| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Repeat Disorders v1.15 | EP400_SCA_CAG | Zornitza Stark Tag preprint tag was added to STR: EP400_SCA_CAG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.15 | Zornitza Stark removed STR:DM1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.14 | DM1 | Zornitza Stark Marked STR: DM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.14 | DM1 | Zornitza Stark Str: dm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.14 | Zornitza Stark Copied STR DM1 from panel Myopathy - adult onset | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.14 | DM1 |
Zornitza Stark STR: DM1 was added STR: DM1 was added to Repeat Disorders. Sources: Expert Review Green,Expert list STR tags were added to STR: DM1. Mode of inheritance for STR: DM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DM1 were set to 20301344; 29325606 Phenotypes for STR: DM1 were set to Myotonic dystrophy 1 MIM#160900 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.13 | CBL_FRA11B_CCG | Zornitza Stark reviewed STR: CBL_FRA11B_CCG: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.13 | TYMS_CPUM_ACCATC | Bryony Thompson Marked STR: TYMS_CPUM_ACCATC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.13 | TYMS_CPUM_ACCATC | Bryony Thompson Str: tyms_cpum_accatc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.13 | TYMS_CPUM_ACCATC |
Bryony Thompson STR: TYMS_CPUM_ACCATC was added STR: TYMS_CPUM_ACCATC was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: TYMS_CPUM_ACCATC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: TYMS_CPUM_ACCATC were set to 40589716 Phenotypes for STR: TYMS_CPUM_ACCATC were set to Congenital progressive universal melanosis MONDO:0013648 Review for STR: TYMS_CPUM_ACCATC was set to RED Added comment: PMID 40589716 reports a single Thai family with 15-year-old monozygotic twin girls and congenital progressive universal melanosis (diffuse hyperpigmentation from birth). Both carry biallelic GATGGT hexanucleotide expansions in intron 3 of TYMS, reported as 210-259 repeats. Both parents are unaffected heterozygous carriers at age 56 (106/230-245 and 93/217-224). The twins are monozygotic (KING kinship 0.4934). In-house long-read controls (n=236) had 42-172 repeats, with 47% at 106 and no control carrying a long allele on both chromosomes. Reduced TYMS expression is the proposed mechanism, but TYMS RNA in fibroblasts and PBMCs and protein in fibroblasts all fell within the control range. Further probands/families are required to confirm the gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.12 | FAM193B_OPDM_CGG | Bryony Thompson Marked STR: FAM193B_OPDM_CGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.12 | FAM193B_OPDM_CGG | Bryony Thompson Str: fam193b_opdm_cgg has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.12 | FAM193B_OPDM_CGG |
Bryony Thompson STR: FAM193B_OPDM_CGG was added STR: FAM193B_OPDM_CGG was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAM193B_OPDM_CGG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAM193B_OPDM_CGG were set to 38297326; 40357124; 10.1101/2025.01.06.631535; 38585781 Phenotypes for STR: FAM193B_OPDM_CGG were set to Oculopharyngodistal myopathy, FAM193B-related (candidate) MONDO:0025193 Review for STR: FAM193B_OPDM_CGG was set to RED Added comment: A single Undiagnosed Diseases Network family reported in PMID 38297326, 38585781 and doi 10.1101/2025.01.06.631535. 2 affected sisters had heterozygous 5'UTR CGG expansions of 198 and 194 repeats, inherited from their unaffected mother with 158 repeats. The unaffected father had 16 repeats. No normal range is defined. Discovery cohort alleles were <~30 repeats. No pathogenic threshold is defined. 194 repeats was the lowest number of repeats in an affected individual. The sisters presented at 49 and 51 years. Blood FAM193B overexpression without promoter hypermethylation is the only functional evidence. A screen of ~50 OPDM long-read genomes found no second family. Further probands/families are required to confirm the gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.11 | TBC1D7_OPDM_CGG | Bryony Thompson Marked STR: TBC1D7_OPDM_CGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.11 | TBC1D7_OPDM_CGG | Bryony Thompson Str: tbc1d7_opdm_cgg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.11 | TBC1D7_OPDM_CGG | Bryony Thompson Classified STR: TBC1D7_OPDM_CGG as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.11 | TBC1D7_OPDM_CGG | Bryony Thompson Str: tbc1d7_opdm_cgg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.10 | TBC1D7_OPDM_CGG | Bryony Thompson edited their review of STR: TBC1D7_OPDM_CGG: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.10 | TBC1D7_OPDM_CGG | Bryony Thompson Classified STR: TBC1D7_OPDM_CGG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.10 | TBC1D7_OPDM_CGG | Bryony Thompson Str: tbc1d7_opdm_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.9 | TBC1D7_OPDM_CGG |
Bryony Thompson STR: TBC1D7_OPDM_CGG was added STR: TBC1D7_OPDM_CGG was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: TBC1D7_OPDM_CGG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: TBC1D7_OPDM_CGG were set to 41959811 Phenotypes for STR: TBC1D7_OPDM_CGG were set to Oculopharyngodistal myopathy, TBC1D7-related MONDO:0025193 Review for STR: TBC1D7_OPDM_CGG was set to GREEN Added comment: Preprint PMID 41959811 reports 3 families with a heterozygous 5'UTR CCG expansion in TBC1D7 and oculopharyngodistal myopathy. Affected individuals had 83, 87, 113, 137 and 148 repeats (n=5). All 3 families share a core 16 kb haplotype, consistent with a common ancestral origin. An unaffected transmitting father carries the largest allele, 184 repeats, hypermethylated. Gain of function is the proposed mechanism of disease. Patient-derived fibroblasts show increased TBC1D7 expression, and muscle biopsy shows p62-positive intranuclear inclusions, supporting a dominant toxic gain-of-function mechanism analogous to other CCG-expansion disorders. No normal range is defined. 79/70,752 GE control alleles had >50 repeats. The reference and 94.3% of 1,718 control alleles carry an interrupted CCGCTG structure, while patient alleles are long pure CCG. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.8 | EP400_SCA_CAG | Bryony Thompson Marked STR: EP400_SCA_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.8 | EP400_SCA_CAG | Bryony Thompson Str: ep400_sca_cag has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.8 | EP400_SCA_CAG | Bryony Thompson Classified STR: EP400_SCA_CAG as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.8 | EP400_SCA_CAG | Bryony Thompson Str: ep400_sca_cag has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.7 | EP400_SCA_CAG |
Bryony Thompson STR: EP400_SCA_CAG was added STR: EP400_SCA_CAG was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: EP400_SCA_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: EP400_SCA_CAG were set to 10.1101/2025.01.06.631535 Phenotypes for STR: EP400_SCA_CAG were set to Spinocerebellar ataxia, EP400-related MONDO:0000437 Review for STR: EP400_SCA_CAG was set to AMBER Added comment: Preprint doi 10.1101/2025.01.06.631535 reports 2 unrelated families with an exonic CAG (polyglutamine) expansion in exon 47 of EP400 and spinocerebellar ataxia. A father and daughter had 56 and 58 pure CAG repeats. An affected child in the second family had 75. The longest pure CAG tract in 543 control genomes was 24. Normal 39 and pathogenic 71 are total allele length including CAA interruptions. The paper counts the longest pure CAG tract, 15 repeats lower. No pathogenic threshold is defined. 56 repeats was the lowest in an affected individual. Ages of onset were 15, ~35, 42 and 43 years. No functional analysis. Further probands/families are required to confirm the gene-disease association. Comment on list classification: Two families only and no functional evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.6 | CSNK1E_FRA22A_CGG | Bryony Thompson Marked STR: CSNK1E_FRA22A_CGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.6 | CSNK1E_FRA22A_CGG | Bryony Thompson Str: csnk1e_fra22a_cgg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.6 | CSNK1E_FRA22A_CGG | Bryony Thompson Classified STR: CSNK1E_FRA22A_CGG as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.6 | CSNK1E_FRA22A_CGG | Bryony Thompson Str: csnk1e_fra22a_cgg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.5 | CSNK1E_FRA22A_CGG |
Bryony Thompson STR: CSNK1E_FRA22A_CGG was added STR: CSNK1E_FRA22A_CGG was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: CSNK1E_FRA22A_CGG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CSNK1E_FRA22A_CGG were set to 40751262; 39107278 Phenotypes for STR: CSNK1E_FRA22A_CGG were set to CSNK1E-related progressive myoclonic epilepsy and developmental and epileptic encephalopathy Review for STR: CSNK1E_FRA22A_CGG was set to AMBER Added comment: PMID 39107278 and 40751262 report 4 unrelated families with a heterozygous CGG expansion in the 5'UTR of CSNK1E at fragile site FRA22A. 3 probands had developmental and epileptic encephalopathy and 1 had progressive myoclonic epilepsy from age 10. Analysis of 1000 Genomes ONT data (n=908) suggests a normal range up to 48 repeats (98.7% <20). Neither paper proposes a pathogenic threshold. The affected proband had 745 repeats, her unaffected 18-year-old sister 980 and their unaffected mother 131. An affected DEE proband had ~430-700 repeats and an unaffected carrier mother ~500. Hypermethylation with ~50% reduced expression in fibroblasts is suggested to be the mechanism. The same hypermethylation was found in 6/23,116 controls. Further probands/families are required to confirm the gene-disease association. Comment on list classification: Unaffected carriers occur throughout the expansion range and no pathogenic threshold exists, and not useful in the clinical diagnostic setting. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.4 | Bryony Thompson Copied STR BCLAF3_FRAXG_CCG from panel Mendeliome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.4 | BCLAF3_FRAXG_CCG |
Bryony Thompson STR: BCLAF3_FRAXG_CCG was added STR: BCLAF3_FRAXG_CCG was added to Repeat Disorders. Sources: Expert Review Green,Literature Mode of inheritance for STR: BCLAF3_FRAXG_CCG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: BCLAF3_FRAXG_CCG were set to 42482100 Phenotypes for STR: BCLAF3_FRAXG_CCG were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.3 | HSF1_ET_CCCCGCNCCGCCT_CCNCGCCT | Bryony Thompson HSF_ET_CCCCGCNCCGCCT_CCNCGCCT was changed to HSF1_ET_CCCCGCNCCGCCT_CCNCGCCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.2 | Bryony Thompson Copied STR HSF_ET_CCCCGCNCCGCCT_CCNCGCCT from panel Mendeliome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.2 | HSF_ET_CCCCGCNCCGCCT_CCNCGCCT |
Bryony Thompson STR: HSF_ET_CCCCGCNCCGCCT_CCNCGCCT was added STR: HSF_ET_CCCCGCNCCGCCT_CCNCGCCT was added to Repeat Disorders. Sources: Expert Review Green,Literature Mode of inheritance for STR: HSF_ET_CCCCGCNCCGCCT_CCNCGCCT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HSF_ET_CCCCGCNCCGCCT_CCNCGCCT were set to 40581632 Phenotypes for STR: HSF_ET_CCCCGCNCCGCCT_CCNCGCCT were set to Essential tremor, MONDO:0003233 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.1 | HSF1_ET_CCCCGCNCCGCCT_CCNCGCCT |
Bryony Thompson STR: HSF1_ET_CCCCGCNCCGCCT/CCNCGCCT was added STR: HSF1_ET_CCCCGCNCCGCCT/CCNCGCCT was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: HSF1_ET_CCCCGCNCCGCCT/CCNCGCCT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HSF1_ET_CCCCGCNCCGCCT/CCNCGCCT were set to 40581632 Phenotypes for STR: HSF1_ET_CCCCGCNCCGCCT/CCNCGCCT were set to Essential tremor, MONDO:0003233 Review for STR: HSF1_ET_CCCCGCNCCGCCT/CCNCGCCT was set to GREEN Added comment: NOTE: bp rather than number of repeats is reported above PMID 40581632 reports 33 individuals (27 individuals >700bp) from 18 families with heterozygous intronic VNTR expansions (a combination of two VNTRs, (CCCCGCNCCGCCT)n/(CCNCGCCT)n) in intron 10 of HSF1 that co‑segregate with adult‑onset essential tremor; the expansion reduces HSF1 mRNA and protein levels and Drosophila HSF knockdown recapitulates a tremor phenotype, supporting a loss‑of‑function (haploinsufficiency) mechanism with incomplete penetrance. The study screened 165 Chinese ET pedigrees and 666 normal controls. Expanded VNTR alleles were highly enriched in ET-affected individuals, and the length of VNTRs was positively correlated with disease severity. Most controls had a HSF1 repeat expansion allele size <500 bp most affected individuals had an expansion >700 bp. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | TNRC6A_FAME6_TTTCA | STR TNRC6A_FAME6_TTTCA: gene migrated from ENSG00000090905 to ENSG00000090905 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | RAI1_FAME8_TTTCA | STR RAI1_FAME8_TTTCA: gene migrated from ENSG00000108557 to ENSG00000108557 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | YEATS2_FAME4_TTTCA | STR YEATS2_FAME4_TTTCA: gene migrated from ENSG00000163872 to ENSG00000163872 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | SAMD12_FAME1_TTTGA | STR SAMD12_FAME1_TTTGA: gene migrated from ENSG00000177570 to ENSG00000177570 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | CBL_FRA11B_CCG | STR CBL_FRA11B_CCG: gene migrated from ENSG00000110395 to ENSG00000110395 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | NIPA1_ALS_GCG | STR NIPA1_ALS_GCG: gene migrated from ENSG00000170113 to ENSG00000170113 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ZIC3_VACTERLX_GCC | STR ZIC3_VACTERLX_GCC: gene migrated from ENSG00000156925 to ENSG00000156925 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | C11orf80_FRA11A_CGG | STR C11orf80_FRA11A_CGG: gene migrated from ENSG00000173715 to ENSG00000173715 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | TMEM185A_FRAXF_GCC | STR TMEM185A_FRAXF_GCC: gene migrated from HGNC:17125 to HGNC:17125 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | DMD_DMD_GAA | STR DMD_DMD_GAA: gene migrated from ENSG00000198947 to ENSG00000198947 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | NAXE_NME_GGGCC | STR NAXE_NME_GGGCC: gene migrated from ENSG00000163382 to ENSG00000163382 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | AFF3_FRA2A_CGG | STR AFF3_FRA2A_CGG: gene migrated from ENSG00000144218 to ENSG00000144218 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | DIP2B_FRA12A_CGG | STR DIP2B_FRA12A_CGG: gene migrated from ENSG00000066084 to ENSG00000066084 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | RAPGEF2_FAME7_TTTCA | STR RAPGEF2_FAME7_TTTCA: gene migrated from ENSG00000109756 to ENSG00000109756 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | RUNX2_CCD_GCN | STR RUNX2_CCD_GCN: gene migrated from ENSG00000124813 to ENSG00000124813 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | THAP11_SCA51_CAG | STR THAP11_SCA51_CAG: gene migrated from ENSG00000168286 to ENSG00000168286 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ZNF713_FRA7A_CGG | STR ZNF713_FRA7A_CGG: gene migrated from ENSG00000178665 to ENSG00000178665 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ABCD3_OPDM_GCC | STR ABCD3_OPDM_GCC: gene migrated from ENSG00000117528 to ENSG00000117528 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | RILPL1_OPDM4_CGG | STR RILPL1_OPDM4_CGG: gene migrated from ENSG00000188026 to ENSG00000188026 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | NOTCH2NLC_NIID_GGC | STR NOTCH2NLC_NIID_GGC: gene migrated from ENSG00000286219 to ENSG00000286219 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | LRP12_OPDM1_CGG | STR LRP12_OPDM1_CGG: gene migrated from ENSG00000147650 to ENSG00000147650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | PLIN4_MRUPAV_33-mer | STR PLIN4_MRUPAV_33-mer: gene migrated from ENSG00000167676 to ENSG00000167676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | GIPC1_OPDM2_CGG | STR GIPC1_OPDM2_CGG: gene migrated from ENSG00000123159 to ENSG00000123159 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | PRDM12_HSAN8_GCC | STR PRDM12_HSAN8_GCC: gene migrated from ENSG00000130711 to ENSG00000130711 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | COMP_MEDPSACH_GAC | STR COMP_MEDPSACH_GAC: gene migrated from ENSG00000105664 to ENSG00000105664 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ZIC2_HPE5_GCN | STR ZIC2_HPE5_GCN: gene migrated from ENSG00000043355 to ENSG00000043355 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | VWA1_HMNMYO_GCGCGGAGCG | STR VWA1_HMNMYO_GCGCGGAGCG: gene migrated from ENSG00000179403 to ENSG00000179403 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | HOXA13_HFGS_GCN1 | STR HOXA13_HFGS_GCN1: gene migrated from ENSG00000106031 to ENSG00000106031 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | JPH3_HDL2_CTG | STR JPH3_HDL2_CTG: gene migrated from ENSG00000154118 to ENSG00000154118 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | HTT_HD_CAG | STR HTT_HD_CAG: gene migrated from ENSG00000197386 to ENSG00000197386 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | FMR1_FXTAS_CGG | STR FMR1_FXTAS_CGG: gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | FMR1_FXS_CGG | STR FMR1_FXS_CGG: gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | GLS_GDPAG_GCA | STR GLS_GDPAG_GCA: gene migrated from ENSG00000115419 to ENSG00000115419 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | FMR1_FXPOI_CGG | STR FMR1_FXPOI_CGG: gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | C9orf72_FTDALS_GGGGCC | STR C9orf72_FTDALS_GGGGCC: gene migrated from ENSG00000147894 to ENSG00000147894 