changed from pantothenate kinase-associated neurodegeneration MONDO:0009319 to pantothenate kinase-associated neurodegeneration MONDO:0009319
Early-onset Parkinson disease v0.259 PANK2 Zornitza Stark Marked gene: PANK2 as ready
Early-onset Parkinson disease v0.259 PANK2 Zornitza Stark Gene: pank2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.259 PANK2 Zornitza Stark Phenotypes for gene: PANK2 were changed from pantothenate kinase-associated neurodegeneration MONDO:0009319 to pantothenate kinase-associated neurodegeneration MONDO:0009319
Early-onset Parkinson disease v0.258 PANK2 Zornitza Stark Phenotypes for gene: PANK2 were changed from to pantothenate kinase-associated neurodegeneration MONDO:0009319
Early-onset Parkinson disease v0.257 PANK2 Zornitza Stark Publications for gene: PANK2 were set to
Early-onset Parkinson disease v0.256 PANK2 Zornitza Stark Mode of inheritance for gene: PANK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.255 PLA2G6 Zornitza Stark Marked gene: PLA2G6 as ready
Early-onset Parkinson disease v0.255 PLA2G6 Zornitza Stark Gene: pla2g6 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.255 PLA2G6 Zornitza Stark Phenotypes for gene: PLA2G6 were changed from to autosomal recessive Parkinson disease 14 MONDO:0013060
Early-onset Parkinson disease v0.254 PLA2G6 Zornitza Stark Publications for gene: PLA2G6 were set to
Early-onset Parkinson disease v0.253 PLA2G6 Zornitza Stark Mode of inheritance for gene: PLA2G6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.252 POLG Zornitza Stark Marked gene: POLG as ready
Early-onset Parkinson disease v0.252 POLG Zornitza Stark Gene: polg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.252 POLG Zornitza Stark Phenotypes for gene: POLG were changed from to autosomal dominant progressive external ophthalmoplegia MONDO:0008003
Early-onset Parkinson disease v0.251 POLG Zornitza Stark Publications for gene: POLG were set to
Early-onset Parkinson disease v0.250 POLG Zornitza Stark Mode of inheritance for gene: POLG was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.249 PRKRA Zornitza Stark Marked gene: PRKRA as ready
Early-onset Parkinson disease v0.249 PRKRA Zornitza Stark Gene: prkra has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.249 PRKRA Zornitza Stark Phenotypes for gene: PRKRA were changed from to dystonia 16 MONDO:0012789
Early-onset Parkinson disease v0.248 PRKRA Zornitza Stark Publications for gene: PRKRA were set to
Early-onset Parkinson disease v0.247 PRKRA Zornitza Stark Mode of inheritance for gene: PRKRA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.246 PRNP Zornitza Stark Marked gene: PRNP as ready
Early-onset Parkinson disease v0.246 PRNP Zornitza Stark Gene: prnp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.246 PRNP Zornitza Stark Phenotypes for gene: PRNP were changed from to inherited Creutzfeldt-Jakob disease MONDO:0007403; Gerstmann-Straussler-Scheinker syndrome MONDO:0007656
Early-onset Parkinson disease v0.245 PRNP Zornitza Stark Publications for gene: PRNP were set to
Early-onset Parkinson disease v0.244 PRNP Zornitza Stark Mode of inheritance for gene: PRNP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 PSEN1 Kaitlyn Dianna Weldon reviewed gene: PSEN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 3548932, 34843019, 36825052; Phenotypes: early-onset parkinsons disease; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 PRNP Kaitlyn Dianna Weldon reviewed gene: PRNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301407; Phenotypes: inherited Creutzfeldt-Jakob disease MONDO:0007403, Gerstmann-Straussler-Scheinker syndrome MONDO:0007656; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 PRKRA Kaitlyn Dianna Weldon reviewed gene: PRKRA: Rating: GREEN; Mode of pathogenicity: None; Publications: 33502045; Phenotypes: dystonia 16 MONDO:0012789; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 POLG Kaitlyn Dianna Weldon reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301791, 15351195; Phenotypes: autosomal dominant progressive external ophthalmoplegia MONDO:0008003; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 PLA2G6 Kaitlyn Dianna Weldon reviewed gene: PLA2G6: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301718; Phenotypes: autosomal recessive Parkinson disease 14 MONDO:0013060; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 PANK2 Kaitlyn Dianna Weldon edited their review of gene: PANK2: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 PARK7 Kaitlyn Dianna Weldon reviewed gene: PARK7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301402; Phenotypes: Parkinson disease MONDO:0005180, autosomal recessive early-onset Parkinson disease 7 MONDO:0011658; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 PANK2 Kaitlyn Dianna Weldon reviewed gene: PANK2: Rating: ; Mode of pathogenicity: None; Publications: 23447832, 20301663; Phenotypes: pantothenate kinase-associated neurodegeneration MONDO:0009319; Mode of inheritance: None
Early-onset Parkinson disease v0.243 MAPT Kaitlyn Dianna Weldon reviewed gene: MAPT: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301678; Phenotypes: late-onset Parkinson disease MONDO:0008199; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 LYST Kaitlyn Dianna Weldon reviewed gene: LYST: Rating: GREEN; Mode of pathogenicity: None; Publications: 23436631, 23521865, 20301751; Phenotypes: Chediak-Higashi syndrome MONDO:0008963; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 LRRK2 Kaitlyn Dianna Weldon reviewed gene: LRRK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301387; Phenotypes: autosomal dominant Parkinson disease 8 MONDO:0011764, obsolete hereditary late onset Parkinson disease MONDO:0018466, Parkinson disease MONDO:0005180; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 FTL Kaitlyn Dianna Weldon edited their review of gene: FTL: Changed rating: GREEN
Early-onset Parkinson disease v0.243 FTL Kaitlyn Dianna Weldon reviewed gene: FTL: Rating: ; Mode of pathogenicity: None; Publications: 23447832, 20301320; Phenotypes: neuroferritinopathy MONDO:0011638; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 FBXO7 Kaitlyn Dianna Weldon reviewed gene: FBXO7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301402; Phenotypes: parkinsonian-pyramidal syndrome MONDO:0009830; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 DNAJC6 Kaitlyn Dianna Weldon reviewed gene: DNAJC6: Rating: GREEN; Mode of pathogenicity: None; Publications: 33983693; Phenotypes: juvenile onset Parkinson disease 19A MONDO:0014231; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 OPA3 Kaitlyn Dianna Weldon reviewed gene: OPA3: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 DCTN1 Kaitlyn Dianna Weldon reviewed gene: DCTN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20945553; Phenotypes: Perry syndrome MONDO:0008201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 CSF1R Kaitlyn Dianna Weldon reviewed gene: CSF1R: Rating: GREEN; Mode of pathogenicity: None; Publications: 25935893, 22934315; Phenotypes: obsolete hereditary diffuse leukoencephalopathy with axonal spheroids and pigmented glia MONDO:0009096; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 C19orf12 Kaitlyn Dianna Weldon reviewed gene: C19orf12: Rating: GREEN; Mode of pathogenicity: None; Publications: 21981780, 23278385; Phenotypes: neurodegeneration with brain iron accumulation 4 MONDO:0013674; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 ATP1A3 Kaitlyn Dianna Weldon reviewed gene: ATP1A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 17282997, 15260953, 17595045, 17516473, 22534615; Phenotypes: ATP1A3-associated neurological disorder MONDO:0700002; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.243 ATP13A2 Kaitlyn Dianna Weldon reviewed gene: ATP13A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25900096; Phenotypes: parkinsonism due to ATP13A2 deficiency MONDO:0017809; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.243 PTPA Zornitza Stark Publications for gene: PTPA were set to 36073231
Early-onset Parkinson disease v0.242 PTPA Zornitza Stark Mode of inheritance for gene: PTPA was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.241 PTPA Zornitza Stark Mode of inheritance for gene: PTPA was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.241 PTPA Zornitza Stark Mode of inheritance for gene: PTPA was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.240 PTPA Ee Ming Wong reviewed gene: PTPA: Rating: AMBER; Mode of pathogenicity: None; Publications: 37448355; Phenotypes: Intellectual disability, MONDO: 36073231, PTPA-related, Parkisonism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Early-onset Parkinson disease v0.240 ATP7B Sangavi Sivagnanasundram reviewed gene: ATP7B: Rating: AMBER; Mode of pathogenicity: None; Publications: 31426520, 33972609, 36553628, 16737839; Phenotypes: Wilson disease (MONDO:0010200); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Parkinson disease v0.240 GIGYF2 Bryony Thompson Publications for gene: GIGYF2 were set to 18358451; 33239198; 25279164; 20060621; 19250854; 26152800; 19449032
Early-onset Parkinson disease v0.239 GIGYF2 Bryony Thompson Publications for gene: GIGYF2 were set to PMID: 18358451, 19449032
Early-onset Parkinson disease v0.238 GIGYF2 Bryony Thompson Classified gene: GIGYF2 as Red List (low evidence)
Early-onset Parkinson disease v0.238 GIGYF2 Bryony Thompson Gene: gigyf2 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.237 GIGYF2 Bryony Thompson reviewed gene: GIGYF2: Rating: RED; Mode of pathogenicity: None; Publications: 18358451, 33239198, 25279164, 20060621, 19250854, 26152800; Phenotypes: {Parkinson disease 11} , OMIM # 607688; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.237 Zornitza Stark HPO terms changed from to Abnormality of extrapyramidal motor function, HP:0002071
List of related panels changed from to Abnormality of extrapyramidal motor function; HP:0002071
Early-onset Parkinson disease v0.236 AFG3L2 Zornitza Stark Phenotypes for gene: AFG3L2 were changed from to Spinocerebellar ataxia 28, MIM# 610246; optic atrophy; spastic ataxia; L-dopa-responsive parkinsonism
Early-onset Parkinson disease v0.236 AFG3L2 Zornitza Stark Publications for gene: AFG3L2 were set to
Early-onset Parkinson disease v0.235 AFG3L2 Zornitza Stark Mode of inheritance for gene: AFG3L2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.234 AFG3L2 Zornitza Stark Classified gene: AFG3L2 as Amber List (moderate evidence)
Early-onset Parkinson disease v0.234 AFG3L2 Zornitza Stark Gene: afg3l2 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.233 AFG3L2 Zornitza Stark Classified gene: AFG3L2 as Amber List (moderate evidence)
Early-onset Parkinson disease v0.233 AFG3L2 Zornitza Stark Gene: afg3l2 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.232 AFG3L2 Zornitza Stark reviewed gene: AFG3L2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Spinocerebellar ataxia 28, MIM# 610246; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.232 AFG3L2 Shekeeb Mohammad reviewed gene: AFG3L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36110148; Phenotypes: dystonia, parkinsonism, intellectual disability, optic hypoplasia, cognitive decline, dementia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Early-onset Parkinson disease v0.232 PTPA Zornitza Stark Marked gene: PTPA as ready
Early-onset Parkinson disease v0.232 PTPA Zornitza Stark Gene: ptpa has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.232 PTPA Zornitza Stark Classified gene: PTPA as Amber List (moderate evidence)
Early-onset Parkinson disease v0.232 PTPA Zornitza Stark Gene: ptpa has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.231 PTPA Zornitza Stark gene: PTPA was added
gene: PTPA was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PTPA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTPA were set to 36073231
Phenotypes for gene: PTPA were set to Intellectual disability, MONDO: 36073231, PTPA-related; Parkisonism
Review for gene: PTPA was set to AMBER
Added comment: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below.

There is currently no associated phenotype in OMIM, G2P, PanelApp UK or SysID.

Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports.

------

Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants.

These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation.

Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies.

Role of the gene:
As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders.

Variant studies:
Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt.

Drosophila / animal models:
Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment.
Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice.
Sources: Literature
Early-onset Parkinson disease v0.230 ATXN1_CAG Zornitza Stark Marked STR: ATXN1_CAG as ready
Early-onset Parkinson disease v0.230 ATXN1_CAG Zornitza Stark Str: atxn1_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.230 ATXN1_CAG Zornitza Stark Classified STR: ATXN1_CAG as Green List (high evidence)
Early-onset Parkinson disease v0.230 ATXN1_CAG Zornitza Stark Str: atxn1_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.229 MT-ND6 Zornitza Stark Tag mtDNA tag was added to gene: MT-ND6.
