Activity

Filter

Cancel
Date Panel Item Activity
694 actions
Repeat Disorders v1.0 TNRC6A_FAME6_TTTCA STR TNRC6A_FAME6_TTTCA: gene migrated from ENSG00000090905 to ENSG00000090905 (gene set migration)
Repeat Disorders v1.0 RAI1_FAME8_TTTCA STR RAI1_FAME8_TTTCA: gene migrated from ENSG00000108557 to ENSG00000108557 (gene set migration)
Repeat Disorders v1.0 YEATS2_FAME4_TTTCA STR YEATS2_FAME4_TTTCA: gene migrated from ENSG00000163872 to ENSG00000163872 (gene set migration)
Repeat Disorders v1.0 SAMD12_FAME1_TTTGA STR SAMD12_FAME1_TTTGA: gene migrated from ENSG00000177570 to ENSG00000177570 (gene set migration)
Repeat Disorders v1.0 CBL_FRA11B_CCG STR CBL_FRA11B_CCG: gene migrated from ENSG00000110395 to ENSG00000110395 (gene set migration)
Repeat Disorders v1.0 NIPA1_ALS_GCG STR NIPA1_ALS_GCG: gene migrated from ENSG00000170113 to ENSG00000170113 (gene set migration)
Repeat Disorders v1.0 ZIC3_VACTERLX_GCC STR ZIC3_VACTERLX_GCC: gene migrated from ENSG00000156925 to ENSG00000156925 (gene set migration)
Repeat Disorders v1.0 C11orf80_FRA11A_CGG STR C11orf80_FRA11A_CGG: gene migrated from ENSG00000173715 to ENSG00000173715 (gene set migration)
Repeat Disorders v1.0 TMEM185A_FRAXF_GCC STR TMEM185A_FRAXF_GCC: gene migrated from HGNC:17125 to HGNC:17125 (gene set migration)
Repeat Disorders v1.0 DMD_DMD_GAA STR DMD_DMD_GAA: gene migrated from ENSG00000198947 to ENSG00000198947 (gene set migration)
Repeat Disorders v1.0 NAXE_NME_GGGCC STR NAXE_NME_GGGCC: gene migrated from ENSG00000163382 to ENSG00000163382 (gene set migration)
Repeat Disorders v1.0 AFF3_FRA2A_CGG STR AFF3_FRA2A_CGG: gene migrated from ENSG00000144218 to ENSG00000144218 (gene set migration)
Repeat Disorders v1.0 DIP2B_FRA12A_CGG STR DIP2B_FRA12A_CGG: gene migrated from ENSG00000066084 to ENSG00000066084 (gene set migration)
Repeat Disorders v1.0 RAPGEF2_FAME7_TTTCA STR RAPGEF2_FAME7_TTTCA: gene migrated from ENSG00000109756 to ENSG00000109756 (gene set migration)
Repeat Disorders v1.0 RUNX2_CCD_GCN STR RUNX2_CCD_GCN: gene migrated from ENSG00000124813 to ENSG00000124813 (gene set migration)
Repeat Disorders v1.0 THAP11_SCA51_CAG STR THAP11_SCA51_CAG: gene migrated from ENSG00000168286 to ENSG00000168286 (gene set migration)
Repeat Disorders v1.0 ZNF713_FRA7A_CGG STR ZNF713_FRA7A_CGG: gene migrated from ENSG00000178665 to ENSG00000178665 (gene set migration)
Repeat Disorders v1.0 ABCD3_OPDM_GCC STR ABCD3_OPDM_GCC: gene migrated from ENSG00000117528 to ENSG00000117528 (gene set migration)
Repeat Disorders v1.0 RILPL1_OPDM4_CGG STR RILPL1_OPDM4_CGG: gene migrated from ENSG00000188026 to ENSG00000188026 (gene set migration)
Repeat Disorders v1.0 NOTCH2NLC_NIID_GGC STR NOTCH2NLC_NIID_GGC: gene migrated from ENSG00000286219 to ENSG00000286219 (gene set migration)
Repeat Disorders v1.0 LRP12_OPDM1_CGG STR LRP12_OPDM1_CGG: gene migrated from ENSG00000147650 to ENSG00000147650 (gene set migration)
Repeat Disorders v1.0 PLIN4_MRUPAV_33-mer STR PLIN4_MRUPAV_33-mer: gene migrated from ENSG00000167676 to ENSG00000167676 (gene set migration)
Repeat Disorders v1.0 GIPC1_OPDM2_CGG STR GIPC1_OPDM2_CGG: gene migrated from ENSG00000123159 to ENSG00000123159 (gene set migration)
Repeat Disorders v1.0 PRDM12_HSAN8_GCC STR PRDM12_HSAN8_GCC: gene migrated from ENSG00000130711 to ENSG00000130711 (gene set migration)
Repeat Disorders v1.0 COMP_MEDPSACH_GAC STR COMP_MEDPSACH_GAC: gene migrated from ENSG00000105664 to ENSG00000105664 (gene set migration)
Repeat Disorders v1.0 ZIC2_HPE5_GCN STR ZIC2_HPE5_GCN: gene migrated from ENSG00000043355 to ENSG00000043355 (gene set migration)
Repeat Disorders v1.0 VWA1_HMNMYO_GCGCGGAGCG STR VWA1_HMNMYO_GCGCGGAGCG: gene migrated from ENSG00000179403 to ENSG00000179403 (gene set migration)
Repeat Disorders v1.0 HOXA13_HFGS_GCN1 STR HOXA13_HFGS_GCN1: gene migrated from ENSG00000106031 to ENSG00000106031 (gene set migration)
Repeat Disorders v1.0 JPH3_HDL2_CTG STR JPH3_HDL2_CTG: gene migrated from ENSG00000154118 to ENSG00000154118 (gene set migration)
Repeat Disorders v1.0 HTT_HD_CAG STR HTT_HD_CAG: gene migrated from ENSG00000197386 to ENSG00000197386 (gene set migration)
Repeat Disorders v1.0 FMR1_FXTAS_CGG STR FMR1_FXTAS_CGG: gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration)
Repeat Disorders v1.0 FMR1_FXS_CGG STR FMR1_FXS_CGG: gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration)
Repeat Disorders v1.0 GLS_GDPAG_GCA STR GLS_GDPAG_GCA: gene migrated from ENSG00000115419 to ENSG00000115419 (gene set migration)
Repeat Disorders v1.0 FMR1_FXPOI_CGG STR FMR1_FXPOI_CGG: gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration)
Repeat Disorders v1.0 C9orf72_FTDALS_GGGGCC STR C9orf72_FTDALS_GGGGCC: gene migrated from ENSG00000147894 to ENSG00000147894 (gene set migration)
Repeat Disorders v1.0 FXN_FRDA_GAA STR FXN_FRDA_GAA: gene migrated from ENSG00000165060 to ENSG00000165060 (gene set migration)
Repeat Disorders v1.0 AFF2_FRAXE_GCC STR AFF2_FRAXE_GCC: gene migrated from ENSG00000155966 to ENSG00000155966 (gene set migration)
Repeat Disorders v1.0 TCF4_FECD3_CTG STR TCF4_FECD3_CTG: gene migrated from ENSG00000196628 to ENSG00000196628 (gene set migration)
Repeat Disorders v1.0 SAMD12_FAME1_TTTCA STR SAMD12_FAME1_TTTCA: gene migrated from ENSG00000177570 to ENSG00000177570 (gene set migration)
Repeat Disorders v1.0 STARD7_FAME2_ATTTC STR STARD7_FAME2_ATTTC: gene migrated from ENSG00000084090 to ENSG00000084090 (gene set migration)
Repeat Disorders v1.0 CSTB_EPM1_CCCCGCCCCGCG STR CSTB_EPM1_CCCCGCCCCGCG: gene migrated from ENSG00000160213 to ENSG00000160213 (gene set migration)
Repeat Disorders v1.0 ARX_EIEE1_GCN2 STR ARX_EIEE1_GCN2: gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration)
Repeat Disorders v1.0 ARX_EIEE1_GCN1 STR ARX_EIEE1_GCN1: gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration)
Repeat Disorders v1.0 CNBP_DM2_CCTG STR CNBP_DM2_CCTG: gene migrated from ENSG00000169714 to ENSG00000169714 (gene set migration)
Repeat Disorders v1.0 DMPK_DM1_CTG STR DMPK_DM1_CTG: gene migrated from ENSG00000104936 to ENSG00000104936 (gene set migration)
Repeat Disorders v1.0 PRNP_CJD_octapeptide STR PRNP_CJD_octapeptide: gene migrated from ENSG00000171867 to ENSG00000171867 (gene set migration)
Repeat Disorders v1.0 PHOX2B_CCHS_GCN STR PHOX2B_CCHS_GCN: gene migrated from ENSG00000109132 to ENSG00000109132 (gene set migration)
Repeat Disorders v1.0 XYLT1_DBQD2_GGC STR XYLT1_DBQD2_GGC: gene migrated from ENSG00000103489 to ENSG00000103489 (gene set migration)
Repeat Disorders v1.0 ATXN7_SCA7_CAG STR ATXN7_SCA7_CAG: gene migrated from ENSG00000163635 to ENSG00000163635 (gene set migration)
Repeat Disorders v1.0 HOXA13_HFGS_GCN3 STR HOXA13_HFGS_GCN3: gene migrated from ENSG00000106031 to ENSG00000106031 (gene set migration)
Repeat Disorders v1.0 HOXA13_HFGS_GCN2 STR HOXA13_HFGS_GCN2: gene migrated from ENSG00000106031 to ENSG00000106031 (gene set migration)
Repeat Disorders v1.0 FOXL2_BPES_GCN STR FOXL2_BPES_GCN: gene migrated from ENSG00000183770 to ENSG00000183770 (gene set migration)
Repeat Disorders v1.0 ATN1_DRPLA_CAG STR ATN1_DRPLA_CAG: gene migrated from ENSG00000111676 to ENSG00000111676 (gene set migration)
Repeat Disorders v1.0 NUTM2B-AS1_OPDM_CCG STR NUTM2B-AS1_OPDM_CCG: gene migrated from ENSG00000225484 to ENSG00000225484 (gene set migration)
Repeat Disorders v1.0 RFC1_CANVAS_ANNGN STR RFC1_CANVAS_ANNGN: gene migrated from ENSG00000035928 to ENSG00000035928 (gene set migration)
Repeat Disorders v1.0 PABPN1_OPMD_GCN STR PABPN1_OPMD_GCN: gene migrated from ENSG00000100836 to ENSG00000100836 (gene set migration)
Repeat Disorders v1.0 TAF1_XDP_CCCTCT STR TAF1_XDP_CCCTCT: gene migrated from ENSG00000147133 to ENSG00000147133 (gene set migration)
Repeat Disorders v1.0 TBX1_TOF_GCN STR TBX1_TOF_GCN: gene migrated from ENSG00000184058 to ENSG00000184058 (gene set migration)
Repeat Disorders v1.0 HOXD13_SPD1_GCG STR HOXD13_SPD1_GCG: gene migrated from ENSG00000128714 to ENSG00000128714 (gene set migration)
Repeat Disorders v1.0 ATXN8OS_SCA8_CTG STR ATXN8OS_SCA8_CTG: gene migrated from ENSG00000230223 to ENSG00000230223 (gene set migration)
Repeat Disorders v1.0 CACNA1A_SCA6_CAG STR CACNA1A_SCA6_CAG: gene migrated from ENSG00000141837 to ENSG00000141837 (gene set migration)
Repeat Disorders v1.0 ZFHX3_SCA4_GGC STR ZFHX3_SCA4_GGC: gene migrated from ENSG00000140836 to ENSG00000140836 (gene set migration)
Repeat Disorders v1.0 DAB1_SCA37_ATTTC STR DAB1_SCA37_ATTTC: gene migrated from ENSG00000173406 to ENSG00000173406 (gene set migration)
Repeat Disorders v1.0 NOP56_SCA36_GGCCTG STR NOP56_SCA36_GGCCTG: gene migrated from ENSG00000101361 to ENSG00000101361 (gene set migration)
Repeat Disorders v1.0 ATXN3_SCA3_CAG STR ATXN3_SCA3_CAG: gene migrated from ENSG00000066427 to ENSG00000066427 (gene set migration)
Repeat Disorders v1.0 BEAN1_SCA31_TGGAA STR BEAN1_SCA31_TGGAA: gene migrated from ENSG00000166546 to ENSG00000166546 (gene set migration)
Repeat Disorders v1.0 FGF14_SCA27B_GAA STR FGF14_SCA27B_GAA: gene migrated from ENSG00000102466 to ENSG00000102466 (gene set migration)
Repeat Disorders v1.0 ATXN2_SCA2_CAG STR ATXN2_SCA2_CAG: gene migrated from ENSG00000204842 to ENSG00000204842 (gene set migration)
Repeat Disorders v1.0 TBP_SCA17_CAG STR TBP_SCA17_CAG: gene migrated from ENSG00000112592 to ENSG00000112592 (gene set migration)
Repeat Disorders v1.0 PPP2R2B_SCA12_CAG STR PPP2R2B_SCA12_CAG: gene migrated from ENSG00000156475 to ENSG00000156475 (gene set migration)
Repeat Disorders v1.0 ATXN10_SCA10_ATTCT STR ATXN10_SCA10_ATTCT: gene migrated from ENSG00000130638 to ENSG00000130638 (gene set migration)
Repeat Disorders v1.0 ATXN1_SCA1_CAG STR ATXN1_SCA1_CAG: gene migrated from ENSG00000124788 to ENSG00000124788 (gene set migration)
Repeat Disorders v1.0 AR_SBMA_CAG STR AR_SBMA_CAG: gene migrated from ENSG00000169083 to ENSG00000169083 (gene set migration)
Repeat Disorders v1.0 EIF4A3_RCPS_complex STR EIF4A3_RCPS_complex: gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Repeat Disorders v1.0 SOX3_PHPX_GCN STR SOX3_PHPX_GCN: gene migrated from ENSG00000134595 to ENSG00000134595 (gene set migration)
Repeat Disorders v1.0 MARCHF6_FAME3_TTTCA STR MARCHF6_FAME3_TTTCA: gene migrated from ENSG00000145495 to ENSG00000145495 (gene set migration)
Repeat Disorders v1.0 Panel migrated to gene set Ensemblv115. Source version: v0.272
Repeat Disorders v0.272 ABCD3_OPDM_GCC Zornitza Stark Phenotypes for STR: ABCD3_OPDM_GCC were changed from Oculopharyngodistal myopathy MONDO:0025193 to Oculopharyngodistal myopathy 5, MIM# 621446
Repeat Disorders v0.271 ABCD3_OPDM_GCC Zornitza Stark Publications for STR: ABCD3_OPDM_GCC were set to https://doi.org/10.1101/2023.10.09.23296582
Repeat Disorders v0.270 ABCD3_OPDM_GCC Zornitza Stark reviewed STR: ABCD3_OPDM_GCC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Oculopharyngodistal myopathy 5, MIM# 621446; Mode of inheritance: None
Repeat Disorders v0.270 MARCHF6_FAME3_TTTCA Bryony Thompson MARCH6_FAME3_TTTCA was changed to MARCHF6_FAME3_TTTCA
Repeat Disorders v0.269 DIP2B_FRA12A_CGG Bryony Thompson Phenotypes for STR: DIP2B_FRA12A_CGG were changed from Mental retardation, FRA12A type MIM#136630 to intellectual disability, FRA12A type MONDO:0007634
Repeat Disorders v0.268 DIP2B_FRA12A_CGG Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128; 39854091; 33510257
Repeat Disorders v0.267 DIP2B_FRA12A_CGG Bryony Thompson edited their review of STR: DIP2B_FRA12A_CGG: Added comment: Unsure about the expansions association with disease due to variable phenotypes and possible incomplete penetrance
PMID 17236128, 39854091, and 41028987 report 23 unrelated families with heterozygous CGG repeat expansions in the 5′UTR of DIP2B. Sixteen families present with intellectual disability associated with the FRA12A fragile site, while seven families (including two siblings, five ataxia probands, and one dystonia case) exhibit neurodevelopmental disability with progressive movement disorders (chorea, dystonia, ataxia). Functional studies demonstrate reduced DIP2B expression via promoter hypermethylation. Segregation analysis shows segregation from unaffected parents (possibly reduced penetrance) and de novo events. DIP2B expansion OR 2.8 (p=0.04) in ataxia cohort (5/788) vs gnomAD.; Changed publications: 17236128, 33510257, 39854091, 41028987; Changed phenotypes: intellectual disability, FRA12A type MONDO:0007634
Repeat Disorders v0.267 THAP11_SCA51_CAG Bryony Thompson edited their review of STR: THAP11_SCA51_CAG: Changed publications: 15368101, 24677642, 34165550, 38113319, 40459937, 39651830, 37148549
Repeat Disorders v0.267 THAP11_SCA51_CAG Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319; 40459937; 39651830
Repeat Disorders v0.266 THAP11_SCA51_CAG Bryony Thompson changed review comment from: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual. A 46/29 CAG THAP11 genotype has also been identified in an individual with ataxia of European ancestry, that also had a CACNA1A pathogenic expansion which causes SCA6. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease.
