| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Intellectual disability syndromic and non-syndromic v2.44 | ASTN1 | Zornitza Stark edited their review of gene: ASTN1: Added comment: PMID 41544630 reports 18 individuals with NDDs from 12 unrelated families with bi-allelic, ultra-rare, predicted damaging variants in ASTN1. Clinical features ranged from mild to profound developmental delay or intellectual disability +/- autism, ADHD, and epilepsy. Other recurrent abnormalities included dysmorphic facial features, hypotonia, spasticity, and ataxia. The neuroradiographic phenotype ranged from normal to mild (a thin corpus callosum and cerebellar dysgenesis), to severe (polymicrogyria and lissencephaly).; Changed publications: 41544630, 29706646, 27431290, 26539891; Changed phenotypes: Neurodevelopmental disorder (MONDO:0700092), ASTN1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.41 | BLOC1S1 | Zornitza Stark edited their review of gene: BLOC1S1: Added comment: Now published in PMID 41887224: 11 individuals from seven families.; Changed publications: 33875846, 41887224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.27 | KLC1 |
Sangavi Sivagnanasundram changed review comment from: 7 individuals reported with rare missense variants in KLC1 in individuals affected with a neurodevelopmental disorder characterised by dystonia, spasticity, ID and DD. Sources: Literature; to: 5 of the 7 individuals reported with rare missense variants in KLC1 in individuals affected with a neurodevelopmental disorder characterised by dystonia, spasticity, ID and DD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.19 | TMEM63B | Zornitza Stark edited their review of gene: TMEM63B: Added comment: PMID: 42259295 Chan et al 2026 report five individuals from four unrelated families with childhood interstitial lung disease and biallelic predicted loss-of-function variants in TMEM63B. Other phenotypic characteristics include moderate/severe developmental delay (5/5), white matter changes, (1/5), mild global atrophy on brain imaging (1/5) and severe short stature (2/5). None of the individuals had epilepsy or hearing loss. Individuals were from Saudi Arabian, Malay, European and Native American ethnicities. 5 different variants were reported including nonsense, frameshift and splice donor variants. The authors report that while there are 53 TMEM63B pLoF variants in gnomAD v.4.1.0 database none are in the homozygous state. Histopathological examination of lung tissue also showed a pattern consistent with surfactant dysfunction. The authors conclude that biallelic loss of function variants result in a distinct pulmonary-predominant phenotype characterized by hypoxaemia, early-onset respiratory failure, histological features of surfactant dysfunction, and chest imaging consistent with chILD.; Changed publications: 37421948, 42259295; Changed phenotypes: Developmental and epileptic encephalopathy 118, MIM# 621250, Hereditary pulmonary alveolar proteinosis, MONDO:0012580, TMEM63B-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IDUA | Gene migrated from ENSG00000127415 to ENSG00000127415 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.831 | CLUAP1 |
Sarah Milton changed review comment from: CLUAP1 encodes Clusterin-associated protein 1 which localizes to the base and tip of cilia and associates with the intraflagellar transport (IFT) complex B group of proteins. Leber congenital amaurosis (LCA) PMID: 26820066 and 34209753 report biallelic variants in CLUAP1 in individuals with Leber congenital amaurosis including severe visual dysfunction from birth and nystagmus. Missense and splice variants were reported with functional studies to support a deleterious nature (Cell models/Zebrafish transfection and minigene splice assays). Other causative LCA genes are known to be involved in intraflagellar transport. Biallelic zebrafish and mouse result in lethality in utero, zebrafish embryos at 5 days post fertilisation demonstrate lack of photoreceptor cells. Amber for this association. Ciliopathy PMID 28679688 reports one individual with biallelic variants in CLUAP1 with a syndromic phenotype reminiscent of Joubert/orofaciodigital syndrome including dysmorphic features, rhizomelic limb shortening, polydactyly, molar tooth sign, midline teeth, oculomotor apraxia. One missense and one nonsense variant were noted with functional studies to support the deleterious nature. Red for this association. It is plausible the LCA and ciliopathy phenotypes are a spectrum of disease however there is insufficient evidence to indicate this currently. Sources: Literature; to: CLUAP1 encodes Clusterin-associated protein 1 which localizes to the base and tip of cilia and associates with the intraflagellar transport (IFT) complex B group of proteins. Leber congenital amaurosis (LCA) PMID: 26820066 and 34209753 report biallelic variants in CLUAP1 in 2 individuals with Leber congenital amaurosis including severe visual dysfunction from birth and nystagmus. Missense and splice variants were reported with functional studies to support a deleterious nature (Cell models/Zebrafish transfection and minigene splice assays). Other causative LCA genes are known to be involved in intraflagellar transport. Biallelic zebrafish and mouse result in lethality in utero, zebrafish embryos at 5 days post fertilisation demonstrate lack of photoreceptor cells. Amber for this association. Ciliopathy PMID 28679688 reports one individual with biallelic variants in CLUAP1 with a syndromic phenotype reminiscent of Joubert/orofaciodigital syndrome including dysmorphic features, rhizomelic limb shortening, polydactyly, molar tooth sign, midline teeth, oculomotor apraxia. One missense and one nonsense variant were noted with functional studies to support the deleterious nature. Red for this association. It is plausible the LCA and ciliopathy phenotypes are a spectrum of disease however there is insufficient evidence to indicate this currently. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.827 | IRF2BP1 |
Zornitza Stark changed review comment from: PMID 38091987 reports two unrelated individuals with de novo truncating IRF2BP1 variants presenting with neurodevelopmental disorder, severe immunodeficiency, microcephaly and developmental delay, while PMID 37501076 adds a third unrelated individual with a de novo nonsense IRF2BP1 variant causing neonatal‑onset microcephaly, epilepsy, hypotonia and global developmental delay. Sources: Literature; to: PMID 38091987 reports two unrelated individuals with de novo truncating IRF2BP1 variants presenting with neurodevelopmental disorder, severe immunodeficiency, microcephaly and developmental delay, while PMID 37501076 adds a third unrelated individual with a de novo nonsense IRF2BP1 variant causing neonatal‑onset microcephaly, epilepsy, hypotonia and global developmental delay. However, all three individuals were identified as part of large cohort studies and I also note LoF variants in gnomAD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.774 | EMG1 |
Zornitza Stark edited their review of gene: EMG1: Added comment: Affected individuals present with severe developmental delay, microcephaly, growth failure, micrognathia, joint contractures and early death. Functional studies show loss‑of‑function through protein destabilisation, reduced EMG1 levels, binucleate fibroblasts, G2/M arrest, impaired 18S rRNA processing and recapitulation of the phenotype in a mouse knock‑in model. GDA to remain as AMBER as the same founder variant in the Hutterite population has been reported in the additional PMIDs and could potentially be the same families. Further reports would be required to upgrade to Green.; Changed publications: 19463982, 27798105, 26676230, 25708872 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.772 | KLHL15 |
Zornitza Stark edited their review of gene: KLHL15: Added comment: Additional male individual presenting with impaired intelligence, short stature, frequent hypoglycaemia and periodic fever. Hemizygous variant was identified in the proband c.736 C>T p.(Arg246*) - absent from gnomAD v4.1; Changed rating: GREEN; Changed publications: 25644381, 24817631, 37452054; Changed phenotypes: intellectual disability, X-linked 103 MONDO:0010508 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.766 | NPRL2 |
Lucy Spencer changed review comment from: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy; PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2 PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2 PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad Borderline amber/green for this panel Sources: Literature; to: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy; PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2 PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2 PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.763 | LMAN2L |
Zornitza Stark edited their review of gene: LMAN2L: Added comment: Upgrade AR GDA to Green given the reports of biallelic variants in affected individuals. No new reports supportive of the AD GDA association. PMID: 40221759 and 37667433 report two additional probands presenting with ID, global DD and other neurodevelopmental features. Both probands were compound heterozygous.; Changed rating: GREEN; Changed publications: 40221759, 37667433 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.757 | SLC20A2 |
Zornitza Stark edited their review of gene: SLC20A2: Added comment: PMID 41458256: Reports a single individual a homozygous nonsense SLC20A2 variant presenting with infantile primary familial brain calcification, cerebral arterial vasculopathy and ischaemic stroke. Individual exhibited seizures, hypotonia, poor feeding, and extensive ischaemic changes. PMID 35881308: reports two siblings from a consanguineous Turkish family with a homozygous splice‑site loss‑of‑function variant NM_006749.5:c.1794+1G>A. The affected children presented with severe paediatric‑onset features resembling congenital CMV infection: growth retardation, bilateral cataracts, microcephaly, seizures, cerebral atrophy, corpus callosum hypoplasia and brain microcalcifications. Gene is classically associated with a milder mono-allelic disorder, which typically does not involve ID.; Changed rating: AMBER; Changed publications: 41458256, 35881308; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.752 | NPRL2 |
Lucy Spencer gene: NPRL2 was added gene: NPRL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NPRL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NPRL2 were set to 26505888; 34376795; 40804712; 30093711 Phenotypes for gene: NPRL2 were set to epilepsy, familial focal, with variable foci 2 (MIM#617116) Review for gene: NPRL2 was set to AMBER Added comment: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy; PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2 PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2 PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad Borderline amber/green for this panel Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.749 | EMX2 |
Krithika Murali changed review comment from: PMID: 25577462 Lin et al 2014 - novel, heterozygous EMX2 PTC variant (p.E142X) identified in an XX female with didelphic uterus, variant inheritance unknown. Western blot and functional studies indicated formation of a truncated protein with dominant-negative effect. Variant was identified through direct sequencing of EMX2 in a cohort of 517 patients with incomplete Mullerian fusion. PMID: 33434492 Chen et al 2021 AJHG, identified a novel, heterozygous EMX2 PTC variant (p.Tyr120ter) in a female with type I MKHS (inheritance unknown). Identified through exome-sequencing in an MKHS cohort. PMID: 34829455 Miclea et al 2021 (Diagnostic) - large panel sequencing performed in a DSD cohort. Novel missense (inheritance unknown) - p.Arg205Gln - identified in a 4 yo XY male with hypospadius, GDD/ID, Pierre-robin sequence, hydrocephalus. Variant located in the DNA binding domain, classified as VUS. PMID: 41765865 Stamou et al 2026 (Genetics in Medicine) performed trio WES on an idiopathic hypogonadotrophic hypogonadism cohort. 3 de novo CNVs that included 18 genes in the minimal critical region including EMX2 in individuals with DSD and developmental delay. In addition, x2 unrelated individuals with DSD, dev delay, hearing loss had a heterozygous de novo p.Lys199Gln missense variant located in the DNA binding domain. x1 individual identified with crytorchidism and a heterozygous Ser111Ter variant (inheritance unknown). Based on the current evidence: - Green for hypogonadotrophic hypogonadism and DSD - Amber for ID - based on 3 unrelated individuals with dev delay and variants in the DNA binding domain (p.Arg205Gln, p.Lys199Gln) - Red for Pierre-Robin sequence; to: PMID: 25577462 Lin et al 2014 - novel, heterozygous EMX2 PTC variant (p.E142X) identified in an XX female with didelphic uterus, variant inheritance unknown. Western blot and functional studies indicated formation of a truncated protein with dominant-negative effect. Variant was identified through direct sequencing of EMX2 in a cohort of 517 patients with incomplete Mullerian fusion. PMID: 33434492 Chen et al 2021 AJHG, identified a novel, heterozygous EMX2 PTC variant (p.Tyr120ter) in a female with type I MKHS (inheritance unknown). Identified through exome-sequencing in an MKHS cohort. PMID: 34829455 Miclea et al 2021 (Diagnostic) - large panel sequencing performed in a DSD cohort. Novel missense (inheritance unknown) - p.Arg205Gln - identified in a 4 yo XY male with hypospadius, GDD/ID, Pierre-robin sequence, hydrocephalus. Variant located in the DNA binding domain, classified as VUS. PMID: 41765865 Stamou et al 2026 (Genetics in Medicine) performed trio WES on an idiopathic hypogonadotrophic hypogonadism cohort. 3 de novo CNVs detected in individuals with DSD and developmental delay - 18 genes including EMX2 in the minimal critical region. In addition, x2 unrelated individuals with DSD, dev delay, hearing loss had a heterozygous de novo p.Lys199Gln missense variant located in the DNA binding domain. x1 individual identified with crytorchidism and a heterozygous Ser111Ter variant (inheritance unknown). Based on the current evidence: - Green for hypogonadotrophic hypogonadism and DSD - Amber for ID - based on 3 unrelated individuals with dev delay and variants in the DNA binding domain (p.Arg205Gln, p.Lys199Gln) - Red for Pierre-Robin sequence |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.742 | KCNJ4 |
