| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Leukodystrophy - adult onset v0.153 | LAMB1 | Zornitza Stark Phenotypes for gene: LAMB1 were changed from Leukodystrophy, MONDO:0019046, LAMB1-related; Retinal Vascular Abnormality; mild intellectual disability; white matter lesions; lower limb spasticity to Leukoencephalopathy, adult-onset, MIM# 621424 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.152 | CTSA | Zornitza Stark Phenotypes for gene: CTSA were changed from Cathepsin-A-related arteriopathy with strokes and leukoencephalopathy to Brain small vessel disease 6 with leukoencephalopathy, MIM# 621394 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.151 | CTSA | Zornitza Stark edited their review of gene: CTSA: Changed phenotypes: Brain small vessel disease 6 with leukoencephalopathy, MIM# 621394 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.151 | ZNF319 | Zornitza Stark Marked gene: ZNF319 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.151 | ZNF319 | Zornitza Stark Gene: znf319 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.151 | ZNF319 |
Zornitza Stark gene: ZNF319 was added gene: ZNF319 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: ZNF319 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF319 were set to 40820230 Phenotypes for gene: ZNF319 were set to Leukodystrophy, MONDO:0019046, ZNF319-related Review for gene: ZNF319 was set to RED Added comment: Single individual with homozygous missense variant reported, p.Phe267Ser. 18-year-old male presenting with spasticity, ataxia, cognitive decline, and white matter abnormalities on MRI. Molecular dynamics simulations revealed that F267 is a stabilizing residue within a β-strand of the zinc finger domain, forming π-stacking and hydrophobic interactions that are lost upon substitution with serine, leading to structural instability, increased flexibility, and protein unfolding. Despite normal transcript and protein expression, ZNF319-F267S mislocalized to the cytoplasm due to disruption of its bipartite nuclear localization signal (NLS), resulting in impaired interaction with importin α1 (KPNA1). Functional analysis confirmed that the variant disrupts nuclear transport and prevents transcriptional activation of genes involved in myelination. Protein interaction network and gene ontology analysis highlighted ZNF319's role in transcriptional regulation and its localization in the CHOP-C/EBP transcriptional complex. Expression profiling demonstrated ZNF319 enrichment in oligodendrocytes and white matter regions, correlating with the observed leukoencephalopathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.150 | C1R | Zornitza Stark Classified gene: C1R as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.150 | C1R | Zornitza Stark Gene: c1r has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.149 | C1R | Leah Frajman reviewed gene: C1R: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 37323685; Phenotypes: Ehlers-Danlos syndrome, periodontal type, 1 MIM#130080, leukoencephalopathy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.149 | NOTCH2NLC_NIID_GGC | Bryony Thompson Gene: NOTCH2NL was changed to NOTCH2NLC. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.148 | CST3 | Zornitza Stark Phenotypes for gene: CST3 were changed from leukodystrophy MONDO:0019046 to Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.147 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.146 | C9orf72_FTDALS_GGGGCC | Bryony Thompson Marked STR: C9orf72_FTDALS_GGGGCC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.146 | C9orf72_FTDALS_GGGGCC | Bryony Thompson Str: c9orf72_ftdals_ggggcc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.146 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.145 | PRNP_CJD_octapeptide | Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.145 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.145 | PRNP_CJD_octapeptide | Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.145 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.144 | PRNP_CJD_octapeptide |
Bryony Thompson STR: PRNP_CJD_octapeptide was added STR: PRNP_CJD_octapeptide was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407 Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP_CJD_octapeptide was set to GREEN STR: PRNP_CJD_octapeptide was marked as clinically relevant STR: PRNP_CJD_octapeptide was marked as current diagnostic Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.143 | SNORD118 | Zornitza Stark Tag non-coding gene tag was added to gene: SNORD118. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.143 | LMNB1 | Zornitza Stark Phenotypes for gene: LMNB1 were changed from Leukodystrophy, adult-onset, autosomal dominant, 169500 to Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500; Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.142 | LMNB1 | Zornitza Stark Mode of inheritance for gene: LMNB1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.141 | LMNB1 | Zornitza Stark edited their review of gene: LMNB1: Changed phenotypes: Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500, Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.141 | LAMB1 | Zornitza Stark Phenotypes for gene: LAMB1 were changed from Retinal Vascular Abnormality; mild intellectual disability; white matter lesions; lower limb spasticity to Leukodystrophy, MONDO:0019046, LAMB1-related; Retinal Vascular Abnormality; mild intellectual disability; white matter lesions; lower limb spasticity | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.140 | NOTCH3 | Ain Roesley Phenotypes for gene: NOTCH3 were changed from neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310 to neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.139 | NOTCH3 | Ain Roesley Phenotypes for gene: NOTCH3 were changed from Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, 125310 to neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.138 | NOTCH3 | Ain Roesley Mode of inheritance for gene: NOTCH3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.137 | NOTCH3 | Ain Roesley reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder MONDO:0700092, NOTCH3-related, Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.137 | PRNP | Bryony Thompson Marked gene: PRNP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.137 | PRNP | Bryony Thompson Gene: prnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.137 | PRNP | Bryony Thompson Classified gene: PRNP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.137 | PRNP | Bryony Thompson Gene: prnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.136 | PRNP |
Bryony Thompson gene: PRNP was added gene: PRNP was added to Leukodystrophy - adult onset. Sources: Other Mode of inheritance for gene: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRNP were set to 25220284; 24252267 Phenotypes for gene: PRNP were set to fatal familial insomnia MONDO:0010808 Mode of pathogenicity for gene: PRNP was set to Other Review for gene: PRNP was set to GREEN gene: PRNP was marked as current diagnostic Added comment: White-matter abnormalities have been reported in inherited prion diseases Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.135 | ITM2B | Bryony Thompson Marked gene: ITM2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.135 | ITM2B | Bryony Thompson Gene: itm2b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.135 | ITM2B | Bryony Thompson Classified gene: ITM2B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.135 | ITM2B | Bryony Thompson Gene: itm2b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.134 | ITM2B |
Bryony Thompson gene: ITM2B was added gene: ITM2B was added to Leukodystrophy - adult onset. Sources: Other Mode of inheritance for gene: ITM2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ITM2B were set to 10775542 Phenotypes for gene: ITM2B were set to ABri amyloidosis MONDO:0008306 Mode of pathogenicity for gene: ITM2B was set to Other Review for gene: ITM2B was set to AMBER Added comment: White matter abnormalities have been reported in 11 at-risk individuals from the original large family reported. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.133 | CST3 | Bryony Thompson Marked gene: CST3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.133 | CST3 | Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.133 | CST3 | Bryony Thompson Classified gene: CST3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.133 | CST3 | Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.132 | CST3 |
Bryony Thompson gene: CST3 was added gene: CST3 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: CST3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CST3 were set to 38489591 Phenotypes for gene: CST3 were set to leukodystrophy MONDO:0019046 Review for gene: CST3 was set to GREEN Added comment: 16 patients from 8 leukodystrophy families carrying one of four different stop-gain or frameshift dominant variants in the C-terminal (in the NMD-exclusion zone) of the CST3 gene. The suggested mechanism of disease by rendering the protein more prone to aggregation. The clinical phenotype consists of recurrent episodes of hemiplegic migraine associated with transient unilateral focal deficits and slowly progressing motor symptoms and cognitive decline in mid-old adult ages. Clinical & radiological features differ from Cerebral Amyloid Angiopathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.131 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.131 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.130 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 36970046; 36632182 Phenotypes for STR: FTDALS were set to frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MONDO:0007105 Penetrance for STR: FTDALS were set to Incomplete Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant STR: FTDALS was marked as current diagnostic Added comment: Expansion carriers showed widespread white-matter abnormalities in the brain Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.129 | MAPT | Bryony Thompson Marked gene: MAPT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.129 | MAPT | Bryony Thompson Gene: mapt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.129 | MAPT | Bryony Thompson Classified gene: MAPT as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.129 | MAPT | Bryony Thompson Gene: mapt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.128 | MAPT |
Bryony Thompson gene: MAPT was added gene: MAPT was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: MAPT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAPT were set to 33802612; 36970046 Phenotypes for gene: MAPT were set to semantic dementia MONDO:0010857 Mode of pathogenicity for gene: MAPT was set to Other Review for gene: MAPT was set to GREEN gene: MAPT was marked as current diagnostic Added comment: White-matter abnormalities have been reported in symptomatic and pre-symptomatic carriers of MAPT pathogenic variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.127 | GRN | Bryony Thompson Marked gene: GRN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.127 | GRN | Bryony Thompson Gene: grn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.127 | GRN | Bryony Thompson Classified gene: GRN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.127 | GRN | Bryony Thompson Gene: grn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.126 | GRN |
Bryony Thompson gene: GRN was added gene: GRN was added to Leukodystrophy - adult onset. Sources: Other Mode of inheritance for gene: GRN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GRN were set to 36970046; 36632182 Phenotypes for gene: GRN were set to GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842 Review for gene: GRN was set to GREEN gene: GRN was marked as current diagnostic Added comment: White matter abnormalities have been reported in presymptomatic carriers and affected carriers. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.125 | PSEN2 | Bryony Thompson Marked gene: PSEN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.125 | PSEN2 | Bryony Thompson Gene: psen2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.125 | PSEN2 | Bryony Thompson Classified gene: PSEN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.125 | PSEN2 | Bryony Thompson Gene: psen2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.124 | PSEN2 |
Bryony Thompson gene: PSEN2 was added gene: PSEN2 was added to Leukodystrophy - adult onset. Sources: Other Mode of inheritance for gene: PSEN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PSEN2 were set to 36845656 Phenotypes for gene: PSEN2 were set to early-onset autosomal dominant Alzheimer disease MONDO:0015140 Mode of pathogenicity for gene: PSEN2 was set to Other Review for gene: PSEN2 was set to GREEN gene: PSEN2 was marked as current diagnostic Added comment: White matter abnormalities are a common feature of Alzheimer's disease Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.123 | PSEN1 | Bryony Thompson Marked gene: PSEN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.123 | PSEN1 | Bryony Thompson Gene: psen1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.123 | PSEN1 | Bryony Thompson Classified gene: PSEN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.123 | PSEN1 | Bryony Thompson Gene: psen1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.122 | PSEN1 |