Early-onset Parkinson disease v0.229 WASL Zornitza Stark Marked gene: WASL as ready
Early-onset Parkinson disease v0.229 WASL Zornitza Stark Gene: wasl has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.229 WASL Zornitza Stark Phenotypes for gene: WASL were changed from Early onset parkinsonism to Parkinson's disease, MONDO:0005180, WASL-related
Early-onset Parkinson disease v0.228 WASL Zornitza Stark Classified gene: WASL as Red List (low evidence)
Early-onset Parkinson disease v0.228 WASL Zornitza Stark Gene: wasl has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.227 WASL Zornitza Stark reviewed gene: WASL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson's disease, MONDO:0005180, WASL-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.227 KMT2B Zornitza Stark Marked gene: KMT2B as ready
Early-onset Parkinson disease v0.227 KMT2B Zornitza Stark Gene: kmt2b has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.227 KMT2B Zornitza Stark Phenotypes for gene: KMT2B were changed from DYT28; Childhood‐onset and progressive dystonia; Dysarthria; Dysphagia; Developmental delay; Dysmorphic features; Parkinsonism; OMIM 617284 to Dystonia 28, childhood-onset , MIM#617284
Early-onset Parkinson disease v0.226 KMT2B Zornitza Stark Mode of inheritance for gene: KMT2B was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.225 KMT2B Zornitza Stark Classified gene: KMT2B as Green List (high evidence)
Early-onset Parkinson disease v0.225 KMT2B Zornitza Stark Gene: kmt2b has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.224 KMT2B Zornitza Stark reviewed gene: KMT2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dystonia 28, childhood-onset , MIM#617284; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.224 GBA Zornitza Stark Marked gene: GBA as ready
Early-onset Parkinson disease v0.224 GBA Zornitza Stark Gene: gba has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.224 GBA Zornitza Stark Phenotypes for gene: GBA were changed from Gaucher Disease Type 1; Early onset parkinsonism; Bone lesions; Hepatosplenomegaly; Hematologic disorders; OMIM 230800 to Parkinson's disease, MONDO:0005180, GBA-related
Early-onset Parkinson disease v0.223 GBA Zornitza Stark Publications for gene: GBA were set to PMID: 12809640
Early-onset Parkinson disease v0.222 GBA Zornitza Stark Mode of inheritance for gene: GBA was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.221 GBA Zornitza Stark Classified gene: GBA as Green List (high evidence)
Early-onset Parkinson disease v0.221 GBA Zornitza Stark Gene: gba has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.220 GBA Zornitza Stark reviewed gene: GBA: Rating: GREEN; Mode of pathogenicity: None; Publications: 35639160; Phenotypes: Parkinson's disease, MONDO:0005180, GBA-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.220 FRRS1L Zornitza Stark Marked gene: FRRS1L as ready
Early-onset Parkinson disease v0.220 FRRS1L Zornitza Stark Gene: frrs1l has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.220 FRRS1L Zornitza Stark Phenotypes for gene: FRRS1L were changed from Developmental and epileptic dyskinetic encephalopathy; Seizures; Chorea; Parkinsonism; Developmental delay; OMIM 616981 to Developmental and epileptic encephalopathy 37, MIM# 616981; Seizures; Chorea; Parkinsonism; Developmental delay
Early-onset Parkinson disease v0.219 FRRS1L Zornitza Stark Classified gene: FRRS1L as Green List (high evidence)
Early-onset Parkinson disease v0.219 FRRS1L Zornitza Stark Gene: frrs1l has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.218 FRRS1L Zornitza Stark reviewed gene: FRRS1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 37, MIM# 616981; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.218 ALPL Zornitza Stark Marked gene: ALPL as ready
Early-onset Parkinson disease v0.218 ALPL Zornitza Stark Gene: alpl has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.218 ALPL Zornitza Stark Phenotypes for gene: ALPL were changed from Hypophosphatasia; Osteomalacia; Parkinsonism; OMIM 146300 to Hypophosphatasia, adult, MIM# 146300; Osteomalacia; Parkinsonism
Early-onset Parkinson disease v0.217 ALPL Zornitza Stark Classified gene: ALPL as Red List (low evidence)
Early-onset Parkinson disease v0.217 ALPL Zornitza Stark Gene: alpl has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.216 ALPL Zornitza Stark reviewed gene: ALPL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypophosphatasia, adult, MIM# 146300; Mode of inheritance: None
Early-onset Parkinson disease v0.216 ADAR Zornitza Stark Marked gene: ADAR as ready
Early-onset Parkinson disease v0.216 ADAR Zornitza Stark Gene: adar has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.216 ADAR Zornitza Stark Classified gene: ADAR as Green List (high evidence)
Early-onset Parkinson disease v0.216 ADAR Zornitza Stark Gene: adar has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.215 ATXN1_CAG SHEKEEB MOHAMMAD STR: ATXN1_CAG was added
STR: ATXN1_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN1_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN1_CAG were set to • PMID: 24602359
Phenotypes for STR: ATXN1_CAG were set to Spinocerebellar Ataxia type 1; Parkinsonism; OMIM 164400
Review for STR: ATXN1_CAG was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.215 MT-ND6 SHEKEEB MOHAMMAD gene: MT-ND6 was added
gene: MT-ND6 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene gene: MT-ND6 was set to MITOCHONDRIAL
Publications for gene: MT-ND6 were set to PMID: 33109474
Phenotypes for gene: MT-ND6 were set to Leber Optic Atrophy; Parkinsonism; OMIM 516006
Review for gene: MT-ND6 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.215 WASL SHEKEEB MOHAMMAD gene: WASL was added
gene: WASL was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: WASL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WASL were set to PMID: 33571872
Phenotypes for gene: WASL were set to Early onset parkinsonism
Review for gene: WASL was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.215 KMT2B SHEKEEB MOHAMMAD gene: KMT2B was added
gene: KMT2B was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: KMT2B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KMT2B were set to PMID: 33816656
Phenotypes for gene: KMT2B were set to DYT28; Childhood‐onset and progressive dystonia; Dysarthria; Dysphagia; Developmental delay; Dysmorphic features; Parkinsonism; OMIM 617284
Review for gene: KMT2B was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.215 GBA SHEKEEB MOHAMMAD gene: GBA was added
gene: GBA was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: GBA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GBA were set to PMID: 12809640
Phenotypes for gene: GBA were set to Gaucher Disease Type 1; Early onset parkinsonism; Bone lesions; Hepatosplenomegaly; Hematologic disorders; OMIM 230800
Review for gene: GBA was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.215 FRRS1L SHEKEEB MOHAMMAD gene: FRRS1L was added
gene: FRRS1L was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: FRRS1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FRRS1L were set to PMID: 29086067
Phenotypes for gene: FRRS1L were set to Developmental and epileptic dyskinetic encephalopathy; Seizures; Chorea; Parkinsonism; Developmental delay; OMIM 616981
Review for gene: FRRS1L was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.215 ALPL SHEKEEB MOHAMMAD gene: ALPL was added
gene: ALPL was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: ALPL was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: ALPL were set to PMID: 32956941
Phenotypes for gene: ALPL were set to Hypophosphatasia; Osteomalacia; Parkinsonism; OMIM 146300
Review for gene: ALPL was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.215 ADAR SHEKEEB MOHAMMAD gene: ADAR was added
gene: ADAR was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: ADAR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAR were set to PMID: 32911246
Phenotypes for gene: ADAR were set to Aicardi-Goutieres syndrome 6; neuroinflammatory disorder with cerebral calcification; progressive loss of cognition; spasticity; dystonia; parkinsonism; OMIM 615010
Review for gene: ADAR was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.215 KIAA1161 Zornitza Stark Tag new gene name tag was added to gene: KIAA1161.
Early-onset Parkinson disease v0.215 KIAA1161 Zornitza Stark Marked gene: KIAA1161 as ready
Early-onset Parkinson disease v0.215 KIAA1161 Zornitza Stark Gene: kiaa1161 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.215 KIAA1161 Zornitza Stark Phenotypes for gene: KIAA1161 were changed from Primary familial brain calcification; Atypical parkinsonism; Supranuclear gaze palsy; OMIM 618317 to Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317; Primary familial brain calcification; Atypical parkinsonism; Supranuclear gaze palsy
Early-onset Parkinson disease v0.214 KIAA1161 Zornitza Stark Publications for gene: KIAA1161 were set to PMID: 32211515
Early-onset Parkinson disease v0.213 KIAA1161 Zornitza Stark Classified gene: KIAA1161 as Green List (high evidence)
Early-onset Parkinson disease v0.213 KIAA1161 Zornitza Stark Gene: kiaa1161 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.212 KIAA1161 Zornitza Stark reviewed gene: KIAA1161: Rating: GREEN; Mode of pathogenicity: None; Publications: 30656188, 30649222, 30460687, 29910000, 31951047; Phenotypes: Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.212 NHLRC1 Zornitza Stark Marked gene: NHLRC1 as ready
Early-onset Parkinson disease v0.212 NHLRC1 Zornitza Stark Gene: nhlrc1 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.212 NHLRC1 Zornitza Stark Phenotypes for gene: NHLRC1 were changed from Lafora disease; Progressive Myoclonic Epilepsy; Parkinsonism; OMIM 254780 to Epilepsy, progressive myoclonic 2B (Lafora), MIM# 254780; Lafora disease; Progressive Myoclonic Epilepsy; Parkinsonism
Early-onset Parkinson disease v0.211 NHLRC1 Zornitza Stark Classified gene: NHLRC1 as Amber List (moderate evidence)
Early-onset Parkinson disease v0.211 NHLRC1 Zornitza Stark Gene: nhlrc1 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.210 NHLRC1 Zornitza Stark reviewed gene: NHLRC1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Epilepsy, progressive myoclonic 2B (Lafora), MIM# 254780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.210 C9orf3 Zornitza Stark Tag new gene name tag was added to gene: C9orf3.
Early-onset Parkinson disease v0.210 C9orf3 Zornitza Stark Marked gene: C9orf3 as ready
Early-onset Parkinson disease v0.210 C9orf3 Zornitza Stark Gene: c9orf3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.210 C9orf3 Zornitza Stark Phenotypes for gene: C9orf3 were changed from Dystonia-31; Childhood/Adolescence onset generalised dystonia; Dystonia parkinsonism; Zech-Boesch Syndrome; OMIM 619565 to Dystonia 31, MIM# 619565; Childhood/Adolescence onset generalised dystonia; Dystonia parkinsonism; Zech-Boesch Syndrome
Early-onset Parkinson disease v0.209 C9orf3 Zornitza Stark Classified gene: C9orf3 as Green List (high evidence)
Early-onset Parkinson disease v0.209 C9orf3 Zornitza Stark Gene: c9orf3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.208 C9orf3 Zornitza Stark reviewed gene: C9orf3: Rating: GREEN; Mode of pathogenicity: None; Publications: 35306330; Phenotypes: Dystonia 31, MIM# 619565; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.208 ATXN10 Zornitza Stark Marked gene: ATXN10 as ready
Early-onset Parkinson disease v0.208 ATXN10 Zornitza Stark Gene: atxn10 has been removed from the panel.
Early-onset Parkinson disease v0.208 ATXN10 Zornitza Stark Tag STR tag was added to gene: ATXN10.
Early-onset Parkinson disease v0.208 ATXN10 Zornitza Stark commented on gene: ATXN10
Early-onset Parkinson disease v0.208 ATXN2 Zornitza Stark Marked gene: ATXN2 as ready
Early-onset Parkinson disease v0.208 ATXN2 Zornitza Stark Gene: atxn2 has been removed from the panel.
Early-onset Parkinson disease v0.208 ATXN2 Zornitza Stark Publications for gene: ATXN2 were set to PMID: 11761482, 17923635
Early-onset Parkinson disease v0.207 ATXN2 Zornitza Stark Tag STR tag was added to gene: ATXN2.
Early-onset Parkinson disease v0.207 ATXN2 Zornitza Stark commented on gene: ATXN2
Early-onset Parkinson disease v0.207 ATXN3 Zornitza Stark Tag STR tag was added to gene: ATXN3.
Early-onset Parkinson disease v0.207 ATXN3 Zornitza Stark Marked gene: ATXN3 as ready
Early-onset Parkinson disease v0.207 ATXN3 Zornitza Stark Gene: atxn3 has been removed from the panel.
Early-onset Parkinson disease v0.207 ATXN3 Zornitza Stark commented on gene: ATXN3
Early-onset Parkinson disease v0.207 ATXN8 Zornitza Stark Marked gene: ATXN8 as ready
Early-onset Parkinson disease v0.207 ATXN8 Zornitza Stark Gene: atxn8 has been removed from the panel.
Early-onset Parkinson disease v0.207 ATXN8 Zornitza Stark Tag STR tag was added to gene: ATXN8.
Early-onset Parkinson disease v0.207 ATXN8 Zornitza Stark commented on gene: ATXN8
Early-onset Parkinson disease v0.207 TPP1 Zornitza Stark Marked gene: TPP1 as ready
Early-onset Parkinson disease v0.207 TPP1 Zornitza Stark Gene: tpp1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.207 TPP1 Zornitza Stark Phenotypes for gene: TPP1 were changed from Late Infantile NCL; Parkinsonism; OMIM 204500 to Ceroid lipofuscinosis, neuronal, 2, MIM# 204500; Parkinsonism
Early-onset Parkinson disease v0.206 TPP1 Zornitza Stark Classified gene: TPP1 as Green List (high evidence)
Early-onset Parkinson disease v0.206 TPP1 Zornitza Stark Gene: tpp1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.205 TPP1 Zornitza Stark reviewed gene: TPP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 2, MIM# 204500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.205 CYP27A1 Zornitza Stark Marked gene: CYP27A1 as ready
Early-onset Parkinson disease v0.205 CYP27A1 Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.205 CYP27A1 Zornitza Stark Phenotypes for gene: CYP27A1 were changed from Cerebrotendinous xanthomatosis, infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas; Epilepsy; Parkinsonism; Ataxia; Peripheral neuropathy; OMIM 213700 to Cerebrotendinous xanthomatosis, MIM# 213700; Cerebrotendinous xanthomatosis, infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas; Epilepsy; Parkinsonism; Ataxia; Peripheral neuropathy
Early-onset Parkinson disease v0.204 CYP27A1 Zornitza Stark Classified gene: CYP27A1 as Green List (high evidence)
Early-onset Parkinson disease v0.204 CYP27A1 Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.203 DDC Zornitza Stark Marked gene: DDC as ready
Early-onset Parkinson disease v0.203 DDC Zornitza Stark Gene: ddc has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.203 DDC Zornitza Stark Phenotypes for gene: DDC were changed from Aromatic L-amino acid decarboxylase deficiency (DYT-DDC); Infantile-onset parkinsonism & dystonia; Bulbar dysfunction; Oculogyric crisis; Autonomic dysfunction; Intellectual disability; OMIM 608603 to Aromatic L-amino acid decarboxylase deficiency, MIM# 608643; Infantile-onset parkinsonism & dystonia; Bulbar dysfunction; Oculogyric crisis; Autonomic dysfunction; Intellectual disability
Early-onset Parkinson disease v0.202 DDC Zornitza Stark Classified gene: DDC as Amber List (moderate evidence)
Early-onset Parkinson disease v0.202 DDC Zornitza Stark Gene: ddc has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.201 DDC Zornitza Stark reviewed gene: DDC: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Aromatic L-amino acid decarboxylase deficiency, MIM# 608643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.201 DHDDS Zornitza Stark Marked gene: DHDDS as ready
Early-onset Parkinson disease v0.201 DHDDS Zornitza Stark Gene: dhdds has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.201 DHDDS Zornitza Stark Phenotypes for gene: DHDDS were changed from Myoclonic Epilepsy; Parkinsonism; Ataxia; Intellectual disability; OMIM 617836 to Developmental delay and seizures with or without movement abnormalities, MIM# 617836; Myoclonic Epilepsy; Parkinsonism; Ataxia; Intellectual disability
Early-onset Parkinson disease v0.200 DHDDS Zornitza Stark Publications for gene: DHDDS were set to PMID: 34837344, 29100083
Early-onset Parkinson disease v0.199 DHDDS Zornitza Stark Classified gene: DHDDS as Amber List (moderate evidence)
Early-onset Parkinson disease v0.199 DHDDS Zornitza Stark Gene: dhdds has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.198 DHDDS Zornitza Stark reviewed gene: DHDDS: Rating: AMBER; Mode of pathogenicity: None; Publications: 34837344; Phenotypes: Developmental delay and seizures with or without movement abnormalities, MIM# 617836; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.198 EIF2AK2 Zornitza Stark Marked gene: EIF2AK2 as ready
Early-onset Parkinson disease v0.198 EIF2AK2 Zornitza Stark Gene: eif2ak2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.198 EIF2AK2 Zornitza Stark Phenotypes for gene: EIF2AK2 were changed from Neurodevelopmental Syndrome; Developmental delays; Ataxia; Parkinsonism; White matter alterations; OMIM 618877 to Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877; Neurodevelopmental Syndrome; Developmental delays; Ataxia; Parkinsonism; White matter alterations
Early-onset Parkinson disease v0.197 EIF2AK2 Zornitza Stark Mode of inheritance for gene: EIF2AK2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.196 EIF2AK2 Zornitza Stark Classified gene: EIF2AK2 as Green List (high evidence)
Early-onset Parkinson disease v0.196 EIF2AK2 Zornitza Stark Gene: eif2ak2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.195 EIF2AK2 Zornitza Stark reviewed gene: EIF2AK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.195 EPM2A Zornitza Stark Marked gene: EPM2A as ready
Early-onset Parkinson disease v0.195 EPM2A Zornitza Stark Gene: epm2a has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.195 EPM2A Zornitza Stark Phenotypes for gene: EPM2A were changed from Lafora disease; Progressive Myoclonic Epilepsy; Parkinsonism; OMIM 254780 to Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780; Progressive Myoclonic Epilepsy; Parkinsonism
Early-onset Parkinson disease v0.194 EPM2A Zornitza Stark Classified gene: EPM2A as Amber List (moderate evidence)
Early-onset Parkinson disease v0.194 EPM2A Zornitza Stark Gene: epm2a has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.193 EPM2A Zornitza Stark reviewed gene: EPM2A: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.193 FOXG1 Zornitza Stark Classified gene: FOXG1 as Green List (high evidence)
Early-onset Parkinson disease v0.193 FOXG1 Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.192 FOXG1 Zornitza Stark Marked gene: FOXG1 as ready
Early-onset Parkinson disease v0.192 FOXG1 Zornitza Stark Gene: foxg1 has been removed from the panel.