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | FXN_FRDA_GAA | STR FXN_FRDA_GAA: gene migrated from ENSG00000165060 to ENSG00000165060 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | AFF2_FRAXE_GCC | STR AFF2_FRAXE_GCC: gene migrated from ENSG00000155966 to ENSG00000155966 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | TCF4_FECD3_CTG | STR TCF4_FECD3_CTG: gene migrated from ENSG00000196628 to ENSG00000196628 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | SAMD12_FAME1_TTTCA | STR SAMD12_FAME1_TTTCA: gene migrated from ENSG00000177570 to ENSG00000177570 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | STARD7_FAME2_ATTTC | STR STARD7_FAME2_ATTTC: gene migrated from ENSG00000084090 to ENSG00000084090 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | CSTB_EPM1_CCCCGCCCCGCG | STR CSTB_EPM1_CCCCGCCCCGCG: gene migrated from ENSG00000160213 to ENSG00000160213 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ARX_EIEE1_GCN2 | STR ARX_EIEE1_GCN2: gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ARX_EIEE1_GCN1 | STR ARX_EIEE1_GCN1: gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | CNBP_DM2_CCTG | STR CNBP_DM2_CCTG: gene migrated from ENSG00000169714 to ENSG00000169714 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | DMPK_DM1_CTG | STR DMPK_DM1_CTG: gene migrated from ENSG00000104936 to ENSG00000104936 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | PRNP_CJD_octapeptide | STR PRNP_CJD_octapeptide: gene migrated from ENSG00000171867 to ENSG00000171867 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | PHOX2B_CCHS_GCN | STR PHOX2B_CCHS_GCN: gene migrated from ENSG00000109132 to ENSG00000109132 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | XYLT1_DBQD2_GGC | STR XYLT1_DBQD2_GGC: gene migrated from ENSG00000103489 to ENSG00000103489 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ATXN7_SCA7_CAG | STR ATXN7_SCA7_CAG: gene migrated from ENSG00000163635 to ENSG00000163635 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | HOXA13_HFGS_GCN3 | STR HOXA13_HFGS_GCN3: gene migrated from ENSG00000106031 to ENSG00000106031 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | HOXA13_HFGS_GCN2 | STR HOXA13_HFGS_GCN2: gene migrated from ENSG00000106031 to ENSG00000106031 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | FOXL2_BPES_GCN | STR FOXL2_BPES_GCN: gene migrated from ENSG00000183770 to ENSG00000183770 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ATN1_DRPLA_CAG | STR ATN1_DRPLA_CAG: gene migrated from ENSG00000111676 to ENSG00000111676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | NUTM2B-AS1_OPDM_CCG | STR NUTM2B-AS1_OPDM_CCG: gene migrated from ENSG00000225484 to ENSG00000225484 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | RFC1_CANVAS_ANNGN | STR RFC1_CANVAS_ANNGN: gene migrated from ENSG00000035928 to ENSG00000035928 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | PABPN1_OPMD_GCN | STR PABPN1_OPMD_GCN: gene migrated from ENSG00000100836 to ENSG00000100836 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | TAF1_XDP_CCCTCT | STR TAF1_XDP_CCCTCT: gene migrated from ENSG00000147133 to ENSG00000147133 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | TBX1_TOF_GCN | STR TBX1_TOF_GCN: gene migrated from ENSG00000184058 to ENSG00000184058 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | HOXD13_SPD1_GCG | STR HOXD13_SPD1_GCG: gene migrated from ENSG00000128714 to ENSG00000128714 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ATXN8OS_SCA8_CTG | STR ATXN8OS_SCA8_CTG: gene migrated from ENSG00000230223 to ENSG00000230223 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | CACNA1A_SCA6_CAG | STR CACNA1A_SCA6_CAG: gene migrated from ENSG00000141837 to ENSG00000141837 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ZFHX3_SCA4_GGC | STR ZFHX3_SCA4_GGC: gene migrated from ENSG00000140836 to ENSG00000140836 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | DAB1_SCA37_ATTTC | STR DAB1_SCA37_ATTTC: gene migrated from ENSG00000173406 to ENSG00000173406 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | NOP56_SCA36_GGCCTG | STR NOP56_SCA36_GGCCTG: gene migrated from ENSG00000101361 to ENSG00000101361 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ATXN3_SCA3_CAG | STR ATXN3_SCA3_CAG: gene migrated from ENSG00000066427 to ENSG00000066427 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | BEAN1_SCA31_TGGAA | STR BEAN1_SCA31_TGGAA: gene migrated from ENSG00000166546 to ENSG00000166546 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | FGF14_SCA27B_GAA | STR FGF14_SCA27B_GAA: gene migrated from ENSG00000102466 to ENSG00000102466 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ATXN2_SCA2_CAG | STR ATXN2_SCA2_CAG: gene migrated from ENSG00000204842 to ENSG00000204842 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | TBP_SCA17_CAG | STR TBP_SCA17_CAG: gene migrated from ENSG00000112592 to ENSG00000112592 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | PPP2R2B_SCA12_CAG | STR PPP2R2B_SCA12_CAG: gene migrated from ENSG00000156475 to ENSG00000156475 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ATXN10_SCA10_ATTCT | STR ATXN10_SCA10_ATTCT: gene migrated from ENSG00000130638 to ENSG00000130638 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | ATXN1_SCA1_CAG | STR ATXN1_SCA1_CAG: gene migrated from ENSG00000124788 to ENSG00000124788 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | AR_SBMA_CAG | STR AR_SBMA_CAG: gene migrated from ENSG00000169083 to ENSG00000169083 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | EIF4A3_RCPS_complex | STR EIF4A3_RCPS_complex: gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | SOX3_PHPX_GCN | STR SOX3_PHPX_GCN: gene migrated from ENSG00000134595 to ENSG00000134595 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | MARCHF6_FAME3_TTTCA | STR MARCHF6_FAME3_TTTCA: gene migrated from ENSG00000145495 to ENSG00000145495 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v1.0 | Panel migrated to gene set Ensemblv115. Source version: v0.272 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.272 | ABCD3_OPDM_GCC | Zornitza Stark Phenotypes for STR: ABCD3_OPDM_GCC were changed from Oculopharyngodistal myopathy MONDO:0025193 to Oculopharyngodistal myopathy 5, MIM# 621446 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.271 | ABCD3_OPDM_GCC | Zornitza Stark Publications for STR: ABCD3_OPDM_GCC were set to https://doi.org/10.1101/2023.10.09.23296582 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.270 | ABCD3_OPDM_GCC | Zornitza Stark reviewed STR: ABCD3_OPDM_GCC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Oculopharyngodistal myopathy 5, MIM# 621446; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.270 | MARCHF6_FAME3_TTTCA | Bryony Thompson MARCH6_FAME3_TTTCA was changed to MARCHF6_FAME3_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.269 | DIP2B_FRA12A_CGG | Bryony Thompson Phenotypes for STR: DIP2B_FRA12A_CGG were changed from Mental retardation, FRA12A type MIM#136630 to intellectual disability, FRA12A type MONDO:0007634 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.268 | DIP2B_FRA12A_CGG | Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128; 39854091; 33510257 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.267 | DIP2B_FRA12A_CGG |
Bryony Thompson edited their review of STR: DIP2B_FRA12A_CGG: Added comment: Unsure about the expansions association with disease due to variable phenotypes and possible incomplete penetrance PMID 17236128, 39854091, and 41028987 report 23 unrelated families with heterozygous CGG repeat expansions in the 5′UTR of DIP2B. Sixteen families present with intellectual disability associated with the FRA12A fragile site, while seven families (including two siblings, five ataxia probands, and one dystonia case) exhibit neurodevelopmental disability with progressive movement disorders (chorea, dystonia, ataxia). Functional studies demonstrate reduced DIP2B expression via promoter hypermethylation. Segregation analysis shows segregation from unaffected parents (possibly reduced penetrance) and de novo events. DIP2B expansion OR 2.8 (p=0.04) in ataxia cohort (5/788) vs gnomAD.; Changed publications: 17236128, 33510257, 39854091, 41028987; Changed phenotypes: intellectual disability, FRA12A type MONDO:0007634 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.267 | THAP11_SCA51_CAG | Bryony Thompson edited their review of STR: THAP11_SCA51_CAG: Changed publications: 15368101, 24677642, 34165550, 38113319, 40459937, 39651830, 37148549 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.267 | THAP11_SCA51_CAG | Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319; 40459937; 39651830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.266 | THAP11_SCA51_CAG |
Bryony Thompson changed review comment from: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual. A 46/29 CAG THAP11 genotype has also been identified in an individual with ataxia of European ancestry, that also had a CACNA1A pathogenic expansion which causes SCA6. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease. Further probands/families are required to confirm the gene-disease association. Sources: Other; to: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual and the number of CAA interruptions had been reduced from 5/6 to 3. Expanded alleles have been identified in individuals with neurodevelopmental phenotypes, other neurodegenerative phenotypes, and an individual with ataxia who also had a CACNA1A (SCA6) pathogenic expansion. However, all these individuals had 5/6 CAA interruptions instead of 3 that were reported in the initial Chinese families. Suggesting the number of CAA interruptions is associated with pathogenicity of the repeat expansion. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease. Further probands/families are required to confirm the gene-disease association. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.266 | THAP11_SCA51_CAG | Bryony Thompson Phenotypes for STR: THAP11_SCA51_CAG were changed from Spinocerebellar ataxia 51, MIM# 620947 to Spinocerebellar ataxia 51 MONDO:0975800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.265 | THAP11_SCA51_CAG | Bryony Thompson edited their review of STR: THAP11_SCA51_CAG: Changed publications: 15368101, 24677642, 34165550, 38113319, 40459937, 39651830; Changed phenotypes: Spinocerebellar ataxia 51 MONDO:0975800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.265 | THAP11_SCA51_CAG | Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319; 37148549; 39651830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.264 | NOTCH2NLC_NIID_GGC | Bryony Thompson Gene: NOTCH2NL was changed to NOTCH2NLC. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.263 | RAI1_FAME8_TTTCA | Bryony Thompson Marked STR: RAI1_FAME8_TTTCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.263 | RAI1_FAME8_TTTCA | Bryony Thompson Str: rai1_fame8_tttca has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.263 | RAI1_FAME8_TTTCA |
Bryony Thompson STR: RAI1_FAME8_TTTCA was added STR: RAI1_FAME8_TTTCA was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: RAI1_FAME8_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: RAI1_FAME8_TTTCA were set to 37994247 Phenotypes for STR: RAI1_FAME8_TTTCA were set to benign adult familial myoclonic epilepsy MONDO:0019448 Review for STR: RAI1_FAME8_TTTCA was set to RED Added comment: A single family from Mali segregating TTTTA repeat expansions and TTTCA repeat insertions in intron 4 of the RAI1. Consistent with other FAME expansions. RNA toxicity is suggested to be the mechanism. Loss of function is the mechanism of disease of Smith-Magenis syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.262 | NAXE_NME_GGGCC | Bryony Thompson Marked STR: NAXE_NME_GGGCC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.262 | NAXE_NME_GGGCC | Bryony Thompson Str: naxe_nme_gggcc has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.262 | NAXE_NME_GGGCC | Bryony Thompson Classified STR: NAXE_NME_GGGCC as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.262 | NAXE_NME_GGGCC | Bryony Thompson Str: naxe_nme_gggcc has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.261 | NAXE_NME_GGGCC |
Bryony Thompson STR: NAXE_NME_GGGCC was added STR: NAXE_NME_GGGCC was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: NAXE_NME_GGGCC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: NAXE_NME_GGGCC were set to 39455596 Phenotypes for STR: NAXE_NME_GGGCC were set to encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 1 MONDO:0020781 Review for STR: NAXE_NME_GGGCC was set to AMBER STR: NAXE_NME_GGGCC was marked as clinically relevant STR: NAXE_NME_GGGCC was marked as current diagnostic Added comment: A single case with a homozygous (result of UPD) repeat expansion in the promoter that leads to methylation of the promoter (identified by long-read sequencing). Biallelic loss of function variants in this gene cause a mitochondrial disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.260 | THAP11_SCA51_CAG | Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319; 37148549 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.259 | THAP11_SCA51_CAG | Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.258 | AFF3_FRA2A_CGG | Bryony Thompson Publications for STR: AFF3_FRA2A_CGG were set to 24763282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.257 | DIP2B_FRA12A_CGG | Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.256 | THAP11_SCA51_CAG | Bryony Thompson THAP11_SCA_CAG was changed to THAP11_SCA51_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | PABPN1_OPMD_GCN | Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | PABPN1_OPMD_GCN | Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | ZIC3_VACTERLX_GCC | Bryony Thompson VACTERLX was changed to ZIC3_VACTERLX_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.254 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson NUTM2B-AS1_OPML1_CCG was changed to NUTM2B-AS1_OPDM_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.253 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson Classified STR: NUTM2B-AS1_OPML1_CCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.253 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson Str: nutm2b-as1_opml1_ccg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.252 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson edited their review of STR: NUTM2B-AS1_OPML1_CCG: Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.; Changed rating: GREEN; Changed publications: 31332380, 37923380, 39308795, 38159879; Changed phenotypes: Oculopharyngodistal myopathy MONDO:0025193; Set clinically relevant: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.252 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson OPML1 was changed to NUTM2B-AS1_OPML1_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.251 | NIPA1_ALS_GCG | Bryony Thompson NIPA1 was changed to NIPA1_ALS_GCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.250 | TMEM185A_FRAXF_GCC | Bryony Thompson FRAXF was changed to TMEM185A_FRAXF_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.249 | CBL_FRA11B_CCG | Bryony Thompson FRA11B was changed to CBL_FRA11B_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.248 | C11orf80_FRA11A_CGG | Bryony Thompson FRA11A was changed to C11orf80_FRA11A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.247 | TNRC6A_FAME6_TTTCA | Bryony Thompson FAME6 was changed to TNRC6A_FAME6_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.246 | YEATS2_FAME4_TTTCA | Bryony Thompson FAME4 was changed to YEATS2_FAME4_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.245 | SAMD12_FAME1_TTTGA | Bryony Thompson FAME1_TTTGA was changed to SAMD12_FAME1_TTTGA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.244 | THAP11_SCA_CAG | Bryony Thompson SCA_THAP11_CAG was changed to THAP11_SCA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.243 | ZNF713_FRA7A_CGG | Bryony Thompson FRA7A was changed to ZNF713_FRA7A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.242 | AFF3_FRA2A_CGG | Bryony Thompson FRA2A was changed to AFF3_FRA2A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.241 | DIP2B_FRA12A_CGG | Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.240 | RAPGEF2_FAME7_TTTCA | Bryony Thompson FAME7 was changed to RAPGEF2_FAME7_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.239 | DMD_DMD_GAA | Bryony Thompson DMD was changed to DMD_DMD_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.238 | RUNX2_CCD_GCN | Bryony Thompson CCD was changed to RUNX2_CCD_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.237 | Bryony Thompson removed STR:RFC1_CANVAS_ACAGG from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.236 | RFC1_CANVAS_ANNGN | Bryony Thompson edited their review of STR: RFC1_CANVAS_ANNGN: Changed publications: 30926972, 32851396, 33237689, 31230722, 33237689, 32694621, 33103729, 35355059; Set clinically relevant: no | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.236 | RFC1_CANVAS_ANNGN | Bryony Thompson Publications for STR: RFC1_CANVAS_ANNGN were set to 30926972; 32851396; 33237689; 31230722; 33237689; 32694621; 33103729; 35355059 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.235 | RFC1_CANVAS_ANNGN | Bryony Thompson commented on STR: RFC1_CANVAS_ANNGN: Multiple apparently pathogenic expansions now reported (AGGGC, AAGGC, AGAGG, AAAGG, ACAGG) other than the common AAGGG expansion | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.235 | RFC1_CANVAS_ANNGN |
