Activity

Filter

Cancel
Date Panel Item Activity
565 actions
Leukodystrophy - adult onset v0.151 ZNF319 Zornitza Stark Marked gene: ZNF319 as ready
Leukodystrophy - adult onset v0.151 ZNF319 Zornitza Stark Gene: znf319 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.151 ZNF319 Zornitza Stark gene: ZNF319 was added
gene: ZNF319 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: ZNF319 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF319 were set to 40820230
Phenotypes for gene: ZNF319 were set to Leukodystrophy, MONDO:0019046, ZNF319-related
Review for gene: ZNF319 was set to RED
Added comment: Single individual with homozygous missense variant reported, p.Phe267Ser.

18-year-old male presenting with spasticity, ataxia, cognitive decline, and white matter abnormalities on MRI. Molecular dynamics simulations revealed that F267 is a stabilizing residue within a β-strand of the zinc finger domain, forming π-stacking and hydrophobic interactions that are lost upon substitution with serine, leading to structural instability, increased flexibility, and protein unfolding. Despite normal transcript and protein expression, ZNF319-F267S mislocalized to the cytoplasm due to disruption of its bipartite nuclear localization signal (NLS), resulting in impaired interaction with importin α1 (KPNA1). Functional analysis confirmed that the variant disrupts nuclear transport and prevents transcriptional activation of genes involved in myelination. Protein interaction network and gene ontology analysis highlighted ZNF319's role in transcriptional regulation and its localization in the CHOP-C/EBP transcriptional complex. Expression profiling demonstrated ZNF319 enrichment in oligodendrocytes and white matter regions, correlating with the observed leukoencephalopathy.
Sources: Literature
Leukodystrophy - adult onset v0.150 C1R Zornitza Stark Classified gene: C1R as Green List (high evidence)
Leukodystrophy - adult onset v0.150 C1R Zornitza Stark Gene: c1r has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.149 C1R Leah Frajman reviewed gene: C1R: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 37323685; Phenotypes: Ehlers-Danlos syndrome, periodontal type, 1 MIM#130080, leukoencephalopathy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.149 NOTCH2NLC_NIID_GGC Bryony Thompson Gene: NOTCH2NL was changed to NOTCH2NLC.
Leukodystrophy - adult onset v0.148 CST3 Zornitza Stark Phenotypes for gene: CST3 were changed from leukodystrophy MONDO:0019046 to Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214
Leukodystrophy - adult onset v0.147 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson Marked STR: C9orf72_FTDALS_GGGGCC as ready
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson Str: c9orf72_ftdals_ggggcc has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence)
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.144 PRNP_CJD_octapeptide Bryony Thompson STR: PRNP_CJD_octapeptide was added
STR: PRNP_CJD_octapeptide was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407
Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP_CJD_octapeptide was set to GREEN
STR: PRNP_CJD_octapeptide was marked as clinically relevant
STR: PRNP_CJD_octapeptide was marked as current diagnostic
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Literature
Leukodystrophy - adult onset v0.143 SNORD118 Zornitza Stark Tag non-coding gene tag was added to gene: SNORD118.
Leukodystrophy - adult onset v0.143 LMNB1 Zornitza Stark Phenotypes for gene: LMNB1 were changed from Leukodystrophy, adult-onset, autosomal dominant, 169500 to Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500; Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061
Leukodystrophy - adult onset v0.142 LMNB1 Zornitza Stark Mode of inheritance for gene: LMNB1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.141 LMNB1 Zornitza Stark edited their review of gene: LMNB1: Changed phenotypes: Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500, Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061
Leukodystrophy - adult onset v0.141 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from Retinal Vascular Abnormality; mild intellectual disability; white matter lesions; lower limb spasticity to Leukodystrophy, MONDO:0019046, LAMB1-related; Retinal Vascular Abnormality; mild intellectual disability; white matter lesions; lower limb spasticity
Leukodystrophy - adult onset v0.140 NOTCH3 Ain Roesley Phenotypes for gene: NOTCH3 were changed from neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310 to neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310
Leukodystrophy - adult onset v0.139 NOTCH3 Ain Roesley Phenotypes for gene: NOTCH3 were changed from Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, 125310 to neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310
Leukodystrophy - adult onset v0.138 NOTCH3 Ain Roesley Mode of inheritance for gene: NOTCH3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.137 NOTCH3 Ain Roesley reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder MONDO:0700092, NOTCH3-related, Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes
Leukodystrophy - adult onset v0.137 PRNP Bryony Thompson Marked gene: PRNP as ready
Leukodystrophy - adult onset v0.137 PRNP Bryony Thompson Gene: prnp has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.137 PRNP Bryony Thompson Classified gene: PRNP as Green List (high evidence)
Leukodystrophy - adult onset v0.137 PRNP Bryony Thompson Gene: prnp has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.136 PRNP Bryony Thompson gene: PRNP was added
gene: PRNP was added to Leukodystrophy - adult onset. Sources: Other
Mode of inheritance for gene: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRNP were set to 25220284; 24252267
Phenotypes for gene: PRNP were set to fatal familial insomnia MONDO:0010808
Mode of pathogenicity for gene: PRNP was set to Other
Review for gene: PRNP was set to GREEN
gene: PRNP was marked as current diagnostic
Added comment: White-matter abnormalities have been reported in inherited prion diseases
Sources: Other
Leukodystrophy - adult onset v0.135 ITM2B Bryony Thompson Marked gene: ITM2B as ready
Leukodystrophy - adult onset v0.135 ITM2B Bryony Thompson Gene: itm2b has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.135 ITM2B Bryony Thompson Classified gene: ITM2B as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.135 ITM2B Bryony Thompson Gene: itm2b has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.134 ITM2B Bryony Thompson gene: ITM2B was added
gene: ITM2B was added to Leukodystrophy - adult onset. Sources: Other
Mode of inheritance for gene: ITM2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ITM2B were set to 10775542
Phenotypes for gene: ITM2B were set to ABri amyloidosis MONDO:0008306
Mode of pathogenicity for gene: ITM2B was set to Other
Review for gene: ITM2B was set to AMBER
Added comment: White matter abnormalities have been reported in 11 at-risk individuals from the original large family reported.
Sources: Other
Leukodystrophy - adult onset v0.133 CST3 Bryony Thompson Marked gene: CST3 as ready
Leukodystrophy - adult onset v0.133 CST3 Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.133 CST3 Bryony Thompson Classified gene: CST3 as Green List (high evidence)
Leukodystrophy - adult onset v0.133 CST3 Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.132 CST3 Bryony Thompson gene: CST3 was added
gene: CST3 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: CST3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CST3 were set to 38489591
Phenotypes for gene: CST3 were set to leukodystrophy MONDO:0019046
Review for gene: CST3 was set to GREEN
Added comment: 16 patients from 8 leukodystrophy families carrying one of four different stop-gain or frameshift dominant variants in the C-terminal (in the NMD-exclusion zone) of the CST3 gene. The suggested mechanism of disease by rendering the protein more prone to aggregation. The clinical phenotype consists of recurrent episodes of hemiplegic migraine associated with transient unilateral focal deficits and slowly progressing motor symptoms and cognitive decline in mid-old adult ages. Clinical & radiological features differ from Cerebral Amyloid Angiopathy.
Sources: Literature
Leukodystrophy - adult onset v0.131 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Leukodystrophy - adult onset v0.131 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.130 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 36970046; 36632182
Phenotypes for STR: FTDALS were set to frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MONDO:0007105
Penetrance for STR: FTDALS were set to Incomplete
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
STR: FTDALS was marked as current diagnostic
Added comment: Expansion carriers showed widespread white-matter abnormalities in the brain
Sources: Literature
Leukodystrophy - adult onset v0.129 MAPT Bryony Thompson Marked gene: MAPT as ready
Leukodystrophy - adult onset v0.129 MAPT Bryony Thompson Gene: mapt has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.129 MAPT Bryony Thompson Classified gene: MAPT as Green List (high evidence)
Leukodystrophy - adult onset v0.129 MAPT Bryony Thompson Gene: mapt has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.128 MAPT Bryony Thompson gene: MAPT was added
gene: MAPT was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: MAPT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAPT were set to 33802612; 36970046
Phenotypes for gene: MAPT were set to semantic dementia MONDO:0010857
Mode of pathogenicity for gene: MAPT was set to Other
Review for gene: MAPT was set to GREEN
gene: MAPT was marked as current diagnostic
Added comment: White-matter abnormalities have been reported in symptomatic and pre-symptomatic carriers of MAPT pathogenic variants.
Sources: Literature
Leukodystrophy - adult onset v0.127 GRN Bryony Thompson Marked gene: GRN as ready
Leukodystrophy - adult onset v0.127 GRN Bryony Thompson Gene: grn has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.127 GRN Bryony Thompson Classified gene: GRN as Green List (high evidence)
Leukodystrophy - adult onset v0.127 GRN Bryony Thompson Gene: grn has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.126 GRN Bryony Thompson gene: GRN was added
gene: GRN was added to Leukodystrophy - adult onset. Sources: Other
Mode of inheritance for gene: GRN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GRN were set to 36970046; 36632182
Phenotypes for gene: GRN were set to GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842
Review for gene: GRN was set to GREEN
gene: GRN was marked as current diagnostic
Added comment: White matter abnormalities have been reported in presymptomatic carriers and affected carriers.