Early-onset Parkinson disease v0.192 FOXG1 Zornitza Stark Phenotypes for gene: FOXG1 were changed from Developmental and Epileptic Encephalopathy; Dystonia,; Athetosis; Parkinsonism; Stereotypies; OMIM 613454 to Rett syndrome, congenital variant, MIM# 613454; Developmental and Epileptic Encephalopathy; Dystonia,; Athetosis; Parkinsonism; Stereotypies
Early-onset Parkinson disease v0.191 GLB1 Zornitza Stark changed review comment from: Reported in Type 3.; to: Parkinsonism reported in Type 3.
Early-onset Parkinson disease v0.191 GLB1 Zornitza Stark Marked gene: GLB1 as ready
Early-onset Parkinson disease v0.191 GLB1 Zornitza Stark Gene: glb1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.191 GLB1 Zornitza Stark Phenotypes for gene: GLB1 were changed from GM1 Gangliosidosis; Parkinsonism; OMIM 230650 to GM1-gangliosidosis, type III , MIM#230650; Parkinsonism
Early-onset Parkinson disease v0.190 GLB1 Zornitza Stark Classified gene: GLB1 as Green List (high evidence)
Early-onset Parkinson disease v0.190 GLB1 Zornitza Stark Gene: glb1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.189 GLB1 Zornitza Stark reviewed gene: GLB1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: GM1-gangliosidosis, type III , MIM#230650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.189 KIAA1161 SHEKEEB MOHAMMAD gene: KIAA1161 was added
gene: KIAA1161 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: KIAA1161 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIAA1161 were set to PMID: 32211515
Phenotypes for gene: KIAA1161 were set to Primary familial brain calcification; Atypical parkinsonism; Supranuclear gaze palsy; OMIM 618317
Review for gene: KIAA1161 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.189 C9orf3 SHEKEEB MOHAMMAD reviewed gene: C9orf3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Early-onset Parkinson disease v0.189 NHLRC1 SHEKEEB MOHAMMAD gene: NHLRC1 was added
gene: NHLRC1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: NHLRC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NHLRC1 were set to PMID: 22425593
Phenotypes for gene: NHLRC1 were set to Lafora disease; Progressive Myoclonic Epilepsy; Parkinsonism; OMIM 254780
Review for gene: NHLRC1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.189 C9orf3 SHEKEEB MOHAMMAD gene: C9orf3 was added
gene: C9orf3 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: C9orf3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C9orf3 were set to PMID: 35306330
Phenotypes for gene: C9orf3 were set to Dystonia-31; Childhood/Adolescence onset generalised dystonia; Dystonia parkinsonism; Zech-Boesch Syndrome; OMIM 619565
Early-onset Parkinson disease v0.189 HEXA Zornitza Stark edited their review of gene: HEXA: Changed rating: RED; Changed phenotypes: Tay-Sachs disease, MIM# 272800; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.189 HEXA Zornitza Stark Marked gene: HEXA as ready
Early-onset Parkinson disease v0.189 HEXA Zornitza Stark Gene: hexa has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.189 HEXA Zornitza Stark Classified gene: HEXA as Red List (low evidence)
Early-onset Parkinson disease v0.189 HEXA Zornitza Stark Gene: hexa has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.188 HEXA Zornitza Stark Classified gene: HEXA as Amber List (moderate evidence)
Early-onset Parkinson disease v0.188 HEXA Zornitza Stark Gene: hexa has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.187 HEXA Zornitza Stark reviewed gene: HEXA: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Early-onset Parkinson disease v0.187 JPH3 Zornitza Stark Marked gene: JPH3 as ready
Early-onset Parkinson disease v0.187 JPH3 Zornitza Stark Gene: jph3 has been removed from the panel.
Early-onset Parkinson disease v0.187 JPH3 Zornitza Stark Tag STR tag was added to gene: JPH3.
Early-onset Parkinson disease v0.187 JPH3 Zornitza Stark commented on gene: JPH3
Early-onset Parkinson disease v0.187 NPC2 Zornitza Stark Marked gene: NPC2 as ready
Early-onset Parkinson disease v0.187 NPC2 Zornitza Stark Gene: npc2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.187 NPC2 Zornitza Stark Phenotypes for gene: NPC2 were changed from Niemann Pick C2; Parkinsonism; OMIM 607625 to Niemann Pick C2, OMIM 607625; Parkinsonism
Early-onset Parkinson disease v0.186 NPC2 Zornitza Stark Classified gene: NPC2 as Green List (high evidence)
Early-onset Parkinson disease v0.186 NPC2 Zornitza Stark Gene: npc2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.185 NPC1 Zornitza Stark Marked gene: NPC1 as ready
Early-onset Parkinson disease v0.185 NPC1 Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.185 NPC1 Zornitza Stark Phenotypes for gene: NPC1 were changed from Niemann Pick C1; Parkinsonism; OMIM 257220 to Niemann-Pick disease, MIM# 257220; Parkinsonism
Early-onset Parkinson disease v0.184 NPC1 Zornitza Stark Publications for gene: NPC1 were set to PMID: 24035292
Early-onset Parkinson disease v0.183 NPC1 Zornitza Stark Mode of inheritance for gene: NPC1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.182 NPC1 Zornitza Stark Classified gene: NPC1 as Green List (high evidence)
Early-onset Parkinson disease v0.182 NPC1 Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.181 NPC1 Zornitza Stark reviewed gene: NPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Niemann-Pick disease, MIM# 257220; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.181 NUS1 Zornitza Stark Marked gene: NUS1 as ready
Early-onset Parkinson disease v0.181 NUS1 Zornitza Stark Gene: nus1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.181 NUS1 Zornitza Stark Phenotypes for gene: NUS1 were changed from Mental retardation 55 with seizures (MRD55); Parkinsonism; Developmental delay; Intellectual disability; Ataxia; Myoclonus; OMIM 617831 to Intellectual developmental disorder, autosomal dominant 55, with seizures, MIM# 617831; Parkinsonism; Developmental delay; Intellectual disability; Ataxia; Myoclonus
Early-onset Parkinson disease v0.180 NUS1 Zornitza Stark Mode of inheritance for gene: NUS1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.179 NUS1 Zornitza Stark Classified gene: NUS1 as Green List (high evidence)
Early-onset Parkinson disease v0.179 NUS1 Zornitza Stark Gene: nus1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.178 PGK1 Zornitza Stark Marked gene: PGK1 as ready
Early-onset Parkinson disease v0.178 PGK1 Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.178 PGK1 Zornitza Stark Phenotypes for gene: PGK1 were changed from Haemolytic anaemia; Rhabdomyolysis; Myopathy; Juvenile Parkinsonism; OMIM 300653 to Phosphoglycerate kinase 1 deficiency, MIM# 300653; Haemolytic anaemia; Rhabdomyolysis; Myopathy; Juvenile Parkinsonism; OMIM 300653
Early-onset Parkinson disease v0.177 PGK1 Zornitza Stark Classified gene: PGK1 as Green List (high evidence)
Early-onset Parkinson disease v0.177 PGK1 Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.176 PGK1 Zornitza Stark reviewed gene: PGK1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Phosphoglycerate kinase 1 deficiency, MIM# 300653; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Early-onset Parkinson disease v0.176 POLR3A Zornitza Stark Marked gene: POLR3A as ready
Early-onset Parkinson disease v0.176 POLR3A Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.176 POLR3A Zornitza Stark Phenotypes for gene: POLR3A were changed from POLR3A Leukoencephalopathy; Parkinsonism; Ocular and dental abnormality; Hypogonadism, OMIM 607694 to Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694; POLR3A Leukoencephalopathy; Parkinsonism; Ocular and dental abnormality; Hypogonadism
Early-onset Parkinson disease v0.175 POLR3A Zornitza Stark Classified gene: POLR3A as Green List (high evidence)
Early-onset Parkinson disease v0.175 POLR3A Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.174 POLR3A Zornitza Stark reviewed gene: POLR3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.174 PPP2R2B Zornitza Stark Marked gene: PPP2R2B as ready
Early-onset Parkinson disease v0.174 PPP2R2B Zornitza Stark Gene: ppp2r2b has been removed from the panel.
Early-onset Parkinson disease v0.174 PPP2R2B Zornitza Stark Tag STR tag was added to gene: PPP2R2B.
Early-onset Parkinson disease v0.174 PPP2R2B Zornitza Stark commented on gene: PPP2R2B
Early-onset Parkinson disease v0.174 PRKCG Zornitza Stark Marked gene: PRKCG as ready
Early-onset Parkinson disease v0.174 PRKCG Zornitza Stark Gene: prkcg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.174 PRKCG Zornitza Stark Phenotypes for gene: PRKCG were changed from Spinocerebellar ataxia 14; Myoclonus; Parkinsonism; OMIM 605361 to Spinocerebellar ataxia 14, MIM# 605361; Myoclonus; Parkinsonism
Early-onset Parkinson disease v0.173 PRKCG Zornitza Stark Mode of inheritance for gene: PRKCG was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.172 PRKCG Zornitza Stark Classified gene: PRKCG as Green List (high evidence)
Early-onset Parkinson disease v0.172 PRKCG Zornitza Stark Gene: prkcg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.171 PRKCG Zornitza Stark reviewed gene: PRKCG: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spinocerebellar ataxia 14, MIM# 605361; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.171 QDPR Zornitza Stark Marked gene: QDPR as ready
Early-onset Parkinson disease v0.171 QDPR Zornitza Stark Gene: qdpr has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.171 QDPR Zornitza Stark Phenotypes for gene: QDPR were changed from Dehydropteridin reductase deficiency, Infantile-onset dystonia; Parkinsonism; Epilepsy; Autonomic dysfunction; Hyperphenylalaninemia; OMIM 261360 to Hyperphenylalaninemia, BH4-deficient, C, MIM#261630; Dehydropteridin reductase deficiency, Infantile-onset dystonia; Parkinsonism; Epilepsy; Autonomic dysfunction; Hyperphenylalaninemia
Early-onset Parkinson disease v0.170 QDPR Zornitza Stark Classified gene: QDPR as Green List (high evidence)
Early-onset Parkinson disease v0.170 QDPR Zornitza Stark Gene: qdpr has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.169 QDPR Zornitza Stark reviewed gene: QDPR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperphenylalaninemia, BH4-deficient, C, MIM#261630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.169 SCN1A Zornitza Stark Marked gene: SCN1A as ready
Early-onset Parkinson disease v0.169 SCN1A Zornitza Stark Gene: scn1a has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.169 SCN1A Zornitza Stark Phenotypes for gene: SCN1A were changed from Dravet syndrome; Epilepsy, Paekinsonism; OMIM 607208 to Dravet syndrome, MIM# 607208; Epilepsy, Paekinsonism
Early-onset Parkinson disease v0.168 SCN1A Zornitza Stark Mode of inheritance for gene: SCN1A was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.167 SCN1A Zornitza Stark Classified gene: SCN1A as Green List (high evidence)
Early-onset Parkinson disease v0.167 SCN1A Zornitza Stark Gene: scn1a has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.166 SCN1A Zornitza Stark reviewed gene: SCN1A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dravet syndrome, MIM# 607208; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.166 SERAC1 Zornitza Stark Marked gene: SERAC1 as ready
Early-onset Parkinson disease v0.166 SERAC1 Zornitza Stark Gene: serac1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.166 SERAC1 Zornitza Stark Phenotypes for gene: SERAC1 were changed from MEGDEL Syndrome; Parkinsonism to 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739; Parkinsonism
Early-onset Parkinson disease v0.165 SERAC1 Zornitza Stark Classified gene: SERAC1 as Green List (high evidence)
Early-onset Parkinson disease v0.165 SERAC1 Zornitza Stark Gene: serac1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.164 SERAC1 Zornitza Stark reviewed gene: SERAC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.164 SLC19A3 Zornitza Stark Marked gene: SLC19A3 as ready
Early-onset Parkinson disease v0.164 SLC19A3 Zornitza Stark Gene: slc19a3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.164 SLC19A3 Zornitza Stark Phenotypes for gene: SLC19A3 were changed from Biotin-Thiamine Responsive Basal Ganglia disease; Childhood onset Dystonia and Parkinsonism; OMIM 607483 to Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483; Childhood onset Dystonia and Parkinsonism
Early-onset Parkinson disease v0.163 SLC19A3 Zornitza Stark Classified gene: SLC19A3 as Green List (high evidence)
Early-onset Parkinson disease v0.163 SLC19A3 Zornitza Stark Gene: slc19a3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.162 SLC19A3 Zornitza Stark reviewed gene: SLC19A3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.162 SLC18A2 Zornitza Stark Marked gene: SLC18A2 as ready
Early-onset Parkinson disease v0.162 SLC18A2 Zornitza Stark Gene: slc18a2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.162 SLC18A2 Zornitza Stark Phenotypes for gene: SLC18A2 were changed from Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism, OMIM 618049 to Parkinsonism-dystonia, infantile, 2 , MIM# 618049; Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism
Early-onset Parkinson disease v0.161 SLC18A2 Zornitza Stark Publications for gene: SLC18A2 were set to PMID: 23363473, 33983693
Early-onset Parkinson disease v0.160 SLC18A2 Zornitza Stark Classified gene: SLC18A2 as Green List (high evidence)
Early-onset Parkinson disease v0.160 SLC18A2 Zornitza Stark Gene: slc18a2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.159 SLC18A2 Zornitza Stark reviewed gene: SLC18A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23363473, 31240161, 26497564; Phenotypes: Parkinsonism-dystonia, infantile, 2 , MIM# 618049; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.159 SOX6 Zornitza Stark Marked gene: SOX6 as ready
Early-onset Parkinson disease v0.159 SOX6 Zornitza Stark Gene: sox6 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.159 SOX6 Zornitza Stark Publications for gene: SOX6 were set to PMID: 24453155, 25127144
Early-onset Parkinson disease v0.158 SOX6 Zornitza Stark Phenotypes for gene: SOX6 were changed from Tolchin-Le Caignec syndrome; Developmental delay; ID; ASD; ADHD; Parkinsonism; Syringomyelia, OMIM 618971 to Tolchin-Le Caignec syndrome, MIM# 618971; Developmental delay; ID; ASD; ADHD; Parkinsonism; Syringomyelia
Early-onset Parkinson disease v0.157 SOX6 Zornitza Stark Mode of inheritance for gene: SOX6 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.156 SOX6 Zornitza Stark Classified gene: SOX6 as Green List (high evidence)
Early-onset Parkinson disease v0.156 SOX6 Zornitza Stark Gene: sox6 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.155 SPG7 Zornitza Stark Marked gene: SPG7 as ready
Early-onset Parkinson disease v0.155 SPG7 Zornitza Stark Gene: spg7 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.155 SPG7 Zornitza Stark Phenotypes for gene: SPG7 were changed from Hereditary Spastic Paraplegia 7; Ataxia; Progressive external opthalmoplegia; Parkinsonism; OMIM 607259 to Spastic paraplegia 7, autosomal recessive, MIM# 607259; Ataxia; Progressive external opthalmoplegia; Parkinsonism
Early-onset Parkinson disease v0.154 SPG7 Zornitza Stark Classified gene: SPG7 as Green List (high evidence)
Early-onset Parkinson disease v0.154 SPG7 Zornitza Stark Gene: spg7 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.153 STUB1 Zornitza Stark Marked gene: STUB1 as ready
Early-onset Parkinson disease v0.153 STUB1 Zornitza Stark Gene: stub1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.153 STUB1 Zornitza Stark Phenotypes for gene: STUB1 were changed from Spinocerebellar Ataxia 48; Parkinsonism, OMIM 618093 to Spinocerebellar Ataxia 48, OMIM 618093; Parkinsonism
Early-onset Parkinson disease v0.152 STUB1 Zornitza Stark Publications for gene: STUB1 were set to PubMed: 30381368; 32285148, 32337344
Early-onset Parkinson disease v0.152 STUB1 Zornitza Stark Mode of inheritance for gene: STUB1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.151 STUB1 Zornitza Stark Mode of inheritance for gene: STUB1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.151 STUB1 Zornitza Stark Classified gene: STUB1 as Green List (high evidence)
Early-onset Parkinson disease v0.151 STUB1 Zornitza Stark Gene: stub1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.150 STXBP1 Zornitza Stark Marked gene: STXBP1 as ready
Early-onset Parkinson disease v0.150 STXBP1 Zornitza Stark Gene: stxbp1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.150 STXBP1 Zornitza Stark Phenotypes for gene: STXBP1 were changed from Developmental and epileptic encephalopathy 4; Juvenile onset Parkinsonism; OMIM 612164 to Developmental and epileptic encephalopathy 4, MIM# 612164; Juvenile onset Parkinsonism
Early-onset Parkinson disease v0.149 STXBP1 Zornitza Stark Publications for gene: STXBP1 were set to PMID: 25418441, 32643187, 29929108
Early-onset Parkinson disease v0.148 STXBP1 Zornitza Stark Mode of inheritance for gene: STXBP1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.147 STXBP1 Zornitza Stark Classified gene: STXBP1 as Green List (high evidence)
Early-onset Parkinson disease v0.147 STXBP1 Zornitza Stark Gene: stxbp1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.146 STXBP1 Zornitza Stark reviewed gene: STXBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 4, MIM# 612164; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.146 TBC1D24 Zornitza Stark Marked gene: TBC1D24 as ready
Early-onset Parkinson disease v0.146 TBC1D24 Zornitza Stark Gene: tbc1d24 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.146 TBC1D24 Zornitza Stark Phenotypes for gene: TBC1D24 were changed from Developmental and epileptic encephalopathy 16; Intellectual disability; Parkinsonism; Seizures; Psychosis; OMIM 615338 to Developmental and epileptic encephalopathy 16, MIM# 615338; Intellectual disability; Parkinsonism; Seizures; Psychosis
Early-onset Parkinson disease v0.145 TBC1D24 Zornitza Stark Classified gene: TBC1D24 as Green List (high evidence)
Early-onset Parkinson disease v0.145 TBC1D24 Zornitza Stark Gene: tbc1d24 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.144 TBC1D24 Zornitza Stark reviewed gene: TBC1D24: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 16, MIM# 615338; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.144 TBP Zornitza Stark Marked gene: TBP as ready
Early-onset Parkinson disease v0.144 TBP Zornitza Stark Gene: tbp has been removed from the panel.