Bryony Thompson RFC1_CANVAS_AAGGG was changed to RFC1_CANVAS_ANNGN Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.234 | RFC1_CANVAS_AAGGG | Bryony Thompson Publications for STR: RFC1_CANVAS_AAGGG were set to 30926972; 32851396; 33237689; 31230722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.233 | RFC1_CANVAS_ACAGG | Bryony Thompson Publications for STR: RFC1_CANVAS_ACAGG were set to 33237689; 32694621; 33103729 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.232 | RFC1_CANVAS_ACAGG | Bryony Thompson Classified STR: RFC1_CANVAS_ACAGG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.232 | RFC1_CANVAS_ACAGG | Bryony Thompson Str: rfc1_canvas_acagg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.231 | RFC1_CANVAS_ACAGG | Bryony Thompson edited their review of STR: RFC1_CANVAS_ACAGG: Added comment: Greater than 10 families reported now. Also compound heterozygote (ACAGG)exp/(AAGGG)exp cases reported.; Changed rating: GREEN; Changed publications: 33237689, 32694621, 33103729, 35355059 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.231 | RFC1_CANVAS_ACAGG | Bryony Thompson CANVAS_ACAGG was changed to RFC1_CANVAS_ACAGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.230 | TAF1_XDP_CCCTCT | Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.229 | TBX1_TOF_GCN | Bryony Thompson TOF was changed to TBX1_TOF_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.228 | HOXD13_SPD1_GCG | Bryony Thompson SPD1 was changed to HOXD13_SPD1_GCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.227 | ATXN8OS_SCA8_CTG | Bryony Thompson SCA8 was changed to ATXN8OS_SCA8_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.226 | ATXN7_SCA7_CAG | Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.225 | CACNA1A_SCA6_CAG | Bryony Thompson SCA6 was changed to CACNA1A_SCA6_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.224 | ZFHX3_SCA4_GGC | Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.223 | DAB1_SCA37_ATTTC | Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.222 | NOP56_SCA36_GGCCTG | Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.221 | BEAN1_SCA31_TGGAA | Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.220 | ATXN3_SCA3_CAG | Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.219 | FGF14_SCA27B_GAA | Bryony Thompson SCA27B was changed to FGF14_SCA27B_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.218 | ATXN2_SCA2_CAG | Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.217 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.216 | PPP2R2B_SCA12_CAG | Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.215 | ATXN10_SCA10_ATTCT | Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.214 | ATXN1_SCA1_CAG | Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.213 | AR_SBMA_CAG | Bryony Thompson SBMA was changed to AR_SBMA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.212 | EIF4A3_RCPS_complex | Bryony Thompson RCPS was changed to EIF4A3_RCPS_complex | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.211 | SOX3_PHPX_GCN | Bryony Thompson PHPX was changed to SOX3_PHPX_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.210 | ABCD3_OPDM_GCC | Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.209 | PABPN1_OPMD_GCN | Bryony Thompson OPMD was changed to PABPN1_OPMD_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.208 | RILPL1_OPDM4_CGG | Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.207 | GIPC1_OPDM2_CGG | Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.206 | LRP12_OPDM1_CGG | Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.205 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.204 | PLIN4_MRUPAV_33-mer | Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.203 | RFC1_CANVAS_AAGGG | Bryony Thompson RFC1_CANVAS_ AAGGG was changed to RFC1_CANVAS_AAGGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.202 | COMP_MEDPSACH_GAC | Bryony Thompson MEDPSACH was changed to COMP_MEDPSACH_GAC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.201 | PRDM12_HSAN8_GCC | Bryony Thompson HSAN8 was changed to PRDM12_HSAN8_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.200 | ZIC2_HPE5_GCN | Bryony Thompson HPE5 was changed to ZIC2_HPE5_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.199 | VWA1_HMNMYO_GCGCGGAGCG | Bryony Thompson HMNMYO was changed to VWA1_HMNMYO_GCGCGGAGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.198 | HOXA13_HFGS_GCN3 | Bryony Thompson HFGS_tract3 was changed to HOXA13_HFGS_GCN3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.197 | HOXA13_HFGS_GCN2 | Bryony Thompson HFGS_tract2 was changed to HOXA13_HFGS_GCN2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.196 | HOXA13_HFGS_GCN1 | Bryony Thompson HFGS_tract1 was changed to HOXA13_HFGS_GCN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.195 | JPH3_HDL2_CTG | Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.194 | HTT_HD_CAG | Bryony Thompson HD was changed to HTT_HD_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.193 | GLS_GDPAG_GCA | Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.192 | FMR1_FXTAS_CGG | Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.191 | FMR1_FXS_CGG | Bryony Thompson FXS was changed to FMR1_FXS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.190 | FMR1_FXPOI_CGG | Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.189 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.188 | FXN_FRDA_GAA | Bryony Thompson FRDA was changed to FXN_FRDA_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.187 | AFF2_FRAXE_GCC | Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.186 | TCF4_FECD3_CTG | Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.185 | MARCH6_FAME3_TTTCA | Bryony Thompson FAME3 was changed to MARCH6_FAME3_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.184 | STARD7_FAME2_ATTTC | Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.183 | SAMD12_FAME1_TTTCA | Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.182 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson CSTB_EPM1_dodecamer was changed to CSTB_EPM1_CCCCGCCCCGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.181 | CSTB_EPM1_dodecamer | Bryony Thompson CSTB_EPM1_CCCCGCCCCGCG was changed to CSTB_EPM1_dodecamer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.180 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson EPM1 was changed to CSTB_EPM1_CCCCGCCCCGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.179 | ARX_EIEE1_GCN2 | Bryony Thompson EIEE1_tract2 was changed to ARX_EIEE1_GCN2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.178 | ARX_EIEE1_GCN1 | Bryony Thompson EIEE1_tract1 was changed to ARX_EIEE1_GCN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.177 | ATN1_DRPLA_CAG | Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.176 | CNBP_DM2_CCTG | Bryony Thompson DM2 was changed to CNBP_DM2_CCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.175 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.174 | XYLT1_DBQD2_GGC | Bryony Thompson DBQD2 was changed to XYLT1_DBQD2_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.173 | PRNP_CJD_octapeptide | Bryony Thompson PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT was changed to PRNP_CJD_octapeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.172 | PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT | Bryony Thompson CJD was changed to PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.171 | PHOX2B_CCHS_GCN | Bryony Thompson CCHS was changed to PHOX2B_CCHS_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.170 | RFC1_CANVAS_ AAGGG | Bryony Thompson CANVAS was changed to RFC1_CANVAS_ AAGGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.169 | FOXL2_BPES_GCN | Bryony Thompson BPES was changed to FOXL2_BPES_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.168 | SCA_THAP11_CAG | Zornitza Stark Phenotypes for STR: SCA_THAP11_CAG were changed from autosomal dominant cerebellar ataxia MONDO:0020380 to Spinocerebellar ataxia 51, MIM# 620947 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.167 | SCA_THAP11_CAG | Zornitza Stark reviewed STR: SCA_THAP11_CAG: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Spinocerebellar ataxia 51, MIM# 620947; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.167 | OPDM_ABCD3_GCC | Bryony Thompson edited their review of STR: OPDM_ABCD3_GCC: Changed publications: 39068203 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.167 | DMD | Bryony Thompson Publications for STR: DMD were set to 27417533 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.166 | FAME7 | Bryony Thompson Publications for STR: FAME7 were set to 29507423 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.165 | FAME7 | Bryony Thompson Classified STR: FAME7 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.165 | FAME7 | Bryony Thompson Str: fame7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.164 | FAME7 | Bryony Thompson edited their review of STR: FAME7: Added comment: TTTCA expansion (without TTTTA expansion) identified in 3 affected individuals in a Chinese FAME family and another unrelated Japanese proband. Now 3 families reported.; Changed rating: AMBER; Changed publications: 29507423, 30351492, 33791773 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.164 | DMD | Bryony Thompson changed review comment from: Another case with BMD (patient 18) form a Japanese registry was reported with an expansion of 1381–1502 repeats in intron 62.; to: Another case with BMD (patient 18) form a Japanese registry was reported with an expansion of 1381–1502 repeats in intron 62. Repeat expansion causes a splicing aberration | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.164 | DMD | Bryony Thompson Classified STR: DMD as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.164 | DMD | Bryony Thompson Str: dmd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.163 | DMD | Bryony Thompson edited their review of STR: DMD: Added comment: Another case with BMD (patient 18) form a Japanese registry was reported with an expansion of 1381–1502 repeats in intron 62.; Changed rating: AMBER; Changed publications: 27417533, 36048237 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.163 | HFGS_tract2 | Bryony Thompson Marked STR: HFGS_tract2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.163 | HFGS_tract2 | Bryony Thompson Str: hfgs_tract2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.163 | SCA_THAP11_CAG | Bryony Thompson Marked STR: SCA_THAP11_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.163 | SCA_THAP11_CAG | Bryony Thompson Str: sca_thap11_cag has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.163 | SCA_THAP11_CAG | Bryony Thompson Classified STR: SCA_THAP11_CAG as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.163 | SCA_THAP11_CAG | Bryony Thompson Str: sca_thap11_cag has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.162 | SCA_THAP11_CAG |
Bryony Thompson STR: SCA_THAP11_CAG was added STR: SCA_THAP11_CAG was added to Repeat Disorders. Sources: Other Mode of inheritance for STR: SCA_THAP11_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA_THAP11_CAG were set to 15368101; 24677642; 34165550; 38113319 Phenotypes for STR: SCA_THAP11_CAG were set to autosomal dominant cerebellar ataxia MONDO:0020380 Review for STR: SCA_THAP11_CAG was set to AMBER Added comment: 7 individuals from 2 Chinese families with SCA (1 was pre-ataxic) and a THAP11 CAG (polyQ) expansion. 45 repeats was the lowest number of repeats in an affected individual. A 46/29 CAG THAP11 genotype has also been identified in an individual with ataxia of European ancestry, that also had a CACNA1A pathogenic expansion which causes SCA6. Analysis of the 1000 genomes cohort (n=2504), suggests a normal range between 19-39. Also, a supporting mouse model and functional assays support a toxic aggregation mechanism of disease. Further probands/families are required to confirm the gene-disease association. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.161 | OPDM_ABCD3_GCC | Bryony Thompson Marked STR: OPDM_ABCD3_GCC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.161 | OPDM_ABCD3_GCC | Bryony Thompson Str: opdm_abcd3_gcc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.161 | OPDM_ABCD3_GCC | Bryony Thompson Classified STR: OPDM_ABCD3_GCC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.161 | OPDM_ABCD3_GCC | Bryony Thompson Str: opdm_abcd3_gcc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.160 | OPDM_ABCD3_GCC |
Bryony Thompson STR: OPDM_ABCD3_GCC was added STR: OPDM_ABCD3_GCC was added to Repeat Disorders. Sources: Other Mode of inheritance for STR: OPDM_ABCD3_GCC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPDM_ABCD3_GCC were set to https://doi.org/10.1101/2023.10.09.23296582 Phenotypes for STR: OPDM_ABCD3_GCC were set to Oculopharyngodistal myopathy MONDO:0025193 Review for STR: OPDM_ABCD3_GCC was set to GREEN STR: OPDM_ABCD3_GCC was marked as clinically relevant Added comment: 35 OPDM individuals from 8 unrelated families from Australia, the UK, and France with an ABCD3 5’UTR CGG repeat. Affected individuals had repeat expansions ranging from 118-694 (n=19). 7 repeats is the median repeat size in non-neurological controls from the GE 100,000 Genome Project. 10 controls had estimated repeats >50, up to ~93. 50 repeats would be a safe cut-off for normal Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.159 | SCA4_ZFHX3_GGC | Bryony Thompson Marked STR: SCA4_ZFHX3_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.159 | SCA4_ZFHX3_GGC | Bryony Thompson Str: sca4_zfhx3_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.159 | SCA4_ZFHX3_GGC | Bryony Thompson Classified STR: SCA4_ZFHX3_GGC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.159 | SCA4_ZFHX3_GGC | Bryony Thompson Str: sca4_zfhx3_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.158 | SCA4_ZFHX3_GGC |
Bryony Thompson STR: SCA4_ZFHX3_GGC was added STR: SCA4_ZFHX3_GGC was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: SCA4_ZFHX3_GGC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA4_ZFHX3_GGC were set to 38035881; 38197134 Phenotypes for STR: SCA4_ZFHX3_GGC were set to spinocerebellar ataxia type 4 MONDO:0010847 Review for STR: SCA4_ZFHX3_GGC was set to GREEN STR: SCA4_ZFHX3_GGC was marked as clinically relevant Added comment: PMID: 38035881 - repeat expansion is identified in 5 Swedish ataxia families that developed balance and gait disturbances at 15 to 60 years of age and had sensory neuropathy and slow saccades. PMID: 38197134 - Poly-glycine GGC expansion in the last coding exon of ZFHX3 was identified in the original SCA4 Utah pedigree (Swedish origin) in the region of high linkage identified on 16q22. The expansion was also identified in an Iowa ataxia pedigree of Swedish ancestry. The expansion wasn’t identified in 11,258 exomes, 7,650 WGS probands without neurological phenotype, or 803 individuals with ataxia. Grch38 chr16:72787695–72787758 Normal allele <30 repeats, 21 repeats is the most common (derived from 33,094 individuals) Undefined pathogenic 30-48 repeats Definitive pathogenicity 48+ repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.157 | OPDM1 | Bryony Thompson Phenotypes for STR: OPDM1 were changed from Oculopharyngodistal myopathy 1 MIM#164310 to Oculopharyngodistal myopathy 1 MIM#164310; Amyotrophic lateral sclerosis MONDO:0004976 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.156 | OPDM1 | Bryony Thompson Publications for STR: OPDM1 were set to 31332380; 34047774 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.155 | OPDM1 | Bryony Thompson edited their review of STR: OPDM1: Changed publications: 31332380, 34047774, 37339631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.155 | OPDM1 | Bryony Thompson edited their review of STR: OPDM1: Added comment: The CGG repeat expansion in the 5’UTR of LRP12 was identified in 5 ALS families and 2 simplex cases. 61-100 repeats associated with ALS, whereas >100 repeats causes OPDM. Toxic gain-of-function is the mechanism of disease. Authors’ suggest the differences in the levels of toxic RNA and MBNL1 dysfunction, in turn dependent on repeat length, may determine whether the affected individual develops ALS or OPDM; Changed phenotypes: Oculopharyngodistal myopathy 1 MIM#164310, Amyotrophic lateral sclerosis MONDO:0004976 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.155 | MRUPAV | Bryony Thompson Marked STR: MRUPAV as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.155 | MRUPAV | Bryony Thompson Str: mrupav has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.155 | MRUPAV | Bryony Thompson Classified STR: MRUPAV as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.155 | MRUPAV | Bryony Thompson Str: mrupav has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.154 | MRUPAV |
Bryony Thompson STR: MRUPAV was added STR: MRUPAV was added to Repeat Disorders. Sources: Literature adult-onset tags were added to STR: MRUPAV. Mode of inheritance for STR: MRUPAV was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: MRUPAV were set to 32451610; 37145156; 36151849; 35499779 Phenotypes for STR: MRUPAV were set to myopathy, distal, with rimmed vacuoles MONDO:0014945 Review for STR: MRUPAV was set to GREEN STR: MRUPAV was marked as clinically relevant Added comment: Expansion of 33-mer (33 amino acids, 99 bp) identified in coding exon 3 (exon 5) of PLIN4 via linkage analysis and long read sequencing in a large Italian cohort with progressive myopathy with specific pathology including rimmed ubiquitin-positive autophagic vacuolation. Suggested disease name myopathy with rimmed ubiquitin-positive autophagic vacuolation (MRUPAV) An additional 4 unrelated Chinese families/probands were reported. Normal PLIN4 alleles: 27-31 x 33-mer Pathogenic: ≥39 x 33-mer Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.153 | SCA27B | Bryony Thompson Marked STR: SCA27B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.153 | SCA27B | Bryony Thompson Str: sca27b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.153 | SCA27B | Bryony Thompson Classified STR: SCA27B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.153 | SCA27B | Bryony Thompson Str: sca27b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.152 | SCA27B |