Further probands/families are required to confirm the gene-disease association.
Sources: Other; to: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual and the number of CAA interruptions had been reduced from 5/6 to 3. Expanded alleles have been identified in individuals with neurodevelopmental phenotypes, other neurodegenerative phenotypes, and an individual with ataxia who also had a CACNA1A (SCA6) pathogenic expansion. However, all these individuals had 5/6 CAA interruptions instead of 3 that were reported in the initial Chinese families. Suggesting the number of CAA interruptions is associated with pathogenicity of the repeat expansion. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease. Further probands/families are required to confirm the gene-disease association.
Sources: Other
Repeat Disorders v0.266 THAP11_SCA51_CAG Bryony Thompson Phenotypes for STR: THAP11_SCA51_CAG were changed from Spinocerebellar ataxia 51, MIM# 620947 to Spinocerebellar ataxia 51 MONDO:0975800
Repeat Disorders v0.265 THAP11_SCA51_CAG Bryony Thompson edited their review of STR: THAP11_SCA51_CAG: Changed publications: 15368101, 24677642, 34165550, 38113319, 40459937, 39651830; Changed phenotypes: Spinocerebellar ataxia 51 MONDO:0975800
Repeat Disorders v0.265 THAP11_SCA51_CAG Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319; 37148549; 39651830
Repeat Disorders v0.264 NOTCH2NLC_NIID_GGC Bryony Thompson Gene: NOTCH2NL was changed to NOTCH2NLC.
Repeat Disorders v0.263 RAI1_FAME8_TTTCA Bryony Thompson Marked STR: RAI1_FAME8_TTTCA as ready
Repeat Disorders v0.263 RAI1_FAME8_TTTCA Bryony Thompson Str: rai1_fame8_tttca has been classified as Red List (Low Evidence).
Repeat Disorders v0.263 RAI1_FAME8_TTTCA Bryony Thompson STR: RAI1_FAME8_TTTCA was added
STR: RAI1_FAME8_TTTCA was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: RAI1_FAME8_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: RAI1_FAME8_TTTCA were set to 37994247
Phenotypes for STR: RAI1_FAME8_TTTCA were set to benign adult familial myoclonic epilepsy MONDO:0019448
Review for STR: RAI1_FAME8_TTTCA was set to RED
Added comment: A single family from Mali segregating TTTTA repeat expansions and TTTCA repeat insertions in intron 4 of the RAI1. Consistent with other FAME expansions. RNA toxicity is suggested to be the mechanism. Loss of function is the mechanism of disease of Smith-Magenis syndrome.
Sources: Literature
Repeat Disorders v0.262 NAXE_NME_GGGCC Bryony Thompson Marked STR: NAXE_NME_GGGCC as ready
Repeat Disorders v0.262 NAXE_NME_GGGCC Bryony Thompson Str: naxe_nme_gggcc has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.262 NAXE_NME_GGGCC Bryony Thompson Classified STR: NAXE_NME_GGGCC as Amber List (moderate evidence)
Repeat Disorders v0.262 NAXE_NME_GGGCC Bryony Thompson Str: naxe_nme_gggcc has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.261 NAXE_NME_GGGCC Bryony Thompson STR: NAXE_NME_GGGCC was added
STR: NAXE_NME_GGGCC was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NAXE_NME_GGGCC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: NAXE_NME_GGGCC were set to 39455596
Phenotypes for STR: NAXE_NME_GGGCC were set to encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 1 MONDO:0020781
Review for STR: NAXE_NME_GGGCC was set to AMBER
STR: NAXE_NME_GGGCC was marked as clinically relevant
STR: NAXE_NME_GGGCC was marked as current diagnostic
Added comment: A single case with a homozygous (result of UPD) repeat expansion in the promoter that leads to methylation of the promoter (identified by long-read sequencing). Biallelic loss of function variants in this gene cause a mitochondrial disease.
Sources: Literature
Repeat Disorders v0.260 THAP11_SCA51_CAG Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319; 37148549
Repeat Disorders v0.259 THAP11_SCA51_CAG Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319
Repeat Disorders v0.258 AFF3_FRA2A_CGG Bryony Thompson Publications for STR: AFF3_FRA2A_CGG were set to 24763282
Repeat Disorders v0.257 DIP2B_FRA12A_CGG Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128
Repeat Disorders v0.256 THAP11_SCA51_CAG Bryony Thompson THAP11_SCA_CAG was changed to THAP11_SCA51_CAG
Repeat Disorders v0.255 PABPN1_OPMD_GCN Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready
Repeat Disorders v0.255 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Repeat Disorders v0.255 ZIC3_VACTERLX_GCC Bryony Thompson VACTERLX was changed to ZIC3_VACTERLX_GCC
Repeat Disorders v0.254 NUTM2B-AS1_OPDM_CCG Bryony Thompson NUTM2B-AS1_OPML1_CCG was changed to NUTM2B-AS1_OPDM_CCG
Repeat Disorders v0.253 NUTM2B-AS1_OPML1_CCG Bryony Thompson Classified STR: NUTM2B-AS1_OPML1_CCG as Green List (high evidence)
Repeat Disorders v0.253 NUTM2B-AS1_OPML1_CCG Bryony Thompson Str: nutm2b-as1_opml1_ccg has been classified as Green List (High Evidence).
Repeat Disorders v0.252 NUTM2B-AS1_OPML1_CCG Bryony Thompson edited their review of STR: NUTM2B-AS1_OPML1_CCG: Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.; Changed rating: GREEN; Changed publications: 31332380, 37923380, 39308795, 38159879; Changed phenotypes: Oculopharyngodistal myopathy MONDO:0025193; Set clinically relevant: yes
Repeat Disorders v0.252 NUTM2B-AS1_OPML1_CCG Bryony Thompson OPML1 was changed to NUTM2B-AS1_OPML1_CCG
Repeat Disorders v0.251 NIPA1_ALS_GCG Bryony Thompson NIPA1 was changed to NIPA1_ALS_GCG
Repeat Disorders v0.250 TMEM185A_FRAXF_GCC Bryony Thompson FRAXF was changed to TMEM185A_FRAXF_GCC
Repeat Disorders v0.249 CBL_FRA11B_CCG Bryony Thompson FRA11B was changed to CBL_FRA11B_CCG
Repeat Disorders v0.248 C11orf80_FRA11A_CGG Bryony Thompson FRA11A was changed to C11orf80_FRA11A_CGG
Repeat Disorders v0.247 TNRC6A_FAME6_TTTCA Bryony Thompson FAME6 was changed to TNRC6A_FAME6_TTTCA
Repeat Disorders v0.246 YEATS2_FAME4_TTTCA Bryony Thompson FAME4 was changed to YEATS2_FAME4_TTTCA
Repeat Disorders v0.245 SAMD12_FAME1_TTTGA Bryony Thompson FAME1_TTTGA was changed to SAMD12_FAME1_TTTGA
Repeat Disorders v0.244 THAP11_SCA_CAG Bryony Thompson SCA_THAP11_CAG was changed to THAP11_SCA_CAG
Repeat Disorders v0.243 ZNF713_FRA7A_CGG Bryony Thompson FRA7A was changed to ZNF713_FRA7A_CGG
Repeat Disorders v0.242 AFF3_FRA2A_CGG Bryony Thompson FRA2A was changed to AFF3_FRA2A_CGG
Repeat Disorders v0.241 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Repeat Disorders v0.240 RAPGEF2_FAME7_TTTCA Bryony Thompson FAME7 was changed to RAPGEF2_FAME7_TTTCA
Repeat Disorders v0.239 DMD_DMD_GAA Bryony Thompson DMD was changed to DMD_DMD_GAA
Repeat Disorders v0.238 RUNX2_CCD_GCN Bryony Thompson CCD was changed to RUNX2_CCD_GCN
Repeat Disorders v0.237 Bryony Thompson removed STR:RFC1_CANVAS_ACAGG from the panel
Repeat Disorders v0.236 RFC1_CANVAS_ANNGN Bryony Thompson edited their review of STR: RFC1_CANVAS_ANNGN: Changed publications: 30926972, 32851396, 33237689, 31230722, 33237689, 32694621, 33103729, 35355059; Set clinically relevant: no
Repeat Disorders v0.236 RFC1_CANVAS_ANNGN Bryony Thompson Publications for STR: RFC1_CANVAS_ANNGN were set to 30926972; 32851396; 33237689; 31230722; 33237689; 32694621; 33103729; 35355059
Repeat Disorders v0.235 RFC1_CANVAS_ANNGN Bryony Thompson commented on STR: RFC1_CANVAS_ANNGN: Multiple apparently pathogenic expansions now reported (AGGGC, AAGGC, AGAGG, AAAGG, ACAGG) other than the common AAGGG expansion
Repeat Disorders v0.235 RFC1_CANVAS_ANNGN Bryony Thompson RFC1_CANVAS_AAGGG was changed to RFC1_CANVAS_ANNGN
Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN.
Repeat Disorders v0.234 RFC1_CANVAS_AAGGG Bryony Thompson Publications for STR: RFC1_CANVAS_AAGGG were set to 30926972; 32851396; 33237689; 31230722
Repeat Disorders v0.233 RFC1_CANVAS_ACAGG Bryony Thompson Publications for STR: RFC1_CANVAS_ACAGG were set to 33237689; 32694621; 33103729
Repeat Disorders v0.232 RFC1_CANVAS_ACAGG Bryony Thompson Classified STR: RFC1_CANVAS_ACAGG as Green List (high evidence)
Repeat Disorders v0.232 RFC1_CANVAS_ACAGG Bryony Thompson Str: rfc1_canvas_acagg has been classified as Green List (High Evidence).