Early-onset Parkinson disease v0.144 TBP Zornitza Stark Tag STR tag was added to gene: TBP.
Early-onset Parkinson disease v0.144 TBP Zornitza Stark commented on gene: TBP
Early-onset Parkinson disease v0.144 UBTF Zornitza Stark Marked gene: UBTF as ready
Early-onset Parkinson disease v0.144 UBTF Zornitza Stark Gene: ubtf has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.144 UBTF Zornitza Stark Phenotypes for gene: UBTF were changed from Neurodegeneration, childhood-onset; Parkinsonism; Dystonia; Chorea; Brain atrophy to Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; Parkinsonism; Dystonia; Chorea; Brain atrophy
Early-onset Parkinson disease v0.143 UBTF Zornitza Stark Mode of inheritance for gene: UBTF was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.142 UBTF Zornitza Stark Classified gene: UBTF as Green List (high evidence)
Early-onset Parkinson disease v0.142 UBTF Zornitza Stark Gene: ubtf has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.141 UBTF Zornitza Stark reviewed gene: UBTF: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.141 VAC14 Zornitza Stark Marked gene: VAC14 as ready
Early-onset Parkinson disease v0.141 VAC14 Zornitza Stark Gene: vac14 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.141 VAC14 Zornitza Stark Phenotypes for gene: VAC14 were changed from Childhood onset Striatonigral degeneration; Dystonia; Parkinsonism; OMIM 617054 to Striatonigral degeneration, childhood-onset, MIM# 617054; Dystonia; Parkinsonism
Early-onset Parkinson disease v0.140 VAC14 Zornitza Stark Classified gene: VAC14 as Green List (high evidence)
Early-onset Parkinson disease v0.140 VAC14 Zornitza Stark Gene: vac14 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.139 VAC14 Zornitza Stark reviewed gene: VAC14: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Striatonigral degeneration, childhood-onset, MIM# 617054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.139 WARS2 Zornitza Stark Marked gene: WARS2 as ready
Early-onset Parkinson disease v0.139 WARS2 Zornitza Stark Gene: wars2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.139 WARS2 Zornitza Stark Phenotypes for gene: WARS2 were changed from Parkinsonism-dystonia 3, childhood-onset, MIM# 619738 to Parkinsonism-dystonia 3, childhood-onset, MIM# 619738
Early-onset Parkinson disease v0.139 WARS2 Zornitza Stark Phenotypes for gene: WARS2 were changed from Childhood onset parkinsonism dystonia-3; Myoclonus ataxia; OMIM 619738 to Parkinsonism-dystonia 3, childhood-onset, MIM# 619738
Early-onset Parkinson disease v0.138 WARS2 Zornitza Stark Publications for gene: WARS2 were set to PMID: 29120065; 34890876
Early-onset Parkinson disease v0.137 WARS2 Zornitza Stark Classified gene: WARS2 as Green List (high evidence)
Early-onset Parkinson disease v0.137 WARS2 Zornitza Stark Gene: wars2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.136 WARS2 Zornitza Stark reviewed gene: WARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34890876, 31970218, 29120065; Phenotypes: Parkinsonism-dystonia 3, childhood-onset, MIM# 619738; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.136 ZFYVE26 Zornitza Stark Marked gene: ZFYVE26 as ready
Early-onset Parkinson disease v0.136 ZFYVE26 Zornitza Stark Gene: zfyve26 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.136 ZFYVE26 Zornitza Stark Phenotypes for gene: ZFYVE26 were changed from Spastic paraplegia and retinal degeneration; Kjellin syndrome; Parkinsonism; OMIM 270700 to Spastic paraplegia 15, autosomal recessive, MIM# 270700; Spastic paraplegia and retinal degeneration; Kjellin syndrome; Parkinsonism
Early-onset Parkinson disease v0.135 ZFYVE26 Zornitza Stark Classified gene: ZFYVE26 as Green List (high evidence)
Early-onset Parkinson disease v0.135 ZFYVE26 Zornitza Stark Gene: zfyve26 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.134 ATXN10 SHEKEEB MOHAMMAD gene: ATXN10 was added
gene: ATXN10 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: ATXN10 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ATXN10 were set to PMID: 28890930
Phenotypes for gene: ATXN10 were set to Spinocerebellar Ataxia 10; Parkinsonism; OMIM 603516
Review for gene: ATXN10 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 ATXN2 SHEKEEB MOHAMMAD gene: ATXN2 was added
gene: ATXN2 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: ATXN2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ATXN2 were set to PMID: 11761482, 17923635
Phenotypes for gene: ATXN2 were set to Spinocerebellar Ataxia 2; Parkinsonism; Myoclonus; OMIM 183090
Review for gene: ATXN2 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 ATXN3 SHEKEEB MOHAMMAD gene: ATXN3 was added
gene: ATXN3 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: ATXN3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ATXN3 were set to PMID: 11176969; 7574470
Phenotypes for gene: ATXN3 were set to Spinocerebellar 3; Machado Joseph disease; Ataxia; Parkinsonism; OMIM 109150
Review for gene: ATXN3 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 ATXN8 SHEKEEB MOHAMMAD gene: ATXN8 was added
gene: ATXN8 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: ATXN8 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ATXN8 were set to PMID: 24285970
Phenotypes for gene: ATXN8 were set to Spinocerebellar 8; Parkinsonism; OMIM 608768
Review for gene: ATXN8 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 TPP1 SHEKEEB MOHAMMAD gene: TPP1 was added
gene: TPP1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: TPP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TPP1 were set to PMID: 21940688
Phenotypes for gene: TPP1 were set to Late Infantile NCL; Parkinsonism; OMIM 204500
Review for gene: TPP1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 CYP27A1 SHEKEEB MOHAMMAD gene: CYP27A1 was added
gene: CYP27A1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: CYP27A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CYP27A1 were set to PMID: 30054180
Phenotypes for gene: CYP27A1 were set to Cerebrotendinous xanthomatosis, infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas; Epilepsy; Parkinsonism; Ataxia; Peripheral neuropathy; OMIM 213700
Review for gene: CYP27A1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 DDC SHEKEEB MOHAMMAD gene: DDC was added
gene: DDC was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: DDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDC were set to PMID: 33983693
Phenotypes for gene: DDC were set to Aromatic L-amino acid decarboxylase deficiency (DYT-DDC); Infantile-onset parkinsonism & dystonia; Bulbar dysfunction; Oculogyric crisis; Autonomic dysfunction; Intellectual disability; OMIM 608603
Review for gene: DDC was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 DHDDS SHEKEEB MOHAMMAD gene: DHDDS was added
gene: DHDDS was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: DHDDS was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DHDDS were set to PMID: 34837344, 29100083
Phenotypes for gene: DHDDS were set to Myoclonic Epilepsy; Parkinsonism; Ataxia; Intellectual disability; OMIM 617836
Review for gene: DHDDS was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 EIF2AK2 SHEKEEB MOHAMMAD gene: EIF2AK2 was added
gene: EIF2AK2 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: EIF2AK2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: EIF2AK2 were set to PMID: 32197074
Phenotypes for gene: EIF2AK2 were set to Neurodevelopmental Syndrome; Developmental delays; Ataxia; Parkinsonism; White matter alterations; OMIM 618877
Review for gene: EIF2AK2 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 EPM2A SHEKEEB MOHAMMAD gene: EPM2A was added
gene: EPM2A was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: EPM2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EPM2A were set to PMID: 27574708
Phenotypes for gene: EPM2A were set to Lafora disease; Progressive Myoclonic Epilepsy; Parkinsonism; OMIM 254780
Review for gene: EPM2A was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 FOXG1 SHEKEEB MOHAMMAD gene: FOXG1 was added
gene: FOXG1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: FOXG1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FOXG1 were set to PMID: 21953941
Phenotypes for gene: FOXG1 were set to Developmental and Epileptic Encephalopathy; Dystonia,; Athetosis; Parkinsonism; Stereotypies; OMIM 613454
Review for gene: FOXG1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 GLB1 SHEKEEB MOHAMMAD gene: GLB1 was added
gene: GLB1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: GLB1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLB1 were set to PMID: 34514040
Phenotypes for gene: GLB1 were set to GM1 Gangliosidosis; Parkinsonism; OMIM 230650
Review for gene: GLB1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 HEXA SHEKEEB MOHAMMAD gene: HEXA was added
gene: HEXA was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: HEXA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HEXA were set to PMID: 33069254
Phenotypes for gene: HEXA were set to GM2 Gangliosidosis; Tay-Sachs disease; Parkinsonism; OMIM 272800
Review for gene: HEXA was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 JPH3 SHEKEEB MOHAMMAD gene: JPH3 was added
gene: JPH3 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: JPH3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: JPH3 were set to PMID: 28131164
Phenotypes for gene: JPH3 were set to Huntington Disease Like 2 (HDL2); Parkinsonism; Severe Dementia; OMIM 606438
Review for gene: JPH3 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 NPC2 SHEKEEB MOHAMMAD gene: NPC2 was added
gene: NPC2 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: NPC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NPC2 were set to PMID: 35695805
Phenotypes for gene: NPC2 were set to Niemann Pick C2; Parkinsonism; OMIM 607625
Review for gene: NPC2 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 NPC1 SHEKEEB MOHAMMAD edited their review of gene: NPC1: Changed publications: PMID: 24035292, 30369906
Early-onset Parkinson disease v0.134 NPC1 SHEKEEB MOHAMMAD gene: NPC1 was added
gene: NPC1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: NPC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NPC1 were set to PMID: 24035292
Phenotypes for gene: NPC1 were set to Niemann Pick C1; Parkinsonism; OMIM 257220
Review for gene: NPC1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 NUS1 SHEKEEB MOHAMMAD gene: NUS1 was added
gene: NUS1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: NUS1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: NUS1 were set to PMID: 32485575; 30348779
Phenotypes for gene: NUS1 were set to Mental retardation 55 with seizures (MRD55); Parkinsonism; Developmental delay; Intellectual disability; Ataxia; Myoclonus; OMIM 617831
Review for gene: NUS1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 PGK1 SHEKEEB MOHAMMAD gene: PGK1 was added
gene: PGK1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PGK1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: PGK1 were set to PMID: 30975619
Phenotypes for gene: PGK1 were set to Haemolytic anaemia; Rhabdomyolysis; Myopathy; Juvenile Parkinsonism; OMIM 300653
Review for gene: PGK1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 POLR3A SHEKEEB MOHAMMAD gene: POLR3A was added
gene: POLR3A was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: POLR3A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3A were set to PMID: 33652360
Phenotypes for gene: POLR3A were set to POLR3A Leukoencephalopathy; Parkinsonism; Ocular and dental abnormality; Hypogonadism, OMIM 607694
Review for gene: POLR3A was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 PPP2R2B SHEKEEB MOHAMMAD gene: PPP2R2B was added
gene: PPP2R2B was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PPP2R2B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PPP2R2B were set to PMID: 31286011
Phenotypes for gene: PPP2R2B were set to Spinocerebellar ataxia 12; Parkinsonism; OMIM 604326
Review for gene: PPP2R2B was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 PRKCG SHEKEEB MOHAMMAD gene: PRKCG was added
gene: PRKCG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PRKCG was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PRKCG were set to PMID: 29603387
Phenotypes for gene: PRKCG were set to Spinocerebellar ataxia 14; Myoclonus; Parkinsonism; OMIM 605361
Review for gene: PRKCG was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 QDPR SHEKEEB MOHAMMAD gene: QDPR was added
gene: QDPR was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: QDPR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: QDPR were set to PMID: 28413401
Phenotypes for gene: QDPR were set to Dehydropteridin reductase deficiency, Infantile-onset dystonia; Parkinsonism; Epilepsy; Autonomic dysfunction; Hyperphenylalaninemia; OMIM 261360
Review for gene: QDPR was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 SCN1A SHEKEEB MOHAMMAD gene: SCN1A was added
gene: SCN1A was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: SCN1A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SCN1A were set to PMID: 28186331; 24850485
Phenotypes for gene: SCN1A were set to Dravet syndrome; Epilepsy, Paekinsonism; OMIM 607208
Review for gene: SCN1A was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 SERAC1 SHEKEEB MOHAMMAD gene: SERAC1 was added
gene: SERAC1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: SERAC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SERAC1 were set to PMID: 29332177; 16527507
Phenotypes for gene: SERAC1 were set to MEGDEL Syndrome; Parkinsonism
Review for gene: SERAC1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 SLC19A3 SHEKEEB MOHAMMAD gene: SLC19A3 was added
gene: SLC19A3 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: SLC19A3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC19A3 were set to PMID: 24260777
Phenotypes for gene: SLC19A3 were set to Biotin-Thiamine Responsive Basal Ganglia disease; Childhood onset Dystonia and Parkinsonism; OMIM 607483
Review for gene: SLC19A3 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 SLC18A2 SHEKEEB MOHAMMAD gene: SLC18A2 was added
gene: SLC18A2 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: SLC18A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC18A2 were set to PMID: 23363473, 33983693
Phenotypes for gene: SLC18A2 were set to Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism, OMIM 618049
Review for gene: SLC18A2 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 SOX6 SHEKEEB MOHAMMAD gene: SOX6 was added
gene: SOX6 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: SOX6 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SOX6 were set to PMID: 24453155, 25127144
Phenotypes for gene: SOX6 were set to Tolchin-Le Caignec syndrome; Developmental delay; ID; ASD; ADHD; Parkinsonism; Syringomyelia, OMIM 618971
Review for gene: SOX6 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 SPG7 SHEKEEB MOHAMMAD gene: SPG7 was added
gene: SPG7 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: SPG7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPG7 were set to PMID: 31433872
Phenotypes for gene: SPG7 were set to Hereditary Spastic Paraplegia 7; Ataxia; Progressive external opthalmoplegia; Parkinsonism; OMIM 607259
Review for gene: SPG7 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 STUB1 SHEKEEB MOHAMMAD gene: STUB1 was added