Bryony Thompson STR: SCA27B was added STR: SCA27B was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: SCA27B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA27B were set to 37165652; 36516086; 36493768 Phenotypes for STR: SCA27B were set to Spinocerebellar ataxia type 27B MONDO:0012247; Spinocerebellar ataxia 50; late-onset cerebellar ataxias (LOCAs) Review for STR: SCA27B was set to GREEN STR: SCA27B was marked as clinically relevant Added comment: NM_175929.3(FGF14):c.208+239747CTT[X] Expansions of 250 or more GAA repeat units were associated with late-onset cerebellar ataxia in a French-Canadian (OR: 105.60 [95% CI=31.09-334.20], p<0.001) and a German (OR: 8.76 [95% CI=3.45-20.84], p<0.001) case-control series. Additionally, expanded alleles greater than (GAA)332 are pathogenic and fully penetrant in a combined Australian and German dataset (p = 6.0 × 10−8, OR = 72 [95% CI = 4.3–1,227]). Whereas, alleles in the range of (GAA)250-334 are likely to be pathogenic with reduced penetrance (p = 0.0015, OR = 3.6 [95% CI = 1.6–7.9]). 250-300 repeats in the incompletely penetrant range >300 is fully penetrant for ataxia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.151 | OPDM4 | Bryony Thompson Publications for STR: OPDM4 were set to 35148830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.150 | OPDM4 | Bryony Thompson Marked STR: OPDM4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.150 | OPDM4 | Bryony Thompson Str: opdm4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.150 | OPDM4 | Bryony Thompson Classified STR: OPDM4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.150 | OPDM4 | Bryony Thompson Str: opdm4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.149 | OPDM4 |
Bryony Thompson STR: OPDM4 was added STR: OPDM4 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: OPDM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPDM4 were set to 35148830 Phenotypes for STR: OPDM4 were set to Oculopharyngodistal myopathy MONDO:0025193 Review for STR: OPDM4 was set to GREEN STR: OPDM4 was marked as clinically relevant Added comment: 5'UTR repeat upstream of RILPL1. Analyses suggest that toxic RNA gain-of-function is the mechanism of disease for the repeat expansion. Distribution of CGG repeat units in RILPL1 ranged from 9 to 16 among 200 normal controls. The size of the CGG repeat ranged from 139 to 197 (169.91 ± 21.82) repeats in 11 unrelated individuals with OPDM. Segregation evidence from 1 family, with 2 affected individuals with the repeat expansion and 1 individual with essential tremor but not OPDM and 86 repeats (intermediate). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.148 | FRA7A | Bryony Thompson edited their review of STR: FRA7A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 5-53 repeats, with a median of 13.; Changed publications: 25196122, 33510257 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.148 | FRA2A | Bryony Thompson edited their review of STR: FRA2A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 1-64 repeats, with a median of 16.; Changed publications: 24763282, 33510257 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.148 | FRA12A | Bryony Thompson edited their review of STR: FRA12A: Added comment: Bioinformatic analysis of 544 whole genomes from non-affected individuals demonstrated a range of 8-120 repeats, with a median of 8.; Changed publications: 17236128, 33510257 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.148 | FRA7A | Bryony Thompson Classified STR: FRA7A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.148 | FRA7A | Bryony Thompson Str: fra7a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.147 | OPDM1 | Zornitza Stark Tag adult-onset tag was added to STR: OPDM1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.147 | NIID | Zornitza Stark Tag adult-onset tag was added to STR: NIID. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.147 | Zornitza Stark Panel types changed to Australian Genomics; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | VACTERLX | Zornitza Stark Tag paediatric-onset tag was added to STR: VACTERLX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | OPML1 | Zornitza Stark Tag adult-onset tag was added to STR: OPML1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Marked STR: NIPA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | NIPA1 | Zornitza Stark Tag adult-onset tag was added to STR: NIPA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRAXF | Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXF. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA7A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA7A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA11B | Zornitza Stark Marked STR: FRA11B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA11B | Zornitza Stark Str: fra11b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA11B | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11B. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA11A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FAME7 | Zornitza Stark Tag adult-onset tag was added to STR: FAME7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FAME6 | Zornitza Stark Tag adult-onset tag was added to STR: FAME6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FAME4 | Zornitza Stark Tag adult-onset tag was added to STR: FAME4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | DMD |
Zornitza Stark Tag adult-onset tag was added to STR: DMD. Tag paediatric-onset tag was added to STR: DMD. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA2A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA2A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | FRA12A | Zornitza Stark Tag paediatric-onset tag was added to STR: FRA12A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCD | Zornitza Stark Marked STR: CCD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCD | Zornitza Stark Str: ccd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCD | Zornitza Stark Tag paediatric-onset tag was added to STR: CCD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Marked STR: CANVAS_ACAGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Str: canvas_acagg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CANVAS_ACAGG | Zornitza Stark Tag adult-onset tag was added to STR: CANVAS_ACAGG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | XDP | Zornitza Stark Tag adult-onset tag was added to STR: XDP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | TOF | Zornitza Stark Tag paediatric-onset tag was added to STR: TOF. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SPD1 | Zornitza Stark Tag paediatric-onset tag was added to STR: SPD1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA8 | Zornitza Stark Tag adult-onset tag was added to STR: SCA8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA7 | Zornitza Stark Tag adult-onset tag was added to STR: SCA7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA6 | Zornitza Stark Tag adult-onset tag was added to STR: SCA6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA37 | Zornitza Stark Tag adult-onset tag was added to STR: SCA37. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA36 | Zornitza Stark Tag adult-onset tag was added to STR: SCA36. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA31 | Zornitza Stark Tag adult-onset tag was added to STR: SCA31. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA3 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA3. Tag paediatric-onset tag was added to STR: SCA3. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA2 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA2. Tag paediatric-onset tag was added to STR: SCA2. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA17 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA17. Tag paediatric-onset tag was added to STR: SCA17. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA12 |
Zornitza Stark Tag adult-onset tag was added to STR: SCA12. Tag paediatric-onset tag was added to STR: SCA12. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA10 | Zornitza Stark Tag adult-onset tag was added to STR: SCA10. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SCA1 | Zornitza Stark Tag adult-onset tag was added to STR: SCA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | SBMA | Zornitza Stark Tag adult-onset tag was added to STR: SBMA. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | RCPS | Zornitza Stark Tag paediatric-onset tag was added to STR: RCPS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCHS | Zornitza Stark Marked STR: CCHS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | CCHS | Zornitza Stark Str: cchs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.146 | Bryony Thompson Panel status changed from internal to public | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | OPMD | Zornitza Stark Tag adult-onset tag was added to STR: OPMD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | OPDM2 | Zornitza Stark Tag adult-onset tag was added to STR: OPDM2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | MEDPSACH | Zornitza Stark Tag paediatric-onset tag was added to STR: MEDPSACH. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | HSAN8 | Zornitza Stark Tag paediatric-onset tag was added to STR: HSAN8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | FRA2A | Bryony Thompson Marked STR: FRA2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | FRA2A | Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | FRA2A | Bryony Thompson Classified STR: FRA2A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.145 | FRA2A | Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.144 | FRA2A |
Bryony Thompson STR: FRA2A was added STR: FRA2A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA2A were set to 24763282 Phenotypes for STR: FRA2A were set to Neurodevelopmental delay Review for STR: FRA2A was set to AMBER Added comment: Three families with a wide spectrum of neurodevelopmental phenotypes with expression of folate-sensitive fragile site FRA2A. The CGG repeat is in an alternative promoter for AFF3, active in the brain. Expansion of >300 repeats causes expression of FRA2A and is associated with hypermethylation and silencing of AFF3 in at least one individual. There were 3-20 repeats in normal controls. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.143 | FRA7A | Bryony Thompson Marked STR: FRA7A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.143 | FRA7A | Bryony Thompson Str: fra7a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.143 | FRA7A |
Bryony Thompson STR: FRA7A was added STR: FRA7A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA7A were set to 25196122 Phenotypes for STR: FRA7A were set to Autism spectrum disorder Review for STR: FRA7A was set to AMBER Added comment: A de novo occurrence of the 7p11.2 folate-sensitive fragile site FRA7A in a male with an autistic spectrum disorder (ASD) due to a CGG-repeat expansion mutation (∼450 repeats) in a 5' intron of ZNF713. The expanded allele showed hypermethylation of the adjacent CpG island and reduced ZNF713 expression observed in a proband-derived lymphoblastoid cell line. The probands mother had a pre-mutation with 85 repeats. Controls showed a CGG-repeat range of 5 to 22. In a second family a pre-mutation (66-72) was identified in 3 siblings with ASD and an unaffected father. One of the siblings had mitotic instability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.142 | VACTERLX | Bryony Thompson Marked STR: VACTERLX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.142 | VACTERLX | Bryony Thompson Str: vacterlx has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.142 | VACTERLX |
Bryony Thompson STR: VACTERLX was added STR: VACTERLX was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: VACTERLX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: VACTERLX were set to 20452998; 32639022 Phenotypes for STR: VACTERLX were set to VACTERL association, X-linked MIM#314390 Review for STR: VACTERLX was set to RED Added comment: NM_003413.4(ZIC3):c.163GCC[X] PMID: 20452998 - reports a single case with VACTERL association and an expansion of the poly-Ala tract from 10 to 12 alanines. PMID: 32639022 - a family with Oculo-auriculo-vertebral spectrum (OAVS) segregates the 11 alanine expansion in affected males This polyalanine tract is highly polymorphic in gnomAD v2.1, there are 86 hemizygote 12 alanine expansions present and 65 hemizygotes with the 11 alanine expansion. The 13 polyalanine expansion is also present in 13 hemizygotes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.141 | FRA12A | Bryony Thompson Marked STR: FRA12A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.141 | FRA12A | Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.141 | FRA12A | Bryony Thompson Classified STR: FRA12A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.141 | FRA12A | Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.140 | FRA12A |
Bryony Thompson STR: FRA12A was added STR: FRA12A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA12A were set to 17236128 Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630 Review for STR: FRA12A was set to AMBER Added comment: NM_173602.2:c.-137CGG[X] All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp. 70 controls used to determine the "normal" repeat range. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.139 | FRA11A | Bryony Thompson Marked STR: FRA11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.139 | FRA11A | Bryony Thompson Str: fra11a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.139 | FRA11A |
Bryony Thompson STR: FRA11A was added STR: FRA11A was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA11A was set to Unknown Publications for STR: FRA11A were set to 18160775; 453198 Phenotypes for STR: FRA11A were set to Intellectual disability Review for STR: FRA11A was set to RED Added comment: Expansion of a polymorphic CGG-repeat located at the 5' end of the C11orf80 gene causes expression of the folate-sensitive fragile site FRA11A. The CGG-repeat elongation coincides with hypermethylation of the adjacent CpG island and subsequent transcriptional silencing of the C11orf80 gene. The expansion was identified in the 15-year-old proband with intellectual disability as well as in phenotypically normal members of the family. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.138 | TOF | Bryony Thompson Marked STR: TOF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.138 | TOF | Bryony Thompson Str: tof has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.138 | TOF | Bryony Thompson Classified STR: TOF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.138 | TOF | Bryony Thompson Str: tof has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.137 | TOF |
Bryony Thompson STR: TOF was added STR: TOF was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: TOF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: TOF were set to 19948535; 11748311 Phenotypes for STR: TOF were set to Tetralogy of Fallot MIM#187500 Review for STR: TOF was set to GREEN STR: TOF was marked as clinically relevant Added comment: Poly-alanine tract expansion. In vitro functional assays demonstrated the expansion lead to protein aggregation in cells. Two unrelated cases reported with 25 repeats, one case with isolated interrupted aortic arch and one case with scoliosis, facial asymmetry, upslanting palpebral fissures, absent PV, isolated left pulmonary artery (expected de novo - excluded in mother and father not available for testing). Other variant types cause disease in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.136 | FRAXF | Bryony Thompson Marked STR: FRAXF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.136 | FRAXF | Bryony Thompson Str: fraxf has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.136 | FRAXF |
Bryony Thompson STR: FRAXF was added STR: FRAXF was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRAXF was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: FRAXF were set to 7874164; 10094554; 8651274 Phenotypes for STR: FRAXF were set to Intellectual disability Review for STR: FRAXF was set to RED Added comment: FRAXF is a folate-sensitive fragile site, where expansion was identified in a male with developmental delay. However, further studies found that expression of the fragile site through expansion is not associated with a disease phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.135 | FRA11B | Bryony Thompson Classified STR: FRA11B as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.135 | FRA11B | Bryony Thompson Added comment: Comment on list classification: Low evidence of clinical relevance of expression of the fragile site. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.135 | FRA11B | Bryony Thompson Str: fra11b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.134 | FRA11B |