Sources: Other
Leukodystrophy - adult onset v0.125 PSEN2 Bryony Thompson Marked gene: PSEN2 as ready
Leukodystrophy - adult onset v0.125 PSEN2 Bryony Thompson Gene: psen2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.125 PSEN2 Bryony Thompson Classified gene: PSEN2 as Green List (high evidence)
Leukodystrophy - adult onset v0.125 PSEN2 Bryony Thompson Gene: psen2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.124 PSEN2 Bryony Thompson gene: PSEN2 was added
gene: PSEN2 was added to Leukodystrophy - adult onset. Sources: Other
Mode of inheritance for gene: PSEN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PSEN2 were set to 36845656
Phenotypes for gene: PSEN2 were set to early-onset autosomal dominant Alzheimer disease MONDO:0015140
Mode of pathogenicity for gene: PSEN2 was set to Other
Review for gene: PSEN2 was set to GREEN
gene: PSEN2 was marked as current diagnostic
Added comment: White matter abnormalities are a common feature of Alzheimer's disease
Sources: Other
Leukodystrophy - adult onset v0.123 PSEN1 Bryony Thompson Marked gene: PSEN1 as ready
Leukodystrophy - adult onset v0.123 PSEN1 Bryony Thompson Gene: psen1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.123 PSEN1 Bryony Thompson Classified gene: PSEN1 as Green List (high evidence)
Leukodystrophy - adult onset v0.123 PSEN1 Bryony Thompson Gene: psen1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.122 PSEN1 Bryony Thompson gene: PSEN1 was added
gene: PSEN1 was added to Leukodystrophy - adult onset. Sources: Other
Mode of inheritance for gene: PSEN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PSEN1 were set to 36845656
Phenotypes for gene: PSEN1 were set to early-onset autosomal dominant Alzheimer disease MONDO:0015140
Mode of pathogenicity for gene: PSEN1 was set to Other
Review for gene: PSEN1 was set to GREEN
gene: PSEN1 was marked as current diagnostic
Added comment: White matter abnormalities are a common feature of Alzheimer's disease
Sources: Other
Leukodystrophy - adult onset v0.121 APP Bryony Thompson Marked gene: APP as ready
Leukodystrophy - adult onset v0.121 APP Bryony Thompson Gene: app has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.121 APP Bryony Thompson Classified gene: APP as Green List (high evidence)
Leukodystrophy - adult onset v0.121 APP Bryony Thompson Gene: app has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.120 APP Bryony Thompson gene: APP was added
gene: APP was added to Leukodystrophy - adult onset. Sources: Other
Mode of inheritance for gene: APP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: APP were set to 36845656
Phenotypes for gene: APP were set to early-onset autosomal dominant Alzheimer disease MONDO:0015140
Review for gene: APP was set to GREEN
gene: APP was marked as current diagnostic
Added comment: White matter abnormalities are a common feature of Alzheimer's disease
Sources: Other
Leukodystrophy - adult onset v0.119 TPP2 Zornitza Stark Mode of inheritance for gene: TPP2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.118 TPP2 Zornitza Stark edited their review of gene: TPP2: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.118 EIF2B5 Zornitza Stark Marked gene: EIF2B5 as ready
Leukodystrophy - adult onset v0.118 EIF2B5 Zornitza Stark Gene: eif2b5 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.118 EIF2B5 Zornitza Stark Publications for gene: EIF2B5 were set to
Leukodystrophy - adult onset v0.117 EIF2B4 Zornitza Stark Marked gene: EIF2B4 as ready
Leukodystrophy - adult onset v0.117 EIF2B4 Zornitza Stark Gene: eif2b4 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.117 EIF2B4 Zornitza Stark Phenotypes for gene: EIF2B4 were changed from Leukoencephalopathy with vanishing white matter, 603896 to Leukoencephalopathy with vanishing white matter, MIM#603896, MONDO:0011380
Leukodystrophy - adult onset v0.116 EIF2B4 Zornitza Stark Publications for gene: EIF2B4 were set to
Leukodystrophy - adult onset v0.115 EIF2B3 Zornitza Stark Marked gene: EIF2B3 as ready
Leukodystrophy - adult onset v0.115 EIF2B3 Zornitza Stark Gene: eif2b3 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.115 EIF2B3 Zornitza Stark Phenotypes for gene: EIF2B3 were changed from Leukoencephalopathy with vanishing white matter, 603896 to Leukoencephalopathy with vanishing white matter, MIM#603896, MONDO:0011380
Leukodystrophy - adult onset v0.114 EIF2B3 Zornitza Stark Publications for gene: EIF2B3 were set to
Leukodystrophy - adult onset v0.113 EIF2B2 Zornitza Stark Marked gene: EIF2B2 as ready
Leukodystrophy - adult onset v0.113 EIF2B2 Zornitza Stark Gene: eif2b2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.113 EIF2B2 Zornitza Stark Phenotypes for gene: EIF2B2 were changed from Leukoencephalopathy with vanishing white matter, Ovarioleukodystrophy, 603896 to Leukoencephalopathy with vanishing white matter MONDO:0011380
Leukodystrophy - adult onset v0.112 EIF2B2 Zornitza Stark Publications for gene: EIF2B2 were set to
Leukodystrophy - adult onset v0.111 EIF2B1 Zornitza Stark Marked gene: EIF2B1 as ready
Leukodystrophy - adult onset v0.111 EIF2B1 Zornitza Stark Gene: eif2b1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.111 EIF2B1 Zornitza Stark Publications for gene: EIF2B1 were set to
Leukodystrophy - adult onset v0.110 PSAP Zornitza Stark Marked gene: PSAP as ready
Leukodystrophy - adult onset v0.110 PSAP Zornitza Stark Gene: psap has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.110 PSAP Zornitza Stark Publications for gene: PSAP were set to
Leukodystrophy - adult onset v0.109 EIF2B5 Kaitlyn Dianna Weldon reviewed gene: EIF2B5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 EIF2B4 Kaitlyn Dianna Weldon reviewed gene: EIF2B4: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 EIF2B3 Kaitlyn Dianna Weldon reviewed gene: EIF2B3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 EIF2B2 Kaitlyn Dianna Weldon reviewed gene: EIF2B2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 EIF2B1 Kaitlyn Dianna Weldon reviewed gene: EIF2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 PSAP Kaitlyn Dianna Weldon edited their review of gene: PSAP: Added comment: This is a well established leukodystrophy gene; Changed phenotypes: metachromatic leukodystrophy due to saposin B deficiency MONDO:0009590
Leukodystrophy - adult onset v0.109 PSAP Kaitlyn Dianna Weldon reviewed gene: PSAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 26462614; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 SLC17A5 Kaitlyn Dianna Weldon reviewed gene: SLC17A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301643; Phenotypes: Salla disease MONDO:0011449; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 RNASEH2C Kaitlyn Dianna Weldon reviewed gene: RNASEH2C: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301648; Phenotypes: Aicardi-Goutieres syndrome 2 MONDO:0012471; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 RNASEH2B Kaitlyn Dianna Weldon reviewed gene: RNASEH2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301648; Phenotypes: Aicardi-Goutieres syndrome 4 MONDO:0012472; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 RNASEH2A Kaitlyn Dianna Weldon reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301648; Phenotypes: Aicardi-Goutieres syndrome 4 MONDO:0012472; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 GLB1 Kaitlyn Dianna Weldon reviewed gene: GLB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24156116; Phenotypes: GM1 gangliosidosis type 3 MONDO:0009262; Mode of inheritance: None
Leukodystrophy - adult onset v0.109 GBE1 Kaitlyn Dianna Weldon reviewed gene: GBE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301758; Phenotypes: adult polyglucosan body disease MONDO:0009897; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 GLA Claire Fryer-Smith reviewed gene: GLA: Rating: GREEN; Mode of pathogenicity: None; Publications: 30757954, 12786754, 15924232, 31200018, 31519519; Phenotypes: Fabry disease (MIM# 301500); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Leukodystrophy - adult onset v0.109 CYP27A1 Kaitlyn Dianna Weldon reviewed gene: CYP27A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301583; Phenotypes: cerebrotendinous xanthomatosis MONDO:0008948; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 CSF1R Kaitlyn Dianna Weldon reviewed gene: CSF1R: Rating: GREEN; Mode of pathogenicity: None; Publications: 22934315; Phenotypes: brain abnormalities, neurodegeneration, and dysosteosclerosis MONDO:0032772; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.109 COL4A1 Kaitlyn Dianna Weldon reviewed gene: COL4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301768; Phenotypes: brain small vessel disease 1 with or without ocular anomalies MONDO:0008289; Mode of inheritance: None
Leukodystrophy - adult onset v0.109 ADAR Kaitlyn Dianna Weldon reviewed gene: ADAR: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301648; Phenotypes: Aicardi-Goutieres syndrome 6 MONDO:0014007; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.109 ABCD1 Kaitlyn Dianna Weldon reviewed gene: ABCD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301491; Phenotypes: adrenoleukodystrophy MONDO:0018544, X-linked cerebral adrenoleukodystrophy MONDO:0010247; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Leukodystrophy - adult onset v0.109 AARS2 Kaitlyn Dianna Weldon reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34285876, 35084689; Phenotypes: leukodystrophy MONDO:0019046; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.109 ACTA2 Bryony Thompson Marked gene: ACTA2 as ready
Leukodystrophy - adult onset v0.109 ACTA2 Bryony Thompson Gene: acta2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.109 ACTA2 Bryony Thompson Classified gene: ACTA2 as Green List (high evidence)
Leukodystrophy - adult onset v0.109 ACTA2 Bryony Thompson Gene: acta2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.108 ACTA2 Bryony Thompson gene: ACTA2 was added
gene: ACTA2 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: ACTA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ACTA2 were set to 29300374
Phenotypes for gene: ACTA2 were set to multisystemic smooth muscle dysfunction syndrome MONDO:0013452
Mode of pathogenicity for gene: ACTA2 was set to Other
Review for gene: ACTA2 was set to GREEN
gene: ACTA2 was marked as current diagnostic
Added comment: Hyperintense periventricular white matter lesions were present in 95% (21/22) of smooth muscle dysfunction syndrome cases with missense variants involving Arg179. Age of diagnosis varied from infancy to adulthood.
Sources: Literature
Leukodystrophy - adult onset v0.107 PLD3 Bryony Thompson Classified gene: PLD3 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.107 PLD3 Bryony Thompson Gene: pld3 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.106 PLD3 Tegan French gene: PLD3 was added
gene: PLD3 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: PLD3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLD3 were set to PMID: 34267643
Phenotypes for gene: PLD3 were set to Leukodystrophy
Review for gene: PLD3 was set to AMBER
Added comment: Unconfirmed gene-disease association for biallelic LOF variants in PLD3 and leukodystrophy.
- Single patient in literature with homozygous frameshift nonsense variants in PLD3. This patient had leukodystrophy, vision and hearing impairment, impaired kidney function.
- Homozygous frameshift nonsense variants in another unpublished patient with leukodystrophy
Sources: Literature
Leukodystrophy - adult onset v0.106 Zornitza Stark List of related panels changed from to Leukodystrophy; HP:0002415; Abnormal cerebral white matter morphology; HP:0002500; Abnormal CNS myelination; HP:0011400
Leukodystrophy - adult onset v0.105 PAH Zornitza Stark Tag treatable tag was added to gene: PAH.
Leukodystrophy - adult onset v0.105 C1R Zornitza Stark Marked gene: C1R as ready
Leukodystrophy - adult onset v0.105 C1R Zornitza Stark Gene: c1r has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.105 C1R Zornitza Stark Classified gene: C1R as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.105 C1R Zornitza Stark Gene: c1r has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.104 ARSA Zornitza Stark Tag treatable tag was added to gene: ARSA.
Tag clinical trial tag was added to gene: ARSA.