gene: STUB1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: STUB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: STUB1 were set to PubMed: 30381368; 32285148, 32337344
Phenotypes for gene: STUB1 were set to Spinocerebellar Ataxia 48; Parkinsonism, OMIM 618093
Review for gene: STUB1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 STXBP1 SHEKEEB MOHAMMAD gene: STXBP1 was added
gene: STXBP1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: STXBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: STXBP1 were set to PMID: 25418441, 32643187, 29929108
Phenotypes for gene: STXBP1 were set to Developmental and epileptic encephalopathy 4; Juvenile onset Parkinsonism; OMIM 612164
Review for gene: STXBP1 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 TBC1D24 SHEKEEB MOHAMMAD gene: TBC1D24 was added
gene: TBC1D24 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: TBC1D24 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBC1D24 were set to PMID: 28663785; 21087195
Phenotypes for gene: TBC1D24 were set to Developmental and epileptic encephalopathy 16; Intellectual disability; Parkinsonism; Seizures; Psychosis; OMIM 615338
Review for gene: TBC1D24 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 TBP SHEKEEB MOHAMMAD gene: TBP was added
gene: TBP was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: TBP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TBP were set to PMID: 27172828; 14638975; 11313753; 11914409
Phenotypes for gene: TBP were set to Spinocerebellar Ataxia 17; Parkinsonism; Chorea; Seizures; Psychosis; Dementia; OMIM 607136
Review for gene: TBP was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 UBTF SHEKEEB MOHAMMAD gene: UBTF was added
gene: UBTF was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: UBTF was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: UBTF were set to PubMed: 28777933; 29300972
Phenotypes for gene: UBTF were set to Neurodegeneration, childhood-onset; Parkinsonism; Dystonia; Chorea; Brain atrophy
Review for gene: UBTF was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 VAC14 SHEKEEB MOHAMMAD gene: VAC14 was added
gene: VAC14 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: VAC14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VAC14 were set to PMID: 31392254; 28502045
Phenotypes for gene: VAC14 were set to Childhood onset Striatonigral degeneration; Dystonia; Parkinsonism; OMIM 617054
Review for gene: VAC14 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 WARS2 SHEKEEB MOHAMMAD reviewed gene: WARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Early-onset Parkinson disease v0.134 WARS2 SHEKEEB MOHAMMAD gene: WARS2 was added
gene: WARS2 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: WARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WARS2 were set to PMID: 29120065; 34890876
Phenotypes for gene: WARS2 were set to Childhood onset parkinsonism dystonia-3; Myoclonus ataxia; OMIM 619738
Early-onset Parkinson disease v0.134 ZFYVE26 SHEKEEB MOHAMMAD gene: ZFYVE26 was added
gene: ZFYVE26 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: ZFYVE26 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZFYVE26 were set to PMID: 33033739; 21462267
Phenotypes for gene: ZFYVE26 were set to Spastic paraplegia and retinal degeneration; Kjellin syndrome; Parkinsonism; OMIM 270700
Review for gene: ZFYVE26 was set to GREEN
Added comment: Sources: Literature
Early-onset Parkinson disease v0.134 NR4A2 Zornitza Stark Phenotypes for gene: NR4A2 were changed from Intellectual Disability; Dystonia and Early-onset Parkinson to Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911
Early-onset Parkinson disease v0.133 GIGYF2 Zornitza Stark Marked gene: GIGYF2 as ready
Early-onset Parkinson disease v0.133 GIGYF2 Zornitza Stark Gene: gigyf2 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.133 GIGYF2 Chirag Patel Classified gene: GIGYF2 as Amber List (moderate evidence)
Early-onset Parkinson disease v0.133 GIGYF2 Chirag Patel Gene: gigyf2 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.132 GIGYF2 Chirag Patel gene: GIGYF2 was added
gene: GIGYF2 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: GIGYF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GIGYF2 were set to PMID: 18358451, 19449032
Phenotypes for gene: GIGYF2 were set to {Parkinson disease 11} , OMIM # 607688
Review for gene: GIGYF2 was set to AMBER
Added comment: In affected members of 12 unrelated Italian or French families with Parkinson disease-11 (PARK11; 607688), Lautier et al. (2008) identified 7 different heterozygous mutations in the GIGYF2 gene. Tan et al. (2009) identified 4 different heterozygous mutations in the GIGYF2 gene in 7 (1.6%) of 450 patients with Parkinson disease from Taiwan and Singapore. The mutations were not identified in 400 controls. Reduced penetrance seen in the families reported by both groups. No replication since.
Sources: Literature
Early-onset Parkinson disease v0.131 FXTAS Bryony Thompson Marked STR: FXTAS as ready
Early-onset Parkinson disease v0.131 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.131 FXTAS Bryony Thompson Classified STR: FXTAS as Green List (high evidence)
Early-onset Parkinson disease v0.131 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.130 FXTAS Bryony Thompson STR: FXTAS was added
STR: FXTAS was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXTAS were set to 27340021; 28176767; 20301558; 23765048; 25227148; 11445641
Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623
Review for STR: FXTAS was set to GREEN
STR: FXTAS was marked as clinically relevant
Added comment: Parkinsonism is a common feature of FXTAS, which is associated with the premutation.
HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
Sources: Literature
Early-onset Parkinson disease v0.129 FMR1 Bryony Thompson Phenotypes for gene: FMR1 were changed from Fragile X tremor/ataxia syndrome MIM#300623; Fragile X syndrome MIM#300624 to Fragile X tremor/ataxia syndrome MIM#300623
Early-onset Parkinson disease v0.128 FMR1 Bryony Thompson Publications for gene: FMR1 were set to 27340021; 28176767
Early-onset Parkinson disease v0.127 FMR1 Bryony Thompson changed review comment from: Parkinsonism can be a relatively common feature of the condition. The major cause of the condition is 5'UTR repeat expansion, but at least 6 pathogenic intragenic SNV or small indels have been reported in affected males.; to: Parkinsonism can be a relatively common feature of FXTAS, which is caused by 5'UTR repeat expansion.
Early-onset Parkinson disease v0.127 FMR1 Bryony Thompson edited their review of gene: FMR1: Changed publications: 27340021, 28176767, 20301558; Changed phenotypes: Fragile X tremor/ataxia syndrome MIM#300623
Early-onset Parkinson disease v0.127 FMR1 Bryony Thompson Classified gene: FMR1 as No list
Early-onset Parkinson disease v0.127 FMR1 Bryony Thompson Added comment: Comment on list classification: Parkinsonism is a feature of FXTAS and is not reported in cases with intragenic variants, which have the FXS phenotype. Added as an STR.
Early-onset Parkinson disease v0.127 FMR1 Bryony Thompson Gene: fmr1 has been removed from the panel.
Early-onset Parkinson disease v0.126 SYNJ1 Zornitza Stark Marked gene: SYNJ1 as ready
Early-onset Parkinson disease v0.126 SYNJ1 Zornitza Stark Gene: synj1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.126 SYNJ1 Zornitza Stark Phenotypes for gene: SYNJ1 were changed from to Parkinson disease 20, early-onset, MIM# 615530
Early-onset Parkinson disease v0.125 SYNJ1 Zornitza Stark Publications for gene: SYNJ1 were set to
Early-onset Parkinson disease v0.124 SYNJ1 Zornitza Stark Mode of inheritance for gene: SYNJ1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.123 SYNJ1 Zornitza Stark reviewed gene: SYNJ1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23804563, 23804577, 27496670, 33841314; Phenotypes: Parkinson disease 20, early-onset, MIM# 615530; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.123 VPS35 Zornitza Stark Marked gene: VPS35 as ready
Early-onset Parkinson disease v0.123 VPS35 Zornitza Stark Gene: vps35 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.123 VPS35 Zornitza Stark Phenotypes for gene: VPS35 were changed from to Parkinson disease 17, MIM# 614203
Early-onset Parkinson disease v0.122 VPS35 Zornitza Stark Publications for gene: VPS35 were set to
Early-onset Parkinson disease v0.121 VPS35 Zornitza Stark Mode of inheritance for gene: VPS35 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.120 VPS35 Zornitza Stark reviewed gene: VPS35: Rating: GREEN; Mode of pathogenicity: None; Publications: 21763482, 21763483, 22801713, 34704029; Phenotypes: Parkinson disease 17, MIM# 614203; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.119 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Parkinson disease v0.118 Bryony Thompson removed STR:NIID from the panel
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Classified gene: TAF1 as No list
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Added comment: Comment on list classification: Added as an STR to the panel
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Gene: taf1 has been removed from the panel.
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Marked STR: XDP as ready
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.115 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Early-onset Parkinson disease. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.113 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778; 31779815
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Parkinson disease v0.112 Bryony Thompson removed STR:C9orf72 from the panel
Early-onset Parkinson disease v0.111 PSAP Zornitza Stark Phenotypes for gene: PSAP were changed from Parkinson Disease, AD to Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491
Early-onset Parkinson disease v0.110 PSAP Zornitza Stark reviewed gene: PSAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491; Mode of inheritance: None
Early-onset Parkinson disease v0.110 FMR1 Bryony Thompson Phenotypes for gene: FMR1 were changed from to Fragile X tremor/ataxia syndrome MIM#300623; Fragile X syndrome MIM#300624
Early-onset Parkinson disease v0.109 FMR1 Bryony Thompson Publications for gene: FMR1 were set to
Early-onset Parkinson disease v0.108 FMR1 Bryony Thompson Mode of inheritance for gene: FMR1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Parkinson disease v0.107 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Parkinson disease v0.107 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.107 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Parkinson disease v0.107 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.106 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[(66_517)] Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Parkinson disease v0.105 PINK1 Zornitza Stark Marked gene: PINK1 as ready
Early-onset Parkinson disease v0.105 PINK1 Zornitza Stark Gene: pink1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.105 PINK1 Zornitza Stark Phenotypes for gene: PINK1 were changed from to Parkinson disease 6, early onset MIM#605909
Early-onset Parkinson disease v0.104 PINK1 Zornitza Stark Publications for gene: PINK1 were set to
Early-onset Parkinson disease v0.103 PINK1 Zornitza Stark Mode of inheritance for gene: PINK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.102 PINK1 Elena Savva reviewed gene: PINK1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 28980524; Phenotypes: Parkinson disease 6, early onset MIM#605909; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.102 UQCRC1 Zornitza Stark Phenotypes for gene: UQCRC1 were changed from Parkinson's disease to Parkinsonism with polyneuropathy, MIM# 619279
Early-onset Parkinson disease v0.101 UQCRC1 Zornitza Stark edited their review of gene: UQCRC1: Changed phenotypes: Parkinsonism with polyneuropathy, MIM# 619279
Early-onset Parkinson disease v0.101 PSAP Seb Lunke Marked gene: PSAP as ready
Early-onset Parkinson disease v0.101 PSAP Seb Lunke Gene: psap has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.101 PSAP Seb Lunke Phenotypes for gene: PSAP were changed from parkinson's disease to Parkinson Disease, AD
Early-onset Parkinson disease v0.100 PSAP Seb Lunke Classified gene: PSAP as Green List (high evidence)
Early-onset Parkinson disease v0.100 PSAP Seb Lunke Added comment: Comment on list classification: Described onset between 33 and 60yrs
Early-onset Parkinson disease v0.100 PSAP Seb Lunke Gene: psap has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.99 PSAP Seb Lunke Classified gene: PSAP as Green List (high evidence)
Early-onset Parkinson disease v0.99 PSAP Seb Lunke Gene: psap has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.98 PSAP Ain Roesley changed review comment from: 6 affecteds from 3 families. Age of onset ranges from 33-60.
Functional studies: Autophagic vacuole accumulation in skin fibroblasts , a-Synuclein aggregation and PSAP retention in the ER and abnormal intracellular accumulation in iPSC-dopaminergic neurons. Mouse model for one of 1 of the variants had motor deficits and dopaminergic neurodegeneration
Sources: Literature; to: - 6 affecteds from 3 families. Age of onset ranges from 33-60.
- 2x missense and 1 inframe del
- Functional studies: Autophagic vacuole accumulation in skin fibroblasts , a-Synuclein aggregation and PSAP retention in the ER and abnormal intracellular accumulation in iPSC-dopaminergic neurons. Mouse model for one of 1 of the variants had motor deficits and dopaminergic neurodegeneration
Sources: Literature
Early-onset Parkinson disease v0.98 PSAP Ain Roesley gene: PSAP was added
gene: PSAP was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PSAP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PSAP were set to 32201884
Phenotypes for gene: PSAP were set to parkinson's disease
Penetrance for gene: PSAP were set to unknown
Review for gene: PSAP was set to GREEN
Added comment: 6 affecteds from 3 families. Age of onset ranges from 33-60.
Functional studies: Autophagic vacuole accumulation in skin fibroblasts , a-Synuclein aggregation and PSAP retention in the ER and abnormal intracellular accumulation in iPSC-dopaminergic neurons. Mouse model for one of 1 of the variants had motor deficits and dopaminergic neurodegeneration
Sources: Literature
Early-onset Parkinson disease v0.98 NR4A2 Sebastian Lunke Marked gene: NR4A2 as ready
Early-onset Parkinson disease v0.98 NR4A2 Sebastian Lunke Gene: nr4a2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.98 NR4A2 Sebastian Lunke Classified gene: NR4A2 as Green List (high evidence)
Early-onset Parkinson disease v0.98 NR4A2 Sebastian Lunke Gene: nr4a2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.97 NR4A2 Sebastian Lunke gene: NR4A2 was added
gene: NR4A2 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: NR4A2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: NR4A2 were set to 31922365
Phenotypes for gene: NR4A2 were set to Intellectual Disability; Dystonia and Early-onset Parkinson
Review for gene: NR4A2 was set to GREEN
Added comment: Three patients described to expand the known phenotype of mild ID with early adulthood onset Dystonia and Early-onset Parkinson. Three patients described in two publications, two with frameshift and one with missense, all de-novo.