Bryony Thompson STR: FRA11B was added STR: FRA11B was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FRA11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA11B were set to 7881408; 7603564; 9508241; 9927483; 10767345; 11076037; 19267933 Phenotypes for STR: FRA11B were set to Jacobsen syndrome MIM#147791 Review for STR: FRA11B was set to AMBER Added comment: FRA11B is a rare folate sensitive fragile site caused by expansion of (CCG)n in the 5'UTR of CBL, and hypermethylation of adjacent CpG islands. There are commonly 11 repeats. The pre-mutation ranges from 80-100, while >100 leads to expression of the fragile site. Two cases of Jacobsen (llq-) syndrome, which is the clinical presentation of the loss of part of the long arm of chromosome 11, have been associated with the FRA11B repeat expansion (expected breakpoint). The estimated prevalence of the FRA11B expansion is 1 in 5,000, which the estimated prevalence of Jacobsen syndrome is <1 in 100,000. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Classified STR: NIPA1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Added comment: Comment on list classification: This is an association/risk allele rather than high-risk disease-causing expansion, and not useful in the clinical diagnostic setting. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.133 | NIPA1 | Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Classified STR: NIPA1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Added comment: Comment on list classification: The odds ratio associated with the expansion of this repeat is not high-risk or high-penetrance, and not useful in the clinical diagnostic setting. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.132 | NIPA1 | Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.131 | NIPA1 |
Bryony Thompson STR: NIPA1 was added STR: NIPA1 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: NIPA1 was set to Unknown Publications for STR: NIPA1 were set to 30342764; 22378146 Phenotypes for STR: NIPA1 were set to Amyotrophic lateral sclerosis Review for STR: NIPA1 was set to GREEN Added comment: Meta-analysis on a total of 6245 patients with ALS and 5051 controls showed an overall increased risk of ALS in those with expanded (>8) GCG repeat length, odds ratio = 1.50, p = 3.8×10-5. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Marked STR: HSAN8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Classified STR: HSAN8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.130 | HSAN8 | Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.129 | HSAN8 |
Bryony Thompson STR: HSAN8 was added STR: HSAN8 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: HSAN8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: HSAN8 were set to 26005867 Phenotypes for STR: HSAN8 were set to Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488 Review for STR: HSAN8 was set to GREEN STR: HSAN8 was marked as clinically relevant Added comment: NM_021619.3(PRDM12):c.1041CGC[X] Poly-Ala repeat, with 7-14 repeats identified in controls. A large consanguineous Pakastani family with HSAN segregating a homozygous expansion from 12 to 19 residues, and an Irish family with HSAN segregating a expansion from 12 to 18 residues. In vitro functional expression studies in COS-7 cells showed that the polyalanine expansions resulted in reduced protein expression and caused discrete, concentrated foci to form in the nucleus and cytoplasm. SNVs also cause disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS |
Bryony Thompson changed review comment from: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature; to: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS | Bryony Thompson Marked STR: RCPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS | Bryony Thompson Str: rcps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS | Bryony Thompson Classified STR: RCPS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.128 | RCPS | Bryony Thompson Str: rcps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.127 | RCPS |
Bryony Thompson STR: RCPS was added STR: RCPS was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: RCPS were set to 24360810; 29112243 Phenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: RCPS was set to GREEN STR: RCPS was marked as clinically relevant Added comment: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Marked STR: MEDPSACH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Str: medpsach has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Classified STR: MEDPSACH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.126 | MEDPSACH | Bryony Thompson Str: medpsach has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.125 | MEDPSACH |
Bryony Thompson STR: MEDPSACH was added STR: MEDPSACH was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: MEDPSACH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: MEDPSACH were set to 9887340; 17133256; 21922596 Phenotypes for STR: MEDPSACH were set to Epiphyseal dysplasia, multiple, 1 MIM#132400; Pseudoachondroplasia MIM#177170 Review for STR: MEDPSACH was set to GREEN STR: MEDPSACH was marked as clinically relevant STR: MEDPSACH was marked as current diagnostic Added comment: At least 5 cases reported with 6 or 7 GAC repeats. 5 repeats is normal. Deletion/contraction of the repeat is also reported. Other SNV and small indels are reported as disease-causing in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.124 | DMD | Bryony Thompson Marked STR: DMD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.124 | DMD | Bryony Thompson Str: dmd has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.124 | DMD |
Bryony Thompson STR: DMD was added STR: DMD was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: DMD was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: DMD were set to 27417533 Phenotypes for STR: DMD were set to Duchenne muscular dystrophy MIM#310200; Becker muscular dystrophy MIM#300376 Review for STR: DMD was set to RED Added comment: Single family reported with GAA repeat expansion in intron 62. Normal repeat range 11-33 in healthy controls. Expanded repeats range from 59-82 in the family, with 2 female carriers manifesting symptoms, a male foetus, 2 asymptomatic female carriers, and 2 male asymptomatic carriers ages 6 and 4 years. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | PHPX | Zornitza Stark Tag paediatric-onset tag was added to STR: PHPX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HPE5 | Zornitza Stark Tag paediatric-onset tag was added to STR: HPE5. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HMNMYO | Zornitza Stark Tag paediatric-onset tag was added to STR: HMNMYO. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HFGS_tract3 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HFGS_tract2 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HFGS_tract1 | Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HDL2 | Zornitza Stark Tag adult-onset tag was added to STR: HDL2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | HD | Zornitza Stark Tag adult-onset tag was added to STR: HD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | GDPAG | Zornitza Stark Tag paediatric-onset tag was added to STR: GDPAG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FXTAS | Zornitza Stark Tag adult-onset tag was added to STR: FXTAS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FXS | Zornitza Stark Tag paediatric-onset tag was added to STR: FXS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FXPOI | Zornitza Stark Tag adult-onset tag was added to STR: FXPOI. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FTDALS | Zornitza Stark Tag adult-onset tag was added to STR: FTDALS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FRDA | Zornitza Stark Tag paediatric-onset tag was added to STR: FRDA. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FRAXE | Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXE. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FECD3 | Zornitza Stark Tag adult-onset tag was added to STR: FECD3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FAME3 | Zornitza Stark Tag adult-onset tag was added to STR: FAME3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FAME2 | Zornitza Stark Tag adult-onset tag was added to STR: FAME2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | FAME1 | Zornitza Stark Tag adult-onset tag was added to STR: FAME1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | EPM1 | Zornitza Stark Tag paediatric-onset tag was added to STR: EPM1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | EIEE1_tract2 | Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | EIEE1_tract1 | Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | DRPLA |
Zornitza Stark Tag adult-onset tag was added to STR: DRPLA. Tag paediatric-onset tag was added to STR: DRPLA. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | DM2 | Zornitza Stark Tag adult-onset tag was added to STR: DM2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | DM1 |
Zornitza Stark Tag adult-onset tag was added to STR: DM1. Tag paediatric-onset tag was added to STR: DM1. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | DBQD2 | Zornitza Stark Tag paediatric-onset tag was added to STR: DBQD2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Zornitza Stark Tag adult-onset tag was added to STR: CJD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CCHS | Zornitza Stark Tag paediatric-onset tag was added to STR: CCHS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CANVAS | Zornitza Stark Tag adult-onset tag was added to STR: CANVAS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | BPES | Zornitza Stark Tag paediatric-onset tag was added to STR: BPES. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Bryony Thompson Marked STR: CJD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Bryony Thompson Classified STR: CJD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.123 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.122 | CJD |
Bryony Thompson STR: CJD was added STR: CJD was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CJD were set to 2159587; 20301407 Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: CJD was set to GREEN STR: CJD was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.121 | OPDM2 | Bryony Thompson Marked STR: OPDM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.121 | OPDM2 | Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.121 | OPDM2 | Bryony Thompson Classified STR: OPDM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.121 | OPDM2 | Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.120 | OPDM2 |
Bryony Thompson STR: OPDM2 was added STR: OPDM2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPDM2 were set to 32413282; 33374016 Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940 Review for STR: OPDM2 was set to GREEN STR: OPDM2 was marked as clinically relevant Added comment: NM_005716.4:c.-211GGC[X] >15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.119 | FAME3 | Bryony Thompson Marked STR: FAME3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.119 | FAME3 | Bryony Thompson Str: fame3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.119 | FAME3 | Bryony Thompson Classified STR: FAME3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.119 | FAME3 | Bryony Thompson Str: fame3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.118 | FAME3 |
Bryony Thompson STR: FAME3 was added STR: FAME3 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME3 were set to 31664039 Phenotypes for STR: FAME3 were set to Epilepsy, familial adult myoclonic, 3 MIM#613608 Review for STR: FAME3 was set to GREEN STR: FAME3 was marked as clinically relevant Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.117 | FAME2 | Bryony Thompson Marked STR: FAME2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.117 | FAME2 | Bryony Thompson Str: fame2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.117 | FAME2 | Bryony Thompson Classified STR: FAME2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.117 | FAME2 | Bryony Thompson Str: fame2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.116 | FAME2 |
Bryony Thompson STR: FAME2 was added STR: FAME2 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME2 were set to 31664034 Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876 Review for STR: FAME2 was set to GREEN STR: FAME2 was marked as clinically relevant Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X] 158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.115 | FAME4 | Bryony Thompson Marked STR: FAME4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.115 | FAME4 | Bryony Thompson Str: fame4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.115 | FAME4 |
Bryony Thompson STR: FAME4 was added STR: FAME4 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME4 were set to 31539032 Phenotypes for STR: FAME4 were set to Epilepsy, myoclonic, familial adult, 4 MIM#615127 Review for STR: FAME4 was set to RED Added comment: 13 affected members of a single Thai family with familial adult myoclonic epilepsy-4 with a heterozygous (TTTTA)n/TTTCA(n) repeat expansion in intron 1 of the YEATS2 gene. 1 affected family member was estimated to be (TTTTA)819/(TTTCA)221, whereas a control had (TTTTA)7/(TTTTA)8. No functional analysis, but RNA toxicity is expected to be the mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.114 | OPML1 | Bryony Thompson Marked STR: OPML1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.114 | OPML1 | Bryony Thompson Str: opml1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.114 | OPML1 |
Bryony Thompson STR: OPML1 was added STR: OPML1 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: OPML1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPML1 were set to 31332380 Phenotypes for STR: OPML1 were set to Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637 Review for STR: OPML1 was set to RED Added comment: NR_120611.1:n.192CCG[X] 4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.113 | OPDM1 | Bryony Thompson Marked STR: OPDM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.113 | OPDM1 | Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.113 | OPDM1 | Bryony Thompson Classified STR: OPDM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.113 | OPDM1 | Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.112 | OPDM1 |
Bryony Thompson STR: OPDM1 was added STR: OPDM1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: OPDM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: OPDM1 were set to 31332380; 34047774 Phenotypes for STR: OPDM1 were set to Oculopharyngodistal myopathy 1 MIM#164310 Review for STR: OPDM1 was set to GREEN STR: OPDM1 was marked as clinically relevant Added comment: NM_013437.5:c.-102CGG[X] RNA-mediated toxicity is thought to be the mechanism of disease. Sixty-five Japanese patients with oculopharyngodistal myopathy (OPDM) from 59 families with CGG repeat expansions in LRP12. This represents the most common OPDM subtype among all patients in Japan with genetically diagnosed OPDM. Normal: 13 to 45 repeats. Pathogenic: 85 to 289 repeats. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.111 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.111 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.111 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.111 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.110 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier. Intermediate range: 41-60 identified in Parkinson's disease Pathogenic repeat range: >=60-520 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.109 | Bryony Thompson removed STR:NIID from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.108 | NIID | Bryony Thompson Marked STR: NIID as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.108 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.108 | NIID | Bryony Thompson Classified STR: NIID as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.108 | NIID | Bryony Thompson Str: niid has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.107 | NIID |
Bryony Thompson STR: NIID was added STR: NIID was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102 Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866 Review for STR: NIID was set to GREEN STR: NIID was marked as clinically relevant Added comment: NM_001364012.2:c.-164GGC[X] Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2. Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.106 | GDPAG | Bryony Thompson Marked STR: GDPAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.106 | GDPAG | Bryony Thompson Str: gdpag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.106 | GDPAG | Bryony Thompson Classified STR: GDPAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.106 | GDPAG | Bryony Thompson Str: gdpag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.105 | GDPAG |
Bryony Thompson STR: GDPAG was added STR: GDPAG was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GDPAG were set to 30970188 Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GDPAG was set to GREEN STR: GDPAG was marked as clinically relevant Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.104 | FAME1_TTTGA | Bryony Thompson Marked STR: FAME1_TTTGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.104 | FAME1_TTTGA | Bryony Thompson Str: fame1_tttga has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.104 | FAME1_TTTGA |
Bryony Thompson STR: FAME1_TTTGA was added STR: FAME1_TTTGA was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME1_TTTGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME1_TTTGA were set to 31483537 Phenotypes for STR: FAME1_TTTGA were set to familial cortical myoclonic tremor with epilepsy Review for STR: FAME1_TTTGA was set to RED Added comment: A single family with 2 cases and 1 asymptomatic carrier with the repeat allele (TTTTA)114-123 (TTTGA)108-116, instead of the TTTCA FAME1 repeat. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.103 | CANVAS_ACAGG | Bryony Thompson Classified STR: CANVAS_ACAGG as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.103 | CANVAS_ACAGG | Bryony Thompson Added comment: Comment on list classification: Used the pathogenic cut-off of 400 repeats from original CANVAS repeat | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.103 | CANVAS_ACAGG | Bryony Thompson Str: canvas_acagg has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.102 | CANVAS_ACAGG |