Leukodystrophy - adult onset v0.104 C1R Deepak Subramanian gene: C1R was added
gene: C1R was added to Leukodystrophy - adult onset. Sources: Literature,Other
Mode of inheritance for gene: C1R was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: C1R were set to 8958339; 30535813
Phenotypes for gene: C1R were set to Ehlers-Danlos syndrome, periodontal type, 1 (MIM# 130080); Leukodystrophy - adult onset
Penetrance for gene: C1R were set to unknown
Mode of pathogenicity for gene: C1R was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: C1R was set to AMBER
Added comment: Classic periodontal EDS (pEDS) phenotype is associated with gain-of-function mutations in this gene (Kapferer-Seebacher, van Dijk, and Zschocke, GeneReviews, 2021). Earlier case reports noted the presence of leukodystrophy in one 37-year-old female with clinically-diagnosed pEDS (PMID: 8958339) and eight adult individuals from two families with heterozygous mutations in C1R (PMID: 30535813), where other causes of leukodystrophy were ruled out or considered unlikely. Recent data presented at the 2022 EDS International Scientific Symposium by Angwin et al (Oral Abstract 91) highlighted nine more adults with clinically and molecularly confirmed pEDS with evidence of leukodystrophy (out of ten such patients with available imaging). Nearly all patients reported to date have no cognitive deficits or other neurological features of leukodystrophy, with only isolated cases of recurrent headaches/drop attacks or mild cognitive decline/ataxia that might have a different aetiology. Pathophysiology is thought to result from underlying small vessel disease (similar in pattern to that of CADASIL) which progresses with age and is disproportionate to the observed neurological phenotype in these individuals.
Sources: Literature, Other
Leukodystrophy - adult onset v0.104 NOTCH1 Zornitza Stark Marked gene: NOTCH1 as ready
Leukodystrophy - adult onset v0.104 NOTCH1 Zornitza Stark Gene: notch1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.104 NOTCH1 Zornitza Stark Classified gene: NOTCH1 as Green List (high evidence)
Leukodystrophy - adult onset v0.104 NOTCH1 Zornitza Stark Gene: notch1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.103 NOTCH1 Chern Lim gene: NOTCH1 was added
gene: NOTCH1 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NOTCH1 were set to 35947102
Phenotypes for gene: NOTCH1 were set to Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related
Mode of pathogenicity for gene: NOTCH1 was set to Other
Review for gene: NOTCH1 was set to GREEN
gene: NOTCH1 was marked as current diagnostic
Added comment: PMID: 35947102:
- Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1.
- Other clinical features include intellectual disability, spasticity and etc. Childhood onset in most individuals however 15y and 40y reported in two individuals.
- Missense and small inframe insertion variants in the negative regulatory region.
Sources: Literature
Leukodystrophy - adult onset v0.103 Zornitza Stark HPO terms changed from to Leukodystrophy, HP:0002415; Abnormal cerebral white matter morphology, HP:0002500
Leukodystrophy - adult onset v0.102 LIG3 Zornitza Stark Phenotypes for gene: LIG3 were changed from gut dysmotility; spasticity; ataxia; repetitive behaviours; neurogenic bladder; macular degeneration; leukoencephalopathy; cerebellar atrophy to Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780
Leukodystrophy - adult onset v0.101 LIG3 Zornitza Stark edited their review of gene: LIG3: Changed phenotypes: Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780
Leukodystrophy - adult onset v0.101 ANXA11 Zornitza Stark Marked gene: ANXA11 as ready
Leukodystrophy - adult onset v0.101 ANXA11 Zornitza Stark Gene: anxa11 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.101 ANXA11 Zornitza Stark Phenotypes for gene: ANXA11 were changed from Inclusion body myopathy and brain white matter abnormalities, MIM# 619733; Amyotrophic lateral sclerosis 23, MIM# 617839 to Inclusion body myopathy and brain white matter abnormalities, MIM# 619733
Leukodystrophy - adult onset v0.100 ANXA11 Zornitza Stark Classified gene: ANXA11 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.100 ANXA11 Zornitza Stark Gene: anxa11 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.99 ANXA11 Zornitza Stark Tag founder tag was added to gene: ANXA11.
Leukodystrophy - adult onset v0.99 ANXA11 Zornitza Stark edited their review of gene: ANXA11: Changed phenotypes: Inclusion body myopathy and brain white matter abnormalities, MIM# 619733
Leukodystrophy - adult onset v0.99 ANXA11 Zornitza Stark gene: ANXA11 was added
gene: ANXA11 was added to Leukodystrophy - adult onset. Sources: Expert Review
Mode of inheritance for gene: ANXA11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANXA11 were set to 34048612
Phenotypes for gene: ANXA11 were set to Inclusion body myopathy and brain white matter abnormalities, MIM# 619733; Amyotrophic lateral sclerosis 23, MIM# 617839
Review for gene: ANXA11 was set to AMBER
Added comment: Inclusion body myopathy and brain white matter abnormalities (IBMWMA) is an autosomal dominant adult-onset disorder characterized predominantly by proximal limb girdle muscle weakness affecting the lower and upper limbs and resulting in gait difficulties and scapular winging. Additional features may include dysarthria, dysphagia, low back pain, and hyporeflexia. EMG is consistent with a myopathic process, although neuropathic findings have also been shown. Muscle biopsy shows fiber type variation, internal nuclei, rimmed vacuoles, and cytoplasmic protein aggregates or inclusions. Serum creatine kinase is usually elevated. Cognitive impairment or frontotemporal dementia occurs in some patients. The disorder is slowly progressive; some patients become wheelchair-bound after many years. Rare patients with this mutation develop ALS; some have both myopathy and ALS. Brain imaging shows white matter abnormalities using diffusion tensor imaging. The disorder is classified as multisystem proteinopathy-6 (MSP6) due to the characteristic disease mechanism of protein misfolding and abnormal tissue deposition.

11 individuals from three unrelated Brazilian families reported, but all had same variant ?founder.
Sources: Expert Review
Leukodystrophy - adult onset v0.98 TPP2 Zornitza Stark Marked gene: TPP2 as ready
Leukodystrophy - adult onset v0.98 TPP2 Zornitza Stark Gene: tpp2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.98 TPP2 Zornitza Stark Classified gene: TPP2 as Green List (high evidence)
Leukodystrophy - adult onset v0.98 TPP2 Zornitza Stark Gene: tpp2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.97 TPP2 Zornitza Stark gene: TPP2 was added
gene: TPP2 was added to Leukodystrophy - adult onset. Sources: Expert Review
Mode of inheritance for gene: TPP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TPP2 were set to 25414442
Phenotypes for gene: TPP2 were set to Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220
Review for gene: TPP2 was set to GREEN
Added comment: 14 individuals with "TRIANGLE" (TPPII-related immunodeficiency,
autoimmunity, and neurodevelopmental delay with impaired glycolysis
and lysosomal expansion) syndrome are summarized in 25414442, where 4/14 presented in adulthood with white matter leasions mimicking multiple sclerosis.
Sources: Expert Review
Leukodystrophy - adult onset v0.96 AARS Zornitza Stark edited their review of gene: AARS: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.96 AARS Zornitza Stark Phenotypes for gene: AARS were changed from Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287 to Leukoencephalopathy, hereditary diffuse, with spheroids 2, MIM# 619661
Leukodystrophy - adult onset v0.95 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.94 AARS Zornitza Stark changed review comment from: Limited evidence to link with leukodystrophy.
Sources: Expert list; to: Limited evidence to link with leukodystrophy. Single multigenerational family segregating a heterozygous missense variant.
Sources: Expert list
Leukodystrophy - adult onset v0.94 AARS Zornitza Stark edited their review of gene: AARS: Changed phenotypes: Leukoencephalopathy, hereditary diffuse, with spheroids 2, MIM# 619661
Leukodystrophy - adult onset v0.94 LAMB1 Alison Yeung Marked gene: LAMB1 as ready
Leukodystrophy - adult onset v0.94 LAMB1 Alison Yeung Gene: lamb1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.94 LAMB1 Alison Yeung Classified gene: LAMB1 as Green List (high evidence)
Leukodystrophy - adult onset v0.94 LAMB1 Alison Yeung Gene: lamb1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.93 LAMB1 Alison Yeung Added comment: Comment on mode of inheritance: Monoallelic mode of inheritance for adult-onset disease
Leukodystrophy - adult onset v0.93 LAMB1 Alison Yeung Mode of inheritance for gene: LAMB1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Leukodystrophy - adult onset v0.93 LAMB1 Alison Yeung Added comment: Comment on mode of inheritance: Monoallelic mode of inheritance for adult-onset disease
Leukodystrophy - adult onset v0.93 LAMB1 Alison Yeung Mode of inheritance for gene: LAMB1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Leukodystrophy - adult onset v0.92 LAMB1 Lucy Spencer reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34606115; Phenotypes: leukoencephalopathy; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.92 POLR1C Zornitza Stark Marked gene: POLR1C as ready
Leukodystrophy - adult onset v0.92 POLR1C Zornitza Stark Added comment: Comment when marking as ready: Four adults from three families reported.
Leukodystrophy - adult onset v0.92 POLR1C Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.92 POLR1C Zornitza Stark Publications for gene: POLR1C were set to
Leukodystrophy - adult onset v0.91 POLR1C Zornitza Stark Classified gene: POLR1C as Green List (high evidence)
Leukodystrophy - adult onset v0.91 POLR1C Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.90 POLR1C Ain Roesley reviewed gene: POLR1C: Rating: AMBER; Mode of pathogenicity: None; Publications: 33190326, 34484918; Phenotypes: Leukodystrophy, hypomyelinating, 11, MIM# 616494; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.90 NIID Bryony Thompson Marked STR: NIID as ready
Leukodystrophy - adult onset v0.90 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.90 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Leukodystrophy - adult onset v0.90 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.89 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Leukodystrophy - adult onset v0.88 Bryony Thompson removed STR:NIID from the panel
Leukodystrophy - adult onset v0.87 TACO1 Seb Lunke Marked gene: TACO1 as ready
Leukodystrophy - adult onset v0.87 TACO1 Seb Lunke Gene: taco1 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.87 TACO1 Seb Lunke gene: TACO1 was added
gene: TACO1 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: TACO1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TACO1 were set to 33709035
Phenotypes for gene: TACO1 were set to Leukoencephalopathy, adult onset
Review for gene: TACO1 was set to RED
Added comment: 50yo female with hom c.676G>T (p.Glu226Ter) variant. Onset of slowly progressive spastic gait and mild cognitive impairment in her 30s. 24yo carrier daughter healthy.

Live imaging microscopy in primary fibroblasts showed a mild reduction of optic atrophy gene 1 long forms, which are the active mediators of mitochondrial fusion (figure 1C), however mitochondrial network morphology was comparable to controls, with the highest percentage of cells showing fused and interconnected organelles.
Sources: Literature
Leukodystrophy - adult onset v0.86 NIID Bryony Thompson Marked STR: NIID as ready
Leukodystrophy - adult onset v0.86 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.86 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Leukodystrophy - adult onset v0.86 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.85 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[(66_517)] Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Leukodystrophy - adult onset v0.84 LIG3 Zornitza Stark Marked gene: LIG3 as ready
Leukodystrophy - adult onset v0.84 LIG3 Zornitza Stark Gene: lig3 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.84 LIG3 Zornitza Stark Classified gene: LIG3 as Green List (high evidence)
Leukodystrophy - adult onset v0.84 LIG3 Zornitza Stark Gene: lig3 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.83 LIG3 Zornitza Stark gene: LIG3 was added
gene: LIG3 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: LIG3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LIG3 were set to 33855352
Phenotypes for gene: LIG3 were set to gut dysmotility; spasticity; ataxia; repetitive behaviours; neurogenic bladder; macular degeneration; leukoencephalopathy; cerebellar atrophy
Review for gene: LIG3 was set to GREEN
Added comment: Seven individuals from three unrelated families and functional data, variable ages of onset from early childhood to late adolescence.