https://doi.org/10.1212/NXG.0000000000000543
https://doi.org/10.1002/mds.27982
Sources: Literature
Early-onset Parkinson disease v0.96 PPP2R5D Zornitza Stark Marked gene: PPP2R5D as ready
Early-onset Parkinson disease v0.96 PPP2R5D Zornitza Stark Gene: ppp2r5d has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.96 PPP2R5D Zornitza Stark Classified gene: PPP2R5D as Green List (high evidence)
Early-onset Parkinson disease v0.96 PPP2R5D Zornitza Stark Gene: ppp2r5d has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.95 PPP2R5D Zornitza Stark gene: PPP2R5D was added
gene: PPP2R5D was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PPP2R5D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R5D were set to 33338668; 32743835
Phenotypes for gene: PPP2R5D were set to Early onset Parkinsonism; Mental retardation, autosomal dominant 35, MIM# 616355
Review for gene: PPP2R5D was set to GREEN
Added comment: 5 individuals reported with de novo missense variants in this gene, a neurodevelopmental disorder, and onset of parkinsonism between the ages of 20-40 years. Four had the same p.(Glu200Lys) variant, and the fifth had p.(Glu198Lys)
Sources: Literature
Early-onset Parkinson disease v0.94 UQCRC1 Zornitza Stark Marked gene: UQCRC1 as ready
Early-onset Parkinson disease v0.94 UQCRC1 Zornitza Stark Gene: uqcrc1 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.94 UQCRC1 Zornitza Stark Classified gene: UQCRC1 as Amber List (moderate evidence)
Early-onset Parkinson disease v0.94 UQCRC1 Zornitza Stark Gene: uqcrc1 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.93 UQCRC1 Zornitza Stark gene: UQCRC1 was added
gene: UQCRC1 was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: UQCRC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UQCRC1 were set to 33141179; 33248804
Phenotypes for gene: UQCRC1 were set to Parkinson's disease
Review for gene: UQCRC1 was set to AMBER
Added comment: Three unrelated families reported in PMID 33141179 with some functional data, however PMID 33248804 failed to identify significant variants in this gene in a large PD cohort.
Sources: Literature
Early-onset Parkinson disease v0.92 SNCA Zornitza Stark Marked gene: SNCA as ready
Early-onset Parkinson disease v0.92 SNCA Zornitza Stark Gene: snca has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.92 SNCA Zornitza Stark Phenotypes for gene: SNCA were changed from to Dementia, Lewy body (MIM#127750); Parkinson disease 1 (MIM#168601); Parkinson disease 4 (MIM#605543)
Early-onset Parkinson disease v0.91 SNCA Zornitza Stark Publications for gene: SNCA were set to
Early-onset Parkinson disease v0.90 SNCA Zornitza Stark Mode of inheritance for gene: SNCA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.89 SNCA Zornitza Stark Tag SV/CNV tag was added to gene: SNCA.
Early-onset Parkinson disease v0.89 SNCA Ain Roesley reviewed gene: SNCA: Rating: GREEN; Mode of pathogenicity: None; Publications: 32849182, 26858591, 32740728; Phenotypes: Dementia, Lewy body (MIM#127750), Parkinson disease 1 (MIM#168601), Parkinson disease 4 (MIM#605543); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.89 C9orf72 Bryony Thompson Marked STR: C9orf72 as ready
Early-onset Parkinson disease v0.89 C9orf72 Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.89 C9orf72 Bryony Thompson Classified STR: C9orf72 as Green List (high evidence)
Early-onset Parkinson disease v0.89 C9orf72 Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.88 C9orf72 Bryony Thompson STR: C9orf72 was added
STR: C9orf72 was added to Early-onset Parkinson disease. Sources: Expert list
STR tags were added to STR: C9orf72.
Mode of inheritance for STR: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: C9orf72 were set to 25577942; 31779815
Phenotypes for STR: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: C9orf72 was set to GREEN
STR: C9orf72 was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Parkinson disease v0.87 C9orf72 Bryony Thompson Classified gene: C9orf72 as No list
Early-onset Parkinson disease v0.87 C9orf72 Bryony Thompson Gene: c9orf72 has been removed from the panel.
Early-onset Parkinson disease v0.86 HTT Bryony Thompson Classified gene: HTT as No list
Early-onset Parkinson disease v0.86 HTT Bryony Thompson Gene: htt has been removed from the panel.
Early-onset Parkinson disease v0.85 RIC3 Bryony Thompson Marked gene: RIC3 as ready
Early-onset Parkinson disease v0.85 RIC3 Bryony Thompson Gene: ric3 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.85 RIC3 Bryony Thompson gene: RIC3 was added
gene: RIC3 was added to Early-onset Parkinson disease. Sources: Other
Mode of inheritance for gene: RIC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RIC3 were set to 27055476; 28153381; 28606768; 32794657
Phenotypes for gene: RIC3 were set to Parkinson disease
Review for gene: RIC3 was set to RED
Added comment: Segregation reported in a single Indian family (PMID: 27055476), with limited in vitro functional assays. The variant is present in the South Asian population in gnomAD v2.1 14/30,596 alleles. The association has not been replicated in any additional studies.
Sources: Other
Early-onset Parkinson disease v0.84 XPR1 Zornitza Stark Marked gene: XPR1 as ready
Early-onset Parkinson disease v0.84 XPR1 Zornitza Stark Gene: xpr1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.84 XPR1 Zornitza Stark Phenotypes for gene: XPR1 were changed from to Basal ganglia calcification, idiopathic, 6, MIM# 616413
Early-onset Parkinson disease v0.83 XPR1 Zornitza Stark Publications for gene: XPR1 were set to
Early-onset Parkinson disease v0.82 XPR1 Zornitza Stark Mode of inheritance for gene: XPR1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.81 XPR1 Zornitza Stark reviewed gene: XPR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25938945; Phenotypes: Basal ganglia calcification, idiopathic, 6, MIM# 616413; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.81 TWNK Zornitza Stark Publications for gene: TWNK were set to
Early-onset Parkinson disease v0.80 TWNK Zornitza Stark Phenotypes for gene: TWNK were changed from to Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286
Early-onset Parkinson disease v0.79 TAF1 Zornitza Stark Marked gene: TAF1 as ready
Early-onset Parkinson disease v0.79 TAF1 Zornitza Stark Gene: taf1 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.79 TAF1 Zornitza Stark Phenotypes for gene: TAF1 were changed from to Dystonia-Parkinsonism, X-linked, MIM# 314250
Early-onset Parkinson disease v0.78 TAF1 Zornitza Stark Publications for gene: TAF1 were set to
Early-onset Parkinson disease v0.77 TAF1 Zornitza Stark Mode of inheritance for gene: TAF1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Early-onset Parkinson disease v0.76 TAF1 Zornitza Stark Classified gene: TAF1 as Amber List (moderate evidence)
Early-onset Parkinson disease v0.76 TAF1 Zornitza Stark Gene: taf1 has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.75 TAF1 Zornitza Stark Tag deep intronic tag was added to gene: TAF1.
Tag founder tag was added to gene: TAF1.
Early-onset Parkinson disease v0.75 TAF1 Zornitza Stark reviewed gene: TAF1: Rating: AMBER; Mode of pathogenicity: None; Publications: 17273961; Phenotypes: Dystonia-Parkinsonism, X-linked, MIM# 314250; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Early-onset Parkinson disease v0.75 PDGFRB Zornitza Stark Marked gene: PDGFRB as ready
Early-onset Parkinson disease v0.75 PDGFRB Zornitza Stark Gene: pdgfrb has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.75 PDGFRB Zornitza Stark Phenotypes for gene: PDGFRB were changed from to Basal ganglia calcification, idiopathic, 4, MIM# 615007
Early-onset Parkinson disease v0.74 PDGFRB Zornitza Stark Publications for gene: PDGFRB were set to
Early-onset Parkinson disease v0.73 PDGFRB Zornitza Stark Mode of inheritance for gene: PDGFRB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.72 PDGFRB Zornitza Stark reviewed gene: PDGFRB: Rating: GREEN; Mode of pathogenicity: None; Publications: 23255827, 30979360; Phenotypes: Basal ganglia calcification, idiopathic, 4 615007; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.72 PDGFB Zornitza Stark Marked gene: PDGFB as ready
Early-onset Parkinson disease v0.72 PDGFB Zornitza Stark Gene: pdgfb has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.72 PDGFB Zornitza Stark Phenotypes for gene: PDGFB were changed from to Basal ganglia calcification, idiopathic, 5, MIM# 615483
Early-onset Parkinson disease v0.71 PDGFB Zornitza Stark Publications for gene: PDGFB were set to
Early-onset Parkinson disease v0.70 PDGFB Zornitza Stark Mode of inheritance for gene: PDGFB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.69 PDGFB Zornitza Stark reviewed gene: PDGFB: Rating: GREEN; Mode of pathogenicity: None; Publications: 23913003; Phenotypes: Basal ganglia calcification, idiopathic, 5, MIM# 615483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.69 MECP2 Zornitza Stark Marked gene: MECP2 as ready
Early-onset Parkinson disease v0.69 MECP2 Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.69 MECP2 Zornitza Stark Phenotypes for gene: MECP2 were changed from to MECP2-related disorders; Rett syndrome, MIM# 312750; Mental retardation, X-linked, syndromic 13, MIM# 300055
Early-onset Parkinson disease v0.68 MECP2 Zornitza Stark Publications for gene: MECP2 were set to
Early-onset Parkinson disease v0.67 MECP2 Zornitza Stark Mode of inheritance for gene: MECP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Early-onset Parkinson disease v0.66 MECP2 Zornitza Stark reviewed gene: MECP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31970230, 27050783; Phenotypes: MECP2-related disorders, Rett syndrome, MIM# 312750, Mental retardation, X-linked, syndromic 13, MIM# 300055; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Early-onset Parkinson disease v0.66 GRN Zornitza Stark Phenotypes for gene: GRN were changed from to Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485
Early-onset Parkinson disease v0.65 GRN Zornitza Stark Publications for gene: GRN were set to
Early-onset Parkinson disease v0.64 GRN Zornitza Stark Mode of inheritance for gene: GRN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.63 GRN Zornitza Stark reviewed gene: GRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 17923627, 20301545; Phenotypes: Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.63 GCH1 Zornitza Stark Marked gene: GCH1 as ready
Early-onset Parkinson disease v0.63 GCH1 Zornitza Stark Gene: gch1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.63 GCH1 Zornitza Stark Phenotypes for gene: GCH1 were changed from to Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230
Early-onset Parkinson disease v0.62 GCH1 Zornitza Stark Publications for gene: GCH1 were set to
Early-onset Parkinson disease v0.61 GCH1 Zornitza Stark Mode of inheritance for gene: GCH1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.60 GCH1 Zornitza Stark reviewed gene: GCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32170445, 32278297, 32746945, 30314816; Phenotypes: Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.60 DNAJC5 Zornitza Stark Marked gene: DNAJC5 as ready
Early-onset Parkinson disease v0.60 DNAJC5 Zornitza Stark Gene: dnajc5 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.60 DNAJC5 Zornitza Stark Phenotypes for gene: DNAJC5 were changed from to Ceroid lipofuscinosis, neuronal, 4, Parry type, MIM# 162350
Early-onset Parkinson disease v0.59 DNAJC5 Zornitza Stark Publications for gene: DNAJC5 were set to
Early-onset Parkinson disease v0.58 DNAJC5 Zornitza Stark Mode of inheritance for gene: DNAJC5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.57 DNAJC5 Zornitza Stark reviewed gene: DNAJC5: Rating: GREEN; Mode of pathogenicity: None; Publications: 22978711, 21820099, 22235333; Phenotypes: Ceroid lipofuscinosis, neuronal, 4, Parry type, MIM# 162350; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.57 CLN3 Zornitza Stark reviewed gene: CLN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 3 MIM#204200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.57 SLC20A2 Zornitza Stark Marked gene: SLC20A2 as ready
Early-onset Parkinson disease v0.57 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.57 SLC20A2 Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600
Early-onset Parkinson disease v0.56 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to
Early-onset Parkinson disease v0.55 SLC20A2 Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.54 SLC20A2 Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.54 COASY Zornitza Stark Marked gene: COASY as ready
Early-onset Parkinson disease v0.54 COASY Zornitza Stark Gene: coasy has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.54 COASY Zornitza Stark Phenotypes for gene: COASY were changed from to Neurodegeneration with brain iron accumulation 6, MIM# 615643
Early-onset Parkinson disease v0.53 COASY Zornitza Stark Publications for gene: COASY were set to
Early-onset Parkinson disease v0.52 COASY Zornitza Stark Mode of inheritance for gene: COASY was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.51 COASY Zornitza Stark Classified gene: COASY as Amber List (moderate evidence)
Early-onset Parkinson disease v0.51 COASY Zornitza Stark Gene: coasy has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.50 COASY Zornitza Stark reviewed gene: COASY: Rating: AMBER; Mode of pathogenicity: None; Publications: 28489334, 24360804; Phenotypes: Neurodegeneration with brain iron accumulation 6, MIM# 615643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.50 CLN3 Zornitza Stark Marked gene: CLN3 as ready
Early-onset Parkinson disease v0.50 CLN3 Zornitza Stark Gene: cln3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.50 CLN3 Zornitza Stark Phenotypes for gene: CLN3 were changed from to Ceroid lipofuscinosis, neuronal, 3 MIM#204200
Early-onset Parkinson disease v0.49 CLN3 Zornitza Stark Publications for gene: CLN3 were set to 19489875; 11342698
Early-onset Parkinson disease v0.48 CLN3 Zornitza Stark Mode of inheritance for gene: CLN3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.48 CLN3 Zornitza Stark Publications for gene: CLN3 were set to
Early-onset Parkinson disease v0.47 C9orf72 Zornitza Stark Phenotypes for gene: C9orf72 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Early-onset Parkinson disease v0.46 C9orf72 Zornitza Stark Publications for gene: C9orf72 were set to
Early-onset Parkinson disease v0.45 C9orf72 Zornitza Stark Mode of inheritance for gene: C9orf72 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.44 APP Zornitza Stark Marked gene: APP as ready
Early-onset Parkinson disease v0.44 APP Zornitza Stark Gene: app has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.44 APP Zornitza Stark Phenotypes for gene: APP were changed from to Alzheimer disease 1, familial, MIM# 104300
Early-onset Parkinson disease v0.43 APP Zornitza Stark Mode of inheritance for gene: APP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.42 APP Zornitza Stark Classified gene: APP as Amber List (moderate evidence)
Early-onset Parkinson disease v0.42 APP Zornitza Stark Gene: app has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.41 APP Zornitza Stark reviewed gene: APP: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Alzheimer disease 1, familial, MIM# 104300; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.41 HD Bryony Thompson Classified STR: HD as Green List (high evidence)
Early-onset Parkinson disease v0.41 HD Bryony Thompson Str: hd has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.40 HD Bryony Thompson STR: HD was added
STR: HD was added to Early-onset Parkinson disease. Sources: Expert list
STR tags were added to STR: HD.
Mode of inheritance for STR: HD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HD were set to 20301482; 29325606
Phenotypes for STR: HD were set to Huntington disease MIM#143100
Review for STR: HD was set to GREEN
STR: HD was marked as clinically relevant
Added comment: NM_002111.8:c.52_54CAG[X]
Primary mechanism of disease is gain of function
Normal: ≤26 repeats
Intermediate: 27-35 repeats, no risk for proband but expansion possible in the next generation
Pathogenic (reduced penetrance): 36-39 repeats, proband at risk for HD but may not develop symptoms
Pathogenic (full penetrance): ≥40 repeats, development of HD with increased certainty assuming a normal life span
Sources: Expert list
Early-onset Parkinson disease v0.39 Bryony Thompson removed STR:HD from the panel
Early-onset Parkinson disease v0.38 HD Bryony Thompson Classified STR: HD as Green List (high evidence)
Early-onset Parkinson disease v0.38 HD Bryony Thompson Str: hd has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.37 HD Bryony Thompson STR: HD was added
STR: HD was added to Early-onset Parkinson disease. Sources: Expert list
STR tags were added to STR: HD.