Bryony Thompson STR: CANVAS_ACAGG was added STR: CANVAS_ACAGG was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: CANVAS_ACAGG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CANVAS_ACAGG were set to 33237689; 32694621; 33103729 Phenotypes for STR: CANVAS_ACAGG were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome; fasciculations; elevated serum creatine kinase levels; denervation Review for STR: CANVAS_ACAGG was set to AMBER Added comment: A novel RFC1 repeat expansion motif, (ACAGG)exp, identified in three affected individuals from 2 families in an Asian-Pacific cohort and one Japanese individual for CANVAS. Southern blot was used to identify the repeat was ~1000kb in one of the cases, equivalent to ~1000 repeats. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.101 | CANVAS | Bryony Thompson Marked STR: CANVAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.101 | CANVAS | Bryony Thompson Str: canvas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.101 | CANVAS | Bryony Thompson Classified STR: CANVAS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.101 | CANVAS | Bryony Thompson Str: canvas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.100 | CANVAS |
Bryony Thompson STR: CANVAS was added STR: CANVAS was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CANVAS were set to 30926972; 32851396; 33237689; 31230722 Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Review for STR: CANVAS was set to GREEN STR: CANVAS was marked as clinically relevant Added comment: NM_001204747.1:c.132+2923_2927AAAAG[X] Simple tandem repeat (AAAAG)n replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Maori population-specific CANVAS configuration (AAAGG)10-25(AAGGG)exp. (AAAGG)n repeat alone is not pathogenic. Mechanism of disease is unknown. Normal: AAAAG 11 repeats (allele frequency = 0.75); AAAAG 12-200 (allele frequency = 0.13); AAAGG 40-1000 (allele frequency = 0.08) Pathogenic: AAGGG repeat expansion, most frequently ranging from 400 to more than 2000 repeats (allele frequency = 0.01-0.04) Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.99 | DBQD2 | Bryony Thompson Marked STR: DBQD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.99 | DBQD2 | Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.99 | DBQD2 | Bryony Thompson Classified STR: DBQD2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.99 | DBQD2 | Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.98 | DBQD2 |
Bryony Thompson STR: DBQD2 was added STR: DBQD2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: DBQD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: DBQD2 were set to 30554721 Phenotypes for STR: DBQD2 were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: DBQD2 was set to GREEN STR: DBQD2 was marked as clinically relevant Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.97 | FAME7 | Bryony Thompson Marked STR: FAME7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.97 | FAME7 | Bryony Thompson Str: fame7 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.97 | FAME7 |
Bryony Thompson STR: FAME7 was added STR: FAME7 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME7 were set to 29507423 Phenotypes for STR: FAME7 were set to Epilepsy, familial adult myoclonic, 7 MIM#618075 Review for STR: FAME7 was set to RED Added comment: The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.96 | FAME6 | Bryony Thompson Marked STR: FAME6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.96 | FAME6 | Bryony Thompson Str: fame6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.96 | FAME6 |
Bryony Thompson STR: FAME6 was added STR: FAME6 was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: FAME6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FAME6 were set to 29507423 Phenotypes for STR: FAME6 were set to Epilepsy, familial adult myoclonic, 6 MIM#618074 Review for STR: FAME6 was set to RED Added comment: The expanded (TTTTA)22(TTTCA)exp(TTTTA)exp allele was identified 5 affected carriers in a single family. (TTTTA)18 is the reference repeats. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 |
Bryony Thompson changed review comment from: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X] A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease. Sources: Expert list; to: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X] A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 | Bryony Thompson Marked STR: FAME1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 | Bryony Thompson Str: fame1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 | Bryony Thompson Classified STR: FAME1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.95 | FAME1 | Bryony Thompson Str: fame1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.94 | FAME1 |
Bryony Thompson STR: FAME1 was added STR: FAME1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for STR: FAME1 were set to 30194086; 29507423 Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068 Review for STR: FAME1 was set to GREEN STR: FAME1 was marked as clinically relevant Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X] A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.93 | SPD1 | Bryony Thompson Marked STR: SPD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.93 | SPD1 | Bryony Thompson Str: spd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.93 | SPD1 | Bryony Thompson Classified STR: SPD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.93 | SPD1 | Bryony Thompson Str: spd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.92 | SPD1 |
Bryony Thompson STR: SPD1 was added STR: SPD1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SPD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SPD1 were set to 8817328; 33811808; 33533119 Phenotypes for STR: SPD1 were set to Synpolydactyly 1 MIM#186000 Review for STR: SPD1 was set to GREEN STR: SPD1 was marked as clinically relevant Added comment: NM_000523.4(HOXD13):c.212_213GCG[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect Normal repeat number: 15 Pathogenic repeat number: 24 Truncation of repeat also reported Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.91 | Bryony Thompson removed STR:SPD1 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.90 | SCA37 | Bryony Thompson Marked STR: SCA37 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.90 | SCA37 | Bryony Thompson Str: sca37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.90 | SCA37 | Bryony Thompson Classified STR: SCA37 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.90 | SCA37 | Bryony Thompson Str: sca37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.89 | SCA37 |
Bryony Thompson STR: SCA37 was added STR: SCA37 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA37 were set to 28686858; 31145571 Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945 Review for STR: SCA37 was set to GREEN STR: SCA37 was marked as clinically relevant Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90] Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease. Non-pathogenic allele: (ATTTT)7–400 Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90] Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP |
Bryony Thompson changed review comment from: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression. Sources: Expert list; to: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within intron 32. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP | Bryony Thompson Marked STR: XDP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP | Bryony Thompson Str: xdp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP | Bryony Thompson Classified STR: XDP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.88 | XDP | Bryony Thompson Str: xdp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.87 | XDP |
Bryony Thompson STR: XDP was added STR: XDP was added to Repeat Disorders. Sources: Expert list founder tags were added to STR: XDP. Mode of inheritance for STR: XDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: XDP were set to 17273961; 29229810 Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250 Review for STR: XDP was set to GREEN STR: XDP was marked as clinically relevant Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.86 | FECD3 | Bryony Thompson Marked STR: FECD3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.86 | FECD3 | Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.86 | FECD3 | Bryony Thompson Classified STR: FECD3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.86 | FECD3 | Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.85 | FECD3 |
Bryony Thompson STR: FECD3 was added STR: FECD3 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FECD3 were set to 25722209; 24255041 Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267 Review for STR: FECD3 was set to GREEN STR: FECD3 was marked as clinically relevant Added comment: NG_011716.2:g.54765TGC[X] Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance. Normal: 5-31 repeats Pathogenic: >50 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.84 | FTDALS | Bryony Thompson Marked STR: FTDALS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.84 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.84 | FTDALS | Bryony Thompson Classified STR: FTDALS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.84 | FTDALS | Bryony Thompson Str: ftdals has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.83 | FTDALS |
Bryony Thompson STR: FTDALS was added STR: FTDALS was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FTDALS were set to 25577942; 21944779; 21944778 Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: FTDALS was set to GREEN STR: FTDALS was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.82 | SCA12 | Bryony Thompson Publications for STR: SCA12 were set to 27864267; 33811808 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.81 | SCA12 | Bryony Thompson edited their review of STR: SCA12: Changed publications: 27864267, 33811808, 10581021 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.81 | SCA8 | Bryony Thompson Publications for STR: SCA8 were set to 20301445 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.80 | SCA8 | Bryony Thompson edited their review of STR: SCA8: Changed publications: 20301445, 10192387 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.80 | FXPOI | Bryony Thompson Publications for STR: FXPOI were set to 20301558 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.79 | FXPOI | Bryony Thompson edited their review of STR: FXPOI: Changed publications: 20301558, 9647544 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.79 | EPM1 | Bryony Thompson Publications for STR: EPM1 were set to 29325606; 20301321 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.78 | EPM1 | Bryony Thompson edited their review of STR: EPM1: Changed publications: 29325606, 20301321, 9126745 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.78 | FRDA | Bryony Thompson Publications for STR: FRDA were set to 20301458 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.77 | FRDA | Bryony Thompson edited their review of STR: FRDA: Changed publications: 20301458, 8596916 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.77 | DM1 | Bryony Thompson Publications for STR: DM1 were set to 20301344; 29325606 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.76 | DM1 | Bryony Thompson edited their review of STR: DM1: Changed publications: 20301344, 29325606, 1546325 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.76 | FXS | Bryony Thompson Publications for STR: FXS were set to 33795824; 25227148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | FXS | Bryony Thompson edited their review of STR: FXS: Changed publications: 33795824, 25227148, 1710175, 2031184 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | SCA36 | Bryony Thompson Marked STR: SCA36 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | SCA36 | Bryony Thompson Str: sca36 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | SCA36 | Bryony Thompson Classified STR: SCA36 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.75 | SCA36 | Bryony Thompson Str: sca36 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.74 | SCA36 |
Bryony Thompson STR: SCA36 was added STR: SCA36 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA36 were set to 21683323 Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153 Review for STR: SCA36 was set to GREEN STR: SCA36 was marked as clinically relevant Added comment: NM_006392.3:c.3+71GGCCTG[X] Toxic RNA effect is suggested mechanism of disease Normal: 3-14 repeats Uncertain significance: 15-650 repeats Pathogenic: ≥650 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.73 | SCA31 | Bryony Thompson Marked STR: SCA31 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.73 | SCA31 | Bryony Thompson Str: sca31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.73 | SCA31 | Bryony Thompson Classified STR: SCA31 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.73 | SCA31 | Bryony Thompson Str: sca31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.72 | SCA31 |
Bryony Thompson STR: SCA31 was added STR: SCA31 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA31 were set to 19878914; 31755042 Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210 Review for STR: SCA31 was set to GREEN STR: SCA31 was marked as clinically relevant Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested. 2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042) Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.71 | FXTAS | Bryony Thompson Marked STR: FXTAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.71 | FXTAS | Bryony Thompson Str: fxtas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.71 | FXTAS | Bryony Thompson Classified STR: FXTAS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.71 | FXTAS | Bryony Thompson Str: fxtas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.70 | FXTAS |
Bryony Thompson STR: FXTAS was added STR: FXTAS was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FXTAS were set to 23765048; 25227148; 11445641 Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623 Review for STR: FXTAS was set to GREEN STR: FXTAS was marked as clinically relevant Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.69 | DM2 | Bryony Thompson Marked STR: DM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.69 | DM2 | Bryony Thompson Str: dm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.69 | DM2 | Bryony Thompson Classified STR: DM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.69 | DM2 | Bryony Thompson Str: dm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.68 | DM2 |
Bryony Thompson STR: DM2 was added STR: DM2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: DM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DM2 were set to 20301639; 11486088 Phenotypes for STR: DM2 were set to Myotonic dystrophy 2 MIM#602668 Review for STR: DM2 was set to GREEN STR: DM2 was marked as clinically relevant Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X] Toxic gain of function RNA expected mechanism of disease Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions Unknown significance (normal vs. mutable): 27-29 CCTG repeats Mutable normal (premutation) alleles. ~30-~54 CCTG repeats Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats Pathogenic: ~75-11,000 CCTG repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.67 | SCA10 | Bryony Thompson Marked STR: SCA10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.67 | SCA10 | Bryony Thompson Str: sca10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.67 | SCA10 | Bryony Thompson Classified STR: SCA10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.67 | SCA10 | Bryony Thompson Str: sca10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.66 | SCA10 |
Bryony Thompson STR: SCA10 was added STR: SCA10 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA10 were set to 20301354; 11017075 Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516 Review for STR: SCA10 was set to GREEN STR: SCA10 was marked as clinically relevant Added comment: NM_013236.2:c.1430+54822ATTCT[X] Toxic RNA gain-of-function mechanism of disease Normal alleles: 10-32 ATTCT repeats Alleles of questionable significance: 33-280 ATTCT repeats Reduced-penetrance alleles: 33-850 repeats Full-penetrance alleles: 800-4,500 ATTCT repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.65 | SCA12 | Bryony Thompson Marked STR: SCA12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.65 | SCA12 | Bryony Thompson Str: sca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.65 | SCA12 | Bryony Thompson Classified STR: SCA12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.65 | SCA12 | Bryony Thompson Str: sca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.64 | SCA12 |
Bryony Thompson STR: SCA12 was added STR: SCA12 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA12 were set to 27864267; 33811808 Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326 Review for STR: SCA12 was set to GREEN STR: SCA12 was marked as clinically relevant Added comment: NM_181675.3:c.27CAG[X] Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase Normal: ≤32 repeats Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12 Established pathogenic (used as diagnostic cut-off): ≥51 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.63 | HMNMYO | Bryony Thompson Marked STR: HMNMYO as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.63 | HMNMYO | Bryony Thompson Str: hmnmyo has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.63 | HMNMYO | Bryony Thompson Classified STR: HMNMYO as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.63 | HMNMYO | Bryony Thompson Str: hmnmyo has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.62 | HMNMYO |