Sources: Literature
Leukodystrophy - adult onset v0.82 SPG21 Zornitza Stark Marked gene: SPG21 as ready
Leukodystrophy - adult onset v0.82 SPG21 Zornitza Stark Added comment: Comment when marking as ready: New HGNC approved name is SPG21.
Leukodystrophy - adult onset v0.82 SPG21 Zornitza Stark Gene: spg21 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.82 SPG21 Zornitza Stark Tag new gene name tag was added to gene: SPG21.
Leukodystrophy - adult onset v0.82 LARS2 Zornitza Stark Marked gene: LARS2 as ready
Leukodystrophy - adult onset v0.82 LARS2 Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.82 LARS2 Zornitza Stark Classified gene: LARS2 as Green List (high evidence)
Leukodystrophy - adult onset v0.82 LARS2 Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.81 LARS2 Zornitza Stark gene: LARS2 was added
gene: LARS2 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: LARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LARS2 were set to 32442335; 30737337
Phenotypes for gene: LARS2 were set to Leukodystrophy
Review for gene: LARS2 was set to GREEN
Added comment: Five individuals reported where leukodystrophy was part of LARS2-associated Perrault syndrome. Neurological decline and MRI abnormalities were primarily in adulthood.
Sources: Literature
Leukodystrophy - adult onset v0.80 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Leukodystrophy - adult onset v0.79 LAMB1 Zornitza Stark edited their review of gene: LAMB1: Changed rating: RED; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.79 LAMB1 Zornitza Stark reviewed gene: LAMB1: Rating: ; Mode of pathogenicity: None; Publications: 32548278; Phenotypes: ; Mode of inheritance: None
Leukodystrophy - adult onset v0.79 LAMB1 Seb Lunke Marked gene: LAMB1 as ready
Leukodystrophy - adult onset v0.79 LAMB1 Seb Lunke Gene: lamb1 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.79 LAMB1 Seb Lunke gene: LAMB1 was added
gene: LAMB1 was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for gene: LAMB1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMB1 were set to Retinal Vascular Abnormality; mild intellectual disability; white matter lesions; lower limb spasticity
Review for gene: LAMB1 was set to RED
Added comment: Single adult female patient with onset of symptoms after 22yrs of age. Novel homozygous missense variant in a distantly related family identified in exome sequencing, no further evidence of pathogenicity.
Sources: Literature
Leukodystrophy - adult onset v0.76 MLC1 Zornitza Stark Classified gene: MLC1 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.76 MLC1 Zornitza Stark Gene: mlc1 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.75 MLC1 Zornitza Stark edited their review of gene: MLC1: Changed rating: AMBER
Leukodystrophy - adult onset v0.75 AARS Zornitza Stark Marked gene: AARS as ready
Leukodystrophy - adult onset v0.75 AARS Zornitza Stark Gene: aars has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.75 AARS Zornitza Stark Classified gene: AARS as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.75 AARS Zornitza Stark Gene: aars has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.74 AARS Zornitza Stark Marked gene: AARS as ready
Leukodystrophy - adult onset v0.74 AARS Zornitza Stark Gene: aars has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.74 AARS Zornitza Stark Classified gene: AARS as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.74 AARS Zornitza Stark Gene: aars has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.73 AARS Zornitza Stark gene: AARS was added
gene: AARS was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: AARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AARS were set to 31775912
Phenotypes for gene: AARS were set to Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287
Review for gene: AARS was set to AMBER
Added comment: Limited evidence to link with leukodystrophy.
Sources: Expert list
Leukodystrophy - adult onset v0.72 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease
Leukodystrophy - adult onset v0.71 RNASET2 Zornitza Stark Marked gene: RNASET2 as ready
Leukodystrophy - adult onset v0.71 RNASET2 Zornitza Stark Gene: rnaset2 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.71 RNASET2 Zornitza Stark Publications for gene: RNASET2 were set to
Leukodystrophy - adult onset v0.70 RNASET2 Zornitza Stark Classified gene: RNASET2 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.70 RNASET2 Zornitza Stark Gene: rnaset2 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.69 RNASET2 Zornitza Stark reviewed gene: RNASET2: Rating: AMBER; Mode of pathogenicity: None; Publications: 19525954; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.69 SAMHD1 Zornitza Stark Marked gene: SAMHD1 as ready
Leukodystrophy - adult onset v0.69 SAMHD1 Zornitza Stark Gene: samhd1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.69 SAMHD1 Zornitza Stark Publications for gene: SAMHD1 were set to
Leukodystrophy - adult onset v0.68 SAMHD1 Zornitza Stark reviewed gene: SAMHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19525956; Phenotypes: Aicardi-Goutieres syndrome 5, MIM# 612952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.68 SPG11 Zornitza Stark Marked gene: SPG11 as ready
Leukodystrophy - adult onset v0.68 SPG11 Zornitza Stark Gene: spg11 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.68 SPG11 Zornitza Stark Publications for gene: SPG11 were set to
Leukodystrophy - adult onset v0.67 SPG11 Zornitza Stark reviewed gene: SPG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 18067136; Phenotypes: Spastic paraplegia 11, autosomal recessive, MIM# 604360; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.67 TREX1 Zornitza Stark changed review comment from: White matter changes are part of the phenotype. Onset is typically in infancy/early childhood but can be highly variable.; to: AGS: White matter changes are part of the phenotype. Onset is typically in infancy/early childhood but can be highly variable. Vasculopathy, retinal, with cerebral leukodystrophy, MIM# 192315: adult-onset disorder.
Leukodystrophy - adult onset v0.67 TREX1 Zornitza Stark edited their review of gene: TREX1: Changed phenotypes: Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750, Vasculopathy, retinal, with cerebral leukodystrophy 192315
Leukodystrophy - adult onset v0.67 TREX1 Zornitza Stark Marked gene: TREX1 as ready
Leukodystrophy - adult onset v0.67 TREX1 Zornitza Stark Gene: trex1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.67 TREX1 Zornitza Stark reviewed gene: TREX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.67 TUBB4A Zornitza Stark Marked gene: TUBB4A as ready
Leukodystrophy - adult onset v0.67 TUBB4A Zornitza Stark Gene: tubb4a has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.67 TUBB4A Zornitza Stark Phenotypes for gene: TUBB4A were changed from Leukodystrophy, hypomyelinating, 6, 612438 to Leukodystrophy, hypomyelinating, 6, MIM#612438
Leukodystrophy - adult onset v0.66 TUBB4A Zornitza Stark Publications for gene: TUBB4A were set to
Leukodystrophy - adult onset v0.65 TUBB4A Zornitza Stark reviewed gene: TUBB4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 28791129; Phenotypes: Leukodystrophy, hypomyelinating, 6, MIM# 612438; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.65 TYROBP Zornitza Stark Marked gene: TYROBP as ready
Leukodystrophy - adult onset v0.65 TYROBP Zornitza Stark Gene: tyrobp has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.65 TYROBP Zornitza Stark reviewed gene: TYROBP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, MIM# 221770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.65 ZFYVE26 Zornitza Stark Marked gene: ZFYVE26 as ready
Leukodystrophy - adult onset v0.65 ZFYVE26 Zornitza Stark Gene: zfyve26 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.65 ZFYVE26 Zornitza Stark reviewed gene: ZFYVE26: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 15, autosomal recessive, MIM# 270700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.65 POLR3B Zornitza Stark Marked gene: POLR3B as ready
Leukodystrophy - adult onset v0.65 POLR3B Zornitza Stark Gene: polr3b has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.65 POLR3B Zornitza Stark Publications for gene: POLR3B were set to
Leukodystrophy - adult onset v0.64 POLR3B Zornitza Stark reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 25339210; Phenotypes: Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, 614381; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.64 POLR3A Zornitza Stark Marked gene: POLR3A as ready
Leukodystrophy - adult onset v0.64 POLR3A Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.64 POLR3A Zornitza Stark Publications for gene: POLR3A were set to
Leukodystrophy - adult onset v0.63 POLR3A Zornitza Stark reviewed gene: POLR3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 31306222; Phenotypes: Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.63 POLR1C Zornitza Stark Marked gene: POLR1C as ready
Leukodystrophy - adult onset v0.63 POLR1C Zornitza Stark Gene: polr1c has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.63 POLR1C Zornitza Stark Phenotypes for gene: POLR1C were changed from Leukodystrophy, hypomyelinating, 11 to Leukodystrophy, hypomyelinating, 11, MIM# 616494
Leukodystrophy - adult onset v0.62 POLR1C Zornitza Stark Classified gene: POLR1C as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.62 POLR1C Zornitza Stark Gene: polr1c has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.61 POLR1C Zornitza Stark reviewed gene: POLR1C: Rating: AMBER; Mode of pathogenicity: None; Publications: 26151409, 32042905; Phenotypes: Leukodystrophy, hypomyelinating, 11, MIM# 616494; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.61 POLG2 Zornitza Stark Marked gene: POLG2 as ready
Leukodystrophy - adult onset v0.61 POLG2 Zornitza Stark Gene: polg2 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.61 POLG2 Zornitza Stark Classified gene: POLG2 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.61 POLG2 Zornitza Stark Gene: polg2 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.60 POLG2 Zornitza Stark reviewed gene: POLG2: Rating: AMBER; Mode of pathogenicity: None; Publications: 25655951; Phenotypes: ; Mode of inheritance: None
Leukodystrophy - adult onset v0.60 Bryony Thompson Panel types changed to Royal Melbourne Hospital; Rare Disease
Leukodystrophy - adult onset v0.59 POLG Zornitza Stark reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM# 613662; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.59 PLP1 Zornitza Stark Marked gene: PLP1 as ready
Leukodystrophy - adult onset v0.59 PLP1 Zornitza Stark Gene: plp1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.59 PLP1 Zornitza Stark Publications for gene: PLP1 were set to
Leukodystrophy - adult onset v0.58 PLP1 Zornitza Stark reviewed gene: PLP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16130097; Phenotypes: Pelizaeus-Merzbacher disease, MIM# 312080; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Leukodystrophy - adult onset v0.58 NOTCH3 Zornitza Stark Marked gene: NOTCH3 as ready
Leukodystrophy - adult onset v0.58 NOTCH3 Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.58 NOTCH3 Zornitza Stark Mode of inheritance for gene: NOTCH3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.57 NOTCH3 Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, MIM# 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.57 MLC1 Zornitza Stark Marked gene: MLC1 as ready