Bryony Thompson gene: PSEN1 was added gene: PSEN1 was added to Leukodystrophy - adult onset. Sources: Other Mode of inheritance for gene: PSEN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PSEN1 were set to 36845656 Phenotypes for gene: PSEN1 were set to early-onset autosomal dominant Alzheimer disease MONDO:0015140 Mode of pathogenicity for gene: PSEN1 was set to Other Review for gene: PSEN1 was set to GREEN gene: PSEN1 was marked as current diagnostic Added comment: White matter abnormalities are a common feature of Alzheimer's disease Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.121 | APP | Bryony Thompson Marked gene: APP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.121 | APP | Bryony Thompson Gene: app has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.121 | APP | Bryony Thompson Classified gene: APP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.121 | APP | Bryony Thompson Gene: app has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.120 | APP |
Bryony Thompson gene: APP was added gene: APP was added to Leukodystrophy - adult onset. Sources: Other Mode of inheritance for gene: APP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: APP were set to 36845656 Phenotypes for gene: APP were set to early-onset autosomal dominant Alzheimer disease MONDO:0015140 Review for gene: APP was set to GREEN gene: APP was marked as current diagnostic Added comment: White matter abnormalities are a common feature of Alzheimer's disease Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.119 | TPP2 | Zornitza Stark Mode of inheritance for gene: TPP2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.118 | TPP2 | Zornitza Stark edited their review of gene: TPP2: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.118 | EIF2B5 | Zornitza Stark Marked gene: EIF2B5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.118 | EIF2B5 | Zornitza Stark Gene: eif2b5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.118 | EIF2B5 | Zornitza Stark Publications for gene: EIF2B5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.117 | EIF2B4 | Zornitza Stark Marked gene: EIF2B4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.117 | EIF2B4 | Zornitza Stark Gene: eif2b4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.117 | EIF2B4 | Zornitza Stark Phenotypes for gene: EIF2B4 were changed from Leukoencephalopathy with vanishing white matter, 603896 to Leukoencephalopathy with vanishing white matter, MIM#603896, MONDO:0011380 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.116 | EIF2B4 | Zornitza Stark Publications for gene: EIF2B4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.115 | EIF2B3 | Zornitza Stark Marked gene: EIF2B3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.115 | EIF2B3 | Zornitza Stark Gene: eif2b3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.115 | EIF2B3 | Zornitza Stark Phenotypes for gene: EIF2B3 were changed from Leukoencephalopathy with vanishing white matter, 603896 to Leukoencephalopathy with vanishing white matter, MIM#603896, MONDO:0011380 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.114 | EIF2B3 | Zornitza Stark Publications for gene: EIF2B3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.113 | EIF2B2 | Zornitza Stark Marked gene: EIF2B2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.113 | EIF2B2 | Zornitza Stark Gene: eif2b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.113 | EIF2B2 | Zornitza Stark Phenotypes for gene: EIF2B2 were changed from Leukoencephalopathy with vanishing white matter, Ovarioleukodystrophy, 603896 to Leukoencephalopathy with vanishing white matter MONDO:0011380 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.112 | EIF2B2 | Zornitza Stark Publications for gene: EIF2B2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.111 | EIF2B1 | Zornitza Stark Marked gene: EIF2B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.111 | EIF2B1 | Zornitza Stark Gene: eif2b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.111 | EIF2B1 | Zornitza Stark Publications for gene: EIF2B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.110 | PSAP | Zornitza Stark Marked gene: PSAP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.110 | PSAP | Zornitza Stark Gene: psap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.110 | PSAP | Zornitza Stark Publications for gene: PSAP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | EIF2B5 | Kaitlyn Dianna Weldon reviewed gene: EIF2B5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | EIF2B4 | Kaitlyn Dianna Weldon reviewed gene: EIF2B4: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | EIF2B3 | Kaitlyn Dianna Weldon reviewed gene: EIF2B3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | EIF2B2 | Kaitlyn Dianna Weldon reviewed gene: EIF2B2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | EIF2B1 | Kaitlyn Dianna Weldon reviewed gene: EIF2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301435; Phenotypes: leukoencephalopathy with vanishing white matter MONDO:0011380; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | PSAP | Kaitlyn Dianna Weldon edited their review of gene: PSAP: Added comment: This is a well established leukodystrophy gene; Changed phenotypes: metachromatic leukodystrophy due to saposin B deficiency MONDO:0009590 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | PSAP | Kaitlyn Dianna Weldon reviewed gene: PSAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 26462614; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | SLC17A5 | Kaitlyn Dianna Weldon reviewed gene: SLC17A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301643; Phenotypes: Salla disease MONDO:0011449; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | RNASEH2C | Kaitlyn Dianna Weldon reviewed gene: RNASEH2C: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301648; Phenotypes: Aicardi-Goutieres syndrome 2 MONDO:0012471; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | RNASEH2B | Kaitlyn Dianna Weldon reviewed gene: RNASEH2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301648; Phenotypes: Aicardi-Goutieres syndrome 4 MONDO:0012472; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | RNASEH2A | Kaitlyn Dianna Weldon reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301648; Phenotypes: Aicardi-Goutieres syndrome 4 MONDO:0012472; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | GLB1 | Kaitlyn Dianna Weldon reviewed gene: GLB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24156116; Phenotypes: GM1 gangliosidosis type 3 MONDO:0009262; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | GBE1 | Kaitlyn Dianna Weldon reviewed gene: GBE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301758; Phenotypes: adult polyglucosan body disease MONDO:0009897; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | GLA | Claire Fryer-Smith reviewed gene: GLA: Rating: GREEN; Mode of pathogenicity: None; Publications: 30757954, 12786754, 15924232, 31200018, 31519519; Phenotypes: Fabry disease (MIM# 301500); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | CYP27A1 | Kaitlyn Dianna Weldon reviewed gene: CYP27A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301583; Phenotypes: cerebrotendinous xanthomatosis MONDO:0008948; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | CSF1R | Kaitlyn Dianna Weldon reviewed gene: CSF1R: Rating: GREEN; Mode of pathogenicity: None; Publications: 22934315; Phenotypes: brain abnormalities, neurodegeneration, and dysosteosclerosis MONDO:0032772; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | COL4A1 | Kaitlyn Dianna Weldon reviewed gene: COL4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301768; Phenotypes: brain small vessel disease 1 with or without ocular anomalies MONDO:0008289; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | ADAR | Kaitlyn Dianna Weldon reviewed gene: ADAR: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301648; Phenotypes: Aicardi-Goutieres syndrome 6 MONDO:0014007; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | ABCD1 | Kaitlyn Dianna Weldon reviewed gene: ABCD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301491; Phenotypes: adrenoleukodystrophy MONDO:0018544, X-linked cerebral adrenoleukodystrophy MONDO:0010247; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | AARS2 | Kaitlyn Dianna Weldon reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34285876, 35084689; Phenotypes: leukodystrophy MONDO:0019046; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | ACTA2 | Bryony Thompson Marked gene: ACTA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | ACTA2 | Bryony Thompson Gene: acta2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | ACTA2 | Bryony Thompson Classified gene: ACTA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.109 | ACTA2 | Bryony Thompson Gene: acta2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.108 | ACTA2 |
Bryony Thompson gene: ACTA2 was added gene: ACTA2 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: ACTA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ACTA2 were set to 29300374 Phenotypes for gene: ACTA2 were set to multisystemic smooth muscle dysfunction syndrome MONDO:0013452 Mode of pathogenicity for gene: ACTA2 was set to Other Review for gene: ACTA2 was set to GREEN gene: ACTA2 was marked as current diagnostic Added comment: Hyperintense periventricular white matter lesions were present in 95% (21/22) of smooth muscle dysfunction syndrome cases with missense variants involving Arg179. Age of diagnosis varied from infancy to adulthood. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.107 | PLD3 | Bryony Thompson Classified gene: PLD3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.107 | PLD3 | Bryony Thompson Gene: pld3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.106 | PLD3 |
Tegan French gene: PLD3 was added gene: PLD3 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: PLD3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLD3 were set to PMID: 34267643 Phenotypes for gene: PLD3 were set to Leukodystrophy Review for gene: PLD3 was set to AMBER Added comment: Unconfirmed gene-disease association for biallelic LOF variants in PLD3 and leukodystrophy. - Single patient in literature with homozygous frameshift nonsense variants in PLD3. This patient had leukodystrophy, vision and hearing impairment, impaired kidney function. - Homozygous frameshift nonsense variants in another unpublished patient with leukodystrophy Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.106 | Zornitza Stark List of related panels changed from to Leukodystrophy; HP:0002415; Abnormal cerebral white matter morphology; HP:0002500; Abnormal CNS myelination; HP:0011400 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.105 | PAH | Zornitza Stark Tag treatable tag was added to gene: PAH. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.105 | C1R | Zornitza Stark Marked gene: C1R as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.105 | C1R | Zornitza Stark Gene: c1r has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.105 | C1R | Zornitza Stark Classified gene: C1R as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.105 | C1R | Zornitza Stark Gene: c1r has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.104 | ARSA |
Zornitza Stark Tag treatable tag was added to gene: ARSA. Tag clinical trial tag was added to gene: ARSA. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.104 | C1R |