Bryony Thompson STR: HMNMYO was added STR: HMNMYO was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: HMNMYO was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: HMNMYO were set to 33559681; 33459760 Phenotypes for STR: HMNMYO were set to Neuropathy, hereditary motor, with myopathic features MIM#619216 Review for STR: HMNMYO was set to GREEN STR: HMNMYO was marked as clinically relevant Added comment: NM_022834.5(VWA1):c.62_71GCGCGGAGCG[X] 10-bp repeat expansion leading to a loss of function allele, was observed in 14/15 families and was homozygous in 10/15 with a recessive hereditary motor neuropathy. Normal: 2 repeats Pathogenic: >=3 repeats (currently only 3 repeats reported) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.61 | SCA8 | Bryony Thompson Marked STR: SCA8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.61 | SCA8 | Bryony Thompson Str: sca8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.61 | SCA8 | Bryony Thompson Classified STR: SCA8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.61 | SCA8 | Bryony Thompson Str: sca8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.60 | SCA8 |
Bryony Thompson STR: SCA8 was added STR: SCA8 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA8 were set to 20301445 Phenotypes for STR: SCA8 were set to Spinocerebellar ataxia 8 MIM#608768 Review for STR: SCA8 was set to GREEN STR: SCA8 was marked as clinically relevant Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X] ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats Alleles of questionable significance: 50-70 repeats. Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.59 | FXPOI | Bryony Thompson Marked STR: FXPOI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.59 | FXPOI | Bryony Thompson Str: fxpoi has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.59 | FXPOI | Bryony Thompson Classified STR: FXPOI as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.59 | FXPOI | Bryony Thompson Str: fxpoi has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.58 | FXPOI |
Bryony Thompson STR: FXPOI was added STR: FXPOI was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FXPOI was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FXPOI were set to 20301558 Phenotypes for STR: FXPOI were set to Premature ovarian failure 1 MIM#311360 Review for STR: FXPOI was set to GREEN STR: FXPOI was marked as clinically relevant Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] RNA-mediated toxicity may result in the POI phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXPOI: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats It is estimated that 21% of women who carry a premutation develop FXPOI. The association between repeat size of the premutation allele and FXPOI is nonlinear; women with 80-99 repeats are at greatest risk for FXPOI. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.57 | EPM1 | Bryony Thompson Marked STR: EPM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.57 | EPM1 | Bryony Thompson Str: epm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.57 | EPM1 | Bryony Thompson Classified STR: EPM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.57 | EPM1 | Bryony Thompson Str: epm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.56 | EPM1 |
Bryony Thompson STR: EPM1 was added STR: EPM1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: EPM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EPM1 were set to 29325606; 20301321 Phenotypes for STR: EPM1 were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Review for STR: EPM1 was set to GREEN STR: EPM1 was marked as clinically relevant Added comment: NM_000100.4:c.-179CCCCGCCCCGCG[X] Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME. Normal: 2-3 dodecamer repeats Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized) Pathogenic (full penetrance): ≥30 dodecamer repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.55 | FRDA | Bryony Thompson Marked STR: FRDA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.55 | FRDA | Bryony Thompson Str: frda has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.55 | FRDA | Bryony Thompson Classified STR: FRDA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.55 | FRDA | Bryony Thompson Str: frda has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.54 | FRDA |
Bryony Thompson STR: FRDA was added STR: FRDA was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FRDA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: FRDA were set to 20301458 Phenotypes for STR: FRDA were set to Friedreich ataxia MIM#229300 Review for STR: FRDA was set to GREEN STR: FRDA was marked as clinically relevant Added comment: NM_000144.4:c.165+1340GAA[X] Loss of function is the mechanism of disease Normal: 5-33 repeats Mutable normal (premutation): 34-65 repeats Borderline: 44-66 repeats Full-penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.53 | FRAXE | Bryony Thompson Marked STR: FRAXE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.53 | FRAXE | Bryony Thompson Str: fraxe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.53 | FRAXE | Bryony Thompson Classified STR: FRAXE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.53 | FRAXE | Bryony Thompson Str: fraxe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.52 | FRAXE |
Bryony Thompson STR: FRAXE was added STR: FRAXE was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FRAXE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: FRAXE were set to 8334699; 8673085; 11388762 Phenotypes for STR: FRAXE were set to Intellectual developmental disorder, X-linked 109 MIM#309548 Review for STR: FRAXE was set to GREEN STR: FRAXE was marked as clinically relevant Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25) Loss of function through methylation silencing is the mechanism of disease Normal - 5-44 repeats Inconclusive - 45-54 repeats Premutation - 55-200 repeats Abnormal - >200 or >230 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.51 | DM1 | Bryony Thompson Marked STR: DM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.51 | DM1 | Bryony Thompson Str: dm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.51 | DM1 | Bryony Thompson Classified STR: DM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.51 | DM1 | Bryony Thompson Str: dm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.50 | DM1 |
Bryony Thompson STR: DM1 was added STR: DM1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: DM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DM1 were set to 20301344; 29325606 Phenotypes for STR: DM1 were set to Myotonic dystrophy 1 MIM#160900 Review for STR: DM1 was set to GREEN STR: DM1 was marked as clinically relevant Added comment: HGVS nomenclature: NM_001081560.2:c.*224_*226CTG[X] RNA toxic gain of function is mechanism of disease Premutation: 35-49 repeats, no clinical signs Mild: 50-~150 repeats, age of onset 20-70 yrs, clinical signs - cataracts, mild myotonia Classic: ~100-~1,000 repeats, age of onset 10-30 yrs, clinical signs - weakness, myotonia, cataracts, balding, cardiac arrhythmia Congenital: >1,000 repeats, age of onset birth-10 yrs , clinical signs - infantile hypotonia, respiratory deficits, intellectual disability, classic signs in adults Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.49 | FXS | Bryony Thompson Marked STR: FXS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.49 | FXS | Bryony Thompson Str: fxs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.49 | FXS | Bryony Thompson Classified STR: FXS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.49 | FXS | Bryony Thompson Str: fxs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.48 | FXS |
Bryony Thompson STR: FXS was added STR: FXS was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: FXS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FXS were set to 33795824; 25227148 Phenotypes for STR: FXS were set to Fragile X syndrome MIM#300624 Review for STR: FXS was set to GREEN STR: FXS was marked as clinically relevant Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.47 | CCD | Bryony Thompson Classified STR: CCD as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.47 | CCD | Bryony Thompson Str: ccd has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.46 | CCD |
Bryony Thompson STR: CCD was added STR: CCD was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: CCD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CCD were set to 9182765; 33811808; 20560987; 26220009; 25852448 Phenotypes for STR: CCD were set to Cleidocranial dysplasia MIM#119600 Review for STR: CCD was set to AMBER Added comment: NM_001024630.4(RUNX2):c.231_233[x] Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein. Only identified 2 reported polyAla repeat expansions in the literature. One family reported with 27 Ala repeats and one case reported with 20 Ala repeats (with supporting in vitro functional assay evidence). Also at least one case reported with expansion of the upstream glutamine repeat. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.45 | Bryony Thompson removed STR:BCCD from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.44 | CCHS | Bryony Thompson Classified STR: CCHS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.44 | CCHS | Bryony Thompson Str: cchs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.43 | CCHS |
Bryony Thompson STR: CCHS was added STR: CCHS was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: CCHS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CCHS were set to 12640453; 34012823; 20301600; 18798833 Phenotypes for STR: CCHS were set to Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880 Review for STR: CCHS was set to GREEN STR: CCHS was marked as clinically relevant Added comment: NM_003924.3:c.721_723[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect. Normal: 20 GCN (alanine) repeats Uncertain significance: 21-23 GCN repeats have not been described in CCHS to date. Later onset: 24 GCN repeats and a subset of individuals with 25 GCN repeats may have a very mild phenotype with delayed onset of the disorder and/or manifestations only when the individual is exposed to respiratory depressants and/or has severe intercurrent pulmonary illness. Neonatal onset: 26-33 GCN repeats, as well as most with 25 GCN repeats, present in the newborn period Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.42 | PHPX | Bryony Thompson Marked STR: PHPX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.42 | PHPX | Bryony Thompson Str: phpx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.42 | PHPX | Bryony Thompson Classified STR: PHPX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.42 | PHPX | Bryony Thompson Str: phpx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.41 | PHPX |
Bryony Thompson STR: PHPX was added STR: PHPX was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: PHPX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: PHPX were set to 12428212; 15800844; 33811808; 23505376; 19654509 Phenotypes for STR: PHPX were set to Intellectual disability, X-linked, with isolated growth hormone deficiency MIM#300123; Panhypopituitarism, X-linked MIM#312000 Review for STR: PHPX was set to GREEN STR: PHPX was marked as clinically relevant Added comment: NM_005634.2:c.700_702[X] Sufficient evidence for an association with growth hormone deficiency, however limited evidence for intellectual disability. ID and growth hormone deficiency identified in a single family with 26 Ala repeats (11 Ala expansion). 22 Ala repeats (7 Ala expansion) has been identified in two families with hypopituitarism (without ID). Mouse model demonstrates that mechanism of disease is polyAlanine tract leading to a loss of function of the protein, Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | BCCD | Bryony Thompson edited their review of STR: BCCD: Changed publications: 9182765, 33811808, 20560987, 26220009 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | BCCD |
Bryony Thompson changed review comment from: NM_001024630.4(RUNX2):c.231_233[x] Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein Normal repeat number: 17 (18 have been reported in the Danish population) Pathogenic repeat number: 27 Sources: Expert list; to: NM_001024630.4(RUNX2):c.231_233[x] Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein Normal repeat number: 17 (18 have been reported in the Danish population) Pathogenic repeat number: 27 (1 case with 20 Ala have been reported) Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | BCCD |
Bryony Thompson changed review comment from: NM_001024630.4(RUNX2):c.231_233[x] Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein Normal repeat number: 17 Pathogenic repeat number: 27 Sources: Expert list; to: NM_001024630.4(RUNX2):c.231_233[x] Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein Normal repeat number: 17 (18 have been reported in the Danish population) Pathogenic repeat number: 27 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | BCCD | Bryony Thompson edited their review of STR: BCCD: Changed publications: 9182765, 33811808, 20560987 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | SPD1 |
Bryony Thompson changed review comment from: NM_000523.4(HOXD13):c.212_213GCG[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect Normal repeat number: 15 Pathogenic repeat number: 24 Sources: Expert list; to: NM_000523.4(HOXD13):c.212_213GCG[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect Normal repeat number: 15 Pathogenic repeat number: 24 Truncation of repeat also reported Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | SPD1 | Bryony Thompson edited their review of STR: SPD1: Changed publications: 8817328, 33811808, 33533119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | EIEE1_tract2 | Bryony Thompson Marked STR: EIEE1_tract2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | EIEE1_tract2 | Bryony Thompson Str: eiee1_tract2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | EIEE1_tract2 | Bryony Thompson Classified STR: EIEE1_tract2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.40 | EIEE1_tract2 | Bryony Thompson Str: eiee1_tract2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.39 | EIEE1_tract2 |
Bryony Thompson STR: EIEE1_tract2 was added STR: EIEE1_tract2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: EIEE1_tract2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: EIEE1_tract2 were set to 11889467; 33811808 Phenotypes for STR: EIEE1_tract2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: EIEE1_tract2 was set to GREEN STR: EIEE1_tract2 was marked as clinically relevant Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.38 | EIEE1_tract1 | Bryony Thompson Marked STR: EIEE1_tract1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.38 | EIEE1_tract1 | Bryony Thompson Str: eiee1_tract1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.38 | EIEE1_tract1 | Bryony Thompson Classified STR: EIEE1_tract1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.38 | EIEE1_tract1 | Bryony Thompson Str: eiee1_tract1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.37 | EIEE1_tract1 |
Bryony Thompson STR: EIEE1_tract1 was added STR: EIEE1_tract1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: EIEE1_tract1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: EIEE1_tract1 were set to 11889467; 33811808 Phenotypes for STR: EIEE1_tract1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: EIEE1_tract1 was set to GREEN STR: EIEE1_tract1 was marked as clinically relevant Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.36 | HPE5 | Bryony Thompson Marked STR: HPE5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.36 | HPE5 | Bryony Thompson Str: hpe5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.36 | HPE5 | Bryony Thompson Classified STR: HPE5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.36 | HPE5 | Bryony Thompson Str: hpe5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.35 | HPE5 |
Bryony Thompson STR: HPE5 was added STR: HPE5 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: HPE5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HPE5 were set to 11285244; 33811808 Phenotypes for STR: HPE5 were set to Holoprosencephaly 5 MIM#609637 Review for STR: HPE5 was set to GREEN STR: HPE5 was marked as clinically relevant Added comment: NM_007129.5(ZIC2):c.1366GCN[X] Mechanism of disease is polyAlanine tract leading to a loss of function of the protein Normal repeat number: 15 Pathogenic repeat number: 25 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.34 | BPES | Bryony Thompson Marked STR: BPES as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.34 | BPES | Bryony Thompson Str: bpes has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.34 | BPES | Bryony Thompson Classified STR: BPES as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.34 | BPES | Bryony Thompson Str: bpes has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.33 | BPES |