Leukodystrophy - adult onset v0.57 MLC1 Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.57 MLC1 Zornitza Stark Publications for gene: MLC1 were set to
Leukodystrophy - adult onset v0.56 MLC1 Zornitza Stark reviewed gene: MLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11254442, 21419380, 21624973; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts, MIM# 604004; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.56 MCOLN1 Zornitza Stark Marked gene: MCOLN1 as ready
Leukodystrophy - adult onset v0.56 MCOLN1 Zornitza Stark Gene: mcoln1 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.56 MCOLN1 Zornitza Stark Classified gene: MCOLN1 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.56 MCOLN1 Zornitza Stark Gene: mcoln1 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.55 MCOLN1 Zornitza Stark reviewed gene: MCOLN1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mucolipidosis IV, MIM# 252650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.55 L2HGDH Zornitza Stark Marked gene: L2HGDH as ready
Leukodystrophy - adult onset v0.55 L2HGDH Zornitza Stark Gene: l2hgdh has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.55 L2HGDH Zornitza Stark Publications for gene: L2HGDH were set to
Leukodystrophy - adult onset v0.54 L2HGDH Zornitza Stark reviewed gene: L2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 10399870; Phenotypes: L-2-hydroxyglutaric aciduria, MIM# 236792; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.54 HTRA1 Zornitza Stark Marked gene: HTRA1 as ready
Leukodystrophy - adult onset v0.54 HTRA1 Zornitza Stark Gene: htra1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.54 HTRA1 Zornitza Stark reviewed gene: HTRA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: CARASIL syndrome, MIM# 600142, Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, MIM# 616779; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.54 HEXA Zornitza Stark Marked gene: HEXA as ready
Leukodystrophy - adult onset v0.54 HEXA Zornitza Stark Gene: hexa has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.54 HEXA Zornitza Stark reviewed gene: HEXA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Tay-Sachs disease, MIM# 272800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.54 HEPACAM Zornitza Stark Marked gene: HEPACAM as ready
Leukodystrophy - adult onset v0.54 HEPACAM Zornitza Stark Gene: hepacam has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.54 HEPACAM Zornitza Stark Publications for gene: HEPACAM were set to
Leukodystrophy - adult onset v0.53 HEPACAM Zornitza Stark Mode of inheritance for gene: HEPACAM was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.52 HEPACAM Zornitza Stark reviewed gene: HEPACAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 21419380, 21419380; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts 2A, MIM# 613925, Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, MIM# 613926; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.52 GJC2 Zornitza Stark Marked gene: GJC2 as ready
Leukodystrophy - adult onset v0.52 GJC2 Zornitza Stark Gene: gjc2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.52 GJC2 Zornitza Stark reviewed gene: GJC2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 2, MIM# 608804; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.52 GJA1 Zornitza Stark Marked gene: GJA1 as ready
Leukodystrophy - adult onset v0.52 GJA1 Zornitza Stark Gene: gja1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.52 GJA1 Zornitza Stark Phenotypes for gene: GJA1 were changed from Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 to Hereditary spastic paraplegia; Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850
Leukodystrophy - adult onset v0.51 GJA1 Zornitza Stark Publications for gene: GJA1 were set to
Leukodystrophy - adult onset v0.50 GJA1 Zornitza Stark reviewed gene: GJA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31023660; Phenotypes: Hereditary spastic paraplegia, Oculodentodigital dysplasia, autosomal recessive, MIM#257850; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.50 GFAP Zornitza Stark Marked gene: GFAP as ready
Leukodystrophy - adult onset v0.50 GFAP Zornitza Stark Gene: gfap has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.50 GFAP Zornitza Stark reviewed gene: GFAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alexander disease, MIM# 203450; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.50 GALC Zornitza Stark Marked gene: GALC as ready
Leukodystrophy - adult onset v0.50 GALC Zornitza Stark Gene: galc has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.50 GALC Zornitza Stark reviewed gene: GALC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Krabbe disease, MIM# 245200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.50 EARS2 Zornitza Stark Marked gene: EARS2 as ready
Leukodystrophy - adult onset v0.50 EARS2 Zornitza Stark Gene: ears2 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.50 EARS2 Zornitza Stark Phenotypes for gene: EARS2 were changed from Combined oxidative phosphorylation deficiency 12, 614924 to Combined oxidative phosphorylation deficiency 12, 614924; Leukoencephalopathy with thalamus and brainstem involvement and high lactate
Leukodystrophy - adult onset v0.49 EARS2 Zornitza Stark Publications for gene: EARS2 were set to
Leukodystrophy - adult onset v0.48 EARS2 Zornitza Stark Classified gene: EARS2 as Red List (low evidence)
Leukodystrophy - adult onset v0.48 EARS2 Zornitza Stark Gene: ears2 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.47 EARS2 Zornitza Stark edited their review of gene: EARS2: Changed rating: RED
Leukodystrophy - adult onset v0.47 EARS2 Zornitza Stark reviewed gene: EARS2: Rating: ; Mode of pathogenicity: None; Publications: 22492562, 23008233, 25854774, 26619324, 26893310; Phenotypes: Combined oxidative phosphorylation deficiency 12, MIM# 614924, Leukoencephalopathy with thalamus and brainstem involvement and high lactate; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.47 DARS2 Zornitza Stark Marked gene: DARS2 as ready
Leukodystrophy - adult onset v0.47 DARS2 Zornitza Stark Gene: dars2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.47 DARS2 Zornitza Stark Publications for gene: DARS2 were set to
Leukodystrophy - adult onset v0.46 DARS2 Zornitza Stark reviewed gene: DARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17384640, 15002045, 16788019; Phenotypes: Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.46 DARS Zornitza Stark Marked gene: DARS as ready
Leukodystrophy - adult onset v0.46 DARS Zornitza Stark Gene: dars has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.46 DARS Zornitza Stark Publications for gene: DARS were set to
Leukodystrophy - adult onset v0.45 DARS Zornitza Stark Tag new gene name tag was added to gene: DARS.
Leukodystrophy - adult onset v0.45 DARS Zornitza Stark reviewed gene: DARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 25527264, 23643384; Phenotypes: Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.45 CLCN2 Zornitza Stark Marked gene: CLCN2 as ready
Leukodystrophy - adult onset v0.45 CLCN2 Zornitza Stark Gene: clcn2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.45 CLCN2 Zornitza Stark Publications for gene: CLCN2 were set to
Leukodystrophy - adult onset v0.44 CLCN2 Zornitza Stark reviewed gene: CLCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23707145; Phenotypes: Leukoencephalopathy with ataxia, MIM# 615651; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.44 ASPA Zornitza Stark Marked gene: ASPA as ready
Leukodystrophy - adult onset v0.44 ASPA Zornitza Stark Gene: aspa has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.44 ASPA Zornitza Stark Phenotypes for gene: ASPA were changed from 25655951; General Leukodystrophy & Mitochondrial Leukoencephalopathy to General Leukodystrophy & Mitochondrial Leukoencephalopathy; Canavan disease, MIM# 271900
Leukodystrophy - adult onset v0.43 ASPA Zornitza Stark Publications for gene: ASPA were set to
Leukodystrophy - adult onset v0.42 ASPA Zornitza Stark reviewed gene: ASPA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Canavan disease, MIM# 271900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.42 ARSA Zornitza Stark Marked gene: ARSA as ready
Leukodystrophy - adult onset v0.42 ARSA Zornitza Stark Gene: arsa has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.42 ARSA Zornitza Stark reviewed gene: ARSA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Metachromatic leukodystrophy, MIM# 250100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.42 ALDH3A2 Zornitza Stark Marked gene: ALDH3A2 as ready
Leukodystrophy - adult onset v0.42 ALDH3A2 Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.42 ALDH3A2 Zornitza Stark reviewed gene: ALDH3A2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sjogren-Larsson syndrome, MIM# 270200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.42 APOPT1 Zornitza Stark edited their review of gene: APOPT1: Changed rating: RED
Leukodystrophy - adult onset v0.42 APOPT1 Zornitza Stark Marked gene: APOPT1 as ready
Leukodystrophy - adult onset v0.42 APOPT1 Zornitza Stark Added comment: Comment when marking as ready: Moved to paediatric leukodystrophy panel.
Leukodystrophy - adult onset v0.42 APOPT1 Zornitza Stark Gene: apopt1 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.42 APOPT1 Zornitza Stark Classified gene: APOPT1 as Red List (low evidence)
Leukodystrophy - adult onset v0.42 APOPT1 Zornitza Stark Gene: apopt1 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.41 AUH Zornitza Stark Marked gene: AUH as ready
Leukodystrophy - adult onset v0.41 AUH Zornitza Stark Gene: auh has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.41 AUH Zornitza Stark Publications for gene: AUH were set to
Leukodystrophy - adult onset v0.40 CTSA Zornitza Stark Marked gene: CTSA as ready
Leukodystrophy - adult onset v0.40 CTSA Zornitza Stark Gene: ctsa has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.40 CYP7B1 Zornitza Stark Marked gene: CYP7B1 as ready
Leukodystrophy - adult onset v0.40 CYP7B1 Zornitza Stark Gene: cyp7b1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.40 EPRS Zornitza Stark Marked gene: EPRS as ready
Leukodystrophy - adult onset v0.40 EPRS Zornitza Stark Gene: eprs has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.40 EPRS Zornitza Stark Publications for gene: EPRS were set to
Leukodystrophy - adult onset v0.39 NPC1 Zornitza Stark Marked gene: NPC1 as ready
Leukodystrophy - adult onset v0.39 NPC1 Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.39 RPIA Zornitza Stark changed review comment from: Four unrelated individuals described to date.
Sources: Literature; to: Four unrelated individuals described to date, variable onset of leukodystrophy in childhood/adolescence, though other symptoms generally precede.
Sources: Literature
Leukodystrophy - adult onset v0.39 RPIA Zornitza Stark Marked gene: RPIA as ready
Leukodystrophy - adult onset v0.39 RPIA Zornitza Stark Gene: rpia has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.39 RPIA Zornitza Stark Publications for gene: RPIA were set to
Leukodystrophy - adult onset v0.38 SNORD118 Zornitza Stark changed review comment from: Over 30 families reported.; to: Over 30 families reported, age at presentation ranged between infancy and 54 years.