chirag patel changed review comment from: PMID 41830586 reports 4 individuals from 4 families with heterozygous missense KCNJ4 variants presenting with refractory epilepsy and neurodevelopmental delay/intellectual disability. Clinical features range from isolated epilepsy to severe developmental and epileptic encephalopathy. Two variants arose de novo and two had unknown segregation status. Electrophysiology in Xenopus oocytes demonstrates variant‑specific gain‑of‑function (Gly136Ser and Glu384Lys) or loss‑of‑function effects (Val206Met and Met293Lys). Sources: Literature; to: PMID 41830586 reports 4 individuals from 4 families with rare heterozygous missense KCNJ4 variants presenting with refractory epilepsy and neurodevelopmental delay/intellectual disability. Clinical features range from isolated epilepsy to severe developmental and epileptic encephalopathy. Two variants arose de novo and two had unknown segregation status. Electrophysiology in Xenopus oocytes demonstrates variant‑specific gain‑of‑function (Gly136Ser and Glu384Lys) or loss‑of‑function effects (Val206Met and Met293Lys). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.711 | TRIM71 | Zornitza Stark edited their review of gene: TRIM71: Added comment: PMID 38833623 reports 20 individuals from 13 unrelated families with heterozygous de novo or rare inherited TRIM71 variants (missense, nonsense, splice‑site, frameshift) presenting with congenital hydrocephalus/ventriculomegaly, developmental delay, dysmorphic features, corpus callosum dysgenesis, white‑matter hypoplasia, limb and craniofacial anomalies, hearing and cardiac defects. Functional studies in HEK293T cells show NHL‑domain missense variants impair binding to CDKN1A/EGR1 and disrupt P‑body localization, supporting loss‑of‑function/altered‑function mechanisms.; Changed publications: 40892928, 38833623 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.690 | JKAMP |
Zornitza Stark gene: JKAMP was added gene: JKAMP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: JKAMP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: JKAMP were set to 41643666 Phenotypes for gene: JKAMP were set to Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM# 621533 Review for gene: JKAMP was set to GREEN Added comment: 14 individuals from 10 families reported. All had moderate to profound neurodevelopmental delay, intellectual disability, and infantile-onset epilepsy. Six were nonverbal, and the remaining individuals spoke only a few words. Five individuals had neurodevelopmental regression. Three individuals died suddenly; death was associated with seizures or status epilepticus in two. Thirteen individuals had hypotonia, 5 had visual impairment, 5 had microcephaly, and 1 had hearing loss. Brain MRIs showed cortical or cerebral atrophy in 11, delayed myelination in 6, and diffuse demyelinating disease in 1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.669 | EPG5 | Zornitza Stark edited their review of gene: EPG5: Added comment: Neurodevelopmental disorder with parkinsonism or other movement abnormalities (NEDPAM) is an autosomal recessive disorder characterized by mild to severe developmental delay or intellectual disability and movement abnormalities including spasticity, early onset-parkinsonism with dystonia, myoclonus, or a combination of these. Movement abnormalities may have onset from birth to adulthood in the sixth decade of life. Adolescent-onset dystonia and parkinsonism on the background of neurodevelopmental delay may be rapidly progressive, with cognitive decline. Patients may have additional features such as seizures and optic nerve atrophy. PMIDs 41053928, 36410285 and 40192014 report over 100 affected individuals.; Changed publications: 23222957, 26917586, 41053928, 36410285, 40192014; Changed phenotypes: Vici syndrome, MIM# 242840, Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.665 | CELSR1 |
Rylee Peters changed review comment from: GREEN rating for biallelic neurodevelopmental disorder association PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature; to: GREEN rating for biallelic neurodevelopmental disorder association PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants associated with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.664 | CELSR1 |
Rylee Peters changed review comment from: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature; to: GREEN rating for biallelic neurodevelopmental disorder association PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.663 | CELSR1 |
Rylee Peters gene: CELSR1 was added gene: CELSR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELSR1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CELSR1 were set to 41530147; 36453712 Review for gene: CELSR1 was set to GREEN Added comment: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.656 | CTNND2 |
Zornitza Stark edited their review of gene: CTNND2: Added comment: PMID 41502569 (preprint) reports phenotypic and molecular information for 57 individuals, 42 previously unpublished, with heterozygous CTNND2 variants. The 41 CTNND2 variants included 12 previously reported loss-of-function- and one missense variant, and 28 novel variants comprising 10 missense and 18 predicted loss-of-function changes. Eight of the novel variants occurred de novo, and 12 were inherited from a parent with a neurodevelopmental phenotype. The most common clinical features were developmental delay (90%), intellectual disability (74%), and behavioral abnormalities (79%). Functional studies revealed impaired early neurogenesis in one patient-derived line, characterized by aberrant neural rosette formation. Transcriptome analysis showed dysregulated WNT signaling, and partial rescue of these defects was achieved by modulating the WNT pathway, highlighting δ-catenin's role in early neural development. Note several of the reported missense variants in this gene have high gnomAD counts so these should be interpreted with caution. Nevertheless, large number of individuals reported now with LoF variants and NDD phenotype.; Changed rating: GREEN; Changed publications: 25839933, 29127138, 25807484, 41502569; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CTNND2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.655 | PGBD5 |
Zornitza Stark gene: PGBD5 was added gene: PGBD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PGBD5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PGBD5 were set to 41533792 Phenotypes for gene: PGBD5 were set to Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482 Review for gene: PGBD5 was set to GREEN Added comment: 10 individuals reported from 5 consanguineous families with bi-allelic variants in this gene and global developmental delay with impaired intellectual development, delayed motor skills, and motor abnormalities. Affected individuals were unable to speak or walk due to peripheral spasticity, ataxia, or hypotonia, and developed early-onset seizures. Additional features included dysmorphic facies, short stature, and brain imaging abnormalities, such as thin corpus callosum and cerebellar atrophy. Pgbd5-null mice were runted and had significantly smaller brains compared to wildtype. Mutant mice showed increased locomotor activity, reduced anxiety-like behavior, impaired motor coordination, increased susceptibility to seizures, and decreased cortical volume on brain MRI. Analysis of neurons derived from Pgbd5-null mouse brains showed reduced DNA breakage and repair in postmitotic neuronal precursors during cortical development compared to controls. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.638 | TMPRSS7 |
Zornitza Stark changed review comment from: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature; to: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder, presenting with fetal agenesis of the corpus callosum and ventriculomegaly. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.636 | ARCN1 | Zornitza Stark changed review comment from: PMID 35300924 reports 14 individuals (9 post‑natal, 5 fetuses) from 3 unrelated families with biallelic loss‑of‑function ARCN1 variants. Core phenotype includes intrauterine growth restriction, micrognathia, short stature, rhizomelic shortening, microcephaly, variable developmental delay/intellectual disability, genitourinary anomalies in males, cataracts, transient liver dysfunction/glycosylation abnormalities, and rare complications such as hepatoblastoma. Functional assays show defective type I collagen transport and abnormal N‑glycan profiles.; to: At least 14 individuals reported, summarised in PMID 35300924. Intrauterine growth restriction, micrognathia, and short stature were present in all patients. Other common features included prematurity (11/15, 73.3%), developmental delay (10/14, 71.4%), genitourinary malformations in males (6/8, 75%), and microcephaly (12/15, 80%). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.634 | ARCN1 | Zornitza Stark edited their review of gene: ARCN1: Added comment: PMID 35300924 reports 14 individuals (9 post‑natal, 5 fetuses) from 3 unrelated families with biallelic loss‑of‑function ARCN1 variants. Core phenotype includes intrauterine growth restriction, micrognathia, short stature, rhizomelic shortening, microcephaly, variable developmental delay/intellectual disability, genitourinary anomalies in males, cataracts, transient liver dysfunction/glycosylation abnormalities, and rare complications such as hepatoblastoma. Functional assays show defective type I collagen transport and abnormal N‑glycan profiles.; Changed publications: 27476655, 33154040, 35300924; Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.633 | YWHAZ | Zornitza Stark edited their review of gene: YWHAZ: Added comment: Further invidividual reported as part of a large CFC cohort PMID 40692796, missense variant, limited further information.; Changed publications: 31024343, 35143101, 35501409, 22124272, 26207352, 40692796 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.626 | VPS51 |
Zornitza Stark edited their review of gene: VPS51: Added comment: PMID 40176246 Reports another individual with autosomal recessive homozygous in-frame duplication in VPS51 (p.Lys126_Met132dup) presenting with severe global developmental delay, microcephaly, hypotonia, hypomyelination, and cerebral and cerebellar atrophy. No functional studies performed; variant absent from gnomAD. PMID 40565173 reports 2 affected individuals another family with a homozygous missense variant NM_013265.4:c.1511C>T (p.Thr504Met) in VPS51. The siblings presented with developmental delay, severe intellectual disability, microcephaly, thin corpus callosum, epilepsy, hearing loss and dysphagia. Biparental inheritance demonstrated. Functional assays in patient fibroblasts showed reduced VPS51 mRNA and protein levels, altered autophagy marker expression (LC3B, p62), and increased mitochondria‑lysosome contacts, supporting a loss‑of‑function mechanism.; Changed rating: GREEN; Changed publications: 30624672, 31207318, 40176246, 40565173; Changed phenotypes: Pontocerebellar hypoplasia, type 13, MIM# 618606 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.624 | SEC31A |
Zornitza Stark edited their review of gene: SEC31A: Added comment: PMID 39725565: Reports another individual from unrelated family with a homozygous splice‑acceptor loss‑of‑function variant (c.14351G>A) presenting with lethal neurodevelopmental disorder, dysmorphic facial features, brain anomalies, and severe skeletal defects. RT‑PCR on patient and carrier parents blood samples shows exon 12 skipping and markedly reduced SEC31A transcript, supporting loss‑of‑function. Functional data from PMID 30464055: knockdown SEC31A Drosophila had defective brains and early lethality. In line with SEC31A encoding one of the two coating layers comprising the Coat protein complex II (COP-II) complex, trafficking newly synthesised proteins from the endoplasmic reticulum (ER) to the Golgi, CRISPR/Cas9-mediated SEC31A null mutant cells demonstrated reduced viability through upregulation of ER-stress pathways.; Changed rating: GREEN; Changed publications: 30464055, 40508110, 39725565; Changed phenotypes: Halperin-Birk syndrome, MIM# 618651 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.621 | ZNF185 |
