Activity

Filter

Cancel
Date Panel Item Activity
16 actions
Intellectual disability syndromic and non-syndromic v2.0 EIF4A3_RCPS_complex STR EIF4A3_RCPS_complex: gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF4A3 Gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.109 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4369 EIF4A3 Zornitza Stark Tag STR tag was added to gene: EIF4A3.
Intellectual disability syndromic and non-syndromic v0.4009 EIF4A3 Zornitza Stark Marked gene: EIF4A3 as ready
Intellectual disability syndromic and non-syndromic v0.4009 EIF4A3 Zornitza Stark Gene: eif4a3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4009 EIF4A3 Zornitza Stark Phenotypes for gene: EIF4A3 were changed from to Robin sequence with cleft mandible and limb anomalies, MIM# 268305; Richieri-Costa-Pereira syndrome
Intellectual disability syndromic and non-syndromic v0.4008 EIF4A3 Zornitza Stark Publications for gene: EIF4A3 were set to
Intellectual disability syndromic and non-syndromic v0.4007 EIF4A3 Zornitza Stark Mode of inheritance for gene: EIF4A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4006 EIF4A3 Zornitza Stark reviewed gene: EIF4A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360810; Phenotypes: Robin sequence with cleft mandible and limb anomalies, MIM# 268305, Richieri-Costa-Pereira syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2833 FAM50A Konstantinos Varvagiannis gene: FAM50A was added
gene: FAM50A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FAM50A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: FAM50A were set to 32703943
Phenotypes for gene: FAM50A were set to Mental retardation syndrome, X-linked, Armfield type (MIM #300261)
Penetrance for gene: FAM50A were set to unknown
Review for gene: FAM50A was set to GREEN
Added comment: Lee et al (2020 - PMID: 32703943) provide evidence that Armfield X-Linked intellectual disability syndrome is caused by monoallelic FAM50A pathogenic variants. The current review is based only on this reference.

The authors provide clinical details on 6 affected individuals from 5 families.

Features included postnatal growth delay, DD and ID (6/6 - also evident for those without formal IQ assesment), seizures (3/6 from 2 families), prominent forehead with presence of other facial features and variable head circumference (5th to >97th %le), ocular anomalies (5/6 - strabismus/nystagmus/Axenfeld-Rieger), cardiac (3/6 - ASD/Fallot) and genitourinary anomalies (3/6).

In the first of these families (Armfield et al 1999 - PMID: 10398235), linkage analysis followed by additional studies (Sanger, NGS of 718 genes on chrX, X-exome NGS - several refs provided) allowed the identification of a FAM50A variant. Variants in other families were identified by singleton (1 fam) or trio-ES (3 fam).

In affected individuals from 3 families, the variant had occurred de novo. Carrier females in the other families were unaffected (based on pedigrees and/or the original publication). XCI was rather biased in most obligate carrier females from the 1st family (although this ranged from 95:5 to 60:40).

Missense variants were reported in all affected subjects incl. Trp206Gly, Asp255Gly, Asp255Asn (dn), Glu254Gly (dn), Arg273Trp (dn) (NM_004699.3).

Previous studies have demonstrated that FAM50A has ubiquitous expression in human fetal and adult tissues (incl. brain in fetal ones).

Immunostaining suggests a nuclear localization for the protein (NIH/3T3 cells). Comparison of protein levels in LCLs from affected males and controls did not demonstrate significant differences. Protein localization for 3 variants (transfection of COS-7 cells) was shown to be similar to wt.

Complementation studies in zebrafish provided evidence that the identified variants confer partial loss of function (rescue of the morpholino phenotype with co-injection of wt but not mt mRNA). The zebrafish ko model seemed to recapitulate the abnormal development of cephalic structures and was indicative of diminished/defective neurogenesis. Transcriptional dysregulation was demonstrated in zebrafish (altered levels and mis-splicing). Upregulation of spliceosome effectors was demonstrated in ko zebrafish.

Similarly, mRNA expression and splicing defects were demonstrated in LCLs from affected individuals. FAM50A pulldown followed by mass spectrometry in transfected HEK293T cells demonstrated enrichment of binding proteins involved in RNA processing and co-immunoprecipitation assays (transfected U-87 cells) suggested that FAM50A interacts with spliceosome U5 and C-complex proteins.

Overall aberrant spliceosome C-complex function is suggested as the underlying pathogenetic mechanism.

Several other neurodevelopmental syndromes are caused by variants in genes encoding C-complex affiliated proteins (incl. EFTUD2, EIF4A3, THOC2, etc.).

Please consider inclusion in the ID panel with green rating and epilepsy panel with amber (seizures in individuals from 2 families).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.0 EIF4A3 Zornitza Stark gene: EIF4A3 was added
gene: EIF4A3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: EIF4A3 was set to Unknown