Bryony Thompson STR: BPES was added STR: BPES was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: BPES was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for STR: BPES were set to 11468277; 33811808 Phenotypes for STR: BPES were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996 Review for STR: BPES was set to GREEN STR: BPES was marked as clinically relevant Added comment: NM_023067.2:c.661_702[X] Mechanism of disease is polyAlanine tract leading to a loss of function of the protein Normal repeat number: 14 Pathogenic repeat number: 19-24 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.32 | HDL2 | Bryony Thompson Marked STR: HDL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.32 | HDL2 | Bryony Thompson Str: hdl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.32 | HDL2 | Bryony Thompson Classified STR: HDL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.32 | HDL2 | Bryony Thompson Str: hdl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.31 | HDL2 |
Bryony Thompson STR: HDL2 was added STR: HDL2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: HDL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HDL2 were set to 11558794; 20301701 Phenotypes for STR: HDL2 were set to Huntington disease-like 2 MIM#606438 Review for STR: HDL2 was set to GREEN STR: HDL2 was marked as clinically relevant Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included Full penetrance: ≥40 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.30 | HFGS_tract3 | Bryony Thompson Marked STR: HFGS_tract3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.30 | HFGS_tract3 | Bryony Thompson Str: hfgs_tract3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.30 | HFGS_tract3 | Bryony Thompson Classified STR: HFGS_tract3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.30 | HFGS_tract3 | Bryony Thompson Str: hfgs_tract3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.29 | HFGS_tract3 |
Bryony Thompson STR: HFGS_tract3 was added STR: HFGS_tract3 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: HFGS_tract3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HFGS_tract3 were set to 10839976; 12073020; 33811808 Phenotypes for STR: HFGS_tract3 were set to Hand-foot-uterus syndrome MIM#140000 Review for STR: HFGS_tract3 was set to GREEN STR: HFGS_tract3 was marked as clinically relevant Added comment: NM_000522.5(HOXA13):c.357_359[X] Expected mechanism of disease is a polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein PolyAla tract 3 of the 3 N-terminal polyAla tracts Normal repeat number: 18 Pathogenic repeat number: 24-30 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.28 | HFGS_tract2 | Bryony Thompson Classified STR: HFGS_tract2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.28 | HFGS_tract2 | Bryony Thompson Str: hfgs_tract2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.27 | HFGS_tract2 |
Bryony Thompson STR: HFGS_tract2 was added STR: HFGS_tract2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: HFGS_tract2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HFGS_tract2 were set to 10839976; 12073020; 33811808 Phenotypes for STR: HFGS_tract2 were set to Hand-foot-uterus syndrome MIM#140000 Review for STR: HFGS_tract2 was set to GREEN STR: HFGS_tract2 was marked as clinically relevant Added comment: NM_000522.5(HOXA13):c.217_219[X] Expected mechanism of disease is a polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein PolyAla tract 2 of the 3 N-terminal polyAla tracts Normal repeat number: 12 Pathogenic repeat number: 18 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.26 | HFGS_tract1 | Bryony Thompson Marked STR: HFGS_tract1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.26 | HFGS_tract1 | Bryony Thompson Str: hfgs_tract1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.26 | HFGS_tract1 | Bryony Thompson Classified STR: HFGS_tract1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.26 | HFGS_tract1 | Bryony Thompson Str: hfgs_tract1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.25 | HFGS_tract1 |
Bryony Thompson STR: HFGS_tract1 was added STR: HFGS_tract1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: HFGS_tract1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HFGS_tract1 were set to 10839976; 12073020; 33811808 Phenotypes for STR: HFGS_tract1 were set to Hand-foot-uterus syndrome MIM#140000 Review for STR: HFGS_tract1 was set to GREEN STR: HFGS_tract1 was marked as clinically relevant Added comment: NM_000522.5(HOXA13):c.126_128[X] Expected mechanism of disease is a polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein PolyAla tract 1 of the 3 N-terminal polyAla tracts Normal repeat number: 14-16 Pathogenic repeat number: 22 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.24 | SCA17 | Bryony Thompson Marked STR: SCA17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.24 | SCA17 | Bryony Thompson Str: sca17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.24 | SCA17 | Bryony Thompson Classified STR: SCA17 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.24 | SCA17 | Bryony Thompson Str: sca17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.23 | SCA17 |
Bryony Thompson STR: SCA17 was added STR: SCA17 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA17 were set to 10484774; 20301611; 29325606 Phenotypes for STR: SCA17 were set to Spinocerebellar ataxia 17 MIM#607136 Review for STR: SCA17 was set to GREEN STR: SCA17 was marked as clinically relevant Added comment: NM_003194.4:c.172_174[X] Mechanism of disease expected to be gain of function Normal: ≤ 40 CAG/CAA repeats Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms. Full-penetrance: ≥49 CAG/CAA repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.22 | OPMD | Bryony Thompson Classified STR: OPMD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.22 | OPMD | Bryony Thompson Str: opmd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.21 | OPMD |
Bryony Thompson STR: OPMD was added STR: OPMD was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: OPMD was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for STR: OPMD were set to 9462747; 20301305 Phenotypes for STR: OPMD were set to Oculopharyngeal muscular dystrophy MIM#164300 Review for STR: OPMD was set to GREEN STR: OPMD was marked as clinically relevant Added comment: NM_004643.3:c.4_6[X] Expected gain of function mechanism of disease Normal allele: (GCN)10 / Ala10 Autosomal recessive: (GCN)11/Ala11 Autosomal dominant: (GCN)12-17 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.20 | BCCD | Bryony Thompson Marked STR: BCCD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.20 | BCCD | Bryony Thompson Str: bccd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.20 | BCCD | Bryony Thompson Classified STR: BCCD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.20 | BCCD | Bryony Thompson Str: bccd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.19 | BCCD |
Bryony Thompson changed review comment from: NM_001024630.4(RUNX2):c.231_233[x] Expected mechansim of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein Normal repeat number: 17 Pathogenic repeat number: 27 Sources: Expert list; to: NM_001024630.4(RUNX2):c.231_233[x] Expected mechanism of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein Normal repeat number: 17 Pathogenic repeat number: 27 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.19 | BCCD |
Bryony Thompson STR: BCCD was added STR: BCCD was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: BCCD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: BCCD were set to 9182765; 33811808 Phenotypes for STR: BCCD were set to Cleidocranial dysplasia MIM#119600 Review for STR: BCCD was set to GREEN STR: BCCD was marked as clinically relevant Added comment: NM_001024630.4(RUNX2):c.231_233[x] Expected mechansim of disease is polyAlanine tract associated with dominant-negative effect or leading to a loss of function of the protein Normal repeat number: 17 Pathogenic repeat number: 27 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.18 | SCA6 | Bryony Thompson Marked STR: SCA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.18 | SCA6 | Bryony Thompson Str: sca6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.18 | SCA6 | Bryony Thompson Classified STR: SCA6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.18 | SCA6 | Bryony Thompson Str: sca6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.17 | SCA6 |
Bryony Thompson STR: SCA6 was added STR: SCA6 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA6 were set to 8988170; 20301319; 29325606 Phenotypes for STR: SCA6 were set to Spinocerebellar ataxia 6 MIM#183086; Episodic ataxia, type 2 MIM#108500 Review for STR: SCA6 was set to GREEN STR: SCA6 was marked as clinically relevant Added comment: NM_023035.2:c.6929_6931CAG[X] PolyQ expansion alters gene binding, impairs transcription factor function, and is toxic to cells expressing the α1ACT – effects consistent with a loss of function Normal: ≤18 repeats Questionable significance: 19 CAG repeats Full penetrance: ≥20 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.16 | SPD1 | Bryony Thompson Marked STR: SPD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.16 | SPD1 | Bryony Thompson Str: spd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.16 | SPD1 | Bryony Thompson Classified STR: SPD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.16 | SPD1 | Bryony Thompson Str: spd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.15 | SPD1 |
Bryony Thompson STR: SPD1 was added STR: SPD1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SPD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SPD1 were set to 8817328; 33811808 Phenotypes for STR: SPD1 were set to Synpolydactyly 1 MIM#186000 Review for STR: SPD1 was set to GREEN STR: SPD1 was marked as clinically relevant Added comment: NM_000523.4(HOXD13):c.212_213GCG[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect Normal repeat number: 15 Pathogenic repeat number: 24 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.14 | SCA7 | Bryony Thompson Marked STR: SCA7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.14 | SCA7 | Bryony Thompson Str: sca7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.14 | SCA7 | Bryony Thompson Classified STR: SCA7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.14 | SCA7 | Bryony Thompson Str: sca7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.13 | SCA7 |
Bryony Thompson STR: SCA7 was added STR: SCA7 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA7 were set to 8908515; 29325606; 20301433 Phenotypes for STR: SCA7 were set to Spinocerebellar ataxia 7 MIM#164500 Review for STR: SCA7 was set to GREEN STR: SCA7 was marked as clinically relevant Added comment: NM_000333.3:c.89_91AGC[X] Gain of function mechanism of disease Normal: ≤27 repeats Mutable normal: 28-33 repeats, meiotically unstable, but not associated with an abnormal phenotype. Pathogenic reduced penetrance: 34-36 repeats, when manifestations occur, they are more likely to be later onset and milder than average Pathogenic full penetrance: 37-460 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.12 | SCA2 | Bryony Thompson Marked STR: SCA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.12 | SCA2 | Bryony Thompson Str: sca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.12 | SCA2 | Bryony Thompson Classified STR: SCA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.12 | SCA2 | Bryony Thompson Str: sca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.11 | SCA2 |
Bryony Thompson STR: SCA2 was added STR: SCA2 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA2 were set to 8896555; 29325606; 20301452 Phenotypes for STR: SCA2 were set to Spinocerebellar ataxia 2 MIM#183090 Review for STR: SCA2 was set to GREEN STR: SCA2 was marked as clinically relevant Added comment: NM_002973.3:c.496_498CAG[X] Toxic protein aggregation is mechanism of disease Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2) Uncertain: 32 repeats ALS risk allele: 30-32 repeats Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life Full penetrance: ≥35 repeats Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.10 | SCA3 | Bryony Thompson Marked STR: SCA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.10 | SCA3 | Bryony Thompson Str: sca3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.10 | SCA3 | Bryony Thompson Classified STR: SCA3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.10 | SCA3 | Bryony Thompson Str: sca3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.9 | SCA3 |
Bryony Thompson STR: SCA3 was added STR: SCA3 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA3 were set to 7874163; 20301375; 29325606 Phenotypes for STR: SCA3 were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3 Review for STR: SCA3 was set to GREEN STR: SCA3 was marked as clinically relevant Added comment: NM_004993.5:c.886_888CAG[X] Toxic aggregation and mislocalization in neurons is mechanism of disease Normal: ≤44 repeats, mostly <31 repeats Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3 Pathogenic (full penetrance): ≥60 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.8 | DRPLA | Bryony Thompson Marked STR: DRPLA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.8 | DRPLA | Bryony Thompson Str: drpla has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.8 | DRPLA | Bryony Thompson Classified STR: DRPLA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.8 | DRPLA | Bryony Thompson Str: drpla has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.7 | DRPLA |
Bryony Thompson STR: DRPLA was added STR: DRPLA was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: DRPLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DRPLA were set to 8136840; 8136826; 29325606; 20301664 Phenotypes for STR: DRPLA were set to Dentatorubral-pallidoluysian atrophy MIM#125370 Review for STR: DRPLA was set to GREEN STR: DRPLA was marked as clinically relevant Added comment: NM_001007026.1:c.1462_1464CAG[X] Toxic gain of function mechanism of disease Benign: ≤35 repeats Mutable normal: 20-35 repeats Pathogenic: ≥48 repeats Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.6 | SCA1 | Bryony Thompson Marked STR: SCA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.6 | SCA1 | Bryony Thompson Str: sca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.6 | SCA1 | Bryony Thompson Classified STR: SCA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.6 | SCA1 | Bryony Thompson Str: sca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.5 | SCA1 |
Bryony Thompson STR: SCA1 was added STR: SCA1 was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SCA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA1 were set to 8358429; 29325606; 20301363 Phenotypes for STR: SCA1 were set to Spinocerebellar ataxia 1 MIM#164400 Review for STR: SCA1 was set to GREEN STR: SCA1 was marked as clinically relevant Added comment: NM_000332.3:c.589_591CAG[X] Toxic protein aggregation is mechanism of disease Normal: ≤35 CAG repeats or 36-44 CAG repeats with CAT interruptions Mutable normal (intermediate): 36-38 CAG repeats without CAT interruptions Full-penetrance: ≥39 CAG repeats without CAT interruptions or ≥46 uninterrupted CAG repeats with CAT interruptions and additional CAGs Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.4 | HD | Bryony Thompson Marked STR: HD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.4 | HD | Bryony Thompson Str: hd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.4 | HD | Bryony Thompson Classified STR: HD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.4 | HD | Bryony Thompson Str: hd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.3 | HD |
Bryony Thompson STR: HD was added STR: HD was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: HD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HD were set to 8458085; 20301482; 29325606 Phenotypes for STR: HD were set to Huntington disease MIM#143100 Review for STR: HD was set to GREEN STR: HD was marked as clinically relevant Added comment: NM_002111.8:c.52_54CAG[X] Primary mechanism of disease is gain of function Normal: ≤26 repeats Intermediate: 27-35 repeats, no risk for proband but expansion possible in the next generation Pathogenic (reduced penetrance): 36-39 repeats, proband at risk for HD but may not develop symptoms Pathogenic (full penetrance): ≥40 repeats, development of HD with increased certainty assuming a normal life span Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.2 | SBMA | Bryony Thompson Marked STR: SBMA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.2 | SBMA | Bryony Thompson Str: sbma has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.2 | SBMA | Bryony Thompson Classified STR: SBMA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.2 | SBMA | Bryony Thompson Str: sbma has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.1 | SBMA |
Bryony Thompson STR: SBMA was added STR: SBMA was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: SBMA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: SBMA were set to 2062380; 20301508; 29325606 Phenotypes for STR: SBMA were set to Spinal and bulbar muscular atrophy of Kennedy MIM#313200 Review for STR: SBMA was set to GREEN STR: SBMA was marked as clinically relevant Added comment: NM_000044.4:c.172_174CAG[X] Toxic gain of function mechanism of disease Normal: ≤34 repeats Unknown: 35 repeats, consideration of the affected individual's clinical presentation and reconciliation with repeat sizes in family members Reduced-penetrance: 36-37 repeats, interpreted within the context of family history, clinical presentation, genotype-phenotype correlations in other family members. Full-penetrance: ≥38 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.0 |
Bryony Thompson Added Panel Repeat Disorders Set panel types to: Royal Melbourne Hospital; Rare Disease |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||