Repeat Disorders v0.231 RFC1_CANVAS_ACAGG Bryony Thompson edited their review of STR: RFC1_CANVAS_ACAGG: Added comment: Greater than 10 families reported now. Also compound heterozygote (ACAGG)exp/(AAGGG)exp cases reported.; Changed rating: GREEN; Changed publications: 33237689, 32694621, 33103729, 35355059
Repeat Disorders v0.231 RFC1_CANVAS_ACAGG Bryony Thompson CANVAS_ACAGG was changed to RFC1_CANVAS_ACAGG
Repeat Disorders v0.230 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Repeat Disorders v0.229 TBX1_TOF_GCN Bryony Thompson TOF was changed to TBX1_TOF_GCN
Repeat Disorders v0.228 HOXD13_SPD1_GCG Bryony Thompson SPD1 was changed to HOXD13_SPD1_GCG
Repeat Disorders v0.227 ATXN8OS_SCA8_CTG Bryony Thompson SCA8 was changed to ATXN8OS_SCA8_CTG
Repeat Disorders v0.226 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Repeat Disorders v0.225 CACNA1A_SCA6_CAG Bryony Thompson SCA6 was changed to CACNA1A_SCA6_CAG
Repeat Disorders v0.224 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Repeat Disorders v0.223 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Repeat Disorders v0.222 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Repeat Disorders v0.221 BEAN1_SCA31_TGGAA Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA
Repeat Disorders v0.220 ATXN3_SCA3_CAG Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG
Repeat Disorders v0.219 FGF14_SCA27B_GAA Bryony Thompson SCA27B was changed to FGF14_SCA27B_GAA
Repeat Disorders v0.218 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Repeat Disorders v0.217 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Repeat Disorders v0.216 PPP2R2B_SCA12_CAG Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG
Repeat Disorders v0.215 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Repeat Disorders v0.214 ATXN1_SCA1_CAG Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG
Repeat Disorders v0.213 AR_SBMA_CAG Bryony Thompson SBMA was changed to AR_SBMA_CAG
Repeat Disorders v0.212 EIF4A3_RCPS_complex Bryony Thompson RCPS was changed to EIF4A3_RCPS_complex
Repeat Disorders v0.211 SOX3_PHPX_GCN Bryony Thompson PHPX was changed to SOX3_PHPX_GCN
Repeat Disorders v0.210 ABCD3_OPDM_GCC Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC
Repeat Disorders v0.209 PABPN1_OPMD_GCN Bryony Thompson OPMD was changed to PABPN1_OPMD_GCN
Repeat Disorders v0.208 RILPL1_OPDM4_CGG Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG
Repeat Disorders v0.207 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Repeat Disorders v0.206 LRP12_OPDM1_CGG Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG
Repeat Disorders v0.205 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Repeat Disorders v0.204 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer
Repeat Disorders v0.203 RFC1_CANVAS_AAGGG Bryony Thompson RFC1_CANVAS_ AAGGG was changed to RFC1_CANVAS_AAGGG
Repeat Disorders v0.202 COMP_MEDPSACH_GAC Bryony Thompson MEDPSACH was changed to COMP_MEDPSACH_GAC
Repeat Disorders v0.201 PRDM12_HSAN8_GCC Bryony Thompson HSAN8 was changed to PRDM12_HSAN8_GCC
Repeat Disorders v0.200 ZIC2_HPE5_GCN Bryony Thompson HPE5 was changed to ZIC2_HPE5_GCN
Repeat Disorders v0.199 VWA1_HMNMYO_GCGCGGAGCG Bryony Thompson HMNMYO was changed to VWA1_HMNMYO_GCGCGGAGCG
Repeat Disorders v0.198 HOXA13_HFGS_GCN3 Bryony Thompson HFGS_tract3 was changed to HOXA13_HFGS_GCN3
Repeat Disorders v0.197 HOXA13_HFGS_GCN2 Bryony Thompson HFGS_tract2 was changed to HOXA13_HFGS_GCN2
Repeat Disorders v0.196 HOXA13_HFGS_GCN1 Bryony Thompson HFGS_tract1 was changed to HOXA13_HFGS_GCN1
Repeat Disorders v0.195 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Repeat Disorders v0.194 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Repeat Disorders v0.193 GLS_GDPAG_GCA Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA
Repeat Disorders v0.192 FMR1_FXTAS_CGG Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG
Repeat Disorders v0.191 FMR1_FXS_CGG Bryony Thompson FXS was changed to FMR1_FXS_CGG
Repeat Disorders v0.190 FMR1_FXPOI_CGG Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG
Repeat Disorders v0.189 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Repeat Disorders v0.188 FXN_FRDA_GAA Bryony Thompson FRDA was changed to FXN_FRDA_GAA
Repeat Disorders v0.187 AFF2_FRAXE_GCC Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC
Repeat Disorders v0.186 TCF4_FECD3_CTG Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG
Repeat Disorders v0.185 MARCH6_FAME3_TTTCA Bryony Thompson FAME3 was changed to MARCH6_FAME3_TTTCA
Repeat Disorders v0.184 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Repeat Disorders v0.183 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Repeat Disorders v0.182 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson CSTB_EPM1_dodecamer was changed to CSTB_EPM1_CCCCGCCCCGCG
Repeat Disorders v0.181 CSTB_EPM1_dodecamer Bryony Thompson CSTB_EPM1_CCCCGCCCCGCG was changed to CSTB_EPM1_dodecamer
Repeat Disorders v0.180 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson EPM1 was changed to CSTB_EPM1_CCCCGCCCCGCG
Repeat Disorders v0.179 ARX_EIEE1_GCN2 Bryony Thompson EIEE1_tract2 was changed to ARX_EIEE1_GCN2
Repeat Disorders v0.178 ARX_EIEE1_GCN1 Bryony Thompson EIEE1_tract1 was changed to ARX_EIEE1_GCN1
Repeat Disorders v0.177 ATN1_DRPLA_CAG Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG
Repeat Disorders v0.176 CNBP_DM2_CCTG Bryony Thompson DM2 was changed to CNBP_DM2_CCTG
Repeat Disorders v0.175 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Repeat Disorders v0.174 XYLT1_DBQD2_GGC Bryony Thompson DBQD2 was changed to XYLT1_DBQD2_GGC
Repeat Disorders v0.173 PRNP_CJD_octapeptide Bryony Thompson PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT was changed to PRNP_CJD_octapeptide
Repeat Disorders v0.172 PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT Bryony Thompson CJD was changed to PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT
Repeat Disorders v0.171 PHOX2B_CCHS_GCN Bryony Thompson CCHS was changed to PHOX2B_CCHS_GCN
Repeat Disorders v0.170 RFC1_CANVAS_ AAGGG Bryony Thompson CANVAS was changed to RFC1_CANVAS_ AAGGG
Repeat Disorders v0.169 FOXL2_BPES_GCN Bryony Thompson BPES was changed to FOXL2_BPES_GCN
Repeat Disorders v0.168 SCA_THAP11_CAG Zornitza Stark Phenotypes for STR: SCA_THAP11_CAG were changed from autosomal dominant cerebellar ataxia MONDO:0020380 to Spinocerebellar ataxia 51, MIM# 620947
Repeat Disorders v0.167 SCA_THAP11_CAG Zornitza Stark reviewed STR: SCA_THAP11_CAG: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Spinocerebellar ataxia 51, MIM# 620947; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Repeat Disorders v0.167 OPDM_ABCD3_GCC Bryony Thompson edited their review of STR: OPDM_ABCD3_GCC: Changed publications: 39068203
Repeat Disorders v0.167 DMD Bryony Thompson Publications for STR: DMD were set to 27417533
Repeat Disorders v0.166 FAME7 Bryony Thompson Publications for STR: FAME7 were set to 29507423
Repeat Disorders v0.165 FAME7 Bryony Thompson Classified STR: FAME7 as Amber List (moderate evidence)
Repeat Disorders v0.165 FAME7 Bryony Thompson Str: fame7 has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.164 FAME7 Bryony Thompson edited their review of STR: FAME7: Added comment: TTTCA expansion (without TTTTA expansion) identified in 3 affected individuals in a Chinese FAME family and another unrelated Japanese proband. Now 3 families reported.; Changed rating: AMBER; Changed publications: 29507423, 30351492, 33791773
Repeat Disorders v0.164 DMD Bryony Thompson changed review comment from: Another case with BMD (patient 18) form a Japanese registry was reported with an expansion of 1381–1502 repeats in intron 62.; to: Another case with BMD (patient 18) form a Japanese registry was reported with an expansion of 1381–1502 repeats in intron 62. Repeat expansion causes a splicing aberration
Repeat Disorders v0.164 DMD Bryony Thompson Classified STR: DMD as Amber List (moderate evidence)
Repeat Disorders v0.164 DMD Bryony Thompson Str: dmd has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.163 DMD Bryony Thompson edited their review of STR: DMD: Added comment: Another case with BMD (patient 18) form a Japanese registry was reported with an expansion of 1381–1502 repeats in intron 62.; Changed rating: AMBER; Changed publications: 27417533, 36048237
Repeat Disorders v0.163 HFGS_tract2 Bryony Thompson Marked STR: HFGS_tract2 as ready
Repeat Disorders v0.163 HFGS_tract2 Bryony Thompson Str: hfgs_tract2 has been classified as Green List (High Evidence).
Repeat Disorders v0.163 SCA_THAP11_CAG Bryony Thompson Marked STR: SCA_THAP11_CAG as ready
Repeat Disorders v0.163 SCA_THAP11_CAG Bryony Thompson Str: sca_thap11_cag has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.163 SCA_THAP11_CAG Bryony Thompson Classified STR: SCA_THAP11_CAG as Amber List (moderate evidence)
Repeat Disorders v0.163 SCA_THAP11_CAG Bryony Thompson Str: sca_thap11_cag has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.162 SCA_THAP11_CAG Bryony Thompson STR: SCA_THAP11_CAG was added
STR: SCA_THAP11_CAG was added to Repeat Disorders. Sources: Other
Mode of inheritance for STR: SCA_THAP11_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA_THAP11_CAG were set to 15368101; 24677642; 34165550; 38113319
Phenotypes for STR: SCA_THAP11_CAG were set to autosomal dominant cerebellar ataxia MONDO:0020380
Review for STR: SCA_THAP11_CAG was set to AMBER
Added comment: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual. A 46/29 CAG THAP11 genotype has also been identified in an individual with ataxia of European ancestry, that also had a CACNA1A pathogenic expansion which causes SCA6. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease.
Further probands/families are required to confirm the gene-disease association.
Sources: Other
Repeat Disorders v0.161 OPDM_ABCD3_GCC Bryony Thompson Marked STR: OPDM_ABCD3_GCC as ready
Repeat Disorders v0.161 OPDM_ABCD3_GCC Bryony Thompson Str: opdm_abcd3_gcc has been classified as Green List (High Evidence).
Repeat Disorders v0.161 OPDM_ABCD3_GCC Bryony Thompson Classified STR: OPDM_ABCD3_GCC as Green List (high evidence)
Repeat Disorders v0.161 OPDM_ABCD3_GCC Bryony Thompson Str: opdm_abcd3_gcc has been classified as Green List (High Evidence).
Repeat Disorders v0.160 OPDM_ABCD3_GCC Bryony Thompson STR: OPDM_ABCD3_GCC was added
STR: OPDM_ABCD3_GCC was added to Repeat Disorders. Sources: Other
Mode of inheritance for STR: OPDM_ABCD3_GCC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM_ABCD3_GCC were set to https://doi.org/10.1101/2023.10.09.23296582
Phenotypes for STR: OPDM_ABCD3_GCC were set to Oculopharyngodistal myopathy MONDO:0025193
Review for STR: OPDM_ABCD3_GCC was set to GREEN
STR: OPDM_ABCD3_GCC was marked as clinically relevant
Added comment: 35 OPDM individuals from 8 unrelated families from Australia, the UK, and France with an ABCD3 5’UTR CGG repeat. Affected individuals had repeat expansions ranging from 118-694 (n=19). 7 repeats is the median repeat size in non-neurological controls from the GE 100,000 Genome Project. 10 controls had estimated repeats >50, up to ~93. 50 repeats would be a safe cut-off for normal
Sources: Other
Repeat Disorders v0.159 SCA4_ZFHX3_GGC Bryony Thompson Marked STR: SCA4_ZFHX3_GGC as ready
Repeat Disorders v0.159 SCA4_ZFHX3_GGC Bryony Thompson Str: sca4_zfhx3_ggc has been classified as Green List (High Evidence).
Repeat Disorders v0.159 SCA4_ZFHX3_GGC Bryony Thompson Classified STR: SCA4_ZFHX3_GGC as Green List (high evidence)
Repeat Disorders v0.159 SCA4_ZFHX3_GGC Bryony Thompson Str: sca4_zfhx3_ggc has been classified as Green List (High Evidence).
Repeat Disorders v0.158 SCA4_ZFHX3_GGC Bryony Thompson STR: SCA4_ZFHX3_GGC was added
STR: SCA4_ZFHX3_GGC was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: SCA4_ZFHX3_GGC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA4_ZFHX3_GGC were set to 38035881; 38197134
Phenotypes for STR: SCA4_ZFHX3_GGC were set to spinocerebellar ataxia type 4 MONDO:0010847
Review for STR: SCA4_ZFHX3_GGC was set to GREEN
STR: SCA4_ZFHX3_GGC was marked as clinically relevant
Added comment: PMID: 38035881 - repeat expansion is identified in 5 Swedish ataxia families that developed balance and gait disturbances at 15 to 60 years of age and had sensory neuropathy and slow saccades.
PMID: 38197134 - Poly-glycine GGC expansion in the last coding exon of ZFHX3 was identified in the original SCA4 Utah pedigree (Swedish origin) in the region of high linkage identified on 16q22. The expansion was also identified in an Iowa ataxia pedigree of Swedish ancestry. The expansion wasn’t identified in 11,258 exomes, 7,650 WGS probands without neurological phenotype, or 803 individuals with ataxia. Grch38 chr16:72787695–72787758
Normal allele <30 repeats, 21 repeats is the most common (derived from 33,094 individuals)
Undefined pathogenic 30-48 repeats
Definitive pathogenicity 48+ repeats
Sources: Literature
Repeat Disorders v0.157 OPDM1 Bryony Thompson Phenotypes for STR: OPDM1 were changed from Oculopharyngodistal myopathy 1 MIM#164310 to Oculopharyngodistal myopathy 1 MIM#164310; Amyotrophic lateral sclerosis MONDO:0004976
Repeat Disorders v0.156 OPDM1 Bryony Thompson Publications for STR: OPDM1 were set to 31332380; 34047774
Repeat Disorders v0.155 OPDM1 Bryony Thompson edited their review of STR: OPDM1: Changed publications: 31332380, 34047774, 37339631
Repeat Disorders v0.155 OPDM1 Bryony Thompson edited their review of STR: OPDM1: Added comment: The CGG repeat expansion in the 5’UTR of LRP12 was identified in 5 ALS families and 2 simplex cases. 61-100 repeats associated with ALS, whereas >100 repeats causes OPDM. Toxic gain-of-function is the mechanism of disease. Authors’ suggest the differences in the levels of toxic RNA and MBNL1 dysfunction, in turn dependent on repeat length, may determine whether the affected individual develops ALS or OPDM; Changed phenotypes: Oculopharyngodistal myopathy 1 MIM#164310, Amyotrophic lateral sclerosis MONDO:0004976
Repeat Disorders v0.155 MRUPAV Bryony Thompson Marked STR: MRUPAV as ready
Repeat Disorders v0.155 MRUPAV Bryony Thompson Str: mrupav has been classified as Green List (High Evidence).
Repeat Disorders v0.155 MRUPAV Bryony Thompson Classified STR: MRUPAV as Green List (high evidence)
Repeat Disorders v0.155 MRUPAV Bryony Thompson Str: mrupav has been classified as Green List (High Evidence).
Repeat Disorders v0.154 MRUPAV Bryony Thompson STR: MRUPAV was added
STR: MRUPAV was added to Repeat Disorders. Sources: Literature
adult-onset tags were added to STR: MRUPAV.
Mode of inheritance for STR: MRUPAV was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: MRUPAV were set to 32451610; 37145156; 36151849; 35499779
Phenotypes for STR: MRUPAV were set to myopathy, distal, with rimmed vacuoles MONDO:0014945
Review for STR: MRUPAV was set to GREEN
STR: MRUPAV was marked as clinically relevant
Added comment: Expansion of 33-mer (33 amino acids, 99 bp) identified in coding exon 3 (exon 5) of PLIN4 via linkage analysis and long read sequencing in a large Italian cohort with progressive myopathy with specific pathology including rimmed ubiquitin-positive autophagic vacuolation.
Suggested disease name myopathy with rimmed ubiquitin-positive autophagic vacuolation (MRUPAV)
An additional 4 unrelated Chinese families/probands were reported.
Normal PLIN4 alleles: 27-31 x 33-mer
Pathogenic: ≥39 x 33-mer
Sources: Literature
Repeat Disorders v0.153 SCA27B Bryony Thompson Marked STR: SCA27B as ready
Repeat Disorders v0.153 SCA27B Bryony Thompson Str: sca27b has been classified as Green List (High Evidence).
Repeat Disorders v0.153 SCA27B Bryony Thompson Classified STR: SCA27B as Green List (high evidence)
Repeat Disorders v0.153 SCA27B Bryony Thompson Str: sca27b has been classified as Green List (High Evidence).
Repeat Disorders v0.152 SCA27B Bryony Thompson STR: SCA27B was added
STR: SCA27B was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: SCA27B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA27B were set to 37165652; 36516086; 36493768
Phenotypes for STR: SCA27B were set to Spinocerebellar ataxia type 27B MONDO:0012247; Spinocerebellar ataxia 50; late-onset cerebellar ataxias (LOCAs)
Review for STR: SCA27B was set to GREEN
STR: SCA27B was marked as clinically relevant
Added comment: NM_175929.3(FGF14):c.208+239747CTT[X]
Expansions of 250 or more GAA repeat units were associated with late-onset cerebellar ataxia in a French-Canadian (OR: 105.60 [95% CI=31.09-334.20], p<0.001) and a German (OR: 8.76 [95% CI=3.45-20.84], p<0.001) case-control series. Additionally, expanded alleles greater than (GAA)332 are pathogenic and fully penetrant in a combined Australian and German dataset (p = 6.0 × 10−8, OR = 72 [95% CI = 4.3–1,227]). Whereas, alleles in the range of (GAA)250-334 are likely to be pathogenic with reduced penetrance (p = 0.0015, OR = 3.6 [95% CI = 1.6–7.9]).