Mode of inheritance for STR: HD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HD were set to 20301482; 29325606
Phenotypes for STR: HD were set to Huntington disease MIM#143100
Review for STR: HD was set to GREEN
STR: HD was marked as clinically relevant
Added comment: NM_002111.8:c.52_54CAG[X]
Primary mechanism of disease is gain of function
Normal: ≤26 repeats
Intermediate: 27-35 repeats, no risk for proband but expansion possible in the next generation
Pathogenic (reduced penetrance): 36-39 repeats, proband at risk for HD but may not develop symptoms
Pathogenic (full penetrance): ≥40 repeats, development of HD with increased certainty assuming a normal life span
Sources: Expert list
Early-onset Parkinson disease v0.36 SLC6A3 Zornitza Stark Marked gene: SLC6A3 as ready
Early-onset Parkinson disease v0.36 SLC6A3 Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.36 SLC6A3 Zornitza Stark Phenotypes for gene: SLC6A3 were changed from Parkinsonism-dystonia, infantile, 1, MIM# 613135 to Parkinsonism-dystonia, infantile, 1, MIM# 613135
Early-onset Parkinson disease v0.36 SLC6A3 Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135
Early-onset Parkinson disease v0.35 SLC6A3 Zornitza Stark Publications for gene: SLC6A3 were set to
Early-onset Parkinson disease v0.34 SLC6A3 Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.33 SLC6A3 Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.33 ATP6AP2 Zornitza Stark Marked gene: ATP6AP2 as ready
Early-onset Parkinson disease v0.33 ATP6AP2 Zornitza Stark Gene: atp6ap2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.33 ATP6AP2 Zornitza Stark Classified gene: ATP6AP2 as Green List (high evidence)
Early-onset Parkinson disease v0.33 ATP6AP2 Zornitza Stark Gene: atp6ap2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.32 ATP6AP2 Zornitza Stark gene: ATP6AP2 was added
gene: ATP6AP2 was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for gene: ATP6AP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ATP6AP2 were set to 30985297; 23595882
Phenotypes for gene: ATP6AP2 were set to Parkinsonism with spasticity, X-linked, MIM# 300911
Review for gene: ATP6AP2 was set to GREEN
Added comment: PMID: 30985297 - 1 de novo male patient with postnatal neurodegeneration, seizures, mild face dysmorphism. Sequential MRI revealed decreasing gray and white matter volumes. Patient has a splice variant proven to cause alternative transcript expression. Supported by null mouse model.

PMID: 23595882 - 2 patients (1 family) with a synonymous variant proven to affect splicing. Patients have X-linked parkinsonian syndrome

Summary: 2 unrelated patients + animal models
Sources: Expert list
Early-onset Parkinson disease v0.31 PSEN2 Bryony Thompson changed review comment from: Parkinson disease and parkinsonism is not a prominent feature of Alzheimer disease caused by PSEN2. A couple of isolated cases with parkinsonism as a feature of the condition and a single family have been reported with established pathogenic variants and a VUS (PMID: 22118943, 26422362, 18427071). VUS or now likely benign/benign missense variants have been identified in a Parkinson Disease cases used in case-control studies (PMID: 29692703, 26522186).
Sources: Other; to: Parkinson disease and parkinsonism is not a prominent feature of Alzheimer disease caused by PSEN2. A couple of isolated cases with VUS and parkinsonism as a feature of the condition and a single family with multiple members with parkinsonism with pathogenic missense variant have been reported (PMID: 22118943, 26422362, 18427071). VUS or now likely benign/benign missense variants have been identified in Parkinson Disease cases used in case-control studies (PMID: 29692703, 26522186).
Sources: Other
Early-onset Parkinson disease v0.31 PSEN2 Bryony Thompson changed review comment from: Parkinson disease and parkinsonism is not a prominent feature of Alzheimer disease caused by PSEN2. A couple of isolated cases with parkinsonism as a feature of the condition and a single family have been reported with established pathogenic or probable pathogenic variants (PMID: 22118943, 26422362, 18427071). VUS or now likely benign/benign missense variants have been identified in a Parkinson Disease cases used in case-control studies (PMID: 29692703, 26522186).
Sources: Other; to: Parkinson disease and parkinsonism is not a prominent feature of Alzheimer disease caused by PSEN2. A couple of isolated cases with parkinsonism as a feature of the condition and a single family have been reported with established pathogenic variants and a VUS (PMID: 22118943, 26422362, 18427071). VUS or now likely benign/benign missense variants have been identified in a Parkinson Disease cases used in case-control studies (PMID: 29692703, 26522186).
Sources: Other
Early-onset Parkinson disease v0.31 PSEN2 Bryony Thompson Marked gene: PSEN2 as ready
Early-onset Parkinson disease v0.31 PSEN2 Bryony Thompson Gene: psen2 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.31 PSEN2 Bryony Thompson gene: PSEN2 was added
gene: PSEN2 was added to Early-onset Parkinson disease. Sources: Other
Mode of inheritance for gene: PSEN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PSEN2 were set to 22118943; 26422362; 18427071; 29692703
Phenotypes for gene: PSEN2 were set to Parkinsonism; Alzheimer disease-4 MIM#606889
Review for gene: PSEN2 was set to RED
Added comment: Parkinson disease and parkinsonism is not a prominent feature of Alzheimer disease caused by PSEN2. A couple of isolated cases with parkinsonism as a feature of the condition and a single family have been reported with established pathogenic or probable pathogenic variants (PMID: 22118943, 26422362, 18427071). VUS or now likely benign/benign missense variants have been identified in a Parkinson Disease cases used in case-control studies (PMID: 29692703, 26522186).
Sources: Other
Early-onset Parkinson disease v0.30 HTT Bryony Thompson Classified gene: HTT as Green List (high evidence)
Early-onset Parkinson disease v0.30 HTT Bryony Thompson Gene: htt has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.29 C9orf72 Bryony Thompson Marked gene: C9orf72 as ready
Early-onset Parkinson disease v0.29 C9orf72 Bryony Thompson Gene: c9orf72 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.29 C9orf72 Bryony Thompson Classified gene: C9orf72 as Green List (high evidence)
Early-onset Parkinson disease v0.29 C9orf72 Bryony Thompson Gene: c9orf72 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.28 PODXL Bryony Thompson gene: PODXL was added
gene: PODXL was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for gene: PODXL was set to Unknown
Publications for gene: PODXL were set to 26864383; 20706633
Phenotypes for gene: PODXL were set to juvenile-onset Parkinson disease
Review for gene: PODXL was set to AMBER
Added comment: Single consanguineous Indian family reported with a homozygous loss of function variant. A Podxl null mouse model has aberrant neurite length and number of branching points, and also evidence of impaired synaptogenesis. Subsequent screening in 280 Parkinson disease patients with various ages of onset identified 3 heterozygous missense variants (P429T, S373N, and R294Q; all numbering according to isoform 2), absent in gnomAD. Transfection of the missense variants into PC12 cells resulted in variable aberrant neurite length and/or branching, suggesting a functional effect. However, there is more evidence supporting the association of monoallelic and biallelic variants with FSGS (see Proteinuria panel). There was no renal symptoms present in the reported family, which had renal function tests.
Sources: Literature
Early-onset Parkinson disease v0.27 Bryony Thompson Panel name changed from Early onset Parkinson disease to Early-onset Parkinson disease
Panel types changed to Melbourne Genomics; Victorian Clinical Genetics Services; Royal Melbourne Hospital
Early-onset Parkinson disease v0.26 VPS13C Bryony Thompson Marked gene: VPS13C as ready
Early-onset Parkinson disease v0.26 VPS13C Bryony Thompson Gene: vps13c has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.26 VPS13C Bryony Thompson Classified gene: VPS13C as Green List (high evidence)
Early-onset Parkinson disease v0.26 VPS13C Bryony Thompson Gene: vps13c has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.25 VPS13C Bryony Thompson gene: VPS13C was added
gene: VPS13C was added to Early onset Parkinson disease. Sources: Expert list
Mode of inheritance for gene: VPS13C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS13C were set to 26942284; 30452786; 28862745
Phenotypes for gene: VPS13C were set to Parkinson disease 23, autosomal recessive, early onset MIM#616840
Review for gene: VPS13C was set to GREEN
Added comment: >3 cases with biallelic variants.
Sources: Expert list
Early-onset Parkinson disease v0.24 TWNK Bryony Thompson Mode of inheritance for gene: TWNK was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.23 TWNK Bryony Thompson Marked gene: TWNK as ready
Early-onset Parkinson disease v0.23 TWNK Bryony Thompson Gene: twnk has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.23 TWNK Bryony Thompson reviewed gene: TWNK: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076137, 22949510, 22580846, 19353676; Phenotypes: Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.23 PTS Bryony Thompson Mode of inheritance for gene: PTS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.22 PTS Bryony Thompson Marked gene: PTS as ready
Early-onset Parkinson disease v0.22 PTS Bryony Thompson Gene: pts has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.22 PTS Bryony Thompson reviewed gene: PTS: Rating: GREEN; Mode of pathogenicity: None; Publications: 11388593, 27562098; Phenotypes: Hyperphenylalaninemia, BH4-deficient, A MIM#261640; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.22 PTRHD1 Bryony Thompson Marked gene: PTRHD1 as ready
Early-onset Parkinson disease v0.22 PTRHD1 Bryony Thompson Gene: ptrhd1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.22 PTRHD1 Bryony Thompson Classified gene: PTRHD1 as Green List (high evidence)
Early-onset Parkinson disease v0.22 PTRHD1 Bryony Thompson Gene: ptrhd1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.21 PTRHD1 Bryony Thompson gene: PTRHD1 was added
gene: PTRHD1 was added to Early onset Parkinson disease. Sources: Expert list
Mode of inheritance for gene: PTRHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTRHD1 were set to 27753167; 27134041; 30398675; 29143421
Phenotypes for gene: PTRHD1 were set to early-onset parkinsonism; intellectual disability
Review for gene: PTRHD1 was set to GREEN
Added comment: Homozygous variants segregate in three unrelated families from Iran and South Africa. No functional assays conducted.
Sources: Expert list
Early-onset Parkinson disease v0.20 KIF5A Bryony Thompson Marked gene: KIF5A as ready
Early-onset Parkinson disease v0.20 KIF5A Bryony Thompson Gene: kif5a has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.20 KIF5A Bryony Thompson Classified gene: KIF5A as Amber List (moderate evidence)
Early-onset Parkinson disease v0.20 KIF5A Bryony Thompson Gene: kif5a has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.19 KIF5A Bryony Thompson reviewed gene: KIF5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 18853458; Phenotypes: Spastic paraplegia 10, autosomal dominant MIM#604187; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.19 C9orf72 Bryony Thompson Classified gene: C9orf72 as Red List (low evidence)
Early-onset Parkinson disease v0.19 C9orf72 Bryony Thompson Added comment: Comment on list classification: A repeat expansion is the cause of disease for this gene, which is currently not detectable by NGS.
Early-onset Parkinson disease v0.19 C9orf72 Bryony Thompson Gene: c9orf72 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.18 C9orf72 Bryony Thompson changed review comment from: Comment on list classification: A repeat expansion is the cause of disease for this gene, which is currently not detectable by NGS.; to: Parkinsonism is a common feature of the condition. A repeat expansion is the cause of disease for this gene.
Early-onset Parkinson disease v0.18 C9orf72 Bryony Thompson changed review comment from: Comment on list classification: A repeat expansion is the cause of disease for this gene, which is currently not detectable by NGS.; to: Comment on list classification: A repeat expansion is the cause of disease for this gene, which is currently not detectable by NGS.
Early-onset Parkinson disease v0.18 C9orf72 Bryony Thompson edited their review of gene: C9orf72: Changed rating: GREEN; Changed publications: 31779815; Changed phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.18 HTT Bryony Thompson Marked gene: HTT as ready
Early-onset Parkinson disease v0.18 HTT Bryony Thompson Gene: htt has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.18 HTT Bryony Thompson Classified gene: HTT as Red List (low evidence)
Early-onset Parkinson disease v0.18 HTT Bryony Thompson Added comment: Comment on list classification: Parkinsonism is a feature of Huntingtons. This repeat expansion is not detectable by current NGS technology.
Early-onset Parkinson disease v0.18 HTT Bryony Thompson Gene: htt has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.17 HTT Bryony Thompson Tag STR tag was added to gene: HTT.
Early-onset Parkinson disease v0.17 HTT Bryony Thompson reviewed gene: HTT: Rating: GREEN; Mode of pathogenicity: None; Publications: 26740508, 27329733, 31800013; Phenotypes: Lopes-Maciel-Rodan syndrome MIM#617435, Huntington disease MIM#143100; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.17 FMR1 Bryony Thompson Marked gene: FMR1 as ready
Early-onset Parkinson disease v0.17 FMR1 Bryony Thompson Gene: fmr1 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.17 FMR1 Bryony Thompson Tag STR tag was added to gene: FMR1.
Early-onset Parkinson disease v0.17 FMR1 Bryony Thompson reviewed gene: FMR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27340021, 28176767; Phenotypes: Fragile X tremor/ataxia syndrome MIM#300623, Fragile X syndrome MIM#300624; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Parkinson disease v0.17 TMEM230 Bryony Thompson gene: TMEM230 was added
gene: TMEM230 was added to Early onset Parkinson disease. Sources: Expert list
Mode of inheritance for gene: TMEM230 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TMEM230 were set to 30804554; 27270108; 28115417; 28017548; 30804555; 30804556; 31323517
Phenotypes for gene: TMEM230 were set to Parkinson disease 21, MIM#616361
Review for gene: TMEM230 was set to AMBER
Added comment: A single family segregating a heterozygous missense (p.Arg141Leu) and supporting functional evidence. However, another group found a DNAJC13 variant in the same family also with supporting functional evidence. A stoploss was also identified in 9 Chinese Parkinson disease probands, however it was identified homozygous in 7 of these with no difference in the severity of phenotype. A similar stop loss was identified in a North American PD case. Another missense was identified in an apparently sporadic PD case (p.Tyr92Cys), but was also present in the unaffected mother (age 57 yrs). Another rare missense has been reported in a case with familial PD. The missense reported in a family from Southern Italy is too common in gnomAD v2.1 for a dominant disease (PMID: 31323517 - p.Ile125Met).
Sources: Expert list
Early-onset Parkinson disease v0.16 DNAJC13 Bryony Thompson Marked gene: DNAJC13 as ready
Early-onset Parkinson disease v0.16 DNAJC13 Bryony Thompson Gene: dnajc13 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.16 DNAJC13 Bryony Thompson edited their review of gene: DNAJC13: Changed phenotypes: Parkinson disease 21, MIM#616361
Early-onset Parkinson disease v0.16 DNAJC13 Bryony Thompson gene: DNAJC13 was added
gene: DNAJC13 was added to Early onset Parkinson disease. Sources: Expert list
Mode of inheritance for gene: DNAJC13 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DNAJC13 were set to 30788857; 24218364; 29309590; 31082451; 29887357; 27270108
Review for gene: DNAJC13 was set to AMBER
Added comment: A single family segregating a heterozygous missense (p.Asn855Ser) and supporting functional evidence. However, another group found a TMEM230 variant in the same family also with supporting functional evidence. Two missense reported in two other studies (PMID: 30788857 - p.Arg1382His; PMID: 29887357 - p.Arg903Lys) are more common in gnomAD v2.1 than would be expected for a dominant disorder.
Sources: Expert list
Early-onset Parkinson disease v0.15 DCAF17 Bryony Thompson Marked gene: DCAF17 as ready
Early-onset Parkinson disease v0.15 DCAF17 Bryony Thompson Gene: dcaf17 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.15 DCAF17 Bryony Thompson Classified gene: DCAF17 as Red List (low evidence)
Early-onset Parkinson disease v0.15 DCAF17 Bryony Thompson Added comment: Comment on list classification: Dystonia rather parkinsonism appears to be a feature of this condition and this gene is one the dystonia panel.