Lucy Spencer gene: ZNF185 was added gene: ZNF185 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF185 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: ZNF185 were set to 41404552 Phenotypes for gene: ZNF185 were set to Cerebrooculonasal syndrome MONDO:0011575, ZNF185-related Review for gene: ZNF185 was set to RED Added comment: PMID 41404552 describes a single female individual with cerebro oculo nasal syndrome and a de novo heterozygous X linked frameshift ZNF185. The proband presented with developmental delay, moderate ID, dysmorphic facial features, cleft lip/palate, nasal anomaly, CHD and anopthalmia. She was shown to have skewed X-inactivation 19:81, however it is not stated if the skewing was towards the allele with the variant. The variant in this individual (p.Gln102SerfsTer18) is NMD predicted and absent from gnomad, however there are at least 6 NMD variants present in gnomad as hemizygous (4 with over 4 hemis) all of which also have over 5 heterozygotes Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.592 | RNU4-2 | Zornitza Stark edited their review of gene: RNU4-2: Added comment: PMID 40297424: preprint reporting 16 individuals from 10 families with balletic variants and presenting with global developmental delay, intellectual disability, speech delay or absence, hypotonia, spasticity, microcephaly, ophthalmologic and visual impairment, seizures, and variable genital, skin, hair and limb anomalies; brain MRI shows distinctive white‑matter abnormalities and cerebellar atrophy.; Changed publications: 38991538, 40297424; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.552 | UNC13A |
Zornitza Stark edited their review of gene: UNC13A: Added comment: PMID 41125872 reports 48 individuals with neurodevelopmental disorders and UNC13A variants. Of these, 20 classified as pathogenic. Of these 6 individuals had biallelic variants and presented with severe-to-profound GDD or intellectual disability, hypotonia and seizures of different types (largely controllable with medication) or death in early childhood caused by respiratory failure after pneumonia in one case. Mechanism for this subgroup is LoF with carrier parents unaffected. A second group of 13 patients (21 months to 32 years old) harboured pathogenic, heterozygous de novo missense variants with multiple substitutions at amino acids 808, 811 and 814 (hinge region). They presented with variable degrees of GDD, hypotonia, seizures of different types (mainly refractory to treatment) and typically exhibited ataxia, tremor or dyskinetic movements rarely observed in other patients. Also a family identified with at least four affected members across two generations (4 years to 35 years old) harbouring a pathogenic heterozygous missense variant (C587F) that caused learning difficulties to mild–moderate intellectual disability as well as controlled seizures. Three different types of mechanism of pathogenicity proposed.; Changed phenotypes: neurodevelopmental disorder MONDO#0700092, UNC13A-related, Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.538 | C14orf80 | Zornitza Stark edited their review of gene: C14orf80: Added comment: PMID 30842647 reports another individual with compound heterozygous loss‑of‑function TEDC1 variants (splice and frameshift) causing primary microcephaly, primordial dwarfism and developmental delay. Promote to Green.; Changed rating: GREEN; Changed publications: 39979680, 38252227, 30842647 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.534 | SELENOI | Zornitza Stark changed review comment from: Four families reported now, upgrade to Green. Although spasticity and motor delay are prominent, intellectual impairment and speech delay are also a feature.; to: 8 individuals from four families reported now, upgrade to Green. Although spasticity and motor delay are prominent, intellectual impairment and speech delay are also a feature. Profound ID in one individual, others described as mild or showing signs of regression. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.534 | SELENOI | Zornitza Stark Phenotypes for gene: SELENOI were changed from developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals; microcephaly to Spastic paraplegia 81, autosomal recessive, MIM# 618768 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 |
Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity.; to: Additional cases: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 |
Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanisms and variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 |
Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanisms and variable expressivity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 |
Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel - first case). AD NDD/ID seems to have variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have variable expressivity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.470 | ABI2 |
Zornitza Stark changed review comment from: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Sources: Literature; to: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Amber as still a preprint. Additional individual with recurrent variant identified internally. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.470 | ABI2 |
Zornitza Stark gene: ABI2 was added gene: ABI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ABI2 were set to 40475134 Phenotypes for gene: ABI2 were set to Neurodevelopmental disorder, MONDO:0700092, ABI2-related Review for gene: ABI2 was set to AMBER Added comment: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.468 | NUDT2 | Zornitza Stark edited their review of gene: NUDT2: Added comment: PMID 38141063 reports 18 individuals from 10 unrelated families with biallelic loss‑of‑function NUDT2 variants presenting with early‑onset neurodevelopmental disorder characterized by hypotonia, motor delay, gait disturbance, mild intellectual disability, peripheral neuropathy, corpus callosum abnormalities and progressive basal ganglia signal abnormalities.; Changed publications: 27431290, 30059600, 33058507, 38141063 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.468 | KARS |
Zornitza Stark changed review comment from: Sources: Expert list; to: Infantile-onset progressive leukoencephalopathy with or without deafness (LEPID) is a complex neurodegenerative disorder with onset of symptoms in infancy or early childhood. Most individuals present with sensorineural deafness or hypoacousia and global developmental delay. Affected individuals show episodic regression with progressive motor deterioration resulting in spastic tetraplegia and loss of ambulation, as well as impaired intellectual development with poor or absent speech. Additional more variable features may include poor overall growth with microcephaly, seizures, visual loss, microcytic anaemia, and hepatic enlargement or abnormal liver enzymes. Brain imaging shows deep white matter abnormalities consistent with a progressive leukoencephalopathy. Calcifications of the brain and spinal cord are a feature. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.425 | KLHL13 |
Krithika Murali gene: KLHL13 was added gene: KLHL13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KLHL13 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: KLHL13 were set to PMID: 41159445 Phenotypes for gene: KLHL13 were set to Neurodevelopmental disorder, MONDO:0700092, KLHL13-related Review for gene: KLHL13 was set to GREEN Added comment: PMID: 41159445 Akhther et al 2025 (pre-print) report 8 affected individuals from 4 unrelated famlies with hemizygous/heterozygous KLHL13 variants and an X-linked neurodevelopmental disorder with the following phenotypic features including mild-severe ID, developmental delay, macrocephaly, hypotonia, unsteady gait, facial dysmrophism and behavioural issues. Functional studies support LoF disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.416 | CCNK |
Sangavi Sivagnanasundram changed review comment from: CCNK encodes a regulatory subunit of cyclin-dependent kinases that mediates activation of target kinases. Reported affected individuals presented with a syndromic neurodevelopmental disorder (i.e. DD, ID, language impairment and various dysmorphic features) 7 unrelated families with different de novo variants (missense and CNV, deletion). All variants were either rare for AD gene or absent in gnomAD v4.1. Supportive functional studies (knockdown zebrafish and mouse model) showed recapitulation of human phenotype and was supportive of LoF as the mechanism of disease Sources: Literature; to: CCNK encodes a regulatory subunit of cyclin-dependent kinases that mediates activation of target kinases. Reported affected individuals presented with a syndromic neurodevelopmental disorder (i.e. DD, ID, language impairment and various dysmorphic features) 7 unrelated families with different de novo variants (missense and CNV, deletion). All variants were absent in gnomAD v4.1. Supportive functional studies (knockdown zebrafish and mouse model) showed recapitulation of human phenotype and was supportive of LoF as the mechanism of disease Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.414 | SRRM1 |
Zornitza Stark gene: SRRM1 was added gene: SRRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SRRM1 were set to 41145827 Phenotypes for gene: SRRM1 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM1-related Review for gene: SRRM1 was set to GREEN Added comment: PMID 41145827 reports three individuals from three unrelated families with heterozygous truncating SRRM1 variants presenting with a neurodevelopmental disorder characterised by developmental delay, intellectual disability, short stature, behavioural and skeletal anomalies, and facial dysmorphism. Two variants are confirmed de novo and functional assays in neuronal‑like cells and Drosophila support haploinsufficiency as a disease mechanism. Serine/arginine repetitive matrix protein 1 (SRRM1) is a key component of spliceosomes and plays various roles in messenger RNA processing. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.384 | CDKL1 | Zornitza Stark commented on gene: CDKL1: PMID 40088891 reports two unrelated individuals with de novo heterozygous CDKL1 missense variants (p.Val115Ala, p.Arg169Cys) presenting with childhood‑onset neurodevelopmental disorder, developmental delay and seizures; Drosophila rescue assays show dominant‑negative activity of the variants. However, note that the variants are present at low frequency in gnomAD v4, p.Val115Ala: 2 individuals, p.Arg169Cys: 13 individuals. Some supportive functional data presented. Upgrade to Amber but not Green due to pop counts. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.378 | EIF3B |
Zornitza Stark gene: EIF3B was added gene: EIF3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF3B were set to 41033306 Phenotypes for gene: EIF3B were set to Syndromic disease (MONDO:0002254), EIF3B-related Review for gene: EIF3B was set to GREEN Added comment: Fourteen individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.376 | EIF3A |
Zornitza Stark changed review comment from: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature; to: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.376 | EIF3A |
Zornitza Stark gene: EIF3A was added gene: EIF3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF3A were set to 41033306 Phenotypes for gene: EIF3A were set to Syndromic disease (MONDO:0002254), EIF3A-related Added comment: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.373 | MDGA2 |
Zornitza Stark gene: MDGA2 was added gene: MDGA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MDGA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MDGA2 were set to https://doi.org/10.1101/2025.08.28.25330873; 40168357; 27608760 Phenotypes for gene: MDGA2 were set to MDGA2-related neurodevelopmental disorder MONDO:0700092 Review for gene: MDGA2 was set to GREEN Added comment: Affected individuals present with a broad neurodevelopmental impairment-like phenotype. Pre-print - https://doi.org/10.1101/2025.08.28.25330873 Individuals with developmental and epileptic encephalopathy (DEE) 8 individuals from 6 consanguineous families exhibiting infantile hypotonia, severe neurodevelopmental delay, intractable seizures, progressive brain atrophy, and consistent dysmorphic features. 7 different biallelic LoF variants were identified p.Tyr913Ter, p.Arg404Ter, p.Leu920Ter, c.421-1G>A, p.Lys391SerfsTer7 and c.421-96_595+99del - all variants are rare or absent in gnomAD v4.1 In vitro functional studies of three nonsense variants in mammalian expression systems and hippocampal cultured neurons that resulted in impaired MDGA2 membrane trafficking are supportive of a loss-of-function mechanism. PMID: 40168357, 27608760 A knockout mouse model showed that MGAD2-deficient mice presented with autism-like behaviours (social deficits, repetitive behaviour, and cognitive impairment). The mice also showed abnormalities in excitatory synapses. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.371 | DBX1 |
Zornitza Stark gene: DBX1 was added gene: DBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DBX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DBX1 were set to 40995053 Phenotypes for gene: DBX1 were set to central hypoventilation syndrome, congenital MONDO:0800031 Review for gene: DBX1 was set to RED Added comment: Single individual reported with congenital central hypoventilation syndrome (atypical CCHS) with central hypotonia, global developmental delay, seizures, autoaggressive behaviour. Consanguineous parents, hmz frameshift variant c.340_341delGC, absent from gnomAD. Mouse Dbx1 knockout is lethal indicating essential role in respiration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | RNU6ATAC |