250-300 repeats in the incompletely penetrant range
>300 is fully penetrant for ataxia
Sources: Literature
Repeat Disorders v0.151 OPDM4 Bryony Thompson Publications for STR: OPDM4 were set to 35148830
Repeat Disorders v0.150 OPDM4 Bryony Thompson Marked STR: OPDM4 as ready
Repeat Disorders v0.150 OPDM4 Bryony Thompson Str: opdm4 has been classified as Green List (High Evidence).
Repeat Disorders v0.150 OPDM4 Bryony Thompson Classified STR: OPDM4 as Green List (high evidence)
Repeat Disorders v0.150 OPDM4 Bryony Thompson Str: opdm4 has been classified as Green List (High Evidence).
Repeat Disorders v0.149 OPDM4 Bryony Thompson STR: OPDM4 was added
STR: OPDM4 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: OPDM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM4 were set to 35148830
Phenotypes for STR: OPDM4 were set to Oculopharyngodistal myopathy MONDO:0025193
Review for STR: OPDM4 was set to GREEN
STR: OPDM4 was marked as clinically relevant
Added comment: 5'UTR repeat upstream of RILPL1. Analyses suggest that toxic RNA gain-of-function is the mechanism of disease for the repeat expansion.
Distribution of CGG repeat units in RILPL1 ranged from 9 to 16 among 200 normal controls. The size of the CGG repeat ranged from 139 to 197 (169.91 ± 21.82) repeats in 11 unrelated individuals with OPDM. Segregation evidence from 1 family, with 2 affected individuals with the repeat expansion and 1 individual with essential tremor but not OPDM and 86 repeats (intermediate).
Sources: Literature
Repeat Disorders v0.148 FRA7A Bryony Thompson edited their review of STR: FRA7A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 5-53 repeats, with a median of 13.; Changed publications: 25196122, 33510257
Repeat Disorders v0.148 FRA2A Bryony Thompson edited their review of STR: FRA2A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 1-64 repeats, with a median of 16.; Changed publications: 24763282, 33510257
Repeat Disorders v0.148 FRA12A Bryony Thompson edited their review of STR: FRA12A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 8-120 repeats, with a median of 8.; Changed publications: 17236128, 33510257
Repeat Disorders v0.148 FRA7A Bryony Thompson Classified STR: FRA7A as Amber List (moderate evidence)
Repeat Disorders v0.148 FRA7A Bryony Thompson Str: fra7a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.147 OPDM1 Zornitza Stark Tag adult-onset tag was added to STR: OPDM1.
Repeat Disorders v0.147 NIID Zornitza Stark Tag adult-onset tag was added to STR: NIID.
Repeat Disorders v0.147 Zornitza Stark Panel types changed to Australian Genomics; Royal Melbourne Hospital; Rare Disease
Repeat Disorders v0.146 VACTERLX Zornitza Stark Tag paediatric-onset tag was added to STR: VACTERLX.
Repeat Disorders v0.146 OPML1 Zornitza Stark Tag adult-onset tag was added to STR: OPML1.
Repeat Disorders v0.146 NIPA1 Zornitza Stark Marked STR: NIPA1 as ready
Repeat Disorders v0.146 NIPA1 Zornitza Stark Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.146 NIPA1 Zornitza Stark Tag adult-onset tag was added to STR: NIPA1.
Repeat Disorders v0.146 FRAXF Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXF.
Repeat Disorders v0.146 FRA7A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA7A.
Repeat Disorders v0.146 FRA11B Zornitza Stark Marked STR: FRA11B as ready
Repeat Disorders v0.146 FRA11B Zornitza Stark Str: fra11b has been classified as Red List (Low Evidence).
Repeat Disorders v0.146 FRA11B Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11B.
Repeat Disorders v0.146 FRA11A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11A.
Repeat Disorders v0.146 FAME7 Zornitza Stark Tag adult-onset tag was added to STR: FAME7.
Repeat Disorders v0.146 FAME6 Zornitza Stark Tag adult-onset tag was added to STR: FAME6.
Repeat Disorders v0.146 FAME4 Zornitza Stark Tag adult-onset tag was added to STR: FAME4.
Repeat Disorders v0.146 DMD Zornitza Stark Tag adult-onset tag was added to STR: DMD.
Tag paediatric-onset tag was added to STR: DMD.
Repeat Disorders v0.146 FRA2A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA2A.
Repeat Disorders v0.146 FRA12A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA12A.
Repeat Disorders v0.146 CCD Zornitza Stark Marked STR: CCD as ready
Repeat Disorders v0.146 CCD Zornitza Stark Str: ccd has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.146 CCD Zornitza Stark Tag paediatric-onset tag was added to STR: CCD.
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Marked STR: CANVAS_ACAGG as ready
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Str: canvas_acagg has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Tag adult-onset tag was added to STR: CANVAS_ACAGG.
Repeat Disorders v0.146 XDP Zornitza Stark Tag adult-onset tag was added to STR: XDP.
Repeat Disorders v0.146 TOF Zornitza Stark Tag paediatric-onset tag was added to STR: TOF.
Repeat Disorders v0.146 SPD1 Zornitza Stark Tag paediatric-onset tag was added to STR: SPD1.
Repeat Disorders v0.146 SCA8 Zornitza Stark Tag adult-onset tag was added to STR: SCA8.
Repeat Disorders v0.146 SCA7 Zornitza Stark Tag adult-onset tag was added to STR: SCA7.
Repeat Disorders v0.146 SCA6 Zornitza Stark Tag adult-onset tag was added to STR: SCA6.
Repeat Disorders v0.146 SCA37 Zornitza Stark Tag adult-onset tag was added to STR: SCA37.
Repeat Disorders v0.146 SCA36 Zornitza Stark Tag adult-onset tag was added to STR: SCA36.
Repeat Disorders v0.146 SCA31 Zornitza Stark Tag adult-onset tag was added to STR: SCA31.
Repeat Disorders v0.146 SCA3 Zornitza Stark Tag adult-onset tag was added to STR: SCA3.
Tag paediatric-onset tag was added to STR: SCA3.
Repeat Disorders v0.146 SCA2 Zornitza Stark Tag adult-onset tag was added to STR: SCA2.
Tag paediatric-onset tag was added to STR: SCA2.
Repeat Disorders v0.146 SCA17 Zornitza Stark Tag adult-onset tag was added to STR: SCA17.
Tag paediatric-onset tag was added to STR: SCA17.
Repeat Disorders v0.146 SCA12 Zornitza Stark Tag adult-onset tag was added to STR: SCA12.
Tag paediatric-onset tag was added to STR: SCA12.
Repeat Disorders v0.146 SCA10 Zornitza Stark Tag adult-onset tag was added to STR: SCA10.
Repeat Disorders v0.146 SCA1 Zornitza Stark Tag adult-onset tag was added to STR: SCA1.
Repeat Disorders v0.146 SBMA Zornitza Stark Tag adult-onset tag was added to STR: SBMA.
Repeat Disorders v0.146 RCPS Zornitza Stark Tag paediatric-onset tag was added to STR: RCPS.
Repeat Disorders v0.146 CCHS Zornitza Stark Marked STR: CCHS as ready
Repeat Disorders v0.146 CCHS Zornitza Stark Str: cchs has been classified as Green List (High Evidence).
Repeat Disorders v0.146 Bryony Thompson Panel status changed from internal to public
Repeat Disorders v0.145 OPMD Zornitza Stark Tag adult-onset tag was added to STR: OPMD.
Repeat Disorders v0.145 OPDM2 Zornitza Stark Tag adult-onset tag was added to STR: OPDM2.
Repeat Disorders v0.145 MEDPSACH Zornitza Stark Tag paediatric-onset tag was added to STR: MEDPSACH.
Repeat Disorders v0.145 HSAN8 Zornitza Stark Tag paediatric-onset tag was added to STR: HSAN8.
Repeat Disorders v0.145 FRA2A Bryony Thompson Marked STR: FRA2A as ready
Repeat Disorders v0.145 FRA2A Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.145 FRA2A Bryony Thompson Classified STR: FRA2A as Amber List (moderate evidence)
Repeat Disorders v0.145 FRA2A Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.144 FRA2A Bryony Thompson STR: FRA2A was added
STR: FRA2A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA2A were set to 24763282
Phenotypes for STR: FRA2A were set to Neurodevelopmental delay
Review for STR: FRA2A was set to AMBER
Added comment: Three families with a wide spectrum of neurodevelopmental phenotypes with expression of folate-sensitive fragile site FRA2A. The CGG repeat is in an alternative promoter for AFF3, active in the brain. Expansion of >300 repeats causes expression of FRA2A and is associated with hypermethylation and silencing of AFF3 in at least one individual. There were 3-20 repeats in normal controls.
Sources: Literature
Repeat Disorders v0.143 FRA7A Bryony Thompson Marked STR: FRA7A as ready
Repeat Disorders v0.143 FRA7A Bryony Thompson Str: fra7a has been classified as Red List (Low Evidence).
Repeat Disorders v0.143 FRA7A Bryony Thompson STR: FRA7A was added
STR: FRA7A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA7A were set to 25196122
Phenotypes for STR: FRA7A were set to Autism spectrum disorder
Review for STR: FRA7A was set to AMBER
Added comment: A de novo occurrence of the 7p11.2 folate-sensitive fragile site FRA7A in a male with an autistic spectrum disorder (ASD) due to a CGG-repeat expansion mutation (∼450 repeats) in a 5' intron of ZNF713. The expanded allele showed hypermethylation of the adjacent CpG island and reduced ZNF713 expression observed in a proband-derived lymphoblastoid cell line. The probands mother had a pre-mutation with 85 repeats. Controls showed a CGG-repeat range of 5 to 22. In a second family a pre-mutation (66-72) was identified in 3 siblings with ASD and an unaffected father. One of the siblings had mitotic instability.
Sources: Literature
Repeat Disorders v0.142 VACTERLX Bryony Thompson Marked STR: VACTERLX as ready
Repeat Disorders v0.142 VACTERLX Bryony Thompson Str: vacterlx has been classified as Red List (Low Evidence).
Repeat Disorders v0.142 VACTERLX Bryony Thompson STR: VACTERLX was added
STR: VACTERLX was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: VACTERLX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: VACTERLX were set to 20452998; 32639022
Phenotypes for STR: VACTERLX were set to VACTERL association, X-linked MIM#314390
Review for STR: VACTERLX was set to RED
Added comment: NM_003413.4(ZIC3):c.163GCC[X]
PMID: 20452998 - reports a single case with VACTERL association and an expansion of the poly-Ala tract from 10 to 12 alanines.
PMID: 32639022 - a family with Oculo-auriculo-vertebral spectrum (OAVS) segregates the 11 alanine expansion in affected males
This polyalanine tract is highly polymorphic in gnomAD v2.1, there are 86 hemizygote 12 alanine expansions present and 65 hemizygotes with the 11 alanine expansion. The 13 polyalanine expansion is also present in 13 hemizygotes.
Sources: Literature
Repeat Disorders v0.141 FRA12A Bryony Thompson Marked STR: FRA12A as ready
Repeat Disorders v0.141 FRA12A Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.141 FRA12A Bryony Thompson Classified STR: FRA12A as Amber List (moderate evidence)
Repeat Disorders v0.141 FRA12A Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.140 FRA12A Bryony Thompson STR: FRA12A was added
STR: FRA12A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA12A were set to 17236128
Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630
Review for STR: FRA12A was set to AMBER
Added comment: NM_173602.2:c.-137CGG[X]
All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp.
70 controls used to determine the "normal" repeat range.
Sources: Literature
Repeat Disorders v0.139 FRA11A Bryony Thompson Marked STR: FRA11A as ready
Repeat Disorders v0.139 FRA11A Bryony Thompson Str: fra11a has been classified as Red List (Low Evidence).
Repeat Disorders v0.139 FRA11A Bryony Thompson STR: FRA11A was added
STR: FRA11A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA11A was set to Unknown
Publications for STR: FRA11A were set to 18160775; 453198
Phenotypes for STR: FRA11A were set to Intellectual disability
Review for STR: FRA11A was set to RED
Added comment: Expansion of a polymorphic CGG-repeat located at the 5' end of the C11orf80 gene causes expression of the folate-sensitive fragile site FRA11A. The CGG-repeat elongation coincides with hypermethylation of the adjacent CpG island and subsequent transcriptional silencing of the C11orf80 gene. The expansion was identified in the 15-year-old proband with intellectual disability as well as in phenotypically normal members of the family.
Sources: Literature
Repeat Disorders v0.138 TOF Bryony Thompson Marked STR: TOF as ready
Repeat Disorders v0.138 TOF Bryony Thompson Str: tof has been classified as Green List (High Evidence).
Repeat Disorders v0.138 TOF Bryony Thompson Classified STR: TOF as Green List (high evidence)
Repeat Disorders v0.138 TOF Bryony Thompson Str: tof has been classified as Green List (High Evidence).
Repeat Disorders v0.137 TOF Bryony Thompson STR: TOF was added
STR: TOF was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: TOF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: TOF were set to 19948535; 11748311
Phenotypes for STR: TOF were set to Tetralogy of Fallot MIM#187500
Review for STR: TOF was set to GREEN
STR: TOF was marked as clinically relevant
Added comment: Poly-alanine tract expansion. In vitro functional assays demonstrated the expansion lead to protein aggregation in cells. Two unrelated cases reported with 25 repeats, one case with isolated interrupted aortic arch and one case with scoliosis, facial asymmetry, upslanting
palpebral fissures, absent PV, isolated left pulmonary artery (expected de novo - excluded in mother and father not available for testing). Other variant types cause disease in this gene.
Sources: Literature
Repeat Disorders v0.136 FRAXF Bryony Thompson Marked STR: FRAXF as ready
Repeat Disorders v0.136 FRAXF Bryony Thompson Str: fraxf has been classified as Red List (Low Evidence).
Repeat Disorders v0.136 FRAXF Bryony Thompson STR: FRAXF was added
STR: FRAXF was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRAXF was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXF were set to 7874164; 10094554; 8651274
Phenotypes for STR: FRAXF were set to Intellectual disability
Review for STR: FRAXF was set to RED
Added comment: FRAXF is a folate-sensitive fragile site, where expansion was identified in a male with developmental delay. However, further studies found that expression of the fragile site through expansion is not associated with a disease phenotype.
Sources: Literature
Repeat Disorders v0.135 FRA11B Bryony Thompson Classified STR: FRA11B as Red List (low evidence)
Repeat Disorders v0.135 FRA11B Bryony Thompson Added comment: Comment on list classification: Low evidence of clinical relevance of expression of the fragile site.
Repeat Disorders v0.135 FRA11B Bryony Thompson Str: fra11b has been classified as Red List (Low Evidence).