Deepak Subramanian gene: C1R was added gene: C1R was added to Leukodystrophy - adult onset. Sources: Literature,Other Mode of inheritance for gene: C1R was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: C1R were set to 8958339; 30535813 Phenotypes for gene: C1R were set to Ehlers-Danlos syndrome, periodontal type, 1 (MIM# 130080); Leukodystrophy - adult onset Penetrance for gene: C1R were set to unknown Mode of pathogenicity for gene: C1R was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: C1R was set to AMBER Added comment: Classic periodontal EDS (pEDS) phenotype is associated with gain-of-function mutations in this gene (Kapferer-Seebacher, van Dijk, and Zschocke, GeneReviews, 2021). Earlier case reports noted the presence of leukodystrophy in one 37-year-old female with clinically-diagnosed pEDS (PMID: 8958339) and eight adult individuals from two families with heterozygous mutations in C1R (PMID: 30535813), where other causes of leukodystrophy were ruled out or considered unlikely. Recent data presented at the 2022 EDS International Scientific Symposium by Angwin et al (Oral Abstract 91) highlighted nine more adults with clinically and molecularly confirmed pEDS with evidence of leukodystrophy (out of ten such patients with available imaging). Nearly all patients reported to date have no cognitive deficits or other neurological features of leukodystrophy, with only isolated cases of recurrent headaches/drop attacks or mild cognitive decline/ataxia that might have a different aetiology. Pathophysiology is thought to result from underlying small vessel disease (similar in pattern to that of CADASIL) which progresses with age and is disproportionate to the observed neurological phenotype in these individuals. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.104 | NOTCH1 | Zornitza Stark Marked gene: NOTCH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.104 | NOTCH1 | Zornitza Stark Gene: notch1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.104 | NOTCH1 | Zornitza Stark Classified gene: NOTCH1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.104 | NOTCH1 | Zornitza Stark Gene: notch1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.103 | NOTCH1 |
Chern Lim gene: NOTCH1 was added gene: NOTCH1 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NOTCH1 were set to 35947102 Phenotypes for gene: NOTCH1 were set to Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related Mode of pathogenicity for gene: NOTCH1 was set to Other Review for gene: NOTCH1 was set to GREEN gene: NOTCH1 was marked as current diagnostic Added comment: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Other clinical features include intellectual disability, spasticity and etc. Childhood onset in most individuals however 15y and 40y reported in two individuals. - Missense and small inframe insertion variants in the negative regulatory region. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.103 | Zornitza Stark HPO terms changed from to Leukodystrophy, HP:0002415; Abnormal cerebral white matter morphology, HP:0002500 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.102 | LIG3 | Zornitza Stark Phenotypes for gene: LIG3 were changed from gut dysmotility; spasticity; ataxia; repetitive behaviours; neurogenic bladder; macular degeneration; leukoencephalopathy; cerebellar atrophy to Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.101 | LIG3 | Zornitza Stark edited their review of gene: LIG3: Changed phenotypes: Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.101 | ANXA11 | Zornitza Stark Marked gene: ANXA11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.101 | ANXA11 | Zornitza Stark Gene: anxa11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.101 | ANXA11 | Zornitza Stark Phenotypes for gene: ANXA11 were changed from Inclusion body myopathy and brain white matter abnormalities, MIM# 619733; Amyotrophic lateral sclerosis 23, MIM# 617839 to Inclusion body myopathy and brain white matter abnormalities, MIM# 619733 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.100 | ANXA11 | Zornitza Stark Classified gene: ANXA11 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.100 | ANXA11 | Zornitza Stark Gene: anxa11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.99 | ANXA11 | Zornitza Stark Tag founder tag was added to gene: ANXA11. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.99 | ANXA11 | Zornitza Stark edited their review of gene: ANXA11: Changed phenotypes: Inclusion body myopathy and brain white matter abnormalities, MIM# 619733 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.99 | ANXA11 |
Zornitza Stark gene: ANXA11 was added gene: ANXA11 was added to Leukodystrophy - adult onset. Sources: Expert Review Mode of inheritance for gene: ANXA11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANXA11 were set to 34048612 Phenotypes for gene: ANXA11 were set to Inclusion body myopathy and brain white matter abnormalities, MIM# 619733; Amyotrophic lateral sclerosis 23, MIM# 617839 Review for gene: ANXA11 was set to AMBER Added comment: Inclusion body myopathy and brain white matter abnormalities (IBMWMA) is an autosomal dominant adult-onset disorder characterized predominantly by proximal limb girdle muscle weakness affecting the lower and upper limbs and resulting in gait difficulties and scapular winging. Additional features may include dysarthria, dysphagia, low back pain, and hyporeflexia. EMG is consistent with a myopathic process, although neuropathic findings have also been shown. Muscle biopsy shows fiber type variation, internal nuclei, rimmed vacuoles, and cytoplasmic protein aggregates or inclusions. Serum creatine kinase is usually elevated. Cognitive impairment or frontotemporal dementia occurs in some patients. The disorder is slowly progressive; some patients become wheelchair-bound after many years. Rare patients with this mutation develop ALS; some have both myopathy and ALS. Brain imaging shows white matter abnormalities using diffusion tensor imaging. The disorder is classified as multisystem proteinopathy-6 (MSP6) due to the characteristic disease mechanism of protein misfolding and abnormal tissue deposition. 11 individuals from three unrelated Brazilian families reported, but all had same variant ?founder. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.98 | TPP2 | Zornitza Stark Marked gene: TPP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.98 | TPP2 | Zornitza Stark Gene: tpp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.98 | TPP2 | Zornitza Stark Classified gene: TPP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.98 | TPP2 | Zornitza Stark Gene: tpp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.97 | TPP2 |
Zornitza Stark gene: TPP2 was added gene: TPP2 was added to Leukodystrophy - adult onset. Sources: Expert Review Mode of inheritance for gene: TPP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TPP2 were set to 25414442 Phenotypes for gene: TPP2 were set to Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220 Review for gene: TPP2 was set to GREEN Added comment: 14 individuals with "TRIANGLE" (TPPII-related immunodeficiency, autoimmunity, and neurodevelopmental delay with impaired glycolysis and lysosomal expansion) syndrome are summarized in 25414442, where 4/14 presented in adulthood with white matter leasions mimicking multiple sclerosis. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.96 | AARS | Zornitza Stark edited their review of gene: AARS: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.96 | AARS | Zornitza Stark Phenotypes for gene: AARS were changed from Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287 to Leukoencephalopathy, hereditary diffuse, with spheroids 2, MIM# 619661 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.95 | AARS | Zornitza Stark Mode of inheritance for gene: AARS was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.94 | AARS |
Zornitza Stark changed review comment from: Limited evidence to link with leukodystrophy. Sources: Expert list; to: Limited evidence to link with leukodystrophy. Single multigenerational family segregating a heterozygous missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.94 | AARS | Zornitza Stark edited their review of gene: AARS: Changed phenotypes: Leukoencephalopathy, hereditary diffuse, with spheroids 2, MIM# 619661 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.94 | LAMB1 | Alison Yeung Marked gene: LAMB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.94 | LAMB1 | Alison Yeung Gene: lamb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.94 | LAMB1 | Alison Yeung Classified gene: LAMB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.94 | LAMB1 | Alison Yeung Gene: lamb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.93 | LAMB1 | Alison Yeung Added comment: Comment on mode of inheritance: Monoallelic mode of inheritance for adult-onset disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.93 | LAMB1 | Alison Yeung Mode of inheritance for gene: LAMB1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.93 | LAMB1 | Alison Yeung Added comment: Comment on mode of inheritance: Monoallelic mode of inheritance for adult-onset disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.93 | LAMB1 | Alison Yeung Mode of inheritance for gene: LAMB1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.92 | LAMB1 | Lucy Spencer reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34606115; Phenotypes: leukoencephalopathy; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.92 | POLR1C | Zornitza Stark Marked gene: POLR1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.92 | POLR1C | Zornitza Stark Added comment: Comment when marking as ready: Four adults from three families reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.92 | POLR1C | Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.92 | POLR1C | Zornitza Stark Publications for gene: POLR1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.91 | POLR1C | Zornitza Stark Classified gene: POLR1C as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.91 | POLR1C | Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.90 | POLR1C | Ain Roesley reviewed gene: POLR1C: Rating: AMBER; Mode of pathogenicity: None; Publications: 33190326, 34484918; Phenotypes: Leukodystrophy, hypomyelinating, 11, MIM# 616494; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.90 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.90 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.90 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.90 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.89 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.88 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.87 | TACO1 | Seb Lunke Marked gene: TACO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.87 | TACO1 | Seb Lunke Gene: taco1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.87 | TACO1 |
Seb Lunke gene: TACO1 was added gene: TACO1 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: TACO1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TACO1 were set to 33709035 Phenotypes for gene: TACO1 were set to Leukoencephalopathy, adult onset Review for gene: TACO1 was set to RED Added comment: 50yo female with hom c.676G>T (p.Glu226Ter) variant. Onset of slowly progressive spastic gait and mild cognitive impairment in her 30s. 24yo carrier daughter healthy. Live imaging microscopy in primary fibroblasts showed a mild reduction of optic atrophy gene 1 long forms, which are the active mediators of mitochondrial fusion (figure 1C), however mitochondrial network morphology was comparable to controls, with the highest percentage of cells showing fused and interconnected organelles. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.86 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.86 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.86 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.86 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.85 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[(66_517)] Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.84 | LIG3 | Zornitza Stark Marked gene: LIG3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.84 | LIG3 | Zornitza Stark Gene: lig3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.84 | LIG3 | Zornitza Stark Classified gene: LIG3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.84 | LIG3 | Zornitza Stark Gene: lig3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.83 | LIG3 |
Zornitza Stark gene: LIG3 was added gene: LIG3 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: LIG3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LIG3 were set to 33855352 Phenotypes for gene: LIG3 were set to gut dysmotility; spasticity; ataxia; repetitive behaviours; neurogenic bladder; macular degeneration; leukoencephalopathy; cerebellar atrophy Review for gene: LIG3 was set to GREEN Added comment: Seven individuals from three unrelated families and functional data, variable ages of onset from early childhood to late adolescence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.82 | SPG21 | Zornitza Stark Marked gene: SPG21 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.82 | SPG21 | Zornitza Stark Added comment: Comment when marking as ready: New HGNC approved name is SPG21. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.82 | SPG21 | Zornitza Stark Gene: spg21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.82 | SPG21 | Zornitza Stark Tag new gene name tag was added to gene: SPG21. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.82 | LARS2 | Zornitza Stark Marked gene: LARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.82 | LARS2 | Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.82 | LARS2 | Zornitza Stark Classified gene: LARS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.82 | LARS2 | Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.81 | LARS2 |