Lucy Spencer gene: RNU6ATAC was added gene: RNU6ATAC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU6ATAC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNU6ATAC were set to 40975062 Phenotypes for gene: RNU6ATAC were set to Neurodevelopmental disorder (MONDO:0700092), RNU6ATAC-related Review for gene: RNU6ATAC was set to RED Added comment: PMID: 40975062 1 patient compound heterozygous for n.36T>G and n.28C>T. Has short stature, microcephaly, hypotonia, neurodevelopmental delay, ID, seizures, ataxia, ventriculomegaly, syndactyly, nystagmus and oculomotor apraxia. Identified in a cohort of individuals with an excess of significant intron retention outliers in minor intron containing genes which are usually removed by the minor spliceosome of which RNU6ATAC is a part (as is RNU4ATAC). Proband had no candidate variants in RNU4ATAC or RNU12. Both RNU6ATAC variants are in a highly conserved 39bp region, and affect nucleotides predicted to be important for binding to U4ATAC. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | PTBP1 |
Lucy Spencer gene: PTBP1 was added gene: PTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTBP1 were set to 40965981 Phenotypes for gene: PTBP1 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP1-related Review for gene: PTBP1 was set to GREEN Added comment: PMID: 40965981 27 individuals with abnormal prenatal ultrasound in thirteen (48%) including short femora, IUGR, hydramnios, increased nuchal translucency, asymmetry of heart cavities, and bilateral hydronephrosis. Skeletal anomalies were seen in 24 (89%), short stature/limbs in 63%, facial dysmorphism 25 (93%), developmental delay in 78%, behavioral problems in 30% and ID in 26% generally mild/moderate, 43% had variable brain MRI abnormalities. additional features included skin, nail, and hair anomalies (52%), dental anomalies (37%), ophthalmological findings (44%), and cardiovascular defects (22%). Variants a mix of missense and startloss, and were confirmed de novo in 23/17 cases. Various functional studies showed reduced nuclear localization and enhanced cytoplasmic retention, with start-loss variants also leading to increased protein stability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.346 | SF1 |
Sarah Milton changed review comment from: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15). Variant types included missense and high impact LOF (nonsense and frameshift). Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets. pLI for SF1 is 1 with overall few LOF variants in gene. Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance. Sources: Literature; to: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15). 12 confirmed to have de novo variants including missense and high impact LOF (nonsense and frameshift). Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets. pLI for SF1 is 1 with overall few LOF variants in gene. Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.346 | SF1 |
Sarah Milton gene: SF1 was added gene: SF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SF1 were set to PMID: 40987292 Phenotypes for gene: SF1 were set to Neurodevelopmental disorder, MONDO:0700092, SF1-related Review for gene: SF1 was set to GREEN Added comment: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15). Variant types included missense and high impact LOF (nonsense and frameshift). Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets. pLI for SF1 is 1 with overall few LOF variants in gene. Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.342 | SYNE2 |
chirag patel gene: SYNE2 was added gene: SYNE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SYNE2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SYNE2 were set to 34573277 Phenotypes for gene: SYNE2 were set to Neurodevelopmental disorder, MONDO:0700092, SYNE2 related Review for gene: SYNE2 was set to RED Added comment: 1 individual with autism spectrum disorder, developmental delay and intellectual disability (from a cohort of 410 trios with neurodevelopmental disorders). Trio WES found compound heterozygous variants in SYNE2 [c.2483T>G; p.(Val828Gly) and c.2362G>A; p.(Glu788Lys)]. Both variants are rare, predicted to be highly damaging using in silico tools, and located in the nesprin-2 giant spectrin repeat domain. Both parents and the healthy brother were heterozygous. Expression and functional testing in patient lymphoblastoid cell lines showed a significant reduction of nesprin-2 giant protein levels, however SYNE2 transcription and the nuclear envelope localisation of the mutant proteins was unaffected as compared to parental control cells. SYNE 1-4 genes encode for nesprins (nuclear envelope spectrin repeat proteins) which play fundamental roles in nuclear architecture and positioning, directed cell migration, cellular signalling, ciliogenesis, and mechanobiology. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | INTS6 |
Sarah Milton changed review comment from: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature; to: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | INTS6 |
Sarah Milton gene: INTS6 was added gene: INTS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: INTS6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: INTS6 were set to PMID: 40966122 Phenotypes for gene: INTS6 were set to Neurodevelopmental disorder, MONDO:0700092, INTS6-related Review for gene: INTS6 was set to GREEN Added comment: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.338 | RNU2-2P | Zornitza Stark edited their review of gene: RNU2-2P: Added comment: PMID 40950445: reports bi-allelic cases in a cohort of over 100 individuals. One variant frequently de novo in trans with inherited variant.; Changed publications: 40210679, 40442284, 40950445 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.335 | MRPS36 |
Krithika Murali gene: MRPS36 was added gene: MRPS36 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRPS36 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MRPS36 were set to PMID: 41018056; 38685873 Phenotypes for gene: MRPS36 were set to Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related Review for gene: MRPS36 was set to AMBER Added comment: 3 individuals from 2 unrelated families reported with biallelic MRPS36 variants (current HGNC is KGD4). Gene encodes E4 subunit of OGDHC complex. Individuals present with a phenotype consistent with Leigh syndrome including seizures, hypotonia, dystonia, brain imaging anomalies, persistent lactic acidosis. GDD, ID and cardiomyopathy also reported. Patient-derived fibroblast studies demonstrates reduced OGDHC enzymatic activity, however, this functional evidence is not gene or variant-specific. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.330 | GTF2I | Zornitza Stark edited their review of gene: GTF2I: Added comment: 7 individuals reported with de novo variants in this gene and a neurodevelopmental disorder. All but one of the variants are absent from gnomAD v4 (one het present for the indel variant).; Changed rating: GREEN; Changed publications: 40962490; Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF2I-relatedder; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.329 | BBOX1 |
Zornitza Stark gene: BBOX1 was added gene: BBOX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BBOX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BBOX1 were set to 41022783 Phenotypes for gene: BBOX1 were set to Carnitine deficiency, MONDO:0017716, BBOX1-related Review for gene: BBOX1 was set to AMBER Added comment: Three individuals from two unrelated families reported, presenting with myopathy, neurodevelopmental delay, and later-onset psychiatric manifestations. C. elegans knockout and patient-variant models show embryonic lethality rescued by L‑carnitine supplementation Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.323 | B9D1 | Zornitza Stark edited their review of gene: B9D1: Added comment: Lumped by ClinGen. Additional individuals reported, promote to Green.; Changed publications: 24886560, 21493627, 40565534, 40933483; Changed phenotypes: Ciliopathy, MONDO:0005308, B9D1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.302 | TMEM167A |
chirag patel gene: TMEM167A was added gene: TMEM167A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM167A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM167A were set to PMID: 40924476 Phenotypes for gene: TMEM167A were set to Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related Review for gene: TMEM167A was set to GREEN Added comment: 6 individuals from 6 unrelated families (4/6 consanguineous) presenting with neonatal diabetes onset <4mths (6/6), severe microcephaly (6/6), epilepsy (5/6), and developmental delay (4/6). Whole genome sequencing identified biallelic variants in TMEM167A gene. Variants were homozygous in 5/6 families, and variant types were missense (4), frameshift (1), and splice (1), and all variants were rare/unreported in gnomAD. Segregation studies not reported in paper. Microcephaly, epilepsy and diabetes syndrome has 2 known associated genes (IER3IP1 and YIPF5) which encode proteins involved in endoplasmic reticulum to Golgi trafficking. TMEM167A is highly expressed in developing and adult human pancreas and brain. Both TMEM167A depletion in EndoC-βH1 cells and knock‑in of p.Val59Glu variant in iPSC-derived β cells sensitized β cells to ER stress. The p.Val59Glu variant impaired proinsulin trafficking to the Golgi and induced iPSC-β cell dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.296 | ZNF865 |
Sangavi Sivagnanasundram gene: ZNF865 was added gene: ZNF865 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF865 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNF865 were set to 40936200 Phenotypes for gene: ZNF865 were set to ZNF865‑associated neurodevelopmental disorder MONDO:0700092 Review for gene: ZNF865 was set to AMBER Added comment: PMID: 40936200 18 patients reported with DD, hypotonia and six individuals were reported with some dysmorphic features (frontal bossing, a broad nasal bridge, hypertelorism, and low-set ears) All 18 individuals were reported with de novo truncating variants in ZNF865. All variants were rare/absent in gnomAD v4.1. The mechanism of disease for this gene is unknown. No pathogenic SNVs have been reported in ClinVar at this stage however there are reports of VUS’s and pathogenic CNVs. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.295 | SKOR2 |
Zornitza Stark gene: SKOR2 was added gene: SKOR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SKOR2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SKOR2 were set to 40890458; 29997391; 21937600 Phenotypes for gene: SKOR2 were set to complex neurodevelopmental disorder with motor features MONDO:0100516 Review for gene: SKOR2 was set to GREEN Added comment: 3 unrelated families with consistent phenotypes and a supportive mouse model: PMID: 40890458 - 2 unrelated consanguineous Iranian families with a combination of learning disability, facial dysmorphisms, and motor and speech impairments with homozygous variants (c.374 G>C: p.Arg125Pro & c.1271_1274del: p.K424Rfs*71). The homozygous missense variant segregated with disease in 8 individuals (no unaffected individuals tested were homozygous). PMID: 29997391 - proband with neurodevelopmental delay, hypotonia, ataxia, cerebellar dysplasia from a consanguineous Turkish family with a homozygous null variant (NM_001278063.1:c.2750C>G; p.Ser917*). None of the 4 healthy siblings were homozygous for the variant. PMID: 21937600 - Skor2 -/- mouse model had defective Purkinje cell development, a severe reduction of granule cell proliferation and a malformed cerebellum. Mouse had unstable gait. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.293 | GBX1 |
Zornitza Stark gene: GBX1 was added gene: GBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GBX1 were set to 40519143 Phenotypes for gene: GBX1 were set to Neurodevelopmental disorder, MONDO:0700092, GBX1-related Review for gene: GBX1 was set to RED Added comment: Single individual with de novo LoF variant with DD and focal epilepsy. Zebrafish model had abnormal morphology of the interocular area. Furthermore, the zebrafish larvae exhibited an increased susceptibility to neurophysiological abnormalities associated with epileptiform activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.291 | MTERF3 |
Zornitza Stark gene: MTERF3 was added gene: MTERF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MTERF3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MTERF3 were set to 40543543 Phenotypes for gene: MTERF3 were set to Mitochondrial disease (MONDO:0044970), MTERF3-related Review for gene: MTERF3 was set to AMBER Added comment: Two individuals reported from unrelated families, presenting with DD/ID, intermittent hypoglycaemia and metabolic acidosis. Genetic testing identified compound heterozygous variants c.635dup p.(Asn212Lysfs*7) and c.1055C > T p.(Pro352Leu) in Patient 1, and a homozygous variant c.943A > Gp.(Met315Val) in Patient 2. Patient's fibroblasts and MTERF3 knockdown cells showed impaired mitochondrial respiration and reduced levels of OXPHOS complexes I, III, and IV. Transcription of MT-ND5, ND6, COII, and COIII was reduced, while other mitochondrial genes were upregulated. Wild-type MTERF3 expression restored these defects, but the variant Pro352Leu from patient failed to rescue mitochondrial dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.289 | ATP5A1 |