Repeat Disorders v0.134 FRA11B Bryony Thompson STR: FRA11B was added
STR: FRA11B was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA11B were set to 7881408; 7603564; 9508241; 9927483; 10767345; 11076037; 19267933
Phenotypes for STR: FRA11B were set to Jacobsen syndrome MIM#147791
Review for STR: FRA11B was set to AMBER
Added comment: FRA11B is a rare folate sensitive fragile site caused by expansion of (CCG)n in the 5'UTR of CBL, and hypermethylation of adjacent CpG islands. There are commonly 11 repeats. The pre-mutation ranges from 80-100, while >100 leads to expression of the fragile site. Two cases of Jacobsen (llq-) syndrome, which is the clinical presentation of the loss of part of the long arm of chromosome 11, have been associated with the FRA11B repeat expansion (expected breakpoint). The estimated prevalence of the FRA11B expansion is 1 in 5,000, which the estimated prevalence of Jacobsen syndrome is <1 in 100,000.
Sources: Literature
Repeat Disorders v0.133 NIPA1 Bryony Thompson Classified STR: NIPA1 as Red List (low evidence)
Repeat Disorders v0.133 NIPA1 Bryony Thompson Added comment: Comment on list classification: This is an association/risk allele rather than high-risk disease-causing expansion, and not useful in the clinical diagnostic setting.
Repeat Disorders v0.133 NIPA1 Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.132 NIPA1 Bryony Thompson Deleted their comment
Repeat Disorders v0.132 NIPA1 Bryony Thompson Classified STR: NIPA1 as Red List (low evidence)
Repeat Disorders v0.132 NIPA1 Bryony Thompson Added comment: Comment on list classification: The odds ratio associated with the expansion of this repeat is not high-risk or high-penetrance, and not useful in the clinical diagnostic setting.
Repeat Disorders v0.132 NIPA1 Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.131 NIPA1 Bryony Thompson STR: NIPA1 was added
STR: NIPA1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NIPA1 was set to Unknown
Publications for STR: NIPA1 were set to 30342764; 22378146
Phenotypes for STR: NIPA1 were set to Amyotrophic lateral sclerosis
Review for STR: NIPA1 was set to GREEN
Added comment: Meta-analysis on a total of 6245 patients with ALS and 5051 controls showed an overall increased risk of ALS in those with expanded (>8) GCG repeat length, odds ratio = 1.50, p = 3.8×10-5.
Sources: Literature
Repeat Disorders v0.130 HSAN8 Bryony Thompson Marked STR: HSAN8 as ready
Repeat Disorders v0.130 HSAN8 Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence).
Repeat Disorders v0.130 HSAN8 Bryony Thompson Classified STR: HSAN8 as Green List (high evidence)
Repeat Disorders v0.130 HSAN8 Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence).
Repeat Disorders v0.129 HSAN8 Bryony Thompson STR: HSAN8 was added
STR: HSAN8 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: HSAN8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: HSAN8 were set to 26005867
Phenotypes for STR: HSAN8 were set to Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488
Review for STR: HSAN8 was set to GREEN
STR: HSAN8 was marked as clinically relevant
Added comment: NM_021619.3(PRDM12):c.1041CGC[X]
Poly-Ala repeat, with 7-14 repeats identified in controls. A large consanguineous Pakastani family with HSAN segregating a homozygous expansion from 12 to 19 residues, and an Irish family with HSAN segregating a expansion from 12 to 18 residues. In vitro functional expression studies in COS-7 cells showed that the polyalanine expansions resulted in reduced protein expression and caused discrete, concentrated foci to form in the nucleus and cytoplasm. SNVs also cause disease.
Sources: Literature
Repeat Disorders v0.128 RCPS Bryony Thompson changed review comment from: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature; to: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Repeat Disorders v0.128 RCPS Bryony Thompson Marked STR: RCPS as ready
Repeat Disorders v0.128 RCPS Bryony Thompson Str: rcps has been classified as Green List (High Evidence).
Repeat Disorders v0.128 RCPS Bryony Thompson Classified STR: RCPS as Green List (high evidence)
Repeat Disorders v0.128 RCPS Bryony Thompson Str: rcps has been classified as Green List (High Evidence).
Repeat Disorders v0.127 RCPS Bryony Thompson STR: RCPS was added
STR: RCPS was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RCPS were set to 24360810; 29112243
Phenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: RCPS was set to GREEN
STR: RCPS was marked as clinically relevant
Added comment: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Marked STR: MEDPSACH as ready
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Str: medpsach has been classified as Green List (High Evidence).
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Classified STR: MEDPSACH as Green List (high evidence)
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Str: medpsach has been classified as Green List (High Evidence).
Repeat Disorders v0.125 MEDPSACH Bryony Thompson STR: MEDPSACH was added
STR: MEDPSACH was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: MEDPSACH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: MEDPSACH were set to 9887340; 17133256; 21922596
Phenotypes for STR: MEDPSACH were set to Epiphyseal dysplasia, multiple, 1 MIM#132400; Pseudoachondroplasia MIM#177170
Review for STR: MEDPSACH was set to GREEN
STR: MEDPSACH was marked as clinically relevant
STR: MEDPSACH was marked as current diagnostic
Added comment: At least 5 cases reported with 6 or 7 GAC repeats. 5 repeats is normal. Deletion/contraction of the repeat is also reported. Other SNV and small indels are reported as disease-causing in this gene.
Sources: Literature
Repeat Disorders v0.124 DMD Bryony Thompson Marked STR: DMD as ready
Repeat Disorders v0.124 DMD Bryony Thompson Str: dmd has been classified as Red List (Low Evidence).
Repeat Disorders v0.124 DMD Bryony Thompson STR: DMD was added
STR: DMD was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: DMD was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: DMD were set to 27417533
Phenotypes for STR: DMD were set to Duchenne muscular dystrophy MIM#310200; Becker muscular dystrophy MIM#300376
Review for STR: DMD was set to RED
Added comment: Single family reported with GAA repeat expansion in intron 62. Normal repeat range 11-33 in healthy controls. Expanded repeats range from 59-82 in the family, with 2 female carriers manifesting symptoms, a male foetus, 2 asymptomatic female carriers, and 2 male asymptomatic carriers ages 6 and 4 years.
Sources: Literature
Repeat Disorders v0.123 PHPX Zornitza Stark Tag paediatric-onset tag was added to STR: PHPX.
Repeat Disorders v0.123 HPE5 Zornitza Stark Tag paediatric-onset tag was added to STR: HPE5.
Repeat Disorders v0.123 HMNMYO Zornitza Stark Tag paediatric-onset tag was added to STR: HMNMYO.
Repeat Disorders v0.123 HFGS_tract3 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract3.
Repeat Disorders v0.123 HFGS_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract2.
Repeat Disorders v0.123 HFGS_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract1.
Repeat Disorders v0.123 HDL2 Zornitza Stark Tag adult-onset tag was added to STR: HDL2.
Repeat Disorders v0.123 HD Zornitza Stark Tag adult-onset tag was added to STR: HD.
Repeat Disorders v0.123 GDPAG Zornitza Stark Tag paediatric-onset tag was added to STR: GDPAG.
Repeat Disorders v0.123 FXTAS Zornitza Stark Tag adult-onset tag was added to STR: FXTAS.
Repeat Disorders v0.123 FXS Zornitza Stark Tag paediatric-onset tag was added to STR: FXS.
Repeat Disorders v0.123 FXPOI Zornitza Stark Tag adult-onset tag was added to STR: FXPOI.
Repeat Disorders v0.123 FTDALS Zornitza Stark Tag adult-onset tag was added to STR: FTDALS.
Repeat Disorders v0.123 FRDA Zornitza Stark Tag paediatric-onset tag was added to STR: FRDA.
Repeat Disorders v0.123 FRAXE Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXE.
Repeat Disorders v0.123 FECD3 Zornitza Stark Tag adult-onset tag was added to STR: FECD3.
Repeat Disorders v0.123 FAME3 Zornitza Stark Tag adult-onset tag was added to STR: FAME3.
Repeat Disorders v0.123 FAME2 Zornitza Stark Tag adult-onset tag was added to STR: FAME2.
Repeat Disorders v0.123 FAME1 Zornitza Stark Tag adult-onset tag was added to STR: FAME1.
Repeat Disorders v0.123 EPM1 Zornitza Stark Tag paediatric-onset tag was added to STR: EPM1.
Repeat Disorders v0.123 EIEE1_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract2.
Repeat Disorders v0.123 EIEE1_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract1.
Repeat Disorders v0.123 DRPLA Zornitza Stark Tag adult-onset tag was added to STR: DRPLA.
Tag paediatric-onset tag was added to STR: DRPLA.
Repeat Disorders v0.123 DM2 Zornitza Stark Tag adult-onset tag was added to STR: DM2.
Repeat Disorders v0.123 DM1 Zornitza Stark Tag adult-onset tag was added to STR: DM1.
Tag paediatric-onset tag was added to STR: DM1.
Repeat Disorders v0.123 DBQD2 Zornitza Stark Tag paediatric-onset tag was added to STR: DBQD2.
Repeat Disorders v0.123 CJD Zornitza Stark Tag adult-onset tag was added to STR: CJD.
Repeat Disorders v0.123 CCHS Zornitza Stark Tag paediatric-onset tag was added to STR: CCHS.
Repeat Disorders v0.123 CANVAS Zornitza Stark Tag adult-onset tag was added to STR: CANVAS.
Repeat Disorders v0.123 BPES Zornitza Stark Tag paediatric-onset tag was added to STR: BPES.
Repeat Disorders v0.123 CJD Bryony Thompson Marked STR: CJD as ready
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.123 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.122 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Repeat Disorders v0.121 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.121 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.120 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Expert list
Repeat Disorders v0.119 FAME3 Bryony Thompson Marked STR: FAME3 as ready
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Classified STR: FAME3 as Green List (high evidence)
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.118 FAME3 Bryony Thompson STR: FAME3 was added
STR: FAME3 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME3 were set to 31664039
Phenotypes for STR: FAME3 were set to Epilepsy, familial adult myoclonic, 3 MIM#613608
Review for STR: FAME3 was set to GREEN
STR: FAME3 was marked as clinically relevant
Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells.
Sources: Literature
Repeat Disorders v0.117 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.117 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.116 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Repeat Disorders v0.115 FAME4 Bryony Thompson Marked STR: FAME4 as ready
Repeat Disorders v0.115 FAME4 Bryony Thompson Str: fame4 has been classified as Red List (Low Evidence).
Repeat Disorders v0.115 FAME4 Bryony Thompson STR: FAME4 was added
STR: FAME4 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME4 were set to 31539032
Phenotypes for STR: FAME4 were set to Epilepsy, myoclonic, familial adult, 4 MIM#615127
Review for STR: FAME4 was set to RED
Added comment: 13 affected members of a single Thai family with familial adult myoclonic epilepsy-4 with a heterozygous (TTTTA)n/TTTCA(n) repeat expansion in intron 1 of the YEATS2 gene. 1 affected family member was estimated to be (TTTTA)819/(TTTCA)221, whereas a control had (TTTTA)7/(TTTTA)8. No functional analysis, but RNA toxicity is expected to be the mechanism of disease.
Sources: Literature
Repeat Disorders v0.114 OPML1 Bryony Thompson Marked STR: OPML1 as ready
Repeat Disorders v0.114 OPML1 Bryony Thompson Str: opml1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.114 OPML1 Bryony Thompson STR: OPML1 was added
STR: OPML1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: OPML1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPML1 were set to 31332380
Phenotypes for STR: OPML1 were set to Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637
Review for STR: OPML1 was set to RED
Added comment: NR_120611.1:n.192CCG[X]
4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60.
Sources: Literature
Repeat Disorders v0.113 OPDM1 Bryony Thompson Marked STR: OPDM1 as ready
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.113 OPDM1 Bryony Thompson Classified STR: OPDM1 as Green List (high evidence)
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.112 OPDM1 Bryony Thompson STR: OPDM1 was added
STR: OPDM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM1 were set to 31332380; 34047774
Phenotypes for STR: OPDM1 were set to Oculopharyngodistal myopathy 1 MIM#164310
Review for STR: OPDM1 was set to GREEN
STR: OPDM1 was marked as clinically relevant
Added comment: NM_013437.5:c.-102CGG[X]
RNA-mediated toxicity is thought to be the mechanism of disease. Sixty-five Japanese patients with oculopharyngodistal myopathy (OPDM) from 59 families with CGG repeat expansions in LRP12. This represents the most common OPDM subtype among all patients in Japan with genetically diagnosed OPDM.
Normal: 13 to 45 repeats.
Pathogenic: 85 to 289 repeats.
Sources: Expert list
Repeat Disorders v0.111 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.111 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.110 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Expert list
Repeat Disorders v0.109 Bryony Thompson removed STR:NIID from the panel
Repeat Disorders v0.108 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.108 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.108 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.108 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.107 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 7-60
Pathogenic repeat range: >=61-500
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Repeat Disorders v0.106 GDPAG Bryony Thompson Marked STR: GDPAG as ready
Repeat Disorders v0.106 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Repeat Disorders v0.106 GDPAG Bryony Thompson Classified STR: GDPAG as Green List (high evidence)
Repeat Disorders v0.106 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Repeat Disorders v0.105 GDPAG Bryony Thompson STR: GDPAG was added
STR: GDPAG was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GDPAG were set to 30970188
Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GDPAG was set to GREEN
STR: GDPAG was marked as clinically relevant
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Literature
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson Marked STR: FAME1_TTTGA as ready
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson Str: fame1_tttga has been classified as Red List (Low Evidence).
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson STR: FAME1_TTTGA was added
STR: FAME1_TTTGA was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME1_TTTGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME1_TTTGA were set to 31483537
Phenotypes for STR: FAME1_TTTGA were set to familial cortical myoclonic tremor with epilepsy
Review for STR: FAME1_TTTGA was set to RED
Added comment: A single family with 2 cases and 1 asymptomatic carrier with the repeat allele (TTTTA)114-123 (TTTGA)108-116, instead of the TTTCA FAME1 repeat.
Sources: Literature
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Classified STR: CANVAS_ACAGG as Amber List (moderate evidence)
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Added comment: Comment on list classification: Used the pathogenic cut-off of 400 repeats from original CANVAS repeat
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Str: canvas_acagg has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.102 CANVAS_ACAGG Bryony Thompson STR: CANVAS_ACAGG was added
STR: CANVAS_ACAGG was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: CANVAS_ACAGG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS_ACAGG were set to 33237689; 32694621; 33103729
Phenotypes for STR: CANVAS_ACAGG were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome; fasciculations; elevated serum creatine kinase levels; denervation
Review for STR: CANVAS_ACAGG was set to AMBER
Added comment: A novel RFC1 repeat expansion motif, (ACAGG)exp, identified in three affected individuals from 2 families in an Asian-Pacific cohort and one Japanese individual for CANVAS. Southern blot was used to identify the repeat was ~1000kb in one of the cases, equivalent to ~1000 repeats.
Sources: Literature
Repeat Disorders v0.101 CANVAS Bryony Thompson Marked STR: CANVAS as ready
Repeat Disorders v0.101 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Repeat Disorders v0.101 CANVAS Bryony Thompson Classified STR: CANVAS as Green List (high evidence)
Repeat Disorders v0.101 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Repeat Disorders v0.100 CANVAS Bryony Thompson STR: CANVAS was added
STR: CANVAS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS were set to 30926972; 32851396; 33237689; 31230722
Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575
Review for STR: CANVAS was set to GREEN
STR: CANVAS was marked as clinically relevant
Added comment: NM_001204747​.1:c.132+2923_2927AAAAG[X]
Simple tandem repeat (AAAAG)n replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Maori population-specific CANVAS configuration (AAAGG)10-25(AAGGG)exp. (AAAGG)n repeat alone is not pathogenic. Mechanism of disease is unknown.
