Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.35 | TCP1 | Zornitza Stark Phenotypes for gene: TCP1 were changed from neurodevelopmental disorder MONDO:0700092, TCP1-related to Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.34 | TCP1 | Zornitza Stark reviewed gene: TCP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Marked gene: TCP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Classified gene: TCP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Classified gene: TCP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.17 | TCP1 | Ain Roesley Gene: tcp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.16 | TCP1 |
Ain Roesley gene: TCP1 was added gene: TCP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TCP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TCP1 were set to 39480921 Phenotypes for gene: TCP1 were set to neurodevelopmental disorder MONDO:0700092, TCP1-related Penetrance for gene: TCP1 were set to Complete Review for gene: TCP1 was set to GREEN gene: TCP1 was marked as current diagnostic Added comment: previously known as CCT1 8x individuals including 5x de novo 6x PTCs + 2x missense 6/8 DD/ID 2/8 visual impairment 6/8 seizures 6/8 polymicrogyria + 1x Ventriculomegaly, white matter hyperintensities Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | REPS2 |
Mark Cleghorn gene: REPS2 was added gene: REPS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: REPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: REPS2 were set to complex neurodevelopmental disorder MONDO:0100038; Cerebral palsy HP:0100021 Penetrance for gene: REPS2 were set to unknown Review for gene: REPS2 was set to AMBER Added comment: REPS2 Hao Hu, Guangzhou Women and Children’s MC ESHG talk 1/6/24, unpublished Proposed X-linked cerebral palsy + NDD gene 4 unrelated males with predicted deleterious hemizygous REPS2 variants, 2 PTC, 2 missense. 2 de novo, 2 maternally inherited Phenotypes: 2 w CP + moderate ID/ASD, 2 w NDD NOS Variants described: c.1050_1052delGAA;p.K351del c.1040T>C; p.I347T c.962C>G; p.S321C c.1736delA; p.N579Tfs*17 In vitro assay of above 4 variants suggest reduced REPS2 protein stability Zebrafish model: REPS2 expressed in neuronal cells, REPS2 knock down have reduced motor activity and abN neuronal morphology Mouse model hemizygous w one of above variants (not specified): reduced performance in cognitive tasks, abnormal neuronal migration pattern on post mortem examination Mechanism may relate to dopamine signalling? Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5812 | CASK |
Zornitza Stark Added comment: Comment when marking as ready: Microcephaly with pontine and cerebellar hypoplasia (MICPCH), generally associated with pathogenic loss-of-function variants in CASK X-linked intellectual disability (XLID) with or without nystagmus, generally associated with hypomorphic CASK pathogenic variants |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5774 | WDPCP | Zornitza Stark Marked gene: WDPCP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5774 | WDPCP | Zornitza Stark Gene: wdpcp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5774 | WDPCP | Zornitza Stark Phenotypes for gene: WDPCP were changed from to Bardet-Biedl syndrome 15, MIM# 615992; OFD; Congenital heart defects, hamartomas of tongue, and polysyndactyly, 217085 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5608 | VCP | Zornitza Stark Marked gene: VCP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5608 | VCP | Zornitza Stark Gene: vcp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5608 | VCP | Zornitza Stark Classified gene: VCP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5608 | VCP | Zornitza Stark Gene: vcp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5606 | VCP |
Manny Jacobs gene: VCP was added gene: VCP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: VCP were set to PMID: 37883978 Phenotypes for gene: VCP were set to Neurodevelopmental disorder (MONDO: 0700092) Review for gene: VCP was set to GREEN Added comment: 13 unrelated individuals with childhood onset ID/DD disorder including macrocephaly, hypotonia and dysmorphic features. Non-specific / mild MRI findings. 12 de novo - 1 inherited Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5133 | BUB1 | Zornitza Stark Phenotypes for gene: BUB1 were changed from Neurodevelopmental disorder, BUB1-related MONDO:0700092; Intellectual disability and microcephaly to Primary microcephaly-30 (MCPH30), MIM#620183 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5132 | BUB1 | Zornitza Stark reviewed gene: BUB1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Primary microcephaly-30 (MCPH30), MIM#620183; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4987 | CPS1 | Zornitza Stark Tag treatable tag was added to gene: CPS1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4787 | CPSF3 | Zornitza Stark Phenotypes for gene: CPSF3 were changed from Neurodevelopmental disorder, CPSF3-related, MONDO:0700092 to Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4786 | CPSF3 | Zornitza Stark reviewed gene: CPSF3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4731 | CPS1 | Ain Roesley Phenotypes