Zornitza Stark gene: LARS2 was added gene: LARS2 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: LARS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LARS2 were set to 32442335; 30737337 Phenotypes for gene: LARS2 were set to Leukodystrophy Review for gene: LARS2 was set to GREEN Added comment: Five individuals reported where leukodystrophy was part of LARS2-associated Perrault syndrome. Neurological decline and MRI abnormalities were primarily in adulthood. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.80 | LAMB1 | Zornitza Stark Publications for gene: LAMB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.79 | LAMB1 | Zornitza Stark edited their review of gene: LAMB1: Changed rating: RED; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.79 | LAMB1 | Zornitza Stark reviewed gene: LAMB1: Rating: ; Mode of pathogenicity: None; Publications: 32548278; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.79 | LAMB1 | Seb Lunke Marked gene: LAMB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.79 | LAMB1 | Seb Lunke Gene: lamb1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.79 | LAMB1 |
Seb Lunke gene: LAMB1 was added gene: LAMB1 was added to Leukodystrophy - adult onset. Sources: Literature Mode of inheritance for gene: LAMB1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LAMB1 were set to Retinal Vascular Abnormality; mild intellectual disability; white matter lesions; lower limb spasticity Review for gene: LAMB1 was set to RED Added comment: Single adult female patient with onset of symptoms after 22yrs of age. Novel homozygous missense variant in a distantly related family identified in exome sequencing, no further evidence of pathogenicity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.76 | MLC1 | Zornitza Stark Classified gene: MLC1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.76 | MLC1 | Zornitza Stark Gene: mlc1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.75 | MLC1 | Zornitza Stark edited their review of gene: MLC1: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.75 | AARS | Zornitza Stark Marked gene: AARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.75 | AARS | Zornitza Stark Gene: aars has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.75 | AARS | Zornitza Stark Classified gene: AARS as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.75 | AARS | Zornitza Stark Gene: aars has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.74 | AARS | Zornitza Stark Marked gene: AARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.74 | AARS | Zornitza Stark Gene: aars has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.74 | AARS | Zornitza Stark Classified gene: AARS as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.74 | AARS | Zornitza Stark Gene: aars has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.73 | AARS |
Zornitza Stark gene: AARS was added gene: AARS was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: AARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AARS were set to 31775912 Phenotypes for gene: AARS were set to Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287 Review for gene: AARS was set to AMBER Added comment: Limited evidence to link with leukodystrophy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.72 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.71 | RNASET2 | Zornitza Stark Marked gene: RNASET2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.71 | RNASET2 | Zornitza Stark Gene: rnaset2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.71 | RNASET2 | Zornitza Stark Publications for gene: RNASET2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.70 | RNASET2 | Zornitza Stark Classified gene: RNASET2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.70 | RNASET2 | Zornitza Stark Gene: rnaset2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.69 | RNASET2 | Zornitza Stark reviewed gene: RNASET2: Rating: AMBER; Mode of pathogenicity: None; Publications: 19525954; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.69 | SAMHD1 | Zornitza Stark Marked gene: SAMHD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.69 | SAMHD1 | Zornitza Stark Gene: samhd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.69 | SAMHD1 | Zornitza Stark Publications for gene: SAMHD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.68 | SAMHD1 | Zornitza Stark reviewed gene: SAMHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19525956; Phenotypes: Aicardi-Goutieres syndrome 5, MIM# 612952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.68 | SPG11 | Zornitza Stark Marked gene: SPG11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.68 | SPG11 | Zornitza Stark Gene: spg11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.68 | SPG11 | Zornitza Stark Publications for gene: SPG11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | SPG11 | Zornitza Stark reviewed gene: SPG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 18067136; Phenotypes: Spastic paraplegia 11, autosomal recessive, MIM# 604360; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | TREX1 | Zornitza Stark changed review comment from: White matter changes are part of the phenotype. Onset is typically in infancy/early childhood but can be highly variable.; to: AGS: White matter changes are part of the phenotype. Onset is typically in infancy/early childhood but can be highly variable. Vasculopathy, retinal, with cerebral leukodystrophy, MIM# 192315: adult-onset disorder. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | TREX1 | Zornitza Stark edited their review of gene: TREX1: Changed phenotypes: Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750, Vasculopathy, retinal, with cerebral leukodystrophy 192315 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | TREX1 | Zornitza Stark Marked gene: TREX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | TREX1 | Zornitza Stark Gene: trex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | TREX1 | Zornitza Stark reviewed gene: TREX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | TUBB4A | Zornitza Stark Marked gene: TUBB4A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | TUBB4A | Zornitza Stark Gene: tubb4a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.67 | TUBB4A | Zornitza Stark Phenotypes for gene: TUBB4A were changed from Leukodystrophy, hypomyelinating, 6, 612438 to Leukodystrophy, hypomyelinating, 6, MIM#612438 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.66 | TUBB4A | Zornitza Stark Publications for gene: TUBB4A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | TUBB4A | Zornitza Stark reviewed gene: TUBB4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 28791129; Phenotypes: Leukodystrophy, hypomyelinating, 6, MIM# 612438; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | TYROBP | Zornitza Stark Marked gene: TYROBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | TYROBP | Zornitza Stark Gene: tyrobp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | TYROBP | Zornitza Stark reviewed gene: TYROBP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, MIM# 221770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | ZFYVE26 | Zornitza Stark Marked gene: ZFYVE26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | ZFYVE26 | Zornitza Stark Gene: zfyve26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | ZFYVE26 | Zornitza Stark reviewed gene: ZFYVE26: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 15, autosomal recessive, MIM# 270700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | POLR3B | Zornitza Stark Marked gene: POLR3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | POLR3B | Zornitza Stark Gene: polr3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.65 | POLR3B | Zornitza Stark Publications for gene: POLR3B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.64 | POLR3B | Zornitza Stark reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 25339210; Phenotypes: Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, 614381; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.64 | POLR3A | Zornitza Stark Marked gene: POLR3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.64 | POLR3A | Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.64 | POLR3A | Zornitza Stark Publications for gene: POLR3A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.63 | POLR3A | Zornitza Stark reviewed gene: POLR3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 31306222; Phenotypes: Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.63 | POLR1C | Zornitza Stark Marked gene: POLR1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.63 | POLR1C | Zornitza Stark Gene: polr1c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.63 | POLR1C | Zornitza Stark Phenotypes for gene: POLR1C were changed from Leukodystrophy, hypomyelinating, 11 to Leukodystrophy, hypomyelinating, 11, MIM# 616494 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.62 | POLR1C | Zornitza Stark Classified gene: POLR1C as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.62 | POLR1C | Zornitza Stark Gene: polr1c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.61 | POLR1C | Zornitza Stark reviewed gene: POLR1C: Rating: AMBER; Mode of pathogenicity: None; Publications: 26151409, 32042905; Phenotypes: Leukodystrophy, hypomyelinating, 11, MIM# 616494; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.61 | POLG2 | Zornitza Stark Marked gene: POLG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.61 | POLG2 | Zornitza Stark Gene: polg2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.61 | POLG2 | Zornitza Stark Classified gene: POLG2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.61 | POLG2 | Zornitza Stark Gene: polg2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.60 | POLG2 | Zornitza Stark reviewed gene: POLG2: Rating: AMBER; Mode of pathogenicity: None; Publications: 25655951; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.60 | Bryony Thompson Panel types changed to Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.59 | POLG | Zornitza Stark reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM# 613662; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.59 | PLP1 | Zornitza Stark Marked gene: PLP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.59 | PLP1 | Zornitza Stark Gene: plp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.59 | PLP1 | Zornitza Stark Publications for gene: PLP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.58 | PLP1 | Zornitza Stark reviewed gene: PLP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16130097; Phenotypes: Pelizaeus-Merzbacher disease, MIM# 312080; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.58 | NOTCH3 | Zornitza Stark Marked gene: NOTCH3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.58 | NOTCH3 | Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.58 | NOTCH3 | Zornitza Stark Mode of inheritance for gene: NOTCH3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.57 | NOTCH3 | Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, MIM# 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.57 | MLC1 | Zornitza Stark Marked gene: MLC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.57 | MLC1 | Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.57 | MLC1 | Zornitza Stark Publications for gene: MLC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.56 | MLC1 | Zornitza Stark reviewed gene: MLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11254442, 21419380, 21624973; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts, MIM# 604004; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.56 | MCOLN1 | Zornitza Stark Marked gene: MCOLN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.56 | MCOLN1 | Zornitza Stark Gene: mcoln1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.56 | MCOLN1 | Zornitza Stark Classified gene: MCOLN1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.56 | MCOLN1 | Zornitza Stark Gene: mcoln1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.55 | MCOLN1 | Zornitza Stark reviewed gene: MCOLN1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mucolipidosis IV, MIM# 252650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.55 | L2HGDH | Zornitza Stark Marked gene: L2HGDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.55 | L2HGDH | Zornitza Stark Gene: l2hgdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.55 | L2HGDH | Zornitza Stark Publications for gene: L2HGDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | L2HGDH | Zornitza Stark reviewed gene: L2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 10399870; Phenotypes: L-2-hydroxyglutaric aciduria, MIM# 236792; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HTRA1 | Zornitza Stark Marked gene: HTRA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HTRA1 | Zornitza Stark Gene: htra1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HTRA1 | Zornitza Stark reviewed gene: HTRA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: CARASIL syndrome, MIM# 600142, Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, MIM# 616779; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HEXA | Zornitza Stark Marked gene: HEXA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HEXA | Zornitza Stark Gene: hexa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HEXA | Zornitza Stark reviewed gene: HEXA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Tay-Sachs disease, MIM# 272800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HEPACAM | Zornitza Stark Marked gene: HEPACAM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HEPACAM | Zornitza Stark Gene: hepacam has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.54 | HEPACAM | Zornitza Stark Publications for gene: HEPACAM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.53 | HEPACAM | Zornitza Stark Mode of inheritance for gene: HEPACAM was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.52 | HEPACAM | Zornitza Stark reviewed gene: HEPACAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 21419380, 21419380; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts 2A, MIM# 613925, Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, MIM# 613926; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.52 | GJC2 | Zornitza Stark Marked gene: GJC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.52 | GJC2 | Zornitza Stark Gene: gjc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.52 | GJC2 | Zornitza Stark reviewed gene: GJC2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 2, MIM# 608804; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.52 | GJA1 | Zornitza Stark Marked gene: GJA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.52 | GJA1 | Zornitza Stark Gene: gja1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.52 | GJA1 | Zornitza Stark Phenotypes for gene: GJA1 were changed from Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 to Hereditary spastic paraplegia; Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.51 | GJA1 | Zornitza Stark Publications for gene: GJA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | GJA1 | Zornitza Stark reviewed gene: GJA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31023660; Phenotypes: Hereditary spastic paraplegia, Oculodentodigital dysplasia, autosomal recessive, MIM#257850; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | GFAP | Zornitza Stark Marked gene: GFAP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | GFAP | Zornitza Stark Gene: gfap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | GFAP | Zornitza Stark reviewed gene: GFAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alexander disease, MIM# 203450; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | GALC | Zornitza Stark Marked gene: GALC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | GALC | Zornitza Stark Gene: galc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | GALC | Zornitza Stark reviewed gene: GALC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Krabbe disease, MIM# 245200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | EARS2 | Zornitza Stark Marked gene: EARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | EARS2 | Zornitza Stark Gene: ears2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.50 | EARS2 | Zornitza Stark Phenotypes for gene: EARS2 were changed from Combined oxidative phosphorylation deficiency 12, 614924 to Combined oxidative phosphorylation deficiency 12, 614924; Leukoencephalopathy with thalamus and brainstem involvement and high lactate | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.49 | EARS2 | Zornitza Stark Publications for gene: EARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.48 | EARS2 | Zornitza Stark Classified gene: EARS2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.48 | EARS2 | Zornitza Stark Gene: ears2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.47 | EARS2 | Zornitza Stark edited their review of gene: EARS2: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.47 | EARS2 | Zornitza Stark reviewed gene: EARS2: Rating: ; Mode of pathogenicity: None; Publications: 22492562, 23008233, 25854774, 26619324, 26893310; Phenotypes: Combined oxidative phosphorylation deficiency 12, MIM# 614924, Leukoencephalopathy with thalamus and brainstem involvement and high lactate; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.47 | DARS2 | Zornitza Stark Marked gene: DARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.47 | DARS2 | Zornitza Stark Gene: dars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.47 | DARS2 | Zornitza Stark Publications for gene: DARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.46 | DARS2 | Zornitza Stark reviewed gene: DARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17384640, 15002045, 16788019; Phenotypes: Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.46 | DARS | Zornitza Stark Marked gene: DARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.46 | DARS | Zornitza Stark Gene: dars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.46 | DARS | Zornitza Stark Publications for gene: DARS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.45 | DARS | Zornitza Stark Tag new gene name tag was added to gene: DARS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.45 | DARS | Zornitza Stark reviewed gene: DARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 25527264, 23643384; Phenotypes: Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.45 | CLCN2 | Zornitza Stark Marked gene: CLCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.45 | CLCN2 | Zornitza Stark Gene: clcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.45 | CLCN2 | Zornitza Stark Publications for gene: CLCN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.44 | CLCN2 | Zornitza Stark reviewed gene: CLCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23707145; Phenotypes: Leukoencephalopathy with ataxia, MIM# 615651; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.44 | ASPA | Zornitza Stark Marked gene: ASPA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.44 | ASPA | Zornitza Stark Gene: aspa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.44 | ASPA | Zornitza Stark Phenotypes for gene: ASPA were changed from 25655951; General Leukodystrophy & Mitochondrial Leukoencephalopathy to General Leukodystrophy & Mitochondrial Leukoencephalopathy; Canavan disease, MIM# 271900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.43 | ASPA | Zornitza Stark Publications for gene: ASPA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | ASPA | Zornitza Stark reviewed gene: ASPA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Canavan disease, MIM# 271900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | ARSA | Zornitza Stark Marked gene: ARSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | ARSA | Zornitza Stark Gene: arsa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | ARSA | Zornitza Stark reviewed gene: ARSA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Metachromatic leukodystrophy, MIM# 250100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | ALDH3A2 | Zornitza Stark Marked gene: ALDH3A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | ALDH3A2 | Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | ALDH3A2 | Zornitza Stark reviewed gene: ALDH3A2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sjogren-Larsson syndrome, MIM# 270200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | APOPT1 | Zornitza Stark edited their review of gene: APOPT1: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | APOPT1 | Zornitza Stark Marked gene: APOPT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | APOPT1 | Zornitza Stark Added comment: Comment when marking as ready: Moved to paediatric leukodystrophy panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | APOPT1 | Zornitza Stark Gene: apopt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | APOPT1 | Zornitza Stark Classified gene: APOPT1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.42 | APOPT1 | Zornitza Stark Gene: apopt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.41 | AUH | Zornitza Stark Marked gene: AUH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.41 | AUH | Zornitza Stark Gene: auh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.41 | AUH | Zornitza Stark Publications for gene: AUH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.40 | CTSA | Zornitza Stark Marked gene: CTSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.40 | CTSA | Zornitza Stark Gene: ctsa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.40 | CYP7B1 | Zornitza Stark Marked gene: CYP7B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.40 | CYP7B1 | Zornitza Stark Gene: cyp7b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.40 | EPRS | Zornitza Stark Marked gene: EPRS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.40 | EPRS | Zornitza Stark Gene: eprs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.40 | EPRS | Zornitza Stark Publications for gene: EPRS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.39 | NPC1 | Zornitza Stark Marked gene: NPC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.39 | NPC1 | Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.39 | RPIA |
Zornitza Stark changed review comment from: Four unrelated individuals described to date. Sources: Literature; to: Four unrelated individuals described to date, variable onset of leukodystrophy in childhood/adolescence, though other symptoms generally precede. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.39 | RPIA | Zornitza Stark Marked gene: RPIA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.39 | RPIA | Zornitza Stark Gene: rpia has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.39 | RPIA | Zornitza Stark Publications for gene: RPIA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.38 | SNORD118 | Zornitza Stark changed review comment from: Over 30 families reported.; to: Over 30 families reported, age at presentation ranged between infancy and 54 years. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.38 | SNORD118 | Zornitza Stark Publications for gene: SNORD118 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | SNORD118 | Zornitza Stark Marked gene: SNORD118 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | SNORD118 | Zornitza Stark Gene: snord118 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | SPG21 | Zornitza Stark Marked gene: SPG21 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | SPG21 | Zornitza Stark Gene: spg21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | ATP7B | Zornitza Stark Marked gene: ATP7B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | ATP7B | Zornitza Stark Gene: atp7b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | NPC2 | Zornitza Stark Marked gene: NPC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | NPC2 | Zornitza Stark Gene: npc2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | RNF216 | Zornitza Stark Marked gene: RNF216 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | RNF216 | Zornitza Stark Gene: rnf216 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | SPAST | Zornitza Stark Marked gene: SPAST as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | SPAST | Zornitza Stark Gene: spast has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | SPG7 | Zornitza Stark Marked gene: SPG7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | SPG7 | Zornitza Stark Gene: spg7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | TWNK | Zornitza Stark Marked gene: TWNK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | TWNK | Zornitza Stark Gene: twnk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | RPS6KA3 | Zornitza Stark Marked gene: RPS6KA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | RPS6KA3 | Zornitza Stark Gene: rps6ka3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.37 | RPS6KA3 | Zornitza Stark Publications for gene: RPS6KA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.36 | STXBP2 | Zornitza Stark Marked gene: STXBP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.36 | STXBP2 | Zornitza Stark Gene: stxbp2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.36 | UNC13D | Zornitza Stark Marked gene: UNC13D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.36 | UNC13D | Zornitza Stark Gene: unc13d has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.36 | TYMP | Zornitza Stark Marked gene: TYMP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.36 | TYMP | Zornitza Stark Gene: tymp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.36 | TYMP | Zornitza Stark Classified gene: TYMP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.36 | TYMP | Zornitza Stark Gene: tymp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.35 | TYMP |