Zornitza Stark gene: ATP5A1 was added gene: ATP5A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP5A1 were set to 34483339; 34954817; 40859057 Phenotypes for gene: ATP5A1 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD Review for gene: ATP5A1 was set to GREEN Added comment: At least 12 individuals reported with de novo missense variants in this gene, several recurrent. PMIDs: 34483339, 34954817: 6xde novo patients 4 with Arg207His, 1 Arg182Gln 1 Ser346Phe. All Arg207His patients were neonates with failure to thrive, hyperammonemia, lactic acidosis, and respiratory defects in fibroblasts, major symptoms remitted with treatment by late infancy, and at age 14mo to 3yrs growth and development were normal. Other 2 patients are 17yo with ID, ataxia, spastic paraparesis and dystonia, and a 12yo with psychomotor retardation, spastic tetraparesis, generalised dystonia, absent speech, swallowing problems, and increased blood lactate concentrations. And an internal VCGS patient Arg182Gln (variant also seen in a different patient above) with ID, muscular hypotonia, clinodactyly of the 5th finger, and dysmorphic facial features, proteomics showed decreased ATP5F1A and a complex V deficiency. There is also an alternative change at this residue in the DECIPHER cohort Arg182Pro de novo in an individual with a neurodevelopmental disorder. PMID: 40672495: 6x de novo individuals - 4 variants p.Arg182Gln, p.Ser346Phe, p.Pro331Leu, and p.Leu109Ser - with complex but overlapping neurological phenotypes including developmental delays, intellectual disability, pyramidal tract dysfunction, and dystonia. In vivo functional studies in C. elegans were performed for three of the variants, showing growth defects and disruption of mitochondrial function (measured by mitochondrial stress). Authors suggest a dominant negative mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.283 | TBCB |
Krithika Murali gene: TBCB was added gene: TBCB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TBCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBCB were set to PMID: 40856104 Phenotypes for gene: TBCB were set to Neurodevelopmental disorder, MONDO:0700092, TBCB-related Review for gene: TBCB was set to AMBER Added comment: PMID: 40856104 Bratman, S. et al 2025 (Genetics in Medicine) report 10 individuals from 8 unrelated families of Ashkenazi Jewish descent with a homozygous missense founder variant in TBCB (c.589T>A, p.Tyr197Asn) identified through exome sequencing. This variant is present at 1.3% carrier frequency in the AJ population in gnomAD v4 with 0 homozygotes. Variant is reasonably well-conserved, REVEL 0.9 and in the Cap-Gly domain. No other homozygous missense variants in this region in gnomAD v4 and homozygous variants rare, overall. Phenotypic features included: - Motor/speech delays in infancy (almost all) - ASD (8/10) - ADHD (5/10) - Mild ID - formal cognitive evaluation (5/8). - Spastic paraparesis in late childhood (9-12y) with slowly progressive gait difficulties and lower limb spasticity. Urinary abnormalities were not reported. - Brain MRI was performed on five individuals - three displayed a thin corpus callosum, and two had decreased white matter. No prenatal features reported. Supportive Drosophilia models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.281 | COMMD4 |
Lucy Spencer gene: COMMD4 was added gene: COMMD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COMMD4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COMMD4 were set to 40601774 Phenotypes for gene: COMMD4 were set to Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related Review for gene: COMMD4 was set to RED Added comment: PMID: 40601774 3 siblings with Ritscher-Schinzel syndrome and a homozygous missense in COMMD4 NM_017828.5:c.122T>G; p.Leu41Arg. All three individuals died in infancy and the authors suggest there could be a dual diagnosis to explain the severity. This variant was expressed in a H4 neuroglioma cell line with COMMD4 knocked out, and showed an enhanced degradative turnover compared to WT when treated with cyclohexamide. Western blot in HEK293T cells showed a decrease in the steady-state abundance of COMMD4. Knock out of COMMD4 protein leads to destabilization of the Commander complex. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.280 | POLR3D |
Zornitza Stark gene: POLR3D was added gene: POLR3D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POLR3D was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLR3D were set to 37915380 Phenotypes for gene: POLR3D were set to Leukodystrophy, MONDO:0019046, POLR3D-related Review for gene: POLR3D was set to RED Added comment: PMID 37915380: single individual with compound het variants in POLR3D and childhood onset leukodystrophy manifesting as DD/ID. Additional neurological features included cerebellar signs (e.g., dysarthria, ataxia, and intention tremor) and dysphagia, while non-neurological features included hypodontia, hypogonadotropic hypogonadism, and dysmorphic facial features. Her MRI was notable for diffuse hypomyelination with myelin preservation of early myelinating structures, characteristic of POLR3-related leukodystrophy. Exome sequencing revealed the biallelic variants in POLR3D, a missense variant (c.541C > T, p.P181S) and an intronic splice site variant (c.656-6G > A, p.?). Functional studies of the patient's fibroblasts demonstrated significantly decreased RNA-level expression of POLR3D, along with reduced expression of other Pol III subunit genes. Notably, Pol III transcription was also shown to be aberrant, with a significant decrease in 7SK RNA and several distinct tRNA genes analyzed. Affinity purification coupled to mass spectrometry of the POLR3D p.P181S variant showed normal assembly of Pol III subunits yet altered interaction of Pol III with the PAQosome chaperone complex, indicating the missense variant is likely to alter complex maturation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.277 | FSCN1 |
Zornitza Stark gene: FSCN1 was added gene: FSCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FSCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FSCN1 were set to 40874942 Phenotypes for gene: FSCN1 were set to Neurodevelopmental disorder, MONDO:0700092, FSCN1-related Review for gene: FSCN1 was set to RED Added comment: Two individuals reported from an Iranian cohort with same missense variant, c.665C>A; p.Ala222Asp plus other circumstantial data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.276 | TTC1 |
Zornitza Stark gene: TTC1 was added gene: TTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TTC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC1 were set to 40879651 Phenotypes for gene: TTC1 were set to Pontocerebellar hypoplasia, MONDO:0020135, TTC1-related Review for gene: TTC1 was set to RED Added comment: Four individuals from two families reported with the same homozygous missense variant, NM_003314.3: c.784 T > G, p.Phe262Val. No other supporting data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.275 | MAEA |
Zornitza Stark changed review comment from: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands. Sources: Literature; to: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands. Amber rating as scant detail on the affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.274 | MAEA |
Zornitza Stark gene: MAEA was added gene: MAEA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAEA were set to 40880485 Phenotypes for gene: MAEA were set to Neurodevelopmental disorder, MONDO:0700092, MAEA-related Review for gene: MAEA was set to AMBER Added comment: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.273 | CSMD2 |
Krithika Murali changed review comment from: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature; to: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. In addition, no information about unaffected/affected siblings and segregation testing has been provided Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.272 | CSMD2 |
Krithika Murali gene: CSMD2 was added gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688 Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related Review for gene: CSMD2 was set to RED Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.272 | CSMD2 |
Krithika Murali gene: CSMD2 was added gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688 Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related Review for gene: CSMD2 was set to RED Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.268 | RNF2 | Zornitza Stark edited their review of gene: RNF2: Added comment: PMID 40831499 is a preprint which identifies additional individuals with de novo variants. p.S82R is recurrent. Functional data to support gene-disease association.; Changed rating: GREEN; Changed publications: 33864376, 40831499 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.267 | WDR18 |
Krithika Murali gene: WDR18 was added gene: WDR18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WDR18 were set to PMID: 40677927 Phenotypes for gene: WDR18 were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: WDR18 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.266 | MIS18BP1 |
Krithika Murali gene: MIS18BP1 was added gene: MIS18BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MIS18BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MIS18BP1 were set to PMID: 40677927 Phenotypes for gene: MIS18BP1 were set to Cornelia de Lange syndrome (MONDO:0016033) Review for gene: MIS18BP1 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.263 | ARID3A |
Zornitza Stark gene: ARID3A was added gene: ARID3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARID3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARID3A were set to 40677927 Phenotypes for gene: ARID3A were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: ARID3A was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.262 | PIK3C3 |
Zornitza Stark gene: PIK3C3 was added gene: PIK3C3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIK3C3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PIK3C3 were set to 40677927 Phenotypes for gene: PIK3C3 were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: PIK3C3 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.260 | GLYAT |
Zornitza Stark changed review comment from: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized. Sources: Literature; to: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of oedema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.260 | GLYAT |
Zornitza Stark gene: GLYAT was added gene: GLYAT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GLYAT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GLYAT were set to 40747359 Phenotypes for gene: GLYAT were set to Neurodevelopmental disorder, MONDO:0700092, GLYAT-related Review for gene: GLYAT was set to RED Added comment: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.258 | C1orf109 |
Zornitza Stark gene: C1orf109 was added gene: C1orf109 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: C1orf109 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C1orf109 were set to 40760247 Phenotypes for gene: C1orf109 were set to Neurodevelopmental disorder, MONDO:0700092, C1orf109-related Review for gene: C1orf109 was set to GREEN Added comment: Cohort of 11 unrelated families, encompassing 18 individuals with bi-allelic variants in C1orf109, 17 liveborn. Affected individuals presented with moderate-to-severe or severe global developmental delay/intellectual disability (17 of 17) and never achieved developmental milestones. Microcephaly and seizures were other common features. Reduced ribosome activity demonstrated during early brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.256 | ASAP2 |
Zornitza Stark gene: ASAP2 was added gene: ASAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ASAP2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ASAP2 were set to 40770811; 28191890; 33057194; 35982160 Phenotypes for gene: ASAP2 were set to Neurodevelopmental disorder, MONDO:0700092, ASAP2-related Review for gene: ASAP2 was set to AMBER Added comment: One individual reported with compound het missense variants. Identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811. Another individual with biallelic variants identified in the DDD cohort. Several others found with de novo variants through retrospective literature review of large cohort studies reporting multiple gene candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of ASAP2 in brain development. Rated AMBER as only two families with bi-allelic variants and minimal information on the cases with mono-allelic variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.255 | RTF1 |
Zornitza Stark changed review comment from: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data. Sources: Literature; to: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of RTF1 in brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.254 | RTF1 |
Zornitza Stark gene: RTF1 was added gene: RTF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RTF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RTF1 were set to 40770811; 33057194; 35982160; 31038196 Phenotypes for gene: RTF1 were set to Neurodevelopmental disorder, MONDO:0700092, RTF1-related Review for gene: RTF1 was set to GREEN Added comment: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.253 | CCDC93 |