Normal: AAAAG 11 repeats (allele frequency = 0.75); AAAAG 12-200 (allele frequency = 0.13); AAAGG 40-1000 (allele frequency = 0.08)
Pathogenic: AAGGG repeat expansion, most frequently ranging from 400 to more than 2000 repeats (allele frequency = 0.01-0.04)
Sources: Expert list
Repeat Disorders v0.99 DBQD2 Bryony Thompson Marked STR: DBQD2 as ready
Repeat Disorders v0.99 DBQD2 Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence).
Repeat Disorders v0.99 DBQD2 Bryony Thompson Classified STR: DBQD2 as Green List (high evidence)
Repeat Disorders v0.99 DBQD2 Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence).
Repeat Disorders v0.98 DBQD2 Bryony Thompson STR: DBQD2 was added
STR: DBQD2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DBQD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: DBQD2 were set to 30554721
Phenotypes for STR: DBQD2 were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: DBQD2 was set to GREEN
STR: DBQD2 was marked as clinically relevant
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Expert list
Repeat Disorders v0.97 FAME7 Bryony Thompson Marked STR: FAME7 as ready
Repeat Disorders v0.97 FAME7 Bryony Thompson Str: fame7 has been classified as Red List (Low Evidence).
Repeat Disorders v0.97 FAME7 Bryony Thompson STR: FAME7 was added
STR: FAME7 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME7 were set to 29507423
Phenotypes for STR: FAME7 were set to Epilepsy, familial adult myoclonic, 7 MIM#618075
Review for STR: FAME7 was set to RED
Added comment: The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Repeat Disorders v0.96 FAME6 Bryony Thompson Marked STR: FAME6 as ready
Repeat Disorders v0.96 FAME6 Bryony Thompson Str: fame6 has been classified as Red List (Low Evidence).
Repeat Disorders v0.96 FAME6 Bryony Thompson STR: FAME6 was added
STR: FAME6 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME6 were set to 29507423
Phenotypes for STR: FAME6 were set to Epilepsy, familial adult myoclonic, 6 MIM#618074
Review for STR: FAME6 was set to RED
Added comment: The expanded (TTTTA)22(TTTCA)exp(TTTTA)exp allele was identified 5 affected carriers in a single family. (TTTTA)18 is the reference repeats. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Repeat Disorders v0.95 FAME1 Bryony Thompson changed review comment from: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list; to: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Repeat Disorders v0.95 FAME1 Bryony Thompson Marked STR: FAME1 as ready
Repeat Disorders v0.95 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Repeat Disorders v0.95 FAME1 Bryony Thompson Classified STR: FAME1 as Green List (high evidence)
Repeat Disorders v0.95 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Repeat Disorders v0.94 FAME1 Bryony Thompson STR: FAME1 was added
STR: FAME1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for STR: FAME1 were set to 30194086; 29507423
Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068
Review for STR: FAME1 was set to GREEN
STR: FAME1 was marked as clinically relevant
Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Repeat Disorders v0.93 SPD1 Bryony Thompson Marked STR: SPD1 as ready
Repeat Disorders v0.93 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.93 SPD1 Bryony Thompson Classified STR: SPD1 as Green List (high evidence)
Repeat Disorders v0.93 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.92 SPD1 Bryony Thompson STR: SPD1 was added
STR: SPD1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SPD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SPD1 were set to 8817328; 33811808; 33533119
Phenotypes for STR: SPD1 were set to Synpolydactyly 1 MIM#186000
Review for STR: SPD1 was set to GREEN
STR: SPD1 was marked as clinically relevant
Added comment: NM_000523.4(HOXD13):c.212_213GCG[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
Normal repeat number: 15
Pathogenic repeat number: 24
Truncation of repeat also reported
Sources: Expert list
Repeat Disorders v0.91 Bryony Thompson removed STR:SPD1 from the panel
Repeat Disorders v0.90 SCA37 Bryony Thompson Marked STR: SCA37 as ready
Repeat Disorders v0.90 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Repeat Disorders v0.90 SCA37 Bryony Thompson Classified STR: SCA37 as Green List (high evidence)
Repeat Disorders v0.90 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Repeat Disorders v0.89 SCA37 Bryony Thompson STR: SCA37 was added
STR: SCA37 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA37 were set to 28686858; 31145571
Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: SCA37 was set to GREEN
STR: SCA37 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Repeat Disorders v0.88 XDP Bryony Thompson changed review comment from: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list; to: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within intron 32. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Repeat Disorders v0.88 XDP Bryony Thompson Marked STR: XDP as ready
Repeat Disorders v0.88 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Repeat Disorders v0.88 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Repeat Disorders v0.88 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Repeat Disorders v0.87 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Repeat Disorders. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Repeat Disorders v0.86 FECD3 Bryony Thompson Marked STR: FECD3 as ready
Repeat Disorders v0.86 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Repeat Disorders v0.86 FECD3 Bryony Thompson Classified STR: FECD3 as Green List (high evidence)
Repeat Disorders v0.86 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Repeat Disorders v0.85 FECD3 Bryony Thompson STR: FECD3 was added
STR: FECD3 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FECD3 were set to 25722209; 24255041
Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267
Review for STR: FECD3 was set to GREEN
STR: FECD3 was marked as clinically relevant
Added comment: NG_011716.2:g.54765TGC[X]
Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance.
Normal: 5-31 repeats
Pathogenic: >50 repeats
Sources: Expert list
Repeat Disorders v0.84 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Repeat Disorders v0.84 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Repeat Disorders v0.84 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Repeat Disorders v0.84 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Repeat Disorders v0.83 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Repeat Disorders v0.82 SCA12 Bryony Thompson Publications for STR: SCA12 were set to 27864267; 33811808
Repeat Disorders v0.81 SCA12 Bryony Thompson edited their review of STR: SCA12: Changed publications: 27864267, 33811808, 10581021
Repeat Disorders v0.81 SCA8 Bryony Thompson Publications for STR: SCA8 were set to 20301445
Repeat Disorders v0.80 SCA8 Bryony Thompson edited their review of STR: SCA8: Changed publications: 20301445, 10192387
Repeat Disorders v0.80 FXPOI Bryony Thompson Publications for STR: FXPOI were set to 20301558
Repeat Disorders v0.79 FXPOI Bryony Thompson edited their review of STR: FXPOI: Changed publications: 20301558, 9647544
Repeat Disorders v0.79 EPM1 Bryony Thompson Publications for STR: EPM1 were set to 29325606; 20301321
Repeat Disorders v0.78 EPM1 Bryony Thompson edited their review of STR: EPM1: Changed publications: 29325606, 20301321, 9126745
Repeat Disorders v0.78 FRDA Bryony Thompson Publications for STR: FRDA were set to 20301458
Repeat Disorders v0.77 FRDA Bryony Thompson edited their review of STR: FRDA: Changed publications: 20301458, 8596916
Repeat Disorders v0.77 DM1 Bryony Thompson Publications for STR: DM1 were set to 20301344; 29325606
Repeat Disorders v0.76 DM1 Bryony Thompson edited their review of STR: DM1: Changed publications: 20301344, 29325606, 1546325
Repeat Disorders v0.76 FXS Bryony Thompson Publications for STR: FXS were set to 33795824; 25227148
Repeat Disorders v0.75 FXS Bryony Thompson edited their review of STR: FXS: Changed publications: 33795824, 25227148, 1710175, 2031184
Repeat Disorders v0.75 SCA36 Bryony Thompson Marked STR: SCA36 as ready
Repeat Disorders v0.75 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Repeat Disorders v0.75 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Repeat Disorders v0.75 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Repeat Disorders v0.74 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 21683323
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Repeat Disorders v0.73 SCA31 Bryony Thompson Marked STR: SCA31 as ready
Repeat Disorders v0.73 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Repeat Disorders v0.73 SCA31 Bryony Thompson Classified STR: SCA31 as Green List (high evidence)
Repeat Disorders v0.73 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Repeat Disorders v0.72 SCA31 Bryony Thompson STR: SCA31 was added
STR: SCA31 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA31 were set to 19878914; 31755042
Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210
Review for STR: SCA31 was set to GREEN
STR: SCA31 was marked as clinically relevant
Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested.
2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease
Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042)
Sources: Expert list
Repeat Disorders v0.71 FXTAS Bryony Thompson Marked STR: FXTAS as ready
Repeat Disorders v0.71 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Repeat Disorders v0.71 FXTAS Bryony Thompson Classified STR: FXTAS as Green List (high evidence)
Repeat Disorders v0.71 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Repeat Disorders v0.70 FXTAS Bryony Thompson STR: FXTAS was added
STR: FXTAS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXTAS were set to 23765048; 25227148; 11445641
Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623
Review for STR: FXTAS was set to GREEN
STR: FXTAS was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
Sources: Expert list
Repeat Disorders v0.69 DM2 Bryony Thompson Marked STR: DM2 as ready
Repeat Disorders v0.69 DM2 Bryony Thompson Str: dm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.69 DM2 Bryony Thompson Classified STR: DM2 as Green List (high evidence)
Repeat Disorders v0.69 DM2 Bryony Thompson Str: dm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.68 DM2 Bryony Thompson STR: DM2 was added
STR: DM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM2 were set to 20301639; 11486088
Phenotypes for STR: DM2 were set to Myotonic dystrophy 2 MIM#602668
Review for STR: DM2 was set to GREEN
STR: DM2 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X]
Toxic gain of function RNA expected mechanism of disease
Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions
Unknown significance (normal vs. mutable): 27-29 CCTG repeats
Mutable normal (premutation) alleles. ~30-~54 CCTG repeats
Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats
Pathogenic: ~75-11,000 CCTG repeats
Sources: Expert list
Repeat Disorders v0.67 SCA10 Bryony Thompson Marked STR: SCA10 as ready
Repeat Disorders v0.67 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Repeat Disorders v0.67 SCA10 Bryony Thompson Classified STR: SCA10 as Green List (high evidence)
Repeat Disorders v0.67 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Repeat Disorders v0.66 SCA10 Bryony Thompson STR: SCA10 was added
STR: SCA10 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA10 were set to 20301354; 11017075
Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516
Review for STR: SCA10 was set to GREEN
STR: SCA10 was marked as clinically relevant
Added comment: NM_013236​.2:c.1430+54822ATTCT[X]
Toxic RNA gain-of-function mechanism of disease
Normal alleles: 10-32 ATTCT repeats
Alleles of questionable significance: 33-280 ATTCT repeats
Reduced-penetrance alleles: 33-850 repeats
Full-penetrance alleles: 800-4,500 ATTCT repeats
Sources: Expert list
Repeat Disorders v0.65 SCA12 Bryony Thompson Marked STR: SCA12 as ready
Repeat Disorders v0.65 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Repeat Disorders v0.65 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Repeat Disorders v0.65 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Repeat Disorders v0.64 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 27864267; 33811808
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Expert list
Repeat Disorders v0.63 HMNMYO Bryony Thompson Marked STR: HMNMYO as ready
Repeat Disorders v0.63 HMNMYO Bryony Thompson Str: hmnmyo has been classified as Green List (High Evidence).
Repeat Disorders v0.63 HMNMYO Bryony Thompson Classified STR: HMNMYO as Green List (high evidence)
Repeat Disorders v0.63 HMNMYO Bryony Thompson Str: hmnmyo has been classified as Green List (High Evidence).
Repeat Disorders v0.62 HMNMYO Bryony Thompson STR: HMNMYO was added
STR: HMNMYO was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: HMNMYO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: HMNMYO were set to 33559681; 33459760
Phenotypes for STR: HMNMYO were set to Neuropathy, hereditary motor, with myopathic features MIM#619216
Review for STR: HMNMYO was set to GREEN
STR: HMNMYO was marked as clinically relevant
Added comment: NM_022834.5(VWA1):c.62_71GCGCGGAGCG[X]
10-bp repeat expansion leading to a loss of function allele, was observed in 14/15 families and was homozygous in 10/15 with a recessive hereditary motor neuropathy.
Normal: 2 repeats
Pathogenic: >=3 repeats (currently only 3 repeats reported)
Sources: Literature
Repeat Disorders v0.61 SCA8 Bryony Thompson Marked STR: SCA8 as ready
Repeat Disorders v0.61 SCA8 Bryony Thompson Str: sca8 has been classified as Green List (High Evidence).
Repeat Disorders v0.61 SCA8 Bryony Thompson Classified STR: SCA8 as Green List (high evidence)
Repeat Disorders v0.61 SCA8 Bryony Thompson Str: sca8 has been classified as Green List (High Evidence).
Repeat Disorders v0.60 SCA8 Bryony Thompson STR: SCA8 was added
STR: SCA8 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA8 were set to 20301445
Phenotypes for STR: SCA8 were set to Spinocerebellar ataxia 8 MIM#608768
Review for STR: SCA8 was set to GREEN
STR: SCA8 was marked as clinically relevant
Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X]
ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n
Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism
Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats
Alleles of questionable significance: 50-70 repeats.
Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes
Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not.
Sources: Expert list
Repeat Disorders v0.59 FXPOI Bryony Thompson Marked STR: FXPOI as ready
Repeat Disorders v0.59 FXPOI Bryony Thompson Str: fxpoi has been classified as Green List (High Evidence).
Repeat Disorders v0.59 FXPOI Bryony Thompson Classified STR: FXPOI as Green List (high evidence)
Repeat Disorders v0.59 FXPOI Bryony Thompson Str: fxpoi has been classified as Green List (High Evidence).
Repeat Disorders v0.58 FXPOI Bryony Thompson STR: FXPOI was added
STR: FXPOI was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXPOI was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXPOI were set to 20301558
Phenotypes for STR: FXPOI were set to Premature ovarian failure 1 MIM#311360
Review for STR: FXPOI was set to GREEN
STR: FXPOI was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the POI phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXPOI: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
It is estimated that 21% of women who carry a premutation develop FXPOI. The association between repeat size of the premutation allele and FXPOI is nonlinear; women with 80-99 repeats are at greatest risk for FXPOI.
Sources: Expert list
Repeat Disorders v0.57 EPM1 Bryony Thompson Marked STR: EPM1 as ready
Repeat Disorders v0.57 EPM1 Bryony Thompson Str: epm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.57 EPM1 Bryony Thompson Classified STR: EPM1 as Green List (high evidence)
Repeat Disorders v0.57 EPM1 Bryony Thompson Str: epm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.56 EPM1 Bryony Thompson STR: EPM1 was added
STR: EPM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: EPM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EPM1 were set to 29325606; 20301321
Phenotypes for STR: EPM1 were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: EPM1 was set to GREEN
STR: EPM1 was marked as clinically relevant
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Repeat Disorders v0.55 FRDA Bryony Thompson Marked STR: FRDA as ready
Repeat Disorders v0.55 FRDA Bryony Thompson Str: frda has been classified as Green List (High Evidence).