for gene: CPS1 were changed from Carbamoylphosphate synthetase I deficiency MIM#237300 to Carbamoylphosphate synthetase I deficiency MIM#237300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4731 | CPS1 | Ain Roesley Publications for gene: CPS1 were set to 8486760; 17310273; 21120950; 31268178 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4730 | CPS1 | Ain Roesley Publications for gene: CPS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4730 | CPS1 | Ain Roesley Phenotypes for gene: CPS1 were changed from to Carbamoylphosphate synthetase I deficiency MIM#237300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4730 | CPS1 | Ain Roesley Marked gene: CPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4730 | CPS1 | Ain Roesley Gene: cps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4730 | CPS1 | Ain Roesley Mode of inheritance for gene: CPS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4729 | CPS1 | Ain Roesley reviewed gene: CPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8486760, 17310273, 21120950, 31268178; Phenotypes: Carbamoylphosphate synthetase I deficiency MIM#237300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4525 | CPSF3 | Alison Yeung Phenotypes for gene: CPSF3 were changed from Neurodevelopmental disorder, CPSF3-related, MONDO:0700092 to Neurodevelopmental disorder, CPSF3-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4524 | CPSF3 | Alison Yeung Marked gene: CPSF3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4524 | CPSF3 | Alison Yeung Gene: cpsf3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4524 | CPSF3 | Alison Yeung Phenotypes for gene: CPSF3 were changed from Intellectual disability syndrome to Neurodevelopmental disorder, CPSF3-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4523 | CPSF3 | Alison Yeung Classified gene: CPSF3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4523 | CPSF3 | Alison Yeung Gene: cpsf3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4520 | CPSF3 |
Belinda Chong gene: CPSF3 was added gene: CPSF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CPSF3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CPSF3 were set to 35121750 Phenotypes for gene: CPSF3 were set to Intellectual disability syndrome Review for gene: CPSF3 was set to GREEN gene: CPSF3 was marked as current diagnostic Added comment: Study of a deficit of observed homozygous carriers of missense variants, versus an expected number in a set of 153,054 chip-genotyped Icelanders, to identify potentially pathogenic genotypes Six homozygous carriers of missense variants in CPSF3 show severe intellectual disability, seizures, microcephaly, and abnormal muscle tone. - Four identified through Icelandic geneology (p.Gly468Glu), three carrier couples total of four children who had died prematurely. Tested archival samples for two of these children, and confirm a homozygous genotype. - Two of Mexican descent (p.Ile354Thr), first-degree cousins Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4244 | NUP85 |
Zornitza Stark gene: NUP85 was added gene: NUP85 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NUP85 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NUP85 were set to 34170319; 30179222 Phenotypes for gene: NUP85 were set to Intellectual disability Review for gene: NUP85 was set to AMBER Added comment: Bi-allelic variants in this gene are associated with nephrotic syndrome in 3 families. Phenotype expansion: PMID: 34170319 - Ravindran et al 2021 report two pedigrees with an MCPH-SCKS phenotype spectrum without SRNS. In the first family, a 9 yo female, with consanguineous parents, is reported to have a missense variant in NUP85 (c.932G > A; p.R311Q). Intrauterine growth restriction was noticed. At birth microcephaly was observed (OFC < 3rd centile, < −3.6 SD) as well as hypotrophy [weight −2.8 SD), length 45 cm (−2.7 SD), both <3rd centile], facial dysmorphism, syndactyly, long and thin fingers, and bilateral pes adductus. She has severe developmental delay with strongly delayed motor milestones and absent speech. Drug-resistant, genetic epilepsy with focal-onset seizures started in the first year of life. She had no clinical, laboratory or radiological findings indicative of kidney dysfunction. In the second family, compound heterozygous missense variants in NUP85 were detected (c.1109A > G, c.1589 T > C;p.N370S, p.M530T ) in a fetus. MRI of the fetal brain at 24 + 2 GW indicated complete agenesis of the corpus callosum, abnormal sulcation in the left frontal lobe, nodularity of the frontal horn and trigone with focal puckering of the left lateral ventricle. PMID: 30179222 - Braun et al 2018 - 2 individuals from 1 of the families reported with steroid-resistant nephrotic syndrome were also reported to have intellectual disability but showed no structural brain defects. The degree of intellectual disability is not stated. They were found to have 2 compound heterozygous alleles (c.405+1G>A and c.1741G>C, p.Ala581Pro) in NUP85. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4150 | CPE | Zornitza Stark Publications for gene: CPE were set to 26120850; 32936766 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4149 | CPE | Zornitza Stark Classified gene: CPE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4149 | CPE | Zornitza Stark Gene: cpe has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4148 | CPE | Zornitza Stark edited their review of gene: CPE: Added comment: Bosch et al. 2021 (PMID: 34383079) reported on 4 individuals from 3 additional families harbouring 2 different homozygous truncating variants in this gene. Clinical presentation was prominent for obesity and intellectual disability. Hypogonadotropic hypogonadism was confirmed in one individual and was suspected but not tested for in another two subjects.; Changed rating: GREEN; Changed publications: 26120850, 32936766, 34383079; Changed phenotypes: Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3776 | CPE | Zornitza Stark Marked gene: CPE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3776 | CPE | Zornitza Stark Gene: cpe has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3776 | CPE | Zornitza Stark Classified gene: CPE as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3776 | CPE | Zornitza Stark Gene: cpe has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3775 | CPE |
Zornitza Stark gene: CPE was added gene: CPE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CPE was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CPE were set to 26120850; 32936766 Phenotypes for gene: CPE were set to Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326 Review for gene: CPE was set to AMBER Added comment: Four affected individuals from two unrelated families reported, bi-allelic LoF variants. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3747 | FBXO31 | Zornitza Stark edited their review of gene: FBXO31: Added comment: PMIDs 33675180; 32989326: three unrelated individuals with de novo missense variant, (p.Asp334Asn) and spastic-dystonic CP, including ID.; Changed rating: GREEN; Changed publications: 24623383, 33675180, 32989326; Changed phenotypes: Mental retardation, autosomal recessive 45, MIM#615979, Spastic-dystonic cerebral palsy, de novo dominant; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3713 | JMJD1C |
Chris Richmond gene: JMJD1C was added gene: JMJD1C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: JMJD1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: JMJD1C were set to 26181491; 32996679 Phenotypes for gene: JMJD1C were set to Intellectual disability Penetrance for gene: JMJD1C were set to unknown Review for gene: JMJD1C was set to GREEN Added comment: Reported in ID cohort (with Rett-like phenotypic overlap) with supporting functional studies (PMID: 26181491) "Functional study of the JMJD1C mutant Rett syndrome patient demonstrated that the altered protein had abnormal subcellular localization, diminished activity to demethylate the DNA damage-response protein MDC1, and reduced binding to MECP2. We confirmed that JMJD1C protein is widely expressed in brain regions and that its depletion compromises dendritic activity." Splice-disrupting JMJD1C variant reported in association with learning disability and myoclonic epilepsy (PMID 32996679) Disruption of gene due to balanced translocation (PMID 33591602) implicated in autism spectrum disease phenotype. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3572 | MCPH1 | Zornitza Stark Marked gene: MCPH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3572 | MCPH1 | Zornitza Stark Gene: mcph1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3572 | MCPH1 | Zornitza Stark Phenotypes for gene: MCPH1 were changed from to Microcephaly 1, primary, autosomal recessive, MIM# 251200; MONDO:0009617 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3571 | MCPH1 | Zornitza Stark Publications for gene: MCPH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3570 | MCPH1 | Zornitza Stark Mode of inheritance for gene: MCPH1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3569 | MCPH1 | Zornitza Stark reviewed gene: MCPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12046007, 15199523, 16311745, 20978018, 32294449, 30351297, 29026105; Phenotypes: Microcephaly 1, primary, autosomal recessive, MIM# 251200, MONDO:0009617; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3125 | LRRC32 | Zornitza Stark Phenotypes for gene: LRRC32 were changed from Intellectual disability; cleft palate; proliferative retinopathy to Cleft palate, proliferative retinopathy, and developmental delay (CPPRDD) syndrome, MIM# 619074 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3124 | LRRC32 | Zornitza Stark edited their review of gene: LRRC32: Changed phenotypes: Cleft palate, proliferative retinopathy, and developmental delay (CPPRDD) syndrome, MIM# 619074 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3073 | WDPCP | Zornitza Stark Publications for gene: WDPCP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3072 | WDPCP | Zornitza Stark Classified gene: WDPCP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3072 | WDPCP | Zornitza Stark Gene: wdpcp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3071 | WDPCP | Zornitza Stark edited their review of gene: WDPCP: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3071 | WDPCP | Zornitza Stark edited their review of gene: WDPCP: Changed publications: 20671153, 25427950, 32055034, 29588463, 28289185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3071 | WDPCP | Zornitza Stark Mode of inheritance for gene: WDPCP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3070 | WDPCP | Zornitza Stark Classified gene: WDPCP as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3070 | WDPCP | Zornitza Stark Gene: wdpcp has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3069 | WDPCP | Zornitza Stark reviewed gene: WDPCP: Rating: AMBER; Mode of pathogenicity: None; Publications: 20671153, 25427950; Phenotypes: Bardet-Biedl syndrome 15, MIM# 615992, OFD, Congenital heart defects, hamartomas of tongue, and polysyndactyly, 217085; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3017 | TECPR2 | Zornitza Stark Marked gene: TECPR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3017 | TECPR2 | Zornitza Stark Gene: tecpr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3017 | TECPR2 | Zornitza Stark Phenotypes for gene: TECPR2 were changed from to Spastic paraplegia 49, autosomal recessive, 615031; Autonomic-sensory neuropathy; Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3016 | TECPR2 | Zornitza Stark Publications for gene: TECPR2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3015 | TECPR2 | Zornitza Stark Mode of inheritance for gene: TECPR2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3014 | TECPR2 | Zornitza Stark reviewed gene: TECPR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23176824, 26542466; Phenotypes: Spastic paraplegia 49, autosomal recessive, 615031, Autonomic-sensory neuropathy, Intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2625 | YIF1B |
Konstantinos Varvagiannis gene: YIF1B was added gene: YIF1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YIF1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YIF1B were set to 32006098 Phenotypes for gene: YIF1B were set to Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement Penetrance for gene: YIF1B were set to Complete Review for gene: YIF1B was set to GREEN Added comment: AlMuhaizea et al (2020 - PMID: 32006098) report on the phenotype of 6 individuals (from 5 families) with biallelic YIF1B truncating variants. Affected subjects presented hypotonia, failure to thrive, microcephaly (5/6), severe global DD and ID (as evident from best motor/language milestones achieved - Table S1) as well as features suggestive of a motor disorder (dystonia/spasticity/dyskinesia). Seizures were reported in 2 unrelated individuals (2/6). MRI abnormalities were observed in some with thin CC being a feature in 3. Variable initial investigations were performed including SNP CMA, MECP2, microcephaly / neurotransmitter disorders gene panel testing did not reveal P/LP variants. YIF1B variants were identified in 3 families within ROH. Following exome sequencing, affected individuals were found to be homozygous for truncating variants (4/5 families being consanguineous). The following 3 variants were identified (NM_001039672.2) : c.186dupT or p.Ala64fs / c.360_361insACAT or p.Gly121fs / c.598G>T or p.Glu200*. YIF1B encodes an intracellular transmembrane protein. It has been previously demonstrated that - similarly to other proteins of the Yip family being implicated in intracellular traffic between the Golgi - Yif1B is involved in the anterograde traffic pathway. Yif1B KO mice demonstrate a disorganized Golgi architecture in pyramidal hippocampal neurons (Alterio et al 2015 - PMID: 26077767). The rat ortholog interacts with serotonin receptor 1 (5-HT1AR) with colocalization of Yif1BB and 5-HT1AR in intermediate compartment vesicles and involvement of the former in intracellular trafficing/modulation of 5-HT1AR transport to dendrites (PMID cited: 18685031). Available mRNA and protein expression data (Protein Atlas) suggest that the gene is widely expressed in all tissues incl. neuronal cells. Immunochemistry data from the Human Brain Atlas also suggest that YIF1B is found in vesicles and localized to the Golgi apparatus. Immunohistochemistry in normal human brain tissue (cerebral cortex) demonstrated labeling of neuronal cells (Human Protein Atlas). Functional/network analysis of genes co-regulated with YIF1B based on available RNAseq data, suggest enrichement in in genes important for nervous system development and function. Please consider inclusion in other panels that may be relevant (e.g. microcephaly, etc). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2619 | CDC42BPB |