Sarah Milton gene: CCDC93 was added gene: CCDC93 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC93 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC93 were set to PMID: 40601774 Phenotypes for gene: CCDC93 were set to Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related Review for gene: CCDC93 was set to AMBER Added comment: CCDC93 encodes the coiled coil domain containing subunit of commander complex involved in recycling of integral membrane proteins. PMID: 40601774 describes 1 affected individual with compound heterozygous variants in CCDC93 who presented with Ritscher Schinzel like phenotype. Features included hypoplasia of cerebellar hemispheres, hypoplasia of the brainstem and of the corpus callosum, distinctive facial features and multiple small renal cysts. Variants were missense and nonsense. No homozygous LOF variants in gnomAD v4. Some supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.252 | SCN3B |
Sarah Milton gene: SCN3B was added gene: SCN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SCN3B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SCN3B were set to PMID: 40879121 Phenotypes for gene: SCN3B were set to Neurodevelopmental disorder, MONDO:0700092, SCN3B-related Review for gene: SCN3B was set to AMBER Added comment: SCN3B Encodes b3 auxiliary subunit of the sodium channel. 4 affected individuals from 2 consanguineous families reported in PMID: 40879121 with biallelic variants in this gene with neurodevelopmental phenotypes. Presentation included GDD, ID of variable severity, autism, seizures. One variant was nonsense, one canonical splice site in the penultimate exon. No homozygous LOF variants in gnomAD v4. Some functional studies performed with loss of function of channel demonstrated for one variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.252 | ZNF496 |
Zornitza Stark gene: ZNF496 was added gene: ZNF496 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF496 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNF496 were set to 40806714 Phenotypes for gene: ZNF496 were set to Neurodevelopmental disorder, MONDO:0700092, ZNF496-related Review for gene: ZNF496 was set to RED Added comment: Single individual with NDD and de novo LoF variant, no other supportive data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.248 | TMPRSS7 |
Zornitza Stark gene: TMPRSS7 was added gene: TMPRSS7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMPRSS7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMPRSS7 were set to 40796295 Phenotypes for gene: TMPRSS7 were set to Neurodevelopmental disorder, TMPRSS7-related Review for gene: TMPRSS7 was set to RED Added comment: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.247 | PPP1R2 |
Zornitza Stark gene: PPP1R2 was added gene: PPP1R2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP1R2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PPP1R2 were set to 40597352; 26558779 Phenotypes for gene: PPP1R2 were set to Neurodevelopmental disorder, PPP1R2-related Review for gene: PPP1R2 was set to RED Added comment: Single individual reported with homozygous splicing variant c.403 + 3 A >T. Abnormal splicing demonstrated but leaky. Clinical features included pre and postnatal growth restriction, ventricular septal defect, dysmorphic features (proptosis, long eye lashes, thick eyebrows, low-set ears), microcephaly, sensorineural hearing loss, cortical cataracts, retinal defects, intellectual disability with limited speech, and autism spectrum disorder. Note mouse model is embryonically lethal, leading the authors to speculate survival may be due to fraction of normally spliced transcripts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.245 | BORCS5 |
Zornitza Stark gene: BORCS5 was added gene: BORCS5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BORCS5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BORCS5 were set to 40385417 Phenotypes for gene: BORCS5 were set to Lysosomal storage disease, MONDO:0002561, BORCS5-related Review for gene: BORCS5 was set to GREEN Added comment: preprint PMID 40385417, describing 12 individuals from 7 families with a spectrum of abnormalities (osteopetrosis not mentioned), suggestive of lysosomal disorder. Homozygous loss-of-function variants presented with prenatally lethal arthrogryposis multiplex congenita, brain malformations, and neuropathological evidence of diffuse neuroaxonal dystrophy. Individuals with missense variants presented differently, with microcephaly, developmental epileptic encephalopathy, intellectual disability, optic atrophy, spasticity, and progressive movement disorders. In this group, brain MRI showed diffuse hypomyelination and progressive global cerebral atrophy, consistent with neurodegeneration. Borcs5 knockout in zebrafish exhibited microcephaly, motor deficits, and seizures, mirroring the patients' clinical presentation. At the cellular level, BORCS5 loss-of-function but not missense variants, resulted in lower protein expression and impaired BORC assembly, paralleled by perinuclear lysosomal clustering. However, both loss-of-function and missense BORCS5 variants were associated with reduced total lysosomal proteolysis, reduced activity of the lysosomal hydrolases glucocerebrosidase and cathepsin B, and presence of multilamellar bodies, indicating lysosomal dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.244 | ARNTL |
Sarah Milton gene: ARNTL was added gene: ARNTL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARNTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARNTL were set to PMID: 40720646 Phenotypes for gene: ARNTL were set to Neurodevelopmental disorder, MONDO:0700092, BMAL1-related Review for gene: ARNTL was set to GREEN Added comment: Note has new HGNC approved name - BMAL1 BMAL1 encodes a transcription factor that plays a role in the mammalian molecular clock, binds to promoter of PER and CRY family genes to promote transcription. Other circardian genes have sleep phase disorder assoc but not neurodevelopmental phenotype. 10 affected individuals described in PMID: 40455867 with variable developmental delay/ID from average IQ to severe ID, seizures in 50%, autism, some had sleep disturbance and marfanoid habitus. Variants were LOF & missense and very rare or absent in gnomAD v4. 5 confirmed de novo, 2 confirmed inherited (one from apparently unaffected mother). Functional studies using luciferase reporter assay of downstream target PER showed reduced luminescence for most variants with presumed LOF mechanism. One variant p.(Ile201Thr) led to increased luminescence with author's postulating GOF mechanism for this variant. Drosophilia studies for 2 of the variants demonstrated altered circadian rhythm. ?needs more studies to further define mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.242 | MAN2A2 | Zornitza Stark edited their review of gene: MAN2A2: Added comment: PMID 40628855: second unrelated individual reported, presenting with ID/autism and with bi-allelic variants, one missense and the other LoF. Abnormal glycosylation patterns observed consistent with CDG.; Changed publications: 36357165, 40628855 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.234 | FAAH2 | Zornitza Stark edited their review of gene: FAAH2: Added comment: Further case report of novel missense variant in an individual with a neurodevelopmental disorder, no supportive evidence.; Changed publications: 25885783, 40744325; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, FAAH2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.220 | TBC1D32 |
Zornitza Stark gene: TBC1D32 was added gene: TBC1D32 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: TBC1D32 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBC1D32 were set to 24285566; 32573025; 32060556; 31130284; 36826837; 40319332 Phenotypes for gene: TBC1D32 were set to Orofacial digital syndrome type IX, MIM#258865 Review for gene: TBC1D32 was set to GREEN Added comment: Multiple affected individuals reported from unrelated families. Midline brain abnormalities are a feature and DD/ID is variable. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.213 | ST5 |
Rylee Peters gene: ST5 was added gene: ST5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ST5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ST5 were set to 40717498 Phenotypes for gene: ST5 were set to Neurodevelopmental disorder (MONDO:0700092), DENND2B-related Review for gene: ST5 was set to GREEN Added comment: HGNC: DENND2B Cohort of 11 individuals all with a history of motor and/or language developmental delay, intellectual disability in 6/11 (mild to severe), brain structure/function abnormalities were reported in 9/11 patients (7/11 seizures; 5/9 abnormal findings on brain MRI), muscle weakness/hypotonia in 8/9, psychosis in 4/10 patients, symptoms of catatonia in 4/10, other psychiatric/behavioural concerns (anxiety, attention deficit, autism or autistic features) in 10/10. Total of 10 variants including 2x frameshift/nonsense, 6x missense, 1x splice, 1x single amino acid deletion – all absent from v4 and de novo except 1 inherited from a father with cognitive and psychiatric symptoms and the inframe del which has 2 hets in gnomAD and is inherited an unaffected father (no formal assessment). In vivo zebrafish modelling measuring cilia length suggests that patient variants tested (9/10 excluding the splice variant) did not induce cilia length shortening, which is consistent with KO models and therefore a loss of function effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.213 | BLOC1S1 |
Rylee Peters changed review comment from: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211 11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1. The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy (in some cases), and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy. Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.; to: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211 11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1. The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy, and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy. Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.208 | PDCD6IP |
Zornitza Stark edited their review of gene: PDCD6IP: Added comment: Additional individual with homozygous truncating variant, mild ID, microcephaly and mild thrombocytopenia. p.Arg322* - present in gnomAD (NFE AF - 0.0006%).; Changed rating: GREEN; Changed publications: https://doi.org/10.1111/cge.70025 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.208 | CHTF18 |
Sangavi Sivagnanasundram gene: CHTF18 was added gene: CHTF18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHTF18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHTF18 were set to 40717333 Phenotypes for gene: CHTF18 were set to complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465 Review for gene: CHTF18 was set to AMBER Added comment: Only two individuals reported with ID/DD: 1 - 9M with DD, autism and seizures. De novo variant identified - p.Leu355Val 2 - 23month F with congenital bilateral ventriculomegaly status post ventriculoperitoneal shunt placement, epilepsy, right eye optic nerve hypoplasia, hypotonic cerebral palsy complicated by left hip subluxation, and G-tube dependence. De novo variant identified - p.His645Pro 3 - 3F presenting with global DD, hypotonia, seizure and abnormal brain MRI. De novo variant identified - p.Leu676Arg Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.206 | RNU5A-1 |
Zornitza Stark gene: RNU5A-1 was added gene: RNU5A-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU5A-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU5A-1 were set to 40379786 Phenotypes for gene: RNU5A-1 were set to Neurodevelopmental disorder (MONDO:0700092), RNU5A-1 related Review for gene: RNU5A-1 was set to AMBER Added comment: PMID: 40379786 (2025) - three unrelated individuals with de novo variants in the RNU5A-1 gene (classified as VUS) and a neurodevelopmental disorder. Six individuals with rare de novo variants were identified in total but clinical details were only available for 3/6. Of these three individuals, two harboured the same variant (n.40_41insA) on the maternal allele, while the third individual harboured a different variant (n.39del) but also on the 5′ loop I domain of RNU5A-1. Clinical data showed neurodevelopmental abnormalities (mild ID (2), severe ID (1), epilepsy (2), brain MRI abnormalities (1)) with variable congenital malformations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.204 | BSN |
Zornitza Stark gene: BSN was added gene: BSN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: BSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BSN were set to 40393460 Phenotypes for gene: BSN were set to Neurodevelopmental disorder (MONDO:0700092), BSN-related Review for gene: BSN was set to GREEN Added comment: Guzman et al 2025: Described 12 additional patients with missense (3/12) and premature termination variants (9/12) which included de novo and inherited variants, suggesting incomplete penetrance. They assessed all reported patients (n=29) which revealed common clinical characteristics including epilepsy(13/29), febrile seizures (7/29), generalised tonic-clonic seizures (5/29), and focal-onset seizures (3/29). Behavioural phenotypes were present in almost half of all individuals (14/29), which included ADHD (7/29) and autistic behaviour (5/29). Additional common features included developmental delay (11/29), obesity (10/29), and delayed speech (8/29). In adults with BSN PTVs, milder features were common, suggesting phenotypic variability, including a range of individuals without obvious neurodevelopmental features (7/29). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.198 | PDE1B |