Zornitza Stark gene: TYMP was added gene: TYMP was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: TYMP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TYMP were set to 9924029; 10852545 Phenotypes for gene: TYMP were set to Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM# 603041 Review for gene: TYMP was set to GREEN Added comment: Onset between the second and fifth decades of life of ptosis, progressive external ophthalmoplegia (PEO), gastrointestinal dysmotility (often pseudoobstruction), cachexia, diffuse leukoencephalopathy, peripheral neuropathy, and mitochondrial dysfunction. Mitochondrial DNA abnormalities can include depletion, deletion, and point mutations. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.34 | LMNB1 | Zornitza Stark Marked gene: LMNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.34 | LMNB1 | Zornitza Stark Gene: lmnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.34 | LMNB1 | Zornitza Stark Publications for gene: LMNB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.33 | LMNB1 | Zornitza Stark Tag SV/CNV tag was added to gene: LMNB1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.33 | TREM2 | Zornitza Stark edited their review of gene: TREM2: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.33 | TREM2 | Zornitza Stark Marked gene: TREM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.33 | TREM2 | Zornitza Stark Gene: trem2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.33 | TREM2 | Zornitza Stark Publications for gene: TREM2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.32 | TREM2 | Zornitza Stark reviewed gene: TREM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 12080485, 15883308; Phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.32 | PTEN | Zornitza Stark Marked gene: PTEN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.32 | PTEN | Zornitza Stark Gene: pten has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.32 | PTEN | Zornitza Stark Phenotypes for gene: PTEN were changed from to Cowden syndrome 1, MIM# 158350 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.31 | PTEN | Zornitza Stark reviewed gene: PTEN: Rating: GREEN; Mode of pathogenicity: None; Publications: 29152901; Phenotypes: Cowden syndrome 1, MIM# 158350; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.31 | PAH | Zornitza Stark Marked gene: PAH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.31 | PAH | Zornitza Stark Gene: pah has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.31 | PAH | Zornitza Stark Publications for gene: PAH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.30 | PAH | Zornitza Stark reviewed gene: PAH: Rating: GREEN; Mode of pathogenicity: None; Publications: 31636599, 32141105; Phenotypes: Phenylketonuria, MIM# 261600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.30 | MTHFR | Zornitza Stark Marked gene: MTHFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.30 | MTHFR | Zornitza Stark Gene: mthfr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.30 | MTHFR | Zornitza Stark Publications for gene: MTHFR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.29 | MTHFR | Zornitza Stark reviewed gene: MTHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 29391032; Phenotypes: Homocystinuria due to MTHFR deficiency, MIM# 236250; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.29 | MAN2B1 | Zornitza Stark Marked gene: MAN2B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.29 | MAN2B1 | Zornitza Stark Gene: man2b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.29 | MAN2B1 | Zornitza Stark reviewed gene: MAN2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mannosidosis, alpha-, types I and II, MIM# 248500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.29 | GJB1 | Zornitza Stark Marked gene: GJB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.29 | GJB1 | Zornitza Stark Gene: gjb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.29 | GJB1 | Zornitza Stark Phenotypes for gene: GJB1 were changed from Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800 to Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800; Reversible posterior leukoencephalopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.28 | GJB1 | Zornitza Stark Publications for gene: GJB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.27 | GJB1 | Zornitza Stark reviewed gene: GJB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31842800; Phenotypes: Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM# 302800; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.27 | AUH | Zornitza Stark changed review comment from: Onset is typically in childhood, though presentation is variable so worth keeping on both paediatric and adult panels.; to: Onset is typically in childhood, though presentation is variable so worth keeping on both paediatric and adult panels. Specifically, two individuals with late onset disease including leukodystrophy reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.27 | AUH | Zornitza Stark edited their review of gene: AUH: Changed publications: 20855850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.27 | GCDH | Zornitza Stark Marked gene: GCDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.27 | GCDH | Zornitza Stark Gene: gcdh has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.27 | GCDH | Zornitza Stark Phenotypes for gene: GCDH were changed from Glutaricaciduria, type I, MIM#231670 to Glutaric aciduria, type I, MIM#231670 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.26 | GCDH | Zornitza Stark Classified gene: GCDH as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.26 | GCDH | Zornitza Stark Gene: gcdh has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.25 | GCDH | Zornitza Stark reviewed gene: GCDH: Rating: AMBER; Mode of pathogenicity: None; Publications: 15985591; Phenotypes: Glutaric aciduria, type I 231670; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.25 | GAN | Zornitza Stark Marked gene: GAN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.25 | GAN | Zornitza Stark Gene: gan has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.25 | GAN | Zornitza Stark Classified gene: GAN as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.25 | GAN | Zornitza Stark Gene: gan has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.24 | GAN | Zornitza Stark reviewed gene: GAN: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Giant axonal neuropathy-1, MIM# 256850; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.24 | DCAF17 | Zornitza Stark Marked gene: DCAF17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.24 | DCAF17 | Zornitza Stark Gene: dcaf17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.24 | DCAF17 | Zornitza Stark reviewed gene: DCAF17: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Woodhouse-Sakati syndrome, MIM# 241080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.24 | CTSA | Zornitza Stark reviewed gene: CTSA: Rating: GREEN; Mode of pathogenicity: None; Publications: 31177426; Phenotypes: Cathepsin A-related arteriopathy with strokes and leukoencephalopathy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.24 | CTC1 | Zornitza Stark Marked gene: CTC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.24 | CTC1 | Zornitza Stark Gene: ctc1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.24 | CTC1 | Zornitza Stark Publications for gene: CTC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.23 | CTC1 | Zornitza Stark Classified gene: CTC1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.23 | CTC1 | Zornitza Stark Gene: ctc1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.22 | CTC1 | Zornitza Stark reviewed gene: CTC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 22267198, 22387016, 22532422; Phenotypes: Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.22 | COL4A2 | Zornitza Stark Marked gene: COL4A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.22 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.22 | COL4A2 | Zornitza Stark Classified gene: COL4A2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.22 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | COL4A2 | Zornitza Stark reviewed gene: COL4A2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Brain small vessel disease 2, MIM# 614483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | AUH | Zornitza Stark reviewed gene: AUH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria, type I, MIM# 250950; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | APOPT1 | Zornitza Stark reviewed gene: APOPT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25175347; Phenotypes: Mitochondrial complex IV deficiency, MIM# 220110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | RPS6KA3 | Bryony Thompson edited their review of gene: RPS6KA3: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | RPS6KA3 | Bryony Thompson reviewed gene: RPS6KA3: Rating: ; Mode of pathogenicity: None; Publications: 16691578; Phenotypes: Coffin-Lowry syndrome MIM#303600; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | RNF216 | Bryony Thompson reviewed gene: RNF216: Rating: AMBER; Mode of pathogenicity: None; Publications: 28334938, 26250479; Phenotypes: Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | MARS | Bryony Thompson Marked gene: MARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | MARS | Bryony Thompson Gene: mars has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.21 | MARS | Bryony Thompson Mode of inheritance for gene: MARS was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.20 | MARS | Bryony Thompson reviewed gene: MARS: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2U MIM#616280; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.19 | UNC13D |
Bryony Thompson gene: UNC13D was added gene: UNC13D was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: UNC13D was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UNC13D were set to Hemophagocytic lymphohistiocytosis, familial, 3 608898 Review for gene: UNC13D was set to RED Added comment: There is no clear evidence that leukodystrophy is a prominent feature of the condition caused by this gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.18 | TWNK | Bryony Thompson Classified gene: TWNK as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.18 | TWNK | Bryony Thompson Gene: twnk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.17 | TWNK |
Bryony Thompson gene: TWNK was added gene: TWNK was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: TWNK was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: TWNK were set to 31455269; 19353676 Phenotypes for gene: TWNK were set to Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) 271245; Perrault syndrome 5 616138; Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 609286 Review for gene: TWNK was set to AMBER Added comment: Two reports of white matter changes one in a woman diagnosed with PEO and an infant diagnosed with mitochondrial depletion syndrome. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.16 | STXBP2 |
Bryony Thompson gene: STXBP2 was added gene: STXBP2 was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: STXBP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STXBP2 were set to Hemophagocytic lymphohistiocytosis, familial, 5 613101 Review for gene: STXBP2 was set to RED Added comment: There is no clear evidence that leukodystrophy is a prominent feature of the condition associated with this gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.15 | SPG7 | Bryony Thompson Classified gene: SPG7 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.15 | SPG7 | Bryony Thompson Gene: spg7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.14 | SPG7 |
Bryony Thompson gene: SPG7 was added gene: SPG7 was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: SPG7 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: SPG7 were set to 20108356; 17646629 Phenotypes for gene: SPG7 were set to Spastic paraplegia 7, autosomal recessive 607259 Review for gene: SPG7 was set to AMBER Added comment: White matter abnormalities reported in two cases. It is unclear whether this is a prominent feature of the condition. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.13 | SPG21 | Bryony Thompson Classified gene: SPG21 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.13 | SPG21 | Bryony Thompson Gene: spg21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.12 | SPG21 |
Bryony Thompson gene: SPG21 was added gene: SPG21 was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: SPG21 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPG21 were set to 14564668 Phenotypes for gene: SPG21 were set to Mast syndrome 248900 Review for gene: SPG21 was set to GREEN Added comment: Three patients reported with white matter abnormalities, diagnosed with Mast syndrome. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.11 | SPAST | Bryony Thompson Classified gene: SPAST as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.11 | SPAST | Bryony Thompson Gene: spast has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.10 | SPAST | Bryony Thompson reviewed gene: SPAST: Rating: AMBER; Mode of pathogenicity: None; Publications: 23968121; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.10 | SPAST | Bryony Thompson Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.10 | SPAST |