Leukodystrophy - adult onset v0.38 SNORD118 Zornitza Stark Publications for gene: SNORD118 were set to
Leukodystrophy - adult onset v0.37 SNORD118 Zornitza Stark Marked gene: SNORD118 as ready
Leukodystrophy - adult onset v0.37 SNORD118 Zornitza Stark Gene: snord118 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.37 SPG21 Zornitza Stark Marked gene: SPG21 as ready
Leukodystrophy - adult onset v0.37 SPG21 Zornitza Stark Gene: spg21 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.37 ATP7B Zornitza Stark Marked gene: ATP7B as ready
Leukodystrophy - adult onset v0.37 ATP7B Zornitza Stark Gene: atp7b has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.37 NPC2 Zornitza Stark Marked gene: NPC2 as ready
Leukodystrophy - adult onset v0.37 NPC2 Zornitza Stark Gene: npc2 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.37 RNF216 Zornitza Stark Marked gene: RNF216 as ready
Leukodystrophy - adult onset v0.37 RNF216 Zornitza Stark Gene: rnf216 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.37 SPAST Zornitza Stark Marked gene: SPAST as ready
Leukodystrophy - adult onset v0.37 SPAST Zornitza Stark Gene: spast has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.37 SPG7 Zornitza Stark Marked gene: SPG7 as ready
Leukodystrophy - adult onset v0.37 SPG7 Zornitza Stark Gene: spg7 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.37 TWNK Zornitza Stark Marked gene: TWNK as ready
Leukodystrophy - adult onset v0.37 TWNK Zornitza Stark Gene: twnk has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.37 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Leukodystrophy - adult onset v0.37 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.37 RPS6KA3 Zornitza Stark Publications for gene: RPS6KA3 were set to
Leukodystrophy - adult onset v0.36 STXBP2 Zornitza Stark Marked gene: STXBP2 as ready
Leukodystrophy - adult onset v0.36 STXBP2 Zornitza Stark Gene: stxbp2 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.36 UNC13D Zornitza Stark Marked gene: UNC13D as ready
Leukodystrophy - adult onset v0.36 UNC13D Zornitza Stark Gene: unc13d has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.36 TYMP Zornitza Stark Marked gene: TYMP as ready
Leukodystrophy - adult onset v0.36 TYMP Zornitza Stark Gene: tymp has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.36 TYMP Zornitza Stark Classified gene: TYMP as Green List (high evidence)
Leukodystrophy - adult onset v0.36 TYMP Zornitza Stark Gene: tymp has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.35 TYMP Zornitza Stark gene: TYMP was added
gene: TYMP was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: TYMP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TYMP were set to 9924029; 10852545
Phenotypes for gene: TYMP were set to Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM# 603041
Review for gene: TYMP was set to GREEN
Added comment: Onset between the second and fifth decades of life of ptosis, progressive external ophthalmoplegia (PEO), gastrointestinal dysmotility (often pseudoobstruction), cachexia, diffuse leukoencephalopathy, peripheral neuropathy, and mitochondrial dysfunction. Mitochondrial DNA abnormalities can include depletion, deletion, and point mutations.
Sources: Expert list
Leukodystrophy - adult onset v0.34 LMNB1 Zornitza Stark Marked gene: LMNB1 as ready
Leukodystrophy - adult onset v0.34 LMNB1 Zornitza Stark Gene: lmnb1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.34 LMNB1 Zornitza Stark Publications for gene: LMNB1 were set to
Leukodystrophy - adult onset v0.33 LMNB1 Zornitza Stark Tag SV/CNV tag was added to gene: LMNB1.
Leukodystrophy - adult onset v0.33 TREM2 Zornitza Stark edited their review of gene: TREM2: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.33 TREM2 Zornitza Stark Marked gene: TREM2 as ready
Leukodystrophy - adult onset v0.33 TREM2 Zornitza Stark Gene: trem2 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.33 TREM2 Zornitza Stark Publications for gene: TREM2 were set to
Leukodystrophy - adult onset v0.32 TREM2 Zornitza Stark reviewed gene: TREM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 12080485, 15883308; Phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.32 PTEN Zornitza Stark Marked gene: PTEN as ready
Leukodystrophy - adult onset v0.32 PTEN Zornitza Stark Gene: pten has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.32 PTEN Zornitza Stark Phenotypes for gene: PTEN were changed from to Cowden syndrome 1, MIM# 158350
Leukodystrophy - adult onset v0.31 PTEN Zornitza Stark reviewed gene: PTEN: Rating: GREEN; Mode of pathogenicity: None; Publications: 29152901; Phenotypes: Cowden syndrome 1, MIM# 158350; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.31 PAH Zornitza Stark Marked gene: PAH as ready
Leukodystrophy - adult onset v0.31 PAH Zornitza Stark Gene: pah has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.31 PAH Zornitza Stark Publications for gene: PAH were set to
Leukodystrophy - adult onset v0.30 PAH Zornitza Stark reviewed gene: PAH: Rating: GREEN; Mode of pathogenicity: None; Publications: 31636599, 32141105; Phenotypes: Phenylketonuria, MIM# 261600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.30 MTHFR Zornitza Stark Marked gene: MTHFR as ready
Leukodystrophy - adult onset v0.30 MTHFR Zornitza Stark Gene: mthfr has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.30 MTHFR Zornitza Stark Publications for gene: MTHFR were set to
Leukodystrophy - adult onset v0.29 MTHFR Zornitza Stark reviewed gene: MTHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 29391032; Phenotypes: Homocystinuria due to MTHFR deficiency, MIM# 236250; Mode of inheritance: None
Leukodystrophy - adult onset v0.29 MAN2B1 Zornitza Stark Marked gene: MAN2B1 as ready
Leukodystrophy - adult onset v0.29 MAN2B1 Zornitza Stark Gene: man2b1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.29 MAN2B1 Zornitza Stark reviewed gene: MAN2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mannosidosis, alpha-, types I and II, MIM# 248500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.29 GJB1 Zornitza Stark Marked gene: GJB1 as ready
Leukodystrophy - adult onset v0.29 GJB1 Zornitza Stark Gene: gjb1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.29 GJB1 Zornitza Stark Phenotypes for gene: GJB1 were changed from Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800 to Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800; Reversible posterior leukoencephalopathy
Leukodystrophy - adult onset v0.28 GJB1 Zornitza Stark Publications for gene: GJB1 were set to
Leukodystrophy - adult onset v0.27 GJB1 Zornitza Stark reviewed gene: GJB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31842800; Phenotypes: Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM# 302800; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Leukodystrophy - adult onset v0.27 AUH Zornitza Stark changed review comment from: Onset is typically in childhood, though presentation is variable so worth keeping on both paediatric and adult panels.; to: Onset is typically in childhood, though presentation is variable so worth keeping on both paediatric and adult panels. Specifically, two individuals with late onset disease including leukodystrophy reported.
Leukodystrophy - adult onset v0.27 AUH Zornitza Stark edited their review of gene: AUH: Changed publications: 20855850
Leukodystrophy - adult onset v0.27 GCDH Zornitza Stark Marked gene: GCDH as ready
Leukodystrophy - adult onset v0.27 GCDH Zornitza Stark Gene: gcdh has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.27 GCDH Zornitza Stark Phenotypes for gene: GCDH were changed from Glutaricaciduria, type I, MIM#231670 to Glutaric aciduria, type I, MIM#231670
Leukodystrophy - adult onset v0.26 GCDH Zornitza Stark Classified gene: GCDH as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.26 GCDH Zornitza Stark Gene: gcdh has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.25 GCDH Zornitza Stark reviewed gene: GCDH: Rating: AMBER; Mode of pathogenicity: None; Publications: 15985591; Phenotypes: Glutaric aciduria, type I 231670; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.25 GAN Zornitza Stark Marked gene: GAN as ready
Leukodystrophy - adult onset v0.25 GAN Zornitza Stark Gene: gan has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.25 GAN Zornitza Stark Classified gene: GAN as Red List (low evidence)
Leukodystrophy - adult onset v0.25 GAN Zornitza Stark Gene: gan has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.24 GAN Zornitza Stark reviewed gene: GAN: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Giant axonal neuropathy-1, MIM# 256850; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.24 DCAF17 Zornitza Stark Marked gene: DCAF17 as ready
Leukodystrophy - adult onset v0.24 DCAF17 Zornitza Stark Gene: dcaf17 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.24 DCAF17 Zornitza Stark reviewed gene: DCAF17: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Woodhouse-Sakati syndrome, MIM# 241080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.24 CTSA Zornitza Stark reviewed gene: CTSA: Rating: GREEN; Mode of pathogenicity: None; Publications: 31177426; Phenotypes: Cathepsin A-related arteriopathy with strokes and leukoencephalopathy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.24 CTC1 Zornitza Stark Marked gene: CTC1 as ready
Leukodystrophy - adult onset v0.24 CTC1 Zornitza Stark Gene: ctc1 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.24 CTC1 Zornitza Stark Publications for gene: CTC1 were set to
Leukodystrophy - adult onset v0.23 CTC1 Zornitza Stark Classified gene: CTC1 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.23 CTC1 Zornitza Stark Gene: ctc1 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.22 CTC1 Zornitza Stark reviewed gene: CTC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 22267198, 22387016, 22532422; Phenotypes: Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.22 COL4A2 Zornitza Stark Marked gene: COL4A2 as ready
Leukodystrophy - adult onset v0.22 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.22 COL4A2 Zornitza Stark Classified gene: COL4A2 as Red List (low evidence)
Leukodystrophy - adult onset v0.22 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.21 COL4A2 Zornitza Stark reviewed gene: COL4A2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Brain small vessel disease 2, MIM# 614483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.21 AUH Zornitza Stark reviewed gene: AUH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria, type I, MIM# 250950; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.21 APOPT1 Zornitza Stark reviewed gene: APOPT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25175347; Phenotypes: Mitochondrial complex IV deficiency, MIM# 220110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.21 RPS6KA3 Bryony Thompson edited their review of gene: RPS6KA3: Changed rating: RED
Leukodystrophy - adult onset v0.21 RPS6KA3 Bryony Thompson reviewed gene: RPS6KA3: Rating: ; Mode of pathogenicity: None; Publications: 16691578; Phenotypes: Coffin-Lowry syndrome MIM#303600; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Leukodystrophy - adult onset v0.21 RNF216 Bryony Thompson reviewed gene: RNF216: Rating: AMBER; Mode of pathogenicity: None; Publications: 28334938, 26250479; Phenotypes: Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy - adult onset v0.21 MARS Bryony Thompson Marked gene: MARS as ready
Leukodystrophy - adult onset v0.21 MARS Bryony Thompson Gene: mars has been classified as Red List (Low Evidence).
Leukodystrophy - adult onset v0.21 MARS Bryony Thompson Mode of inheritance for gene: MARS was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.20 MARS Bryony Thompson reviewed gene: MARS: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2U MIM#616280; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Leukodystrophy - adult onset v0.19 UNC13D Bryony Thompson gene: UNC13D was added
gene: UNC13D was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: UNC13D was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UNC13D were set to Hemophagocytic lymphohistiocytosis, familial, 3 608898
Review for gene: UNC13D was set to RED
Added comment: There is no clear evidence that leukodystrophy is a prominent feature of the condition caused by this gene.
Sources: Expert list
Leukodystrophy - adult onset v0.18 TWNK Bryony Thompson Classified gene: TWNK as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.18 TWNK Bryony Thompson Gene: twnk has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.17 TWNK Bryony Thompson gene: TWNK was added
gene: TWNK was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: TWNK was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: TWNK were set to 31455269; 19353676
Phenotypes for gene: TWNK were set to Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) 271245; Perrault syndrome 5 616138; Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 609286
Review for gene: TWNK was set to AMBER
Added comment: Two reports of white matter changes one in a woman diagnosed with PEO and an infant diagnosed with mitochondrial depletion syndrome.