Zornitza Stark gene: PDE1B was added gene: PDE1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PDE1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDE1B were set to 40492975 Phenotypes for gene: PDE1B were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related Review for gene: PDE1B was set to GREEN Added comment: PMID:40492975 reported seven individuals from five unrelated families identified with biallelic PDE1B variants. Three truncating (p.Gln45Ter, p.Gln86Ter, p.Ser298Alafs*6) and three splicing variants (c.594 + 2 T>G, c.735 + 5G>A, c.837-1G>C) were identified from these patients in total. They presented with an early-onset movement disorder characterised by hypotonia in infancy, progressing to ataxia and dystonia in early childhood, with motor and speech delay, and intellectual disability. Functional evidence is also available for these variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.195 | FASTKD5 |
chirag patel gene: FASTKD5 was added gene: FASTKD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FASTKD5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FASTKD5 were set to PMID: 40499538 Phenotypes for gene: FASTKD5 were set to Leigh syndrome MONDO:0009723 Review for gene: FASTKD5 was set to GREEN Added comment: 3 unrelated individuals with Leigh syndrome (1 x severe/early-onset/fatal, 1 x milder/childhood-onset, 1 x adult-onset). WES identified compound heterozygous variants in FASTKD5 gene (3 x missense variants, 2 x frameshift variants leading to a premature stop codon). The FASTKD5 gene codes for a mitochondrial protein essential for processing mRNAs at non-canonical cleavage sites in the primary mitochondrial transcript. Analysis of fibroblasts from two subjects showed reduced steady-state levels of FASTKD5 protein by immunoblot, reduced translation of the cytochrome c oxidase subunit 1, impaired assembly of complex IV, and a consequent decrease in cytochrome c oxidase enzymatic activity. The extent of these deficiencies appeared to correlate with the severity of the clinical phenotype. Expression of a wild-type FASTKD5 cDNA, but not cDNAs expressing the missense variants, rescued all the molecular defects in the subjects' fibroblasts, demonstrating that the alleles are pathogenic. 2/3 missense variants resulted in near complete loss of function, while one was hypomorphic, resulting from impaired protein stability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.188 | LONP1 |
Zornitza Stark edited their review of gene: LONP1: Added comment: New reports of autosomal dominant mitochondrial disease due to missense variants at p.Arg301. - PMID: 36353900; Hartley 2023: 1x heterozygous de novo individual with p.(Arg301Gln), with dystonia, hearing loss, seizures. p.(Arg301Gln) has been reported as de novo in a heterozygous individual with dystonia, delayed speech and language development (VCGS/MCRI internal case) - PMID: 31923470; Besse 2020: 1x heterozygous de novo individual with p.(Arg301Trp) with seizures, encephalopathy, pachygyria and microcephaly. - p.(Arg301Trp) has also been reported in a heterozygous individual with recurrent neonatal seizures, suspected mitochondrial disorder, elevated lactate, microcephaly, EEG showing significantly increased seizure susceptibility which was de novo but parentage not tested (ClinVar, personal communication). - p.(Arg301Trp) has also been identified in a heterozygous individual with neonatal intractable epileptic encephalopathy and lactic acidosis. MRI changes in keeping with mitochondrial disorder, a combined Complex I and complex IV defect identified in muscle (but not liver) by RCE (VCGS/MCRI internal case) - p.(Arg301Gly) has been reported de novo in a heterozygous individual with epileptic encephalopathy, microcephaly and dyskinesia (ClinVar, personal communication) LONP1 functions as both a chaperone and an ATP-dependent protease. Functional evidence in Besse shows p.(Arg301Trp) results in loss of chaperone activity but retains proteolytic activity. Expression of WT LONP1 in patient fibroblast cells did not rescue dysfunction (measured via levels of MRPL44, RPL11, PDHE1a, TFAM, PINK1, complex 1 and complex IV) - indicating NOT LoF effect. Overexpression of LONP1 in control fibroblast cells leads to dysfunction (decrease in NDUFB8, COXIV, MRPL44 and TFAM), however, MRPL11, PDHE1a and PINK1 proteins were unchanged compared to controls. Variant p.R721G associated with AR disease showed decreased homo-oligomerisation whilst p.R301W showed increased WT-Mut and WT-WT oligomers. GoF was suggested but no dose-dependent studies so DN cannot be excluded.; Changed publications: 31636596, 36353900 31923470; Changed phenotypes: CODAS syndrome, MIM#600373, mitochondrial disease (MONDO:0044970), LONP1-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.185 | LGI1 |
Krithika Murali gene: LGI1 was added gene: LGI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LGI1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LGI1 were set to PMID:40455867 Phenotypes for gene: LGI1 were set to Developmental and epileptic encephalopathy MONDO:0100062, LGI1-related Review for gene: LGI1 was set to GREEN Added comment: PMID: 40455867 report patients with biallelic variants in 6 individuals from 4 consanguineous families with a more severe DEE phenotype. All indivduals had seizures, global dev delay/ID and generalised hypotonia. Four out of five exhibited spasticity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.177 | SREK1 |
Sangavi Sivagnanasundram gene: SREK1 was added gene: SREK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SREK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SREK1 were set to 40549565 Phenotypes for gene: SREK1 were set to Prader-Willi-like syndrome, SREK1-related MONDO:0008300 Review for gene: SREK1 was set to AMBER Added comment: Three Pakistani probands from three consanguineous families identified with biallelic variants in SREK1. Affected individuals presented with hyperphagic obesity and neurodevelopmental delay. They also presented with psychological and behavioural issues and were phenotypically similar to Prader-Willi affected individuals. ID/DD is a feature in the affected individuals. Further testing was conducted using human induced pluripotent stem cell (iPSC) -derived neurons followed by RNA sequencing conducted on the neurons. The results of the assay was suggestive that variants located in the RNA recognition domain (residues 19–96 and 173–256) of SREK1 downregulation of SNORD115 and SNORD116 leading to Prader-Willi-like phenotype however proper validation and controls weren't used. No relevant mouse models were identified on IMPC (international mouse phenotype consortium) to further support gene-disease association there gene reviewed as Amber. Variants identified in SREK1 - AF's from gnomADv4.1 P95L - absent in gnomAD v4.1 T194M - EAS PopMax AF - 0.03787% (47 hets) E601K - SAS PopMax AF - 0.01319% (12 hets) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.176 | ADAM23 |
Sarah Milton gene: ADAM23 was added gene: ADAM23 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADAM23 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADAM23 were set to PMID: 40455867 Phenotypes for gene: ADAM23 were set to Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related Review for gene: ADAM23 was set to AMBER Added comment: ADAM23 encodes a transmembrane protein receptor which is a receptor for LGI1. LGI1/ADAM22/ADAM23 form a complex that regulates excitatory synaptic transmission and neuronal excitability in the brain. 1 affected individual described in PMID: 40455867 with severe neonatal seizures, joint contractures, absent reflexes. Noted to have a homozygous NMD predicted variant in ADAM23. Also had a de novo missense variant in PRKD1. Knockout ADAM23 mice show early lethal epilepsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.175 | IKZF2 |
Zornitza Stark gene: IKZF2 was added gene: IKZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IKZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: IKZF2 were set to 37316189 Phenotypes for gene: IKZF2 were set to Immunodysregulation, craniofacial anomalies, hearing impairment, athelia, and developmental delay, MIM# 621234 Review for gene: IKZF2 was set to AMBER Added comment: PMID 37316189: two individuals with de novo variants and syndromic immunodysregulation, including craniofacial anomalies, hearing impairment, athelia, and developmental delay. Note that variants in this gene are also associated with non-syndromic immune dysregulation and non-syndromic HL. Genotype-phenotype correlation unclear. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.171 | KCNA6 |
Zornitza Stark gene: KCNA6 was added gene: KCNA6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNA6 were set to 36318112; 40472070 Phenotypes for gene: KCNA6 were set to Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related Review for gene: KCNA6 was set to GREEN Added comment: PMID 36318112: four individuals with de novo variants in this gene and NDD/epilepsy phenotype. Supportive functional data. Additional individual in PMID 40472070 with de novo variant and epilepsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.168 | ZBTB7B |
Zornitza Stark gene: ZBTB7B was added gene: ZBTB7B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZBTB7B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZBTB7B were set to 40392549 Phenotypes for gene: ZBTB7B were set to Inborn error of immunity, MONDO:0003778, ZBTB7B-related Review for gene: ZBTB7B was set to AMBER Added comment: Single patient presented with a complex syndromic phenotype including CID, severe atopy, severe fibroinflammatory interstitial lung disease, corneal vascularization and scarring, sensorineural hearing loss, global developmental delay, and growth failure. K360N variant is not found in unaffected individuals; functional investigations indicate that K360N exhibits damaging multimorphic effects; and the causal relationship between K360N and the clinical phenotype was confirmed through gene transfer experiments in both T cells and pulmonary fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.162 | WSB2 |
Krithika Murali gene: WSB2 was added gene: WSB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WSB2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WSB2 were set to PMID:40374945 Phenotypes for gene: WSB2 were set to Complex neurodevelopmental disorder, MONDO:0100038, WSB2-related Review for gene: WSB2 was set to GREEN Added comment: PMID: 40374945 describe 5 individuals from 4 unrelated families with biallelic WSB2 variants and a complex neurodevelopmental disorder. Phenotypic features include: - Dev delay (all) - Brain anomalies (4/5 including callosal anomalies and cerebellar hypoplasia) - Dysmorphic feature - IUGR/oligohydramnios (3/5) - Hypotonia (all) - Microcephaly (3/5) - Seizures (3/5) Includes two siblings with biallelic missense variants and shared phenotype. 3 unaffected siblings were heterozygous for the variant or hmz wt. Phenotypic features associated with hmz nonsense/fs variants were more severe than missense. Supportive mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.155 | TM2D3 |
Zornitza Stark gene: TM2D3 was added gene: TM2D3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TM2D3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TM2D3 were set to 40449487 Phenotypes for gene: TM2D3 were set to Neurodevelopmental disorder, MONDO:0700092, TM2D3-related Review for gene: TM2D3 was set to GREEN Added comment: Four individuals from 4 unrelated families identified with biallelic variants in this gene. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.153 | SLK |
Zornitza Stark gene: SLK was added gene: SLK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLK were set to 40347834 Phenotypes for gene: SLK were set to Neurodevelopmental disorder, MONDO:0700092, SLK-related Review for gene: SLK was set to GREEN Added comment: Three affected individuals from three unrelated families reported. Two of the families were consanguineous and homozygous LoF variants were present in the probands. Third individual had compound het missense variants. Functional data from a Drosophila model and transdifferentiated neurons. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.148 | MYCBP2 | Zornitza Stark edited their review of gene: MYCBP2: Added comment: Concerns about LoF variants in population datasets as well as in individuals undergoing diagnostic testing for a wide variety of unrelated phenotypes: downgrade to RED.; Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | FBXO22 |
Sarah Milton gene: FBXO22 was added gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXO22 were set to PMID: 40215970 Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related Review for gene: FBXO22 was set to GREEN Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases. 14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4). Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies. Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Previously referred to as RNU2-2P Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.125 | BRF2 |