Early-onset Parkinson disease v0.15 DCAF17 Bryony Thompson Gene: dcaf17 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.14 DCAF17 Bryony Thompson reviewed gene: DCAF17: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Woodhouse-Sakati syndrome MIM#241080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.14 ATP7B Bryony Thompson Marked gene: ATP7B as ready
Early-onset Parkinson disease v0.14 ATP7B Bryony Thompson Gene: atp7b has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.14 ATP7B Bryony Thompson Classified gene: ATP7B as Green List (high evidence)
Early-onset Parkinson disease v0.14 ATP7B Bryony Thompson Gene: atp7b has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.13 ATP7B Bryony Thompson gene: ATP7B was added
gene: ATP7B was added to Early onset Parkinson disease. Sources: Expert list
Mode of inheritance for gene: ATP7B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATP7B were set to 17435591
Phenotypes for gene: ATP7B were set to Wilson disease MIM#277900
Review for gene: ATP7B was set to GREEN
Added comment: Parkinsonism is a prominent neurological feature of Wilson disease.
Sources: Expert list
Early-onset Parkinson disease v0.12 CP Bryony Thompson reviewed gene: CP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28012953; Phenotypes: Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.12 CLN3 Bryony Thompson reviewed gene: CLN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 19489875, 11342698; Phenotypes: Ceroid lipofuscinosis, neuronal, 3 MIM#204200; Mode of inheritance: None
Early-onset Parkinson disease v0.12 CHCHD2 Bryony Thompson edited their review of gene: CHCHD2: Changed publications: 32068847, 25662902, 31600778, 26705026
Early-onset Parkinson disease v0.12 CHCHD2 Bryony Thompson Publications for gene: CHCHD2 were set to 32068847; 25662902; 31600778
Early-onset Parkinson disease v0.11 CHCHD2 Bryony Thompson Classified gene: CHCHD2 as Green List (high evidence)
Early-onset Parkinson disease v0.11 CHCHD2 Bryony Thompson Gene: chchd2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.10 CHCHD2 Bryony Thompson gene: CHCHD2 was added
gene: CHCHD2 was added to Early onset Parkinson disease. Sources: Expert list
Mode of inheritance for gene: CHCHD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHCHD2 were set to 32068847; 25662902; 31600778
Phenotypes for gene: CHCHD2 were set to Parkinson disease 22, autosomal dominant MIM#616710
Review for gene: CHCHD2 was set to GREEN
Added comment: Five families with heterozygous variants, segregation evidence for T61I in multiple families. Supporting functional evidence suggesting mitochondrial dysfunction through the genes role in mitochondrial respiratory function.
Sources: Expert list
Early-onset Parkinson disease v0.9 C9orf72 Bryony Thompson Classified gene: C9orf72 as Red List (low evidence)
Early-onset Parkinson disease v0.9 C9orf72 Bryony Thompson Added comment: Comment on list classification: A repeat expansion is the cause of disease for this gene, which is currently not detectable by NGS.
Early-onset Parkinson disease v0.9 C9orf72 Bryony Thompson Gene: c9orf72 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.8 C9orf72 Bryony Thompson Tag STR tag was added to gene: C9orf72.
Early-onset Parkinson disease v0.8 AFG3L2 Bryony Thompson Marked gene: AFG3L2 as ready
Early-onset Parkinson disease v0.8 AFG3L2 Bryony Thompson Gene: afg3l2 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.8 AFG3L2 Bryony Thompson Classified gene: AFG3L2 as Red List (low evidence)
Early-onset Parkinson disease v0.8 AFG3L2 Bryony Thompson Gene: afg3l2 has been classified as Red List (Low Evidence).
Early-onset Parkinson disease v0.7 AFG3L2 Bryony Thompson reviewed gene: AFG3L2: Rating: RED; Mode of pathogenicity: None; Publications: 30252181; Phenotypes: optic atrophy, spastic ataxia, L-dopa-responsive parkinsonism; Mode of inheritance: Unknown
Early-onset Parkinson disease v0.7 PRKN Michelle Torres reviewed gene: PRKN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 16476817, PMID: 14519684; Phenotypes: Parkinson disease, juvenile, type 2 600116 AR, Adenocarcinoma of lung, somatic 211980, Ovarian cancer, somatic 167000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.7 Zornitza Stark Panel name changed from Early onset Parkinson disease_MelbourneGenomics_VCGS to Early onset Parkinson disease
Panel types changed to Victorian Clinical Genetics Services; Melbourne Genomics
Early-onset Parkinson disease v0.6 DNAJC12 Zornitza Stark Marked gene: DNAJC12 as ready
Early-onset Parkinson disease v0.6 DNAJC12 Zornitza Stark Gene: dnajc12 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.6 DNAJC12 Zornitza Stark Classified gene: DNAJC12 as Green List (high evidence)
Early-onset Parkinson disease v0.6 DNAJC12 Zornitza Stark Gene: dnajc12 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.5 DNAJC12 Zornitza Stark gene: DNAJC12 was added
gene: DNAJC12 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review
Mode of inheritance for gene: DNAJC12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAJC12 were set to Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384
Review for gene: DNAJC12 was set to GREEN
Added comment: Highly variable neurological phenotype, including ID, dystonia, parkinsonism.
Sources: Expert Review
Early-onset Parkinson disease v0.4 CP Zornitza Stark Marked gene: CP as ready
Early-onset Parkinson disease v0.4 CP Zornitza Stark Gene: cp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.4 CP Zornitza Stark Phenotypes for gene: CP were changed from to Aceruloplasminaemia, MIM#604290
Early-onset Parkinson disease v0.3 CP Zornitza Stark Mode of inheritance for gene: CP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.2 CP Zornitza Stark reviewed gene: CP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aceruloplasminaemia, MIM#604290; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.2 PDE8B Zornitza Stark Marked gene: PDE8B as ready
Early-onset Parkinson disease v0.2 PDE8B Zornitza Stark Gene: pde8b has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.2 PDE8B Zornitza Stark Classified gene: PDE8B as Green List (high evidence)
Early-onset Parkinson disease v0.2 PDE8B Zornitza Stark Gene: pde8b has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.1 PDE8B Zornitza Stark gene: PDE8B was added
gene: PDE8B was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review
Mode of inheritance for gene: PDE8B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PDE8B were set to 20085714; 26769607; 26475694
Phenotypes for gene: PDE8B were set to Striatal degeneration, autosomal dominant, MIM#609161
Review for gene: PDE8B was set to GREEN
Added comment: Movement disorder due to basal ganglia abnormalities, at least three families reported with heterozygous variants in this gene.
Sources: Expert Review
Early-onset Parkinson disease v0.0 XPR1 Zornitza Stark gene: XPR1 was added
gene: XPR1 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: XPR1 was set to Unknown
Early-onset Parkinson disease v0.0 WDR45 Zornitza Stark gene: WDR45 was added
gene: WDR45 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: WDR45 was set to Unknown
Early-onset Parkinson disease v0.0 VPS35 Zornitza Stark gene: VPS35 was added
gene: VPS35 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: VPS35 was set to Unknown
Early-onset Parkinson disease v0.0 VPS13A Zornitza Stark gene: VPS13A was added
gene: VPS13A was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: VPS13A was set to Unknown
Early-onset Parkinson disease v0.0 TWNK Zornitza Stark gene: TWNK was added
gene: TWNK was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TWNK was set to Unknown
Early-onset Parkinson disease v0.0 TUBB4A Zornitza Stark gene: TUBB4A was added
gene: TUBB4A was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TUBB4A was set to Unknown
Early-onset Parkinson disease v0.0 TH Zornitza Stark gene: TH was added
gene: TH was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TH was set to Unknown
Early-onset Parkinson disease v0.0 TAF1 Zornitza Stark gene: TAF1 was added
gene: TAF1 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TAF1 was set to Unknown
Early-onset Parkinson disease v0.0 SYNJ1 Zornitza Stark gene: SYNJ1 was added
gene: SYNJ1 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SYNJ1 was set to Unknown
Early-onset Parkinson disease v0.0 SPR Zornitza Stark gene: SPR was added
gene: SPR was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SPR was set to Unknown
Early-onset Parkinson disease v0.0 SPG11 Zornitza Stark gene: SPG11 was added
gene: SPG11 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SPG11 was set to Unknown
Early-onset Parkinson disease v0.0 SNCA Zornitza Stark gene: SNCA was added
gene: SNCA was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SNCA was set to Unknown
Early-onset Parkinson disease v0.0 SLC6A3 Zornitza Stark gene: SLC6A3 was added
gene: SLC6A3 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SLC6A3 was set to Unknown
Early-onset Parkinson disease v0.0 SLC39A14 Zornitza Stark gene: SLC39A14 was added
gene: SLC39A14 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SLC39A14 was set to Unknown
Early-onset Parkinson disease v0.0 SLC30A10 Zornitza Stark gene: SLC30A10 was added
gene: SLC30A10 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SLC30A10 was set to Unknown
Early-onset Parkinson disease v0.0 SLC20A2 Zornitza Stark gene: SLC20A2 was added
gene: SLC20A2 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SLC20A2 was set to Unknown
Early-onset Parkinson disease v0.0 RAB39B Zornitza Stark gene: RAB39B was added
gene: RAB39B was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: RAB39B was set to Unknown
Early-onset Parkinson disease v0.0 PTS Zornitza Stark gene: PTS was added
gene: PTS was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PTS was set to Unknown
Early-onset Parkinson disease v0.0 PSEN1 Zornitza Stark gene: PSEN1 was added
gene: PSEN1 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PSEN1 was set to Unknown
Early-onset Parkinson disease v0.0 PRNP Zornitza Stark gene: PRNP was added
gene: PRNP was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PRNP was set to Unknown
Early-onset Parkinson disease v0.0 PRKRA Zornitza Stark gene: PRKRA was added
gene: PRKRA was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PRKRA was set to Unknown
Early-onset Parkinson disease v0.0 PRKN Zornitza Stark gene: PRKN was added
gene: PRKN was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PRKN was set to Unknown
Early-onset Parkinson disease v0.0 POLG Zornitza Stark gene: POLG was added
gene: POLG was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: POLG was set to Unknown
Early-onset Parkinson disease v0.0 PLA2G6 Zornitza Stark gene: PLA2G6 was added
gene: PLA2G6 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PLA2G6 was set to Unknown
Early-onset Parkinson disease v0.0 PINK1 Zornitza Stark gene: PINK1 was added
gene: PINK1 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PINK1 was set to Unknown
Early-onset Parkinson disease v0.0 PDGFRB Zornitza Stark gene: PDGFRB was added
gene: PDGFRB was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PDGFRB was set to Unknown
Early-onset Parkinson disease v0.0 PDGFB Zornitza Stark gene: PDGFB was added
gene: PDGFB was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PDGFB was set to Unknown
Early-onset Parkinson disease v0.0 PARK7 Zornitza Stark gene: PARK7 was added
gene: PARK7 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PARK7 was set to Unknown
Early-onset Parkinson disease v0.0 PANK2 Zornitza Stark gene: PANK2 was added
gene: PANK2 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PANK2 was set to Unknown
Early-onset Parkinson disease v0.0 OPA3 Zornitza Stark gene: OPA3 was added
gene: OPA3 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: OPA3 was set to Unknown
Early-onset Parkinson disease v0.0 MECP2 Zornitza Stark gene: MECP2 was added
gene: MECP2 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: MECP2 was set to Unknown
Early-onset Parkinson disease v0.0 MAPT Zornitza Stark gene: MAPT was added
gene: MAPT was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: MAPT was set to Unknown
Early-onset Parkinson disease v0.0 LYST Zornitza Stark gene: LYST was added
gene: LYST was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: LYST was set to Unknown
Early-onset Parkinson disease v0.0 LRRK2 Zornitza Stark gene: LRRK2 was added
gene: LRRK2 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: LRRK2 was set to Unknown
Early-onset Parkinson disease v0.0 KIF5A Zornitza Stark gene: KIF5A was added
gene: KIF5A was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: KIF5A was set to Unknown
Early-onset Parkinson disease v0.0 HTT Zornitza Stark gene: HTT was added
gene: HTT was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: HTT was set to Unknown
Early-onset Parkinson disease v0.0 GRN Zornitza Stark gene: GRN was added
gene: GRN was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: GRN was set to Unknown
Early-onset Parkinson disease v0.0 GCH1 Zornitza Stark gene: GCH1 was added
gene: GCH1 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: GCH1 was set to Unknown
Early-onset Parkinson disease v0.0 FTL Zornitza Stark gene: FTL was added
gene: FTL was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: FTL was set to Unknown
Early-onset Parkinson disease v0.0 FMR1 Zornitza Stark gene: FMR1 was added
gene: FMR1 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: FMR1 was set to Unknown
Early-onset Parkinson disease v0.0 FBXO7 Zornitza Stark gene: FBXO7 was added
gene: FBXO7 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: FBXO7 was set to Unknown
Early-onset Parkinson disease v0.0 DNAJC6 Zornitza Stark gene: DNAJC6 was added
gene: DNAJC6 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: DNAJC6 was set to Unknown
Early-onset Parkinson disease v0.0 DNAJC5 Zornitza Stark gene: DNAJC5 was added
gene: DNAJC5 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: DNAJC5 was set to Unknown
Early-onset Parkinson disease v0.0 DCTN1 Zornitza Stark gene: DCTN1 was added
gene: DCTN1 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: DCTN1 was set to Unknown
Early-onset Parkinson disease v0.0 DCAF17 Zornitza Stark gene: DCAF17 was added
gene: DCAF17 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: DCAF17 was set to Unknown
Early-onset Parkinson disease v0.0 CSF1R Zornitza Stark gene: CSF1R was added
gene: CSF1R was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: CSF1R was set to Unknown
Early-onset Parkinson disease v0.0 CP Zornitza Stark gene: CP was added
gene: CP was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: CP was set to Unknown
Early-onset Parkinson disease v0.0 COASY Zornitza Stark gene: COASY was added
gene: COASY was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: COASY was set to Unknown
Early-onset Parkinson disease v0.0 CLN3 Zornitza Stark gene: CLN3 was added
gene: CLN3 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: CLN3 was set to Unknown
Early-onset Parkinson disease v0.0 C9orf72 Zornitza Stark gene: C9orf72 was added
gene: C9orf72 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: C9orf72 was set to Unknown
Early-onset Parkinson disease v0.0 C19orf12 Zornitza Stark gene: C19orf12 was added
gene: C19orf12 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: C19orf12 was set to Unknown
Early-onset Parkinson disease v0.0 ATP1A3 Zornitza Stark gene: ATP1A3 was added
gene: ATP1A3 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: ATP1A3 was set to Unknown
Early-onset Parkinson disease v0.0 ATP13A2 Zornitza Stark gene: ATP13A2 was added
gene: ATP13A2 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: ATP13A2 was set to Unknown
Early-onset Parkinson disease v0.0 APP Zornitza Stark gene: APP was added
gene: APP was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: APP was set to Unknown
Early-onset Parkinson disease v0.0 AFG3L2 Zornitza Stark gene: AFG3L2 was added
gene: AFG3L2 was added to Early onset Parkinson disease_MelbourneGenomics_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: AFG3L2 was set to Unknown
Early-onset Parkinson disease v0.0 Zornitza Stark Added panel Early onset Parkinson disease_MelbourneGenomics_VCGS