Repeat Disorders v0.55 FRDA Bryony Thompson Classified STR: FRDA as Green List (high evidence)
Repeat Disorders v0.55 FRDA Bryony Thompson Str: frda has been classified as Green List (High Evidence).
Repeat Disorders v0.54 FRDA Bryony Thompson STR: FRDA was added
STR: FRDA was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FRDA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FRDA were set to 20301458
Phenotypes for STR: FRDA were set to Friedreich ataxia MIM#229300
Review for STR: FRDA was set to GREEN
STR: FRDA was marked as clinically relevant
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Repeat Disorders v0.53 FRAXE Bryony Thompson Marked STR: FRAXE as ready
Repeat Disorders v0.53 FRAXE Bryony Thompson Str: fraxe has been classified as Green List (High Evidence).
Repeat Disorders v0.53 FRAXE Bryony Thompson Classified STR: FRAXE as Green List (high evidence)
Repeat Disorders v0.53 FRAXE Bryony Thompson Str: fraxe has been classified as Green List (High Evidence).
Repeat Disorders v0.52 FRAXE Bryony Thompson STR: FRAXE was added
STR: FRAXE was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FRAXE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXE were set to 8334699; 8673085; 11388762
Phenotypes for STR: FRAXE were set to Intellectual developmental disorder, X-linked 109 MIM#309548
Review for STR: FRAXE was set to GREEN
STR: FRAXE was marked as clinically relevant
Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25)
Loss of function through methylation silencing is the mechanism of disease
Normal - 5-44 repeats
Inconclusive - 45-54 repeats
Premutation - 55-200 repeats
Abnormal - >200 or >230 repeats
Sources: Expert list
Repeat Disorders v0.51 DM1 Bryony Thompson Marked STR: DM1 as ready
Repeat Disorders v0.51 DM1 Bryony Thompson Str: dm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.51 DM1 Bryony Thompson Classified STR: DM1 as Green List (high evidence)
Repeat Disorders v0.51 DM1 Bryony Thompson Str: dm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.50 DM1 Bryony Thompson STR: DM1 was added
STR: DM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM1 were set to 20301344; 29325606
Phenotypes for STR: DM1 were set to Myotonic dystrophy 1 MIM#160900
Review for STR: DM1 was set to GREEN
STR: DM1 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_001081560.2:c.*224_*226CTG[X]
RNA toxic gain of function is mechanism of disease
Premutation: 35-49 repeats, no clinical signs
Mild: 50-~150 repeats, age of onset 20-70 yrs, clinical signs - cataracts, mild myotonia
Classic: ~100-~1,000 repeats, age of onset 10-30 yrs, clinical signs - weakness, myotonia, cataracts, balding, cardiac arrhythmia
Congenital: >1,000 repeats, age of onset birth-10 yrs , clinical signs - infantile hypotonia, respiratory deficits, intellectual disability, classic signs in adults
Sources: Expert list
Repeat Disorders v0.49 FXS Bryony Thompson Marked STR: FXS as ready
Repeat Disorders v0.49 FXS Bryony Thompson Str: fxs has been classified as Green List (High Evidence).
Repeat Disorders v0.49 FXS Bryony Thompson Classified STR: FXS as Green List (high evidence)
Repeat Disorders v0.49 FXS Bryony Thompson Str: fxs has been classified as Green List (High Evidence).
Repeat Disorders v0.48 FXS Bryony Thompson STR: FXS was added
STR: FXS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXS were set to 33795824; 25227148
Phenotypes for STR: FXS were set to Fragile X syndrome MIM#300624
Review for STR: FXS was set to GREEN
STR: FXS was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Repeat Disorders v0.47 CCD Bryony Thompson Classified STR: CCD as Amber List (moderate evidence)
Repeat Disorders v0.47 CCD Bryony Thompson Str: ccd has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.46 CCD Bryony Thompson STR: CCD was added
STR: CCD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CCD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CCD were set to 9182765; 33811808; 20560987; 26220009; 25852448
Phenotypes for STR: CCD were set to Cleidocranial dysplasia MIM#119600
Review for STR: CCD was set to AMBER
Added comment: NM_001024630.4(RUNX2):c.231_233[x]
Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein.
Only identified 2 reported polyAla repeat expansions in the literature. One family reported with 27 Ala repeats and one case reported with 20 Ala repeats (with supporting in vitro functional assay evidence). Also at least one case reported with expansion of the upstream glutamine repeat.
Sources: Expert list
Repeat Disorders v0.45 Bryony Thompson removed STR:BCCD from the panel
Repeat Disorders v0.44 CCHS Bryony Thompson Classified STR: CCHS as Green List (high evidence)
Repeat Disorders v0.44 CCHS Bryony Thompson Str: cchs has been classified as Green List (High Evidence).
Repeat Disorders v0.43 CCHS Bryony Thompson STR: CCHS was added
STR: CCHS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CCHS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CCHS were set to 12640453; 34012823; 20301600; 18798833
Phenotypes for STR: CCHS were set to Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880
Review for STR: CCHS was set to GREEN
STR: CCHS was marked as clinically relevant
Added comment: NM_003924​.3:c.721_723[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect.
Normal: 20 GCN (alanine) repeats
Uncertain significance: 21-23 GCN repeats have not been described in CCHS to date.
Later onset: 24 GCN repeats and a subset of individuals with 25 GCN repeats may have a very mild phenotype with delayed onset of the disorder and/or manifestations only when the individual is exposed to respiratory depressants and/or has severe intercurrent pulmonary illness.
Neonatal onset: 26-33 GCN repeats, as well as most with 25 GCN repeats, present in the newborn period
Sources: Expert list
Repeat Disorders v0.42 PHPX Bryony Thompson Marked STR: PHPX as ready
Repeat Disorders v0.42 PHPX Bryony Thompson Str: phpx has been classified as Green List (High Evidence).
Repeat Disorders v0.42 PHPX Bryony Thompson Classified STR: PHPX as Green List (high evidence)
Repeat Disorders v0.42 PHPX Bryony Thompson Str: phpx has been classified as Green List (High Evidence).
Repeat Disorders v0.41 PHPX Bryony Thompson STR: PHPX was added
STR: PHPX was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: PHPX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: PHPX were set to 12428212; 15800844; 33811808; 23505376; 19654509
Phenotypes for STR: PHPX were set to Intellectual disability, X-linked, with isolated growth hormone deficiency MIM#300123; Panhypopituitarism, X-linked MIM#312000
Review for STR: PHPX was set to GREEN
STR: PHPX was marked as clinically relevant
Added comment: NM_005634.2:c.700_702[X]
Sufficient evidence for an association with growth hormone deficiency, however limited evidence for intellectual disability. ID and growth hormone deficiency identified in a single family with 26 Ala repeats (11 Ala expansion). 22 Ala repeats (7 Ala expansion) has been identified in two families with hypopituitarism (without ID). Mouse model demonstrates that mechanism of disease is polyAlanine tract leading to a loss of function of the protein,
Sources: Expert list
Repeat Disorders v0.40 BCCD Bryony Thompson edited their review of STR: BCCD: Changed publications: 9182765, 33811808, 20560987, 26220009
Repeat Disorders v0.40 BCCD Bryony Thompson changed review comment from: NM_001024630.4(RUNX2):c.231_233[x]
Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
Normal repeat number: 17 (18 have been reported in the Danish population)
Pathogenic repeat number: 27
Sources: Expert list; to: NM_001024630.4(RUNX2):c.231_233[x]
Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
Normal repeat number: 17 (18 have been reported in the Danish population)
Pathogenic repeat number: 27 (1 case with 20 Ala have been reported)
Sources: Expert list
Repeat Disorders v0.40 BCCD Bryony Thompson changed review comment from: NM_001024630.4(RUNX2):c.231_233[x]
Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
Normal repeat number: 17
Pathogenic repeat number: 27
Sources: Expert list; to: NM_001024630.4(RUNX2):c.231_233[x]
Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
Normal repeat number: 17 (18 have been reported in the Danish population)
Pathogenic repeat number: 27
Sources: Expert list
Repeat Disorders v0.40 BCCD Bryony Thompson edited their review of STR: BCCD: Changed publications: 9182765, 33811808, 20560987
Repeat Disorders v0.40 SPD1 Bryony Thompson changed review comment from: NM_000523.4(HOXD13):c.212_213GCG[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
Normal repeat number: 15
Pathogenic repeat number: 24
Sources: Expert list; to: NM_000523.4(HOXD13):c.212_213GCG[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
Normal repeat number: 15
Pathogenic repeat number: 24
Truncation of repeat also reported
Sources: Expert list
Repeat Disorders v0.40 SPD1 Bryony Thompson edited their review of STR: SPD1: Changed publications: 8817328, 33811808, 33533119
Repeat Disorders v0.40 EIEE1_tract2 Bryony Thompson Marked STR: EIEE1_tract2 as ready
Repeat Disorders v0.40 EIEE1_tract2 Bryony Thompson Str: eiee1_tract2 has been classified as Green List (High Evidence).
Repeat Disorders v0.40 EIEE1_tract2 Bryony Thompson Classified STR: EIEE1_tract2 as Green List (high evidence)
Repeat Disorders v0.40 EIEE1_tract2 Bryony Thompson Str: eiee1_tract2 has been classified as Green List (High Evidence).
Repeat Disorders v0.39 EIEE1_tract2 Bryony Thompson STR: EIEE1_tract2 was added
STR: EIEE1_tract2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: EIEE1_tract2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: EIEE1_tract2 were set to 11889467; 33811808
Phenotypes for STR: EIEE1_tract2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: EIEE1_tract2 was set to GREEN
STR: EIEE1_tract2 was marked as clinically relevant
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Repeat Disorders v0.38 EIEE1_tract1 Bryony Thompson Marked STR: EIEE1_tract1 as ready
Repeat Disorders v0.38 EIEE1_tract1 Bryony Thompson Str: eiee1_tract1 has been classified as Green List (High Evidence).
Repeat Disorders v0.38 EIEE1_tract1 Bryony Thompson Classified STR: EIEE1_tract1 as Green List (high evidence)
Repeat Disorders v0.38 EIEE1_tract1 Bryony Thompson Str: eiee1_tract1 has been classified as Green List (High Evidence).
Repeat Disorders v0.37 EIEE1_tract1 Bryony Thompson STR: EIEE1_tract1 was added
STR: EIEE1_tract1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: EIEE1_tract1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: EIEE1_tract1 were set to 11889467; 33811808
Phenotypes for STR: EIEE1_tract1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: EIEE1_tract1 was set to GREEN
STR: EIEE1_tract1 was marked as clinically relevant
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Repeat Disorders v0.36 HPE5 Bryony Thompson Marked STR: HPE5 as ready
Repeat Disorders v0.36 HPE5 Bryony Thompson Str: hpe5 has been classified as Green List (High Evidence).
Repeat Disorders v0.36 HPE5 Bryony Thompson Classified STR: HPE5 as Green List (high evidence)
Repeat Disorders v0.36 HPE5 Bryony Thompson Str: hpe5 has been classified as Green List (High Evidence).
Repeat Disorders v0.35 HPE5 Bryony Thompson STR: HPE5 was added
STR: HPE5 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: HPE5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HPE5 were set to 11285244; 33811808
Phenotypes for STR: HPE5 were set to Holoprosencephaly 5 MIM#609637
Review for STR: HPE5 was set to GREEN
STR: HPE5 was marked as clinically relevant
Added comment: NM_007129.5(ZIC2):c.1366GCN[X]
Mechanism of disease is polyAlanine tract leading to a loss of function of the protein
Normal repeat number: 15
Pathogenic repeat number: 25
Sources: Expert list
Repeat Disorders v0.34 BPES Bryony Thompson Marked STR: BPES as ready
Repeat Disorders v0.34 BPES Bryony Thompson Str: bpes has been classified as Green List (High Evidence).
Repeat Disorders v0.34 BPES Bryony Thompson Classified STR: BPES as Green List (high evidence)
Repeat Disorders v0.34 BPES Bryony Thompson Str: bpes has been classified as Green List (High Evidence).
Repeat Disorders v0.33 BPES Bryony Thompson STR: BPES was added
STR: BPES was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: BPES was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for STR: BPES were set to 11468277; 33811808
Phenotypes for STR: BPES were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996
Review for STR: BPES was set to GREEN
STR: BPES was marked as clinically relevant
Added comment: NM_023067.2:c.661_702[X]
Mechanism of disease is polyAlanine tract leading to a loss of function of the protein
Normal repeat number: 14
Pathogenic repeat number: 19-24
Sources: Expert list
Repeat Disorders v0.32 HDL2 Bryony Thompson Marked STR: HDL2 as ready
Repeat Disorders v0.32 HDL2 Bryony Thompson Str: hdl2 has been classified as Green List (High Evidence).
Repeat Disorders v0.32 HDL2 Bryony Thompson Classified STR: HDL2 as Green List (high evidence)
Repeat Disorders v0.32 HDL2 Bryony Thompson Str: hdl2 has been classified as Green List (High Evidence).
Repeat Disorders v0.31 HDL2 Bryony Thompson STR: HDL2 was added
STR: HDL2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: HDL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HDL2 were set to 11558794; 20301701
Phenotypes for STR: HDL2 were set to Huntington disease-like 2 MIM#606438
Review for STR: HDL2 was set to GREEN
STR: HDL2 was marked as clinically relevant
Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included
Full penetrance: ≥40 repeats
Sources: Expert list
Repeat Disorders v0.30 HFGS_tract3 Bryony Thompson Marked STR: HFGS_tract3 as ready
Repeat Disorders v0.30 HFGS_tract3 Bryony Thompson Str: hfgs_tract3 has been classified as Green List (High Evidence).
Repeat Disorders v0.30 HFGS_tract3 Bryony Thompson Classified STR: HFGS_tract3 as Green List (high evidence)
Repeat Disorders v0.30 HFGS_tract3 Bryony Thompson Str: hfgs_tract3 has been classified as Green List (High Evidence).
Repeat Disorders v0.29 HFGS_tract3 Bryony Thompson STR: HFGS_tract3 was added
STR: HFGS_tract3 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: HFGS_tract3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HFGS_tract3 were set to 10839976; 12073020; 33811808
Phenotypes for STR: HFGS_tract3 were set to Hand-foot-uterus syndrome MIM#140000
Review for STR: HFGS_tract3 was set to GREEN
STR: HFGS_tract3 was marked as clinically relevant
Added comment: NM_000522.5(HOXA13):c.357_359[X]
Expected mechanism of disease is a polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
PolyAla tract 3 of the 3 N-terminal polyAla tracts
Normal repeat number: 18
Pathogenic repeat number: 24-30
Sources: Expert list
Repeat Disorders v0.28 HFGS_tract2 Bryony Thompson Classified STR: HFGS_tract2 as Green List (high evidence)
Repeat Disorders v0.28 HFGS_tract2 Bryony Thompson Str: hfgs_tract2 has been classified as Green List (High Evidence).