Bryony Thompson gene: SPAST was added gene: SPAST was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: SPAST was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPAST were set to 23968121 Phenotypes for gene: SPAST were set to Spastic paraplegia 4, autosomal dominant 182601 Review for gene: SPAST was set to RED Added comment: It is not clear that leukodystrophy is a prominent feature of the condition. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.9 | NPC2 | Bryony Thompson Classified gene: NPC2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.9 | NPC2 | Bryony Thompson Gene: npc2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.8 | NPC2 |
Bryony Thompson gene: NPC2 was added gene: NPC2 was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: NPC2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NPC2 were set to 25396745 Phenotypes for gene: NPC2 were set to Niemann-pick disease, type C2 607625 Review for gene: NPC2 was set to AMBER Added comment: White matter lesions associated with NPC1, but haven't been reported in association with NPC2 in humans. A cat with Niemann-pick and white matter degeneration identified during autopsy and a biallelic NPC2 variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.7 | NPC1 | Bryony Thompson Classified gene: NPC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.7 | NPC1 | Bryony Thompson Gene: npc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.6 | NPC1 |
Bryony Thompson gene: NPC1 was added gene: NPC1 was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: NPC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NPC1 were set to 26910362; 29406968 Phenotypes for gene: NPC1 were set to Niemann-Pick disease, type C1/D 257220 Review for gene: NPC1 was set to GREEN Added comment: White matter lesions identified in MRI of 5/11 of Niemann-Pick patients (including adult-onset) and in an NPC mouse model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.5 | CYP7B1 | Bryony Thompson Classified gene: CYP7B1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.5 | CYP7B1 | Bryony Thompson Gene: cyp7b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.4 | CYP7B1 |
Bryony Thompson gene: CYP7B1 was added gene: CYP7B1 was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: CYP7B1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CYP7B1 were set to 24117163; 19439420; 19187859 Phenotypes for gene: CYP7B1 were set to Spastic paraplegia 5A, autosomal recessive 270800 Review for gene: CYP7B1 was set to GREEN Added comment: White matter lesions have been reported as a feature of the condition in >3 cases. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.3 | ATP7B | Bryony Thompson Classified gene: ATP7B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.3 | ATP7B | Bryony Thompson Gene: atp7b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.2 | ATP7B |
Bryony Thompson gene: ATP7B was added gene: ATP7B was added to Leukodystrophy - adult onset. Sources: Expert list Mode of inheritance for gene: ATP7B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATP7B were set to 16966556; 12020274 Phenotypes for gene: ATP7B were set to Wilson disease, 277900 Review for gene: ATP7B was set to AMBER Added comment: White matter changes have been reported in Wilson's disease, but it doesn't appear to be a common feature of the condition. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.1 |
Bryony Thompson Panel name changed from Leukodystrophy - adult onset_RMH to Leukodystrophy - adult onset Panel status changed from internal to public |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | AUH |
Bryony Thompson gene: AUH was added gene: AUH was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: AUH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AUH were set to 3-methylglutaconic aciduria, type I, MIM#250950 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | MAN2B1 |
Bryony Thompson gene: MAN2B1 was added gene: MAN2B1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: MAN2B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MAN2B1 were set to Mannosidosis, alpha-, types I and II, MIM#248500 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | SLC17A5 |
Bryony Thompson gene: SLC17A5 was added gene: SLC17A5 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: SLC17A5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC17A5 were set to General Leukodystrophy & Mitochondrial Leukoencephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | POLG2 |
Bryony Thompson gene: POLG2 was added gene: POLG2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: POLG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: POLG2 were set to 25655951 Phenotypes for gene: POLG2 were set to Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4 610131 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | POLG |
Bryony Thompson gene: POLG was added gene: POLG was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: POLG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POLG were set to Mitochondrial DNA depletion syndrome 4B (MNGIE type) 613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | MLC1 |
Bryony Thompson gene: MLC1 was added gene: MLC1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: MLC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MLC1 were set to Megalencephalic leukoencephalopathy with subcortical cysts (MLC); General Leukodystrophy & Mitochondrial Leukoencephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | ASPA |
Bryony Thompson gene: ASPA was added gene: ASPA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: ASPA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ASPA were set to 25655951; General Leukodystrophy & Mitochondrial Leukoencephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | ZFYVE26 |
Bryony Thompson gene: ZFYVE26 was added gene: ZFYVE26 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: ZFYVE26 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ZFYVE26 were set to Spastic paraplegia 15, autosomal recessive, 270700 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | TYROBP |
Bryony Thompson gene: TYROBP was added gene: TYROBP was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: TYROBP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TYROBP were set to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, 221770 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | TUBB4A |
Bryony Thompson gene: TUBB4A was added gene: TUBB4A was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: TUBB4A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: TUBB4A were set to Leukodystrophy, hypomyelinating, 6, 612438 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | TREX1 |
Bryony Thompson gene: TREX1 was added gene: TREX1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: TREX1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: TREX1 were set to Aicardi-Goutieres syndrome 1, dominant and recessive, 225750; Vasculopathy, retinal, with cerebral leukodystrophy, 192315 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | TREM2 |
Bryony Thompson gene: TREM2 was added gene: TREM2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: TREM2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TREM2 were set to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, 618193 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | SPG11 |
Bryony Thompson gene: SPG11 was added gene: SPG11 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: SPG11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SPG11 were set to Charcot-Marie-Tooth disease, axonal, type 2X, 616668; Spastic paraplegia 11, autosomal recessive, MIM#604360 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | SNORD118 |
Bryony Thompson gene: SNORD118 was added gene: SNORD118 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: SNORD118 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SNORD118 were set to 614561; Leukoencephalopathy, brain calcifications and cysts, 614561 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | SAMHD1 |
Bryony Thompson gene: SAMHD1 was added gene: SAMHD1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: SAMHD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SAMHD1 were set to Aicardi-Goutieres syndrome 5, 612952 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | RPS6KA3 |
Bryony Thompson gene: RPS6KA3 was added gene: RPS6KA3 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Red,Royal Melbourne Hospital Mode of inheritance for gene: RPS6KA3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for gene: RPS6KA3 were set to Coffin-Lowry syndrome, 303600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | RPIA |
Bryony Thompson gene: RPIA was added gene: RPIA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: RPIA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RPIA were set to Ribose 5-phosphate isomerase deficiency, MIM#608611 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | RNF216 |
Bryony Thompson gene: RNF216 was added gene: RNF216 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Amber,Royal Melbourne Hospital Mode of inheritance for gene: RNF216 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNF216 were set to 28334938; 26250479 Phenotypes for gene: RNF216 were set to Cerebellar ataxia and hypogonadotropic hypogonadism, 212840 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | RNASET2 |
Bryony Thompson gene: RNASET2 was added gene: RNASET2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: RNASET2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RNASET2 were set to Leukoencephalopathy, cystic, without megalencephaly, 612951 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | RNASEH2C |
Bryony Thompson gene: RNASEH2C was added gene: RNASEH2C was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: RNASEH2C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RNASEH2C were set to Aicardi-Goutieres syndrome 3, 610329 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | RNASEH2B |
Bryony Thompson gene: RNASEH2B was added gene: RNASEH2B was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: RNASEH2B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RNASEH2B were set to Aicardi-Goutieres syndrome 2, 610181 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | RNASEH2A |
Bryony Thompson gene: RNASEH2A was added gene: RNASEH2A was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: RNASEH2A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RNASEH2A were set to Aicardi-Goutieres syndrome 4, 610333 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | PTEN |
Bryony Thompson gene: PTEN was added gene: PTEN was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: PTEN was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PTEN were set to 29720545; 29152901; 30664625 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | PSAP |
Bryony Thompson gene: PSAP was added gene: PSAP was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: PSAP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PSAP were set to Metachromatic leukodystrophy due to SAP-b deficiency, 249900; Krabbe disease, atypical, 611722 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | POLR3B |
Bryony Thompson gene: POLR3B was added gene: POLR3B was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: POLR3B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POLR3B were set to Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, 614381 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | POLR3A |
Bryony Thompson gene: POLR3A was added gene: POLR3A was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: POLR3A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POLR3A were set to Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, 607694 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | POLR1C |
Bryony Thompson gene: POLR1C was added gene: POLR1C was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: POLR1C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POLR1C were set to Leukodystrophy, hypomyelinating, 11 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | PLP1 |
Bryony Thompson gene: PLP1 was added gene: PLP1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: PLP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PLP1 were set to Pelizaeus-Merzbacher disease, 312080 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | PAH |
Bryony Thompson gene: PAH was added gene: PAH was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: PAH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PAH were set to Phenylketonuria, [Hyperphenylalaninemia, non-PKU mild], 261600 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | NOTCH3 |