Sources: Expert list
Leukodystrophy - adult onset v0.16 STXBP2 Bryony Thompson gene: STXBP2 was added
gene: STXBP2 was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: STXBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STXBP2 were set to Hemophagocytic lymphohistiocytosis, familial, 5 613101
Review for gene: STXBP2 was set to RED
Added comment: There is no clear evidence that leukodystrophy is a prominent feature of the condition associated with this gene.
Sources: Expert list
Leukodystrophy - adult onset v0.15 SPG7 Bryony Thompson Classified gene: SPG7 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.15 SPG7 Bryony Thompson Gene: spg7 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.14 SPG7 Bryony Thompson gene: SPG7 was added
gene: SPG7 was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: SPG7 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: SPG7 were set to 20108356; 17646629
Phenotypes for gene: SPG7 were set to Spastic paraplegia 7, autosomal recessive 607259
Review for gene: SPG7 was set to AMBER
Added comment: White matter abnormalities reported in two cases. It is unclear whether this is a prominent feature of the condition.
Sources: Expert list
Leukodystrophy - adult onset v0.13 SPG21 Bryony Thompson Classified gene: SPG21 as Green List (high evidence)
Leukodystrophy - adult onset v0.13 SPG21 Bryony Thompson Gene: spg21 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.12 SPG21 Bryony Thompson gene: SPG21 was added
gene: SPG21 was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: SPG21 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPG21 were set to 14564668
Phenotypes for gene: SPG21 were set to Mast syndrome 248900
Review for gene: SPG21 was set to GREEN
Added comment: Three patients reported with white matter abnormalities, diagnosed with Mast syndrome.
Sources: Expert list
Leukodystrophy - adult onset v0.11 SPAST Bryony Thompson Classified gene: SPAST as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.11 SPAST Bryony Thompson Gene: spast has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.10 SPAST Bryony Thompson reviewed gene: SPAST: Rating: AMBER; Mode of pathogenicity: None; Publications: 23968121; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Leukodystrophy - adult onset v0.10 SPAST Bryony Thompson Deleted their review
Leukodystrophy - adult onset v0.10 SPAST Bryony Thompson gene: SPAST was added
gene: SPAST was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: SPAST was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPAST were set to 23968121
Phenotypes for gene: SPAST were set to Spastic paraplegia 4, autosomal dominant 182601
Review for gene: SPAST was set to RED
Added comment: It is not clear that leukodystrophy is a prominent feature of the condition.
Sources: Expert list
Leukodystrophy - adult onset v0.9 NPC2 Bryony Thompson Classified gene: NPC2 as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.9 NPC2 Bryony Thompson Gene: npc2 has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.8 NPC2 Bryony Thompson gene: NPC2 was added
gene: NPC2 was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: NPC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NPC2 were set to 25396745
Phenotypes for gene: NPC2 were set to Niemann-pick disease, type C2 607625
Review for gene: NPC2 was set to AMBER
Added comment: White matter lesions associated with NPC1, but haven't been reported in association with NPC2 in humans. A cat with Niemann-pick and white matter degeneration identified during autopsy and a biallelic NPC2 variant.
Sources: Expert list
Leukodystrophy - adult onset v0.7 NPC1 Bryony Thompson Classified gene: NPC1 as Green List (high evidence)
Leukodystrophy - adult onset v0.7 NPC1 Bryony Thompson Gene: npc1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.6 NPC1 Bryony Thompson gene: NPC1 was added
gene: NPC1 was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: NPC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NPC1 were set to 26910362; 29406968
Phenotypes for gene: NPC1 were set to Niemann-Pick disease, type C1/D 257220
Review for gene: NPC1 was set to GREEN
Added comment: White matter lesions identified in MRI of 5/11 of Niemann-Pick patients (including adult-onset) and in an NPC mouse model.
Sources: Expert list
Leukodystrophy - adult onset v0.5 CYP7B1 Bryony Thompson Classified gene: CYP7B1 as Green List (high evidence)
Leukodystrophy - adult onset v0.5 CYP7B1 Bryony Thompson Gene: cyp7b1 has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.4 CYP7B1 Bryony Thompson gene: CYP7B1 was added
gene: CYP7B1 was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: CYP7B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CYP7B1 were set to 24117163; 19439420; 19187859
Phenotypes for gene: CYP7B1 were set to Spastic paraplegia 5A, autosomal recessive 270800
Review for gene: CYP7B1 was set to GREEN
Added comment: White matter lesions have been reported as a feature of the condition in >3 cases.
Sources: Expert list
Leukodystrophy - adult onset v0.3 ATP7B Bryony Thompson Classified gene: ATP7B as Amber List (moderate evidence)
Leukodystrophy - adult onset v0.3 ATP7B Bryony Thompson Gene: atp7b has been classified as Amber List (Moderate Evidence).
Leukodystrophy - adult onset v0.2 ATP7B Bryony Thompson gene: ATP7B was added
gene: ATP7B was added to Leukodystrophy - adult onset. Sources: Expert list
Mode of inheritance for gene: ATP7B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATP7B were set to 16966556; 12020274
Phenotypes for gene: ATP7B were set to Wilson disease, 277900
Review for gene: ATP7B was set to AMBER
Added comment: White matter changes have been reported in Wilson's disease, but it doesn't appear to be a common feature of the condition.
Sources: Expert list
Leukodystrophy - adult onset v0.1 Bryony Thompson Panel name changed from Leukodystrophy - adult onset_RMH to Leukodystrophy - adult onset
Panel status changed from internal to public
Leukodystrophy - adult onset v0.0 AUH Bryony Thompson gene: AUH was added
gene: AUH was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: AUH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AUH were set to 3-methylglutaconic aciduria, type I, MIM#250950
Leukodystrophy - adult onset v0.0 MAN2B1 Bryony Thompson gene: MAN2B1 was added
gene: MAN2B1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: MAN2B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MAN2B1 were set to Mannosidosis, alpha-, types I and II, MIM#248500
Leukodystrophy - adult onset v0.0 SLC17A5 Bryony Thompson gene: SLC17A5 was added
gene: SLC17A5 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: SLC17A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC17A5 were set to General Leukodystrophy & Mitochondrial Leukoencephalopathy
Leukodystrophy - adult onset v0.0 POLG2 Bryony Thompson gene: POLG2 was added
gene: POLG2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: POLG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: POLG2 were set to 25655951
Phenotypes for gene: POLG2 were set to Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4 610131
Leukodystrophy - adult onset v0.0 POLG Bryony Thompson gene: POLG was added
gene: POLG was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: POLG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLG were set to Mitochondrial DNA depletion syndrome 4B (MNGIE type) 613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459
Leukodystrophy - adult onset v0.0 MLC1 Bryony Thompson gene: MLC1 was added
gene: MLC1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: MLC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MLC1 were set to Megalencephalic leukoencephalopathy with subcortical cysts (MLC); General Leukodystrophy & Mitochondrial Leukoencephalopathy
Leukodystrophy - adult onset v0.0 ASPA Bryony Thompson gene: ASPA was added
gene: ASPA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: ASPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ASPA were set to 25655951; General Leukodystrophy & Mitochondrial Leukoencephalopathy
Leukodystrophy - adult onset v0.0 ZFYVE26 Bryony Thompson gene: ZFYVE26 was added
gene: ZFYVE26 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: ZFYVE26 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ZFYVE26 were set to Spastic paraplegia 15, autosomal recessive, 270700
Leukodystrophy - adult onset v0.0 TYROBP Bryony Thompson gene: TYROBP was added
gene: TYROBP was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: TYROBP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TYROBP were set to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, 221770
Leukodystrophy - adult onset v0.0 TUBB4A Bryony Thompson gene: TUBB4A was added
gene: TUBB4A was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: TUBB4A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: TUBB4A were set to Leukodystrophy, hypomyelinating, 6, 612438
Leukodystrophy - adult onset v0.0 TREX1 Bryony Thompson gene: TREX1 was added
gene: TREX1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: TREX1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: TREX1 were set to Aicardi-Goutieres syndrome 1, dominant and recessive, 225750; Vasculopathy, retinal, with cerebral leukodystrophy, 192315
Leukodystrophy - adult onset v0.0 TREM2 Bryony Thompson gene: TREM2 was added
gene: TREM2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: TREM2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TREM2 were set to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, 618193
Leukodystrophy - adult onset v0.0 SPG11 Bryony Thompson gene: SPG11 was added
gene: SPG11 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: SPG11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SPG11 were set to Charcot-Marie-Tooth disease, axonal, type 2X, 616668; Spastic paraplegia 11, autosomal recessive, MIM#604360
Leukodystrophy - adult onset v0.0 SNORD118 Bryony Thompson gene: SNORD118 was added
gene: SNORD118 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: SNORD118 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SNORD118 were set to 614561; Leukoencephalopathy, brain calcifications and cysts, 614561
Leukodystrophy - adult onset v0.0 SAMHD1 Bryony Thompson gene: SAMHD1 was added
gene: SAMHD1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: SAMHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SAMHD1 were set to Aicardi-Goutieres syndrome 5, 612952
Leukodystrophy - adult onset v0.0 RPS6KA3 Bryony Thompson gene: RPS6KA3 was added
gene: RPS6KA3 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Red,Royal Melbourne Hospital
Mode of inheritance for gene: RPS6KA3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: RPS6KA3 were set to Coffin-Lowry syndrome, 303600
Leukodystrophy - adult onset v0.0 RPIA Bryony Thompson gene: RPIA was added
gene: RPIA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: RPIA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RPIA were set to Ribose 5-phosphate isomerase deficiency, MIM#608611
Leukodystrophy - adult onset v0.0 RNF216 Bryony Thompson gene: RNF216 was added
gene: RNF216 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Amber,Royal Melbourne Hospital
Mode of inheritance for gene: RNF216 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF216 were set to 28334938; 26250479
Phenotypes for gene: RNF216 were set to Cerebellar ataxia and hypogonadotropic hypogonadism, 212840
Leukodystrophy - adult onset v0.0 RNASET2 Bryony Thompson gene: RNASET2 was added
gene: RNASET2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: RNASET2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASET2 were set to Leukoencephalopathy, cystic, without megalencephaly, 612951
Leukodystrophy - adult onset v0.0 RNASEH2C Bryony Thompson gene: RNASEH2C was added
gene: RNASEH2C was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: RNASEH2C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2C were set to Aicardi-Goutieres syndrome 3, 610329
Leukodystrophy - adult onset v0.0 RNASEH2B Bryony Thompson gene: RNASEH2B was added
gene: RNASEH2B was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: RNASEH2B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2B were set to Aicardi-Goutieres syndrome 2, 610181
Leukodystrophy - adult onset v0.0 RNASEH2A Bryony Thompson gene: RNASEH2A was added
gene: RNASEH2A was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: RNASEH2A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2A were set to Aicardi-Goutieres syndrome 4, 610333
Leukodystrophy - adult onset v0.0 PTEN Bryony Thompson gene: PTEN was added
gene: PTEN was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: PTEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PTEN were set to 29720545; 29152901; 30664625
Leukodystrophy - adult onset v0.0 PSAP Bryony Thompson gene: PSAP was added
gene: PSAP was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: PSAP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PSAP were set to Metachromatic leukodystrophy due to SAP-b deficiency, 249900; Krabbe disease, atypical, 611722
Leukodystrophy - adult onset v0.0 POLR3B Bryony Thompson gene: POLR3B was added