Repeat Disorders v0.27 HFGS_tract2 Bryony Thompson STR: HFGS_tract2 was added
STR: HFGS_tract2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: HFGS_tract2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HFGS_tract2 were set to 10839976; 12073020; 33811808
Phenotypes for STR: HFGS_tract2 were set to Hand-foot-uterus syndrome MIM#140000
Review for STR: HFGS_tract2 was set to GREEN
STR: HFGS_tract2 was marked as clinically relevant
Added comment: NM_000522.5(HOXA13):c.217_219[X]
Expected mechanism of disease is a polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
PolyAla tract 2 of the 3 N-terminal polyAla tracts
Normal repeat number: 12
Pathogenic repeat number: 18
Sources: Expert list
Repeat Disorders v0.26 HFGS_tract1 Bryony Thompson Marked STR: HFGS_tract1 as ready
Repeat Disorders v0.26 HFGS_tract1 Bryony Thompson Str: hfgs_tract1 has been classified as Green List (High Evidence).
Repeat Disorders v0.26 HFGS_tract1 Bryony Thompson Classified STR: HFGS_tract1 as Green List (high evidence)
Repeat Disorders v0.26 HFGS_tract1 Bryony Thompson Str: hfgs_tract1 has been classified as Green List (High Evidence).
Repeat Disorders v0.25 HFGS_tract1 Bryony Thompson STR: HFGS_tract1 was added
STR: HFGS_tract1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: HFGS_tract1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HFGS_tract1 were set to 10839976; 12073020; 33811808
Phenotypes for STR: HFGS_tract1 were set to Hand-foot-uterus syndrome MIM#140000
Review for STR: HFGS_tract1 was set to GREEN
STR: HFGS_tract1 was marked as clinically relevant
Added comment: NM_000522.5(HOXA13):c.126_128[X]
Expected mechanism of disease is a polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
PolyAla tract 1 of the 3 N-terminal polyAla tracts
Normal repeat number: 14-16
Pathogenic repeat number: 22
Sources: Expert list
Repeat Disorders v0.24 SCA17 Bryony Thompson Marked STR: SCA17 as ready
Repeat Disorders v0.24 SCA17 Bryony Thompson Str: sca17 has been classified as Green List (High Evidence).
Repeat Disorders v0.24 SCA17 Bryony Thompson Classified STR: SCA17 as Green List (high evidence)
Repeat Disorders v0.24 SCA17 Bryony Thompson Str: sca17 has been classified as Green List (High Evidence).
Repeat Disorders v0.23 SCA17 Bryony Thompson STR: SCA17 was added
STR: SCA17 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA17 were set to 10484774; 20301611; 29325606
Phenotypes for STR: SCA17 were set to Spinocerebellar ataxia 17 MIM#607136
Review for STR: SCA17 was set to GREEN
STR: SCA17 was marked as clinically relevant
Added comment: NM_003194.4:c.172_174[X]
Mechanism of disease expected to be gain of function
Normal: ≤ 40 CAG/CAA repeats
Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms.
Full-penetrance: ≥49 CAG/CAA repeats
Sources: Expert list
Repeat Disorders v0.22 OPMD Bryony Thompson Classified STR: OPMD as Green List (high evidence)
Repeat Disorders v0.22 OPMD Bryony Thompson Str: opmd has been classified as Green List (High Evidence).
Repeat Disorders v0.21 OPMD Bryony Thompson STR: OPMD was added
STR: OPMD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPMD was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for STR: OPMD were set to 9462747; 20301305
Phenotypes for STR: OPMD were set to Oculopharyngeal muscular dystrophy MIM#164300
Review for STR: OPMD was set to GREEN
STR: OPMD was marked as clinically relevant
Added comment: NM_004643.3:c.4_6[X]
Expected gain of function mechanism of disease
Normal allele: (GCN)10 / Ala10
Autosomal recessive: (GCN)11/Ala11
Autosomal dominant: (GCN)12-17
Sources: Expert list
Repeat Disorders v0.20 BCCD Bryony Thompson Marked STR: BCCD as ready
Repeat Disorders v0.20 BCCD Bryony Thompson Str: bccd has been classified as Green List (High Evidence).
Repeat Disorders v0.20 BCCD Bryony Thompson Classified STR: BCCD as Green List (high evidence)
Repeat Disorders v0.20 BCCD Bryony Thompson Str: bccd has been classified as Green List (High Evidence).
Repeat Disorders v0.19 BCCD Bryony Thompson changed review comment from: NM_001024630.4(RUNX2):c.231_233[x]
Expected mechansim of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
Normal repeat number: 17
Pathogenic repeat number: 27
Sources: Expert list; to: NM_001024630.4(RUNX2):c.231_233[x]
Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
Normal repeat number: 17
Pathogenic repeat number: 27
Sources: Expert list
Repeat Disorders v0.19 BCCD Bryony Thompson STR: BCCD was added
STR: BCCD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: BCCD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: BCCD were set to 9182765; 33811808
Phenotypes for STR: BCCD were set to Cleidocranial dysplasia MIM#119600
Review for STR: BCCD was set to GREEN
STR: BCCD was marked as clinically relevant
Added comment: NM_001024630.4(RUNX2):c.231_233[x]
Expected mechansim of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein
Normal repeat number: 17
Pathogenic repeat number: 27
Sources: Expert list
Repeat Disorders v0.18 SCA6 Bryony Thompson Marked STR: SCA6 as ready
Repeat Disorders v0.18 SCA6 Bryony Thompson Str: sca6 has been classified as Green List (High Evidence).
Repeat Disorders v0.18 SCA6 Bryony Thompson Classified STR: SCA6 as Green List (high evidence)
Repeat Disorders v0.18 SCA6 Bryony Thompson Str: sca6 has been classified as Green List (High Evidence).
Repeat Disorders v0.17 SCA6 Bryony Thompson STR: SCA6 was added
STR: SCA6 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA6 were set to 8988170; 20301319; 29325606
Phenotypes for STR: SCA6 were set to Spinocerebellar ataxia 6 MIM#183086; Episodic ataxia, type 2 MIM#108500
Review for STR: SCA6 was set to GREEN
STR: SCA6 was marked as clinically relevant
Added comment: NM_023035.2:c.6929_6931CAG[X]
PolyQ expansion alters gene binding, impairs transcription factor function, and is toxic to cells expressing the α1ACT – effects consistent with a loss of function
Normal: ≤18 repeats
Questionable significance: 19 CAG repeats
Full penetrance: ≥20 repeats
Sources: Expert list
Repeat Disorders v0.16 SPD1 Bryony Thompson Marked STR: SPD1 as ready
Repeat Disorders v0.16 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.16 SPD1 Bryony Thompson Classified STR: SPD1 as Green List (high evidence)
Repeat Disorders v0.16 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.15 SPD1 Bryony Thompson STR: SPD1 was added
STR: SPD1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SPD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SPD1 were set to 8817328; 33811808
Phenotypes for STR: SPD1 were set to Synpolydactyly 1 MIM#186000
Review for STR: SPD1 was set to GREEN
STR: SPD1 was marked as clinically relevant
Added comment: NM_000523.4(HOXD13):c.212_213GCG[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
Normal repeat number: 15
Pathogenic repeat number: 24
Sources: Expert list
Repeat Disorders v0.14 SCA7 Bryony Thompson Marked STR: SCA7 as ready
Repeat Disorders v0.14 SCA7 Bryony Thompson Str: sca7 has been classified as Green List (High Evidence).
Repeat Disorders v0.14 SCA7 Bryony Thompson Classified STR: SCA7 as Green List (high evidence)
Repeat Disorders v0.14 SCA7 Bryony Thompson Str: sca7 has been classified as Green List (High Evidence).
Repeat Disorders v0.13 SCA7 Bryony Thompson STR: SCA7 was added
STR: SCA7 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA7 were set to 8908515; 29325606; 20301433
Phenotypes for STR: SCA7 were set to Spinocerebellar ataxia 7 MIM#164500
Review for STR: SCA7 was set to GREEN
STR: SCA7 was marked as clinically relevant
Added comment: NM_000333​.3:c.89_91AGC[X]
Gain of function mechanism of disease
Normal: ≤27 repeats
Mutable normal: 28-33 repeats, meiotically unstable, but not associated with an abnormal phenotype.
Pathogenic reduced penetrance: 34-36 repeats, when manifestations occur, they are more likely to be later onset and milder than average
Pathogenic full penetrance: 37-460 repeats
Sources: Expert list
Repeat Disorders v0.12 SCA2 Bryony Thompson Marked STR: SCA2 as ready
Repeat Disorders v0.12 SCA2 Bryony Thompson Str: sca2 has been classified as Green List (High Evidence).
Repeat Disorders v0.12 SCA2 Bryony Thompson Classified STR: SCA2 as Green List (high evidence)
Repeat Disorders v0.12 SCA2 Bryony Thompson Str: sca2 has been classified as Green List (High Evidence).
Repeat Disorders v0.11 SCA2 Bryony Thompson STR: SCA2 was added
STR: SCA2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA2 were set to 8896555; 29325606; 20301452
Phenotypes for STR: SCA2 were set to Spinocerebellar ataxia 2 MIM#183090
Review for STR: SCA2 was set to GREEN
STR: SCA2 was marked as clinically relevant
Added comment: NM_002973​.3:c.496_498CAG[X]
Toxic protein aggregation is mechanism of disease
Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2)
Uncertain: 32 repeats
ALS risk allele: 30-32 repeats
Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life
Full penetrance: ≥35 repeats
Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat
Sources: Expert list
Repeat Disorders v0.10 SCA3 Bryony Thompson Marked STR: SCA3 as ready
Repeat Disorders v0.10 SCA3 Bryony Thompson Str: sca3 has been classified as Green List (High Evidence).
Repeat Disorders v0.10 SCA3 Bryony Thompson Classified STR: SCA3 as Green List (high evidence)
Repeat Disorders v0.10 SCA3 Bryony Thompson Str: sca3 has been classified as Green List (High Evidence).
Repeat Disorders v0.9 SCA3 Bryony Thompson STR: SCA3 was added
STR: SCA3 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA3 were set to 7874163; 20301375; 29325606
Phenotypes for STR: SCA3 were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3
Review for STR: SCA3 was set to GREEN
STR: SCA3 was marked as clinically relevant
Added comment: NM_004993​.5:c.886_888CAG[X]
Toxic aggregation and mislocalization in neurons is mechanism of disease
Normal: ≤44 repeats, mostly <31 repeats
Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3
Pathogenic (full penetrance): ≥60 repeats
Sources: Expert list
Repeat Disorders v0.8 DRPLA Bryony Thompson Marked STR: DRPLA as ready
Repeat Disorders v0.8 DRPLA Bryony Thompson Str: drpla has been classified as Green List (High Evidence).
Repeat Disorders v0.8 DRPLA Bryony Thompson Classified STR: DRPLA as Green List (high evidence)
Repeat Disorders v0.8 DRPLA Bryony Thompson Str: drpla has been classified as Green List (High Evidence).
Repeat Disorders v0.7 DRPLA Bryony Thompson STR: DRPLA was added
STR: DRPLA was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DRPLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DRPLA were set to 8136840; 8136826; 29325606; 20301664
Phenotypes for STR: DRPLA were set to Dentatorubral-pallidoluysian atrophy MIM#125370
Review for STR: DRPLA was set to GREEN
STR: DRPLA was marked as clinically relevant
Added comment: NM_001007026​.1:c.1462_1464CAG[X]
Toxic gain of function mechanism of disease
Benign: ≤35 repeats
Mutable normal: 20-35 repeats
Pathogenic: ≥48 repeats
Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance
Sources: Expert list
Repeat Disorders v0.6 SCA1 Bryony Thompson Marked STR: SCA1 as ready
Repeat Disorders v0.6 SCA1 Bryony Thompson Str: sca1 has been classified as Green List (High Evidence).
Repeat Disorders v0.6 SCA1 Bryony Thompson Classified STR: SCA1 as Green List (high evidence)
Repeat Disorders v0.6 SCA1 Bryony Thompson Str: sca1 has been classified as Green List (High Evidence).
Repeat Disorders v0.5 SCA1 Bryony Thompson STR: SCA1 was added
STR: SCA1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA1 were set to 8358429; 29325606; 20301363
Phenotypes for STR: SCA1 were set to Spinocerebellar ataxia 1 MIM#164400
Review for STR: SCA1 was set to GREEN
STR: SCA1 was marked as clinically relevant
Added comment: NM_000332.3:c.589_591CAG[X]
Toxic protein aggregation is mechanism of disease
Normal: ≤35 CAG repeats or 36-44 CAG repeats with CAT interruptions
Mutable normal (intermediate): 36-38 CAG repeats without CAT interruptions
Full-penetrance: ≥39 CAG repeats without CAT interruptions or ≥46 uninterrupted CAG repeats with CAT interruptions and additional CAGs
Sources: Expert list
Repeat Disorders v0.4 HD Bryony Thompson Marked STR: HD as ready
Repeat Disorders v0.4 HD Bryony Thompson Str: hd has been classified as Green List (High Evidence).
Repeat Disorders v0.4 HD Bryony Thompson Classified STR: HD as Green List (high evidence)
Repeat Disorders v0.4 HD Bryony Thompson Str: hd has been classified as Green List (High Evidence).
Repeat Disorders v0.3 HD Bryony Thompson STR: HD was added
STR: HD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: HD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HD were set to 8458085; 20301482; 29325606
Phenotypes for STR: HD were set to Huntington disease MIM#143100
Review for STR: HD was set to GREEN
STR: HD was marked as clinically relevant
Added comment: NM_002111.8:c.52_54CAG[X]
Primary mechanism of disease is gain of function
Normal: ≤26 repeats
Intermediate: 27-35 repeats, no risk for proband but expansion possible in the next generation
Pathogenic (reduced penetrance): 36-39 repeats, proband at risk for HD but may not develop symptoms
Pathogenic (full penetrance): ≥40 repeats, development of HD with increased certainty assuming a normal life span
Sources: Expert list
Repeat Disorders v0.2 SBMA Bryony Thompson Marked STR: SBMA as ready
Repeat Disorders v0.2 SBMA Bryony Thompson Str: sbma has been classified as Green List (High Evidence).
Repeat Disorders v0.2 SBMA Bryony Thompson Classified STR: SBMA as Green List (high evidence)
Repeat Disorders v0.2 SBMA Bryony Thompson Str: sbma has been classified as Green List (High Evidence).
Repeat Disorders v0.1 SBMA Bryony Thompson STR: SBMA was added
STR: SBMA was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SBMA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: SBMA were set to 2062380; 20301508; 29325606
Phenotypes for STR: SBMA were set to Spinal and bulbar muscular atrophy of Kennedy MIM#313200
Review for STR: SBMA was set to GREEN
STR: SBMA was marked as clinically relevant
Added comment: NM_000044.4:c.172_174CAG[X]
Toxic gain of function mechanism of disease
Normal: ≤34 repeats
Unknown: 35 repeats, consideration of the affected individual's clinical presentation and reconciliation with repeat sizes in family members
Reduced-penetrance: 36-37 repeats, interpreted within the context of family history, clinical presentation, genotype-phenotype correlations in other family members.
Full-penetrance: ≥38 repeats
Sources: Expert list
Repeat Disorders v0.0 Bryony Thompson Added Panel Repeat Disorders
Set panel types to: Royal Melbourne Hospital; Rare Disease