Bryony Thompson gene: NOTCH3 was added gene: NOTCH3 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: NOTCH3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: NOTCH3 were set to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, 125310 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | MTHFR |
Bryony Thompson gene: MTHFR was added gene: MTHFR was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: MTHFR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MTHFR were set to Homocystinuria due to MTHFR deficiency, 236250 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | MCOLN1 |
Bryony Thompson gene: MCOLN1 was added gene: MCOLN1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: MCOLN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MCOLN1 were set to Mucolipidosis IV, 252650 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | MARS |
Bryony Thompson gene: MARS was added gene: MARS was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Red,Royal Melbourne Hospital Mode of inheritance for gene: MARS was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: MARS were set to Charcot-Marie-Tooth disease, axonal, type 2U, 616280 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | LMNB1 |
Bryony Thompson gene: LMNB1 was added gene: LMNB1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: LMNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: LMNB1 were set to Leukodystrophy, adult-onset, autosomal dominant, 169500 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | L2HGDH |
Bryony Thompson gene: L2HGDH was added gene: L2HGDH was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: L2HGDH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: L2HGDH were set to L-2-hydroxyglutaric aciduria, 236792 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | HTRA1 |
Bryony Thompson gene: HTRA1 was added gene: HTRA1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: HTRA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: HTRA1 were set to Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, 616779; CARASIL syndrome, 600142 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | HEXA |
Bryony Thompson gene: HEXA was added gene: HEXA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: HEXA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HEXA were set to GM2-gangliosidosis, several forms, Tay-Sachs disease, [Hex A pseudodeficiency], 272800 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | HEPACAM |
Bryony Thompson gene: HEPACAM was added gene: HEPACAM was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: HEPACAM was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: HEPACAM were set to Megalencephalic leukoencephalopathy with subcortical cysts 2A, 613925; Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, 613926 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GLB1 |
Bryony Thompson gene: GLB1 was added gene: GLB1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GLB1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GLB1 were set to GM1-gangliosidosis, type III, MIM#230650; white matter abnormality |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GLA |
Bryony Thompson gene: GLA was added gene: GLA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GLA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: GLA were set to Fabry disease, Fabry disease, cardiac variant, 301500 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GJC2 |
Bryony Thompson gene: GJC2 was added gene: GJC2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GJC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GJC2 were set to Leukodystrophy, hypomyelinating, 2, 608804, |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GJB1 |
Bryony Thompson gene: GJB1 was added gene: GJB1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GJB1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: GJB1 were set to Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GJA1 |
Bryony Thompson gene: GJA1 was added gene: GJA1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GJA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: GJA1 were set to Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GFAP |
Bryony Thompson gene: GFAP was added gene: GFAP was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GFAP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: GFAP were set to Alexander disease, 203450 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GCDH |
Bryony Thompson gene: GCDH was added gene: GCDH was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GCDH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GCDH were set to Glutaricaciduria, type I, MIM#231670 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GBE1 |
Bryony Thompson gene: GBE1 was added gene: GBE1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GBE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GBE1 were set to Polyglucosan body disease, adult form, 263570 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GAN |
Bryony Thompson gene: GAN was added gene: GAN was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GAN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GAN were set to Giant axonal neuropathy-1, MIM#256850 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | GALC |
Bryony Thompson gene: GALC was added gene: GALC was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: GALC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GALC were set to Krabbe disease, 245200 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | EPRS |
Bryony Thompson gene: EPRS was added gene: EPRS was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: EPRS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EPRS were set to Leukodystrophy, hypomyelinating, 15, MIM#617951 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | EIF2B5 |
Bryony Thompson gene: EIF2B5 was added gene: EIF2B5 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: EIF2B5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EIF2B5 were set to Leukoencephalopathy with vanishing white matter, 603896 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | EIF2B4 |
Bryony Thompson gene: EIF2B4 was added gene: EIF2B4 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: EIF2B4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EIF2B4 were set to Leukoencephalopathy with vanishing white matter, 603896 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | EIF2B3 |
Bryony Thompson gene: EIF2B3 was added gene: EIF2B3 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: EIF2B3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EIF2B3 were set to Leukoencephalopathy with vanishing white matter, 603896 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | EIF2B2 |
Bryony Thompson gene: EIF2B2 was added gene: EIF2B2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: EIF2B2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EIF2B2 were set to Leukoencephalopathy with vanishing white matter, Ovarioleukodystrophy, 603896 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | EIF2B1 |
Bryony Thompson gene: EIF2B1 was added gene: EIF2B1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: EIF2B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EIF2B1 were set to Leukoencephalopathy with vanishing white matter, 603896 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | EARS2 |
Bryony Thompson gene: EARS2 was added gene: EARS2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: EARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EARS2 were set to Combined oxidative phosphorylation deficiency 12, 614924 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | DCAF17 |
Bryony Thompson gene: DCAF17 was added gene: DCAF17 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: DCAF17 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DCAF17 were set to 31347785 Phenotypes for gene: DCAF17 were set to Woodhouse-Sakati syndrome, MIM#241080 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | DARS2 |
Bryony Thompson gene: DARS2 was added gene: DARS2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: DARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DARS2 were set to Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | DARS |
Bryony Thompson gene: DARS was added gene: DARS was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: DARS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DARS were set to Hypomyelination with brainstem and spinal cord involvement and leg spasticity, 615281 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | CYP27A1 |
Bryony Thompson gene: CYP27A1 was added gene: CYP27A1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: CYP27A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP27A1 were set to Cerebrotendinous xanthomatosis, 213700 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | CTSA |
Bryony Thompson gene: CTSA was added gene: CTSA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: CTSA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CTSA were set to 31177426 Phenotypes for gene: CTSA were set to Cathepsin-A-related arteriopathy with strokes and leukoencephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | CTC1 |
Bryony Thompson gene: CTC1 was added gene: CTC1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: CTC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CTC1 were set to Cerebroretinal microangiopathy with calcifications and cysts, 612199 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | CSF1R |
Bryony Thompson gene: CSF1R was added gene: CSF1R was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: CSF1R was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: CSF1R were set to Leukoencephalopathy, diffuse hereditary, with spheroids, 221820 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | COL4A2 |
Bryony Thompson gene: COL4A2 was added gene: COL4A2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: COL4A2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: COL4A2 were set to 30413629; 27624120; 24390199 Phenotypes for gene: COL4A2 were set to Brain small vessel disease 2, 614483 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | COL4A1 |
Bryony Thompson gene: COL4A1 was added gene: COL4A1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: COL4A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: COL4A1 were set to Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, 611773; Brain small vessel disease with or without ocular anomalies, 175780 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | APOPT1 |
Bryony Thompson gene: APOPT1 was added gene: APOPT1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: APOPT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: APOPT1 were set to Mitochondrial complex IV deficiency, MIM#220110 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | CLCN2 |
Bryony Thompson gene: CLCN2 was added gene: CLCN2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: CLCN2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLCN2 were set to Leukoencephalopathy with ataxia, 615651 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | ARSA |
Bryony Thompson gene: ARSA was added gene: ARSA was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: ARSA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ARSA were set to Metachromatic leukodystrophy, 250100 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | ALDH3A2 |
Bryony Thompson gene: ALDH3A2 was added gene: ALDH3A2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: ALDH3A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALDH3A2 were set to Sjogren-Larsson syndrome, 270200 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | ADAR |
Bryony Thompson gene: ADAR was added gene: ADAR was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: ADAR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAR were set to Aicardi-Goutieres syndrome 6, 615010 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | ABCD1 |
Bryony Thompson gene: ABCD1 was added gene: ABCD1 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: ABCD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ABCD1 were set to Adrenoleukodystrophy, Adrenomyeloneuropathy, adult, 300100 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | AARS2 |
Bryony Thompson gene: AARS2 was added gene: AARS2 was added to Leukodystrophy - adult onset_RMH. Sources: Expert Review Green,Royal Melbourne Hospital Mode of inheritance for gene: AARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AARS2 were set to Leukoencephalopathy, progressive, with ovarian failure, 615889 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy - adult onset v0.0 | Bryony Thompson Added panel Leukodystrophy - adult onset_RMH | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||