Konstantinos Varvagiannis gene: CDC42BPB was added gene: CDC42BPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDC42BPB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CDC42BPB were set to 32031333 Phenotypes for gene: CDC42BPB were set to Central hypotonia; Global developmental delay; Intellectual disability; Seizures; Autistic behavior; Behavioral abnormality Penetrance for gene: CDC42BPB were set to unknown Review for gene: CDC42BPB was set to GREEN Added comment: Chilton et al (2020 - PMID: 32031333) report on 14 individuals with missense and loss-of-function CDC42BPB variants. Features included hypotonia (8/11), DD (12/13 - the 14th was a fetus), ID (7/13), ASD (8/12), clinical seizures (in 3 - a 4th had abnormal EEG without seizures), behavioral abnormalities. Variable non-specific dysmorphic features were reported in some (sparse hair being the most frequent - 4/8). Additional features were observed in few (=<4) incl. cryptorchidism, ophthalmological issues, constipation, kidney abnormalities, micropenis, etc. All individuals had non-diagnostic prior genetic testing (incl. CMA, FMR1, MECP2, Angelman/Prader-Willi methylation studies, autism gene panel - suggesting relevance to the current panel) or metabolic testing. Variants were identified following clinical exome sequencing with Sanger confirmation. Most occurred as de novo events (11/14) while inheritance was not available for few (3/14). Missense variants did not display (particular) clustering. Almost all variants were absent from gnomAD and were predicted to be deleterious in silico (among others almost all had CADD scores >25). As the authors comment, CDC42BPB encodes myotonic dystrophy-related Cdc42-binding kinase β (MRCKβ) a serine/threonine protein kinase playing a role in regulation of cytoskeletal reorganization and cell migration in nonmuscle cells (through phosporylation of MLC2). Previous studies have demonstrated that it is ubiquitously expressed with prenatal brain expression. The gene appears to be intolerant to pLoF (pLI of 1) as well as to missense variants (Z-score of 3.66). CDC42BPB is a downstream effector of CDC42. Mutations of the latter cause Takenouchi-Kosaki syndrome with DD/ID and some further overlapping features (with CDC42BPB-associated phenotypes). Homozygous Cdc42bpb KO in mouse appears to be nonviable (MGI:2136459). Loss of gek in the eyes of Drosophila results in disrupted growth cone targeting to the lamina (gek is the fly CDC42BPB ortholog). Please consider inclusion with amber / green rating in the ID panel (>=4 relevant individuals / variants) and other panels (e.g. for epilepsy, ASD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2575 | GAD1 | Zornitza Stark changed review comment from: Single family reported with bi-allelic variants. Association studies linking with neuropsychiatric issues.; to: Single family reported with bi-allelic variants and CP phenotype. Association studies linking with neuropsychiatric issues. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2350 | TUBGCP4 | Zornitza Stark Marked gene: TUBGCP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2350 | TUBGCP4 | Zornitza Stark Gene: tubgcp4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2350 | TUBGCP4 | Zornitza Stark Classified gene: TUBGCP4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2350 | TUBGCP4 | Zornitza Stark Gene: tubgcp4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2349 | TUBGCP4 |
Zornitza Stark gene: TUBGCP4 was added gene: TUBGCP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TUBGCP4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TUBGCP4 were set to 25817018 Phenotypes for gene: TUBGCP4 were set to Microcephaly and chorioretinopathy, autosomal recessive, 3, 616335 Review for gene: TUBGCP4 was set to AMBER Added comment: Three unrelated families reported; ID described as mild. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2144 | MECP2 | Zornitza Stark Marked gene: MECP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2144 | MECP2 | Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2144 | MECP2 | Zornitza Stark Phenotypes for gene: MECP2 were changed from to Encephalopathy, neonatal severe 300673 XLR; Mental retardation, X-linked, syndromic 13 300055 XLR; Rett syndrome 312750 XLD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2143 | MECP2 | Zornitza Stark Publications for gene: MECP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2142 | MECP2 | Zornitza Stark Mode of inheritance for gene: MECP2 was changed from Unknown to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2132 | MECP2 | Michelle Torres reviewed gene: MECP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301670; Phenotypes: Encephalopathy, neonatal severe 300673 XLR, Mental retardation, X-linked syndromic, Lubs type 300260 XLR, Mental retardation, X-linked, syndromic 13 300055 XLR, Rett syndrome 312750 XLD, Rett syndrome, atypical 312750 XLD, Rett syndrome, preserved speech variant 312750 XLD, {Autism susceptibility, X-linked 3} 300496 XL; Mode of inheritance: Other; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1887 | DCPS | Zornitza Stark Marked gene: DCPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1887 | DCPS | Zornitza Stark Gene: dcps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1887 | DCPS | Zornitza Stark Classified gene: DCPS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1887 | DCPS | Zornitza Stark Gene: dcps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1886 | DCPS |