gene: POLR3B was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: POLR3B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLR3B were set to Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, 614381
Leukodystrophy - adult onset v0.0 POLR3A Bryony Thompson gene: POLR3A was added
gene: POLR3A was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: POLR3A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLR3A were set to Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, 607694
Leukodystrophy - adult onset v0.0 POLR1C Bryony Thompson gene: POLR1C was added
gene: POLR1C was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: POLR1C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLR1C were set to Leukodystrophy, hypomyelinating, 11
Leukodystrophy - adult onset v0.0 PLP1 Bryony Thompson gene: PLP1 was added
gene: PLP1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: PLP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PLP1 were set to Pelizaeus-Merzbacher disease, 312080
Leukodystrophy - adult onset v0.0 PAH Bryony Thompson gene: PAH was added
gene: PAH was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: PAH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PAH were set to Phenylketonuria, [Hyperphenylalaninemia, non-PKU mild], 261600
Leukodystrophy - adult onset v0.0 NOTCH3 Bryony Thompson gene: NOTCH3 was added
gene: NOTCH3 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: NOTCH3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: NOTCH3 were set to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, 125310
Leukodystrophy - adult onset v0.0 MTHFR Bryony Thompson gene: MTHFR was added
gene: MTHFR was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: MTHFR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTHFR were set to Homocystinuria due to MTHFR deficiency, 236250
Leukodystrophy - adult onset v0.0 MCOLN1 Bryony Thompson gene: MCOLN1 was added
gene: MCOLN1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: MCOLN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCOLN1 were set to Mucolipidosis IV, 252650
Leukodystrophy - adult onset v0.0 MARS Bryony Thompson gene: MARS was added
gene: MARS was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Red,Royal Melbourne Hospital
Mode of inheritance for gene: MARS was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: MARS were set to Charcot-Marie-Tooth disease, axonal, type 2U, 616280
Leukodystrophy - adult onset v0.0 LMNB1 Bryony Thompson gene: LMNB1 was added
gene: LMNB1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: LMNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: LMNB1 were set to Leukodystrophy, adult-onset, autosomal dominant, 169500
Leukodystrophy - adult onset v0.0 L2HGDH Bryony Thompson gene: L2HGDH was added
gene: L2HGDH was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: L2HGDH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: L2HGDH were set to L-2-hydroxyglutaric aciduria, 236792
Leukodystrophy - adult onset v0.0 HTRA1 Bryony Thompson gene: HTRA1 was added
gene: HTRA1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: HTRA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: HTRA1 were set to Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, 616779; CARASIL syndrome, 600142
Leukodystrophy - adult onset v0.0 HEXA Bryony Thompson gene: HEXA was added
gene: HEXA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: HEXA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HEXA were set to GM2-gangliosidosis, several forms, Tay-Sachs disease, [Hex A pseudodeficiency], 272800
Leukodystrophy - adult onset v0.0 HEPACAM Bryony Thompson gene: HEPACAM was added
gene: HEPACAM was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: HEPACAM was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: HEPACAM were set to Megalencephalic leukoencephalopathy with subcortical cysts 2A, 613925; Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, 613926
Leukodystrophy - adult onset v0.0 GLB1 Bryony Thompson gene: GLB1 was added
gene: GLB1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GLB1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLB1 were set to GM1-gangliosidosis, type III, MIM#230650; white matter abnormality
Leukodystrophy - adult onset v0.0 GLA Bryony Thompson gene: GLA was added
gene: GLA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GLA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GLA were set to Fabry disease, Fabry disease, cardiac variant, 301500
Leukodystrophy - adult onset v0.0 GJC2 Bryony Thompson gene: GJC2 was added
gene: GJC2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GJC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GJC2 were set to Leukodystrophy, hypomyelinating, 2, 608804,
Leukodystrophy - adult onset v0.0 GJB1 Bryony Thompson gene: GJB1 was added
gene: GJB1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GJB1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GJB1 were set to Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800
Leukodystrophy - adult onset v0.0 GJA1 Bryony Thompson gene: GJA1 was added
gene: GJA1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GJA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: GJA1 were set to Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850
Leukodystrophy - adult onset v0.0 GFAP Bryony Thompson gene: GFAP was added
gene: GFAP was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GFAP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: GFAP were set to Alexander disease, 203450
Leukodystrophy - adult onset v0.0 GCDH Bryony Thompson gene: GCDH was added
gene: GCDH was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GCDH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GCDH were set to Glutaricaciduria, type I, MIM#231670
Leukodystrophy - adult onset v0.0 GBE1 Bryony Thompson gene: GBE1 was added
gene: GBE1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GBE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GBE1 were set to Polyglucosan body disease, adult form, 263570
Leukodystrophy - adult onset v0.0 GAN Bryony Thompson gene: GAN was added
gene: GAN was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GAN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GAN were set to Giant axonal neuropathy-1, MIM#256850
Leukodystrophy - adult onset v0.0 GALC Bryony Thompson gene: GALC was added
gene: GALC was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: GALC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GALC were set to Krabbe disease, 245200
Leukodystrophy - adult onset v0.0 EPRS Bryony Thompson gene: EPRS was added
gene: EPRS was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: EPRS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EPRS were set to Leukodystrophy, hypomyelinating, 15, MIM#617951
Leukodystrophy - adult onset v0.0 EIF2B5 Bryony Thompson gene: EIF2B5 was added
gene: EIF2B5 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: EIF2B5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EIF2B5 were set to Leukoencephalopathy with vanishing white matter, 603896
Leukodystrophy - adult onset v0.0 EIF2B4 Bryony Thompson gene: EIF2B4 was added
gene: EIF2B4 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: EIF2B4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EIF2B4 were set to Leukoencephalopathy with vanishing white matter, 603896
Leukodystrophy - adult onset v0.0 EIF2B3 Bryony Thompson gene: EIF2B3 was added
gene: EIF2B3 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: EIF2B3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EIF2B3 were set to Leukoencephalopathy with vanishing white matter, 603896
Leukodystrophy - adult onset v0.0 EIF2B2 Bryony Thompson gene: EIF2B2 was added
gene: EIF2B2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: EIF2B2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EIF2B2 were set to Leukoencephalopathy with vanishing white matter, Ovarioleukodystrophy, 603896
Leukodystrophy - adult onset v0.0 EIF2B1 Bryony Thompson gene: EIF2B1 was added
gene: EIF2B1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: EIF2B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EIF2B1 were set to Leukoencephalopathy with vanishing white matter, 603896
Leukodystrophy - adult onset v0.0 EARS2 Bryony Thompson gene: EARS2 was added
gene: EARS2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: EARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EARS2 were set to Combined oxidative phosphorylation deficiency 12, 614924
Leukodystrophy - adult onset v0.0 DCAF17 Bryony Thompson gene: DCAF17 was added
gene: DCAF17 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: DCAF17 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DCAF17 were set to 31347785
Phenotypes for gene: DCAF17 were set to Woodhouse-Sakati syndrome, MIM#241080
Leukodystrophy - adult onset v0.0 DARS2 Bryony Thompson gene: DARS2 was added
gene: DARS2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: DARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DARS2 were set to Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105
Leukodystrophy - adult onset v0.0 DARS Bryony Thompson gene: DARS was added
gene: DARS was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: DARS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DARS were set to Hypomyelination with brainstem and spinal cord involvement and leg spasticity, 615281
Leukodystrophy - adult onset v0.0 CYP27A1 Bryony Thompson gene: CYP27A1 was added
gene: CYP27A1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: CYP27A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP27A1 were set to Cerebrotendinous xanthomatosis, 213700
Leukodystrophy - adult onset v0.0 CTSA Bryony Thompson gene: CTSA was added
gene: CTSA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: CTSA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CTSA were set to 31177426
Phenotypes for gene: CTSA were set to Cathepsin-A-related arteriopathy with strokes and leukoencephalopathy
Leukodystrophy - adult onset v0.0 CTC1 Bryony Thompson gene: CTC1 was added
gene: CTC1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: CTC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CTC1 were set to Cerebroretinal microangiopathy with calcifications and cysts, 612199
Leukodystrophy - adult onset v0.0 CSF1R Bryony Thompson gene: CSF1R was added
gene: CSF1R was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: CSF1R was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: CSF1R were set to Leukoencephalopathy, diffuse hereditary, with spheroids, 221820
Leukodystrophy - adult onset v0.0 COL4A2 Bryony Thompson gene: COL4A2 was added
gene: COL4A2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: COL4A2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: COL4A2 were set to 30413629; 27624120; 24390199
Phenotypes for gene: COL4A2 were set to Brain small vessel disease 2, 614483
Leukodystrophy - adult onset v0.0 COL4A1 Bryony Thompson gene: COL4A1 was added
gene: COL4A1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: COL4A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: COL4A1 were set to Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, 611773; Brain small vessel disease with or without ocular anomalies, 175780
Leukodystrophy - adult onset v0.0 APOPT1 Bryony Thompson gene: APOPT1 was added
gene: APOPT1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: APOPT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: APOPT1 were set to Mitochondrial complex IV deficiency, MIM#220110
Leukodystrophy - adult onset v0.0 CLCN2 Bryony Thompson gene: CLCN2 was added
gene: CLCN2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: CLCN2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLCN2 were set to Leukoencephalopathy with ataxia, 615651
Leukodystrophy - adult onset v0.0 ARSA Bryony Thompson gene: ARSA was added
gene: ARSA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: ARSA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ARSA were set to Metachromatic leukodystrophy, 250100
Leukodystrophy - adult onset v0.0 ALDH3A2 Bryony Thompson gene: ALDH3A2 was added
gene: ALDH3A2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: ALDH3A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDH3A2 were set to Sjogren-Larsson syndrome, 270200
Leukodystrophy - adult onset v0.0 ADAR Bryony Thompson gene: ADAR was added
gene: ADAR was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: ADAR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAR were set to Aicardi-Goutieres syndrome 6, 615010
Leukodystrophy - adult onset v0.0 ABCD1 Bryony Thompson gene: ABCD1 was added
gene: ABCD1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: ABCD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ABCD1 were set to Adrenoleukodystrophy, Adrenomyeloneuropathy, adult, 300100
Leukodystrophy - adult onset v0.0 AARS2 Bryony Thompson gene: AARS2 was added
gene: AARS2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital
Mode of inheritance for gene: AARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AARS2 were set to Leukoencephalopathy, progressive, with ovarian failure, 615889
Leukodystrophy - adult onset v0.0 Bryony Thompson Added panel Leukodystrophy - adult onset_RMH