Zornitza Stark gene: DCPS was added gene: DCPS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: DCPS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DCPS were set to 25701870; 30289615; 25712129 Phenotypes for gene: DCPS were set to Al-Raqad syndrome, MIM#616459 Review for gene: DCPS was set to GREEN gene: DCPS was marked as current diagnostic Added comment: 7 individuals from 3 families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1815 | TUBGCP6 | Zornitza Stark Marked gene: TUBGCP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1815 | TUBGCP6 | Zornitza Stark Gene: tubgcp6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1815 | TUBGCP6 | Zornitza Stark Phenotypes for gene: TUBGCP6 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 1, MIM#251270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1814 | TUBGCP6 | Zornitza Stark Publications for gene: TUBGCP6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1813 | TUBGCP6 | Zornitza Stark Mode of inheritance for gene: TUBGCP6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1812 | TUBGCP6 | Zornitza Stark reviewed gene: TUBGCP6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 22279524; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 1, MIM#251270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1633 | TUBGCP2 | Zornitza Stark Marked gene: TUBGCP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1633 | TUBGCP2 | Zornitza Stark Gene: tubgcp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1633 | TUBGCP2 | Zornitza Stark Classified gene: TUBGCP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1633 | TUBGCP2 | Zornitza Stark Gene: tubgcp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1632 | TUBGCP2 |
Zornitza Stark gene: TUBGCP2 was added gene: TUBGCP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TUBGCP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TUBGCP2 were set to 31630790 Phenotypes for gene: TUBGCP2 were set to Lissencephaly; pachygyria; subcortical band heterotopia; microcephaly; intellectual disability Review for gene: TUBGCP2 was set to GREEN Added comment: Four unrelated families reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.54 | CPA6 | Zornitza Stark Marked gene: CPA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.54 | CPA6 | Zornitza Stark Gene: cpa6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.54 | CPA6 | Zornitza Stark Phenotypes for gene: CPA6 were changed from to Epilepsy, familial temporal lobe, 5, MIM#614417; Febrile seizures, familial, 11, MIM#614418 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.53 | CPA6 | Zornitza Stark Publications for gene: CPA6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.52 | CPA6 | Zornitza Stark Mode of inheritance for gene: CPA6 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.51 | CPA6 | Zornitza Stark Classified gene: CPA6 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.51 | CPA6 | Zornitza Stark Gene: cpa6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.50 | CPA6 | Zornitza Stark reviewed gene: CPA6: Rating: RED; Mode of pathogenicity: None; Publications: 25875328, 21922598, 23105115; Phenotypes: Epilepsy, familial temporal lobe, 5, MIM#614417, Febrile seizures, familial, 11, MIM#614418; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.50 | CP | Zornitza Stark Marked gene: CP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.50 | CP | Zornitza Stark Gene: cp has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.50 | CP | Zornitza Stark Phenotypes for gene: CP were changed from to Aceruloplasminaemia, MIM#604290 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.49 | CP | Zornitza Stark Mode of inheritance for gene: CP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.48 | CP | Zornitza Stark Classified gene: CP as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.48 | CP | Zornitza Stark Gene: cp has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.47 | CP | Zornitza Stark reviewed gene: CP: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aceruloplasminaemia, MIM#604290; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | CP |
Zornitza Stark gene: CP was added gene: CP was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: CP was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | WDPCP |
Zornitza Stark gene: WDPCP was added gene: WDPCP was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: WDPCP was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | TUBGCP6 |
Zornitza Stark gene: TUBGCP6 was added gene: TUBGCP6 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: TUBGCP6 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | TECPR2 |
Zornitza Stark gene: TECPR2 was added gene: TECPR2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: TECPR2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | MECP2 |
Zornitza Stark gene: MECP2 was added gene: MECP2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: MECP2 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | MCPH1 |
Zornitza Stark gene: MCPH1 was added gene: MCPH1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: MCPH1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | CPS1 |
Zornitza Stark gene: CPS1 was added gene: CPS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: CPS1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | CPA6 |
Zornitza Stark gene: CPA6 was added gene: CPA6 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: CPA6 was set to Unknown |