Zornitza Stark gene: BRF2 was added gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRF2 were set to 40229899 Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related Review for gene: BRF2 was set to GREEN Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.121 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | LSM1 |
Sarah Milton changed review comment from: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable.; to: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | PCNA |
Sangavi Sivagnanasundram gene: PCNA was added gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCNA were set to 24911150, 33426167, 36990216 Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309 Review for gene: PCNA was set to AMBER Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778 Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown. Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | EIF3K |
Sangavi Sivagnanasundram gene: EIF3K was added gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3K were set to 40219605 Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092 Review for gene: EIF3K was set to RED Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported. Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%). The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype. The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID: 40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 |
Sarah Milton gene: CDKL1 was added gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL1 were set to PMID: 40088891 Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related Mode of pathogenicity for gene: CDKL1 was set to Other Review for gene: CDKL1 was set to AMBER Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4). Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL2 |
Sarah Milton gene: CDKL2 was added gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL2 were set to PMID: 40088891 Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related Penetrance for gene: CDKL2 were set to Complete Mode of pathogenicity for gene: CDKL2 was set to Other Review for gene: CDKL2 was set to AMBER Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion. 2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging. Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5) Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.93 | CELF4 |
Zornitza Stark gene: CELF4 was added gene: CELF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CELF4 were set to 40108438 Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related Review for gene: CELF4 was set to GREEN Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.90 | SVBP | Zornitza Stark edited their review of gene: SVBP: Added comment: PMID 39412222: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).; Changed publications: 39412222; Changed phenotypes: Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569, Spastic paraplegia 94, autosomal recessive, MIM# 621150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.89 | CRMP1 |
Zornitza Stark gene: CRMP1 was added gene: CRMP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CRMP1 were set to 36511780; 39758889 Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092, CRMP2-related Review for gene: CRMP1 was set to GREEN Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants. PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID. Four individuals with neurodevelopmental disorders and de novo variants in this gene. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.83 | KMT2C | Zornitza Stark edited their review of gene: KMT2C: Added comment: Additional report of >80 individuals suggesting condition is distinct from Kleefstra syndrome and needs to be renamed.; Changed publications: 39013459; Changed phenotypes: Kleefstra syndrome 2, MIM#617768, Neurodevelopmental disorder, MONDO:0700092, KMT2C-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.79 | PPP2R5E |
chirag patel gene: PPP2R5E was added gene: PPP2R5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP2R5E was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2R5E were set to PMID: 39284558 Phenotypes for gene: PPP2R5E were set to Mendelian neurodevelopmental disorder MONDO:0100500 Review for gene: PPP2R5E was set to RED Added comment: One 20yrs old individual with learning issues, motor coordination disorders, hypotonia (myopathy on EMG), and behavioural issues (mood and emotional dysregulation). WES testing identified a de novo heterozygous missense variant (Glu191Lys) in PPP2R5E gene. The variant was not found in the 4 healthy brothers of the individual. The variant is located within a conserved LFDSEDPRER motif common to all PPP2R5 B-subunits. Biochemical assays demonstrated a decreased interaction with the PP2A A and C subunits, leading to disturbances in holoenzyme formation. Protein phosphatase 2A (PP2A) is a family of multifunctional enzymatic complexes crucial for cellular signalling, playing a pivotal role in brain function and development. Mutations in specific genes encoding PP2A complexes have been associated with neurodevelopmental disorders with hypotonia and high risk of seizures (e.g. PP2AR-1A, 2B, 3C, 5C, 5D). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.74 | PHACTR4 |
Zornitza Stark gene: PHACTR4 was added gene: PHACTR4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PHACTR4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHACTR4 were set to 40012205 Phenotypes for gene: PHACTR4 were set to Syndromic disease, MONDO:0002254, PHACTR4-related Review for gene: PHACTR4 was set to AMBER Added comment: Two individuals with syndromic disease and de novo missense variants reported together with aggregate information on additional individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.70 | SPOUT1 |
Bryony Thompson gene: SPOUT1 was added gene: SPOUT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPOUT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPOUT1 were set to 39962046 Phenotypes for gene: SPOUT1 were set to complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related Review for gene: SPOUT1 was set to GREEN Added comment: Biallelic SPOUT1 variants were identified in 28 individuals with a complex neurodevelopmental disorder from 21 unrelated families. Common phenotypes include microcephaly (18/21), seizures (20/28), intellectual disability (14/14), and varying degrees of developmental delays (28/28). Also, supporting zebrafish model. The suggested name of the disorder is SpADMiSS (SPOUT1 Associated Development delay Microcephaly Seizures Short stature). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.68 | DDX39B |
Sangavi Sivagnanasundram gene: DDX39B was added gene: DDX39B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DDX39B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DDX39B were set to 39918047 Phenotypes for gene: DDX39B were set to neurodevelopmental disorder MONDO:0700092, DDX39B-related Review for gene: DDX39B was set to GREEN Added comment: Established gene-disease association - ID/DD is a prominent feature in affected individuals. 6 individuals from 5 families with variable neurological and developmental phenotypes including hypotonia, DD, ID and epilepsy. 4 de novo missense variants and 1 inherited splice variant were identified. All variants are absent from gnomAD v4.1. In vivo functional assay using Drosophila transgenic flies was supportive of a loss of function phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.67 | SMARCA1 |
Zornitza Stark gene: SMARCA1 was added gene: SMARCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMARCA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SMARCA1 were set to 37841849 Phenotypes for gene: SMARCA1 were set to Neurodevelopmental disorder, MONDO:0700092, SMARCA1-related Review for gene: SMARCA1 was set to GREEN Added comment: 40 individuals from 30 families with NDD and variants in this gene reported in this preprint, publication imminent Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.62 | ARHGEF40 |
chirag patel gene: ARHGEF40 was added gene: ARHGEF40 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARHGEF40 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARHGEF40 were set to PMID: 39838643 Phenotypes for gene: ARHGEF40 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: ARHGEF40 was set to RED Added comment: 2 individuals with global developmental delay, hypotonia, short stature, hearing impairment, nystagmus, feeding issues, and dysmorphism (bifid uvula, narrow mouth, high palate, micrognathia). Trio clinical whole exome sequencing identified de novo variants in the ARHGEF40 gene at position p.Arg225, which is fully conserved in mammals and located within the n-terminal keratin binding region (p.Arg225Trp and p.Arg225Gln). Of note, multiple additional probands with rare missense variants at the p.Arg225 residue have been identified by the same laboratory (but there was no consent for publication, providing further evidence of the importance of this residue. The ARHGEF40 gene (aka SOLO) is a member of the Rho guanine nucleotide exchange factor (Rho-GEF) family of proteins, which stimulate Rho signal transduction molecules by converting them from inactive GDP-bound form to the active GTP-bound state. No functional studies to characterise disease-gene relationship or disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.59 | HECTD1 |
chirag patel gene: HECTD1 was added gene: HECTD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HECTD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HECTD1 were set to PMID: 39879987 Phenotypes for gene: HECTD1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: HECTD1 was set to GREEN Added comment: 14 unrelated individuals (identified through GeneMatcher) with 15 variants of uncertain significance (VUS) in HECTD1 (10 missense, 3 frameshift, 1 nonsense, and 1 splicing variant). Of the 15 different variants in HECTD1, 10 occurred de novo, 3 had unknown inheritance, and 2 were compound heterozygous. All variants were absent in gnomAD, and HECTD1 is highly intolerant to loss-of-function variation (loss-of-function-intolerant score of 1). Clinical presentation was variable developmental delay, intellectual disability, autism spectrum disorder, ADHD, and epilepsy. The one individual with compound heterozygous variants had growth impairment along with NDD. The variants were inherited from apparently healthy parents, suggesting that genetic or environmental modifiers may be required to develop the phenotype. Significant enrichment of de novo variants in HECTD1 was also shown in an independent cohort of 53,305 published trios with NDDs or congenital heart disease. HECT-domain-containing protein 1 (HECTD1) mediates developmental pathways, including cell signalling, gene expression, and embryogenesis. Conditional knockout of Hectd1 in the neural lineage in mice resulted in microcephaly, severe hippocampal malformations, and complete agenesis of the corpus callosum, supporting a role for Hectd1 in embryonic brain development. Functional studies of 2 missense variants and 1 nonsense variant in C. elegans revealed dominant effects, including either change-of-function or loss-of-function/haploinsufficient mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.52 | RYBP |
Zornitza Stark gene: RYBP was added gene: RYBP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RYBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RYBP were set to 39891528 Phenotypes for gene: RYBP were set to Neurodevelopmental disorder, MONDO:0700092, RYBP-related Review for gene: RYBP was set to GREEN Added comment: Seven individuals with heterozygous de novo variants in RYBP reported. Clinical findings include severe developmental delay, dysmorphisms and multiple congenital anomalies. All the single nucleotide variants in RYBP localized to the N-terminal domain of the gene, which encodes the zinc finger domain and ubiquitin binding moiety. Further supportive in vitro and Drosophila functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.47 | TRPM7 |
Zornitza Stark gene: TRPM7 was added gene: TRPM7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRPM7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRPM7 were set to 35561741; 35712613; 39099563 Phenotypes for gene: TRPM7 were set to Familial primary hypomagnesemia, MONDO:0018100, TRPM7-related Review for gene: TRPM7 was set to GREEN Added comment: Protein expressed in the distal tubule, related to TRPM6. Postulated link with hypoMg with secondary hypoCa. PMID 35561741: two families reported with dominant inheritance. F1: three affected individuals with splicing variant; some supportive functional data. F2: single affected individual, de novo missense variant. PMID 35712613: de novo missense variant in an individual with hypoMg. PMID 39099563: three affected individuals with missense variants, all de novo. Probands had DD, two had seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.45 | TAOK2 |
Zornitza Stark gene: TAOK2 was added gene: TAOK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TAOK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TAOK2 were set to 39737487 Phenotypes for gene: TAOK2 were set to neurodevelopmental disorder, MONDO:0700092, TAOK2-related Review for gene: TAOK2 was set to GREEN Added comment: PMID:39737487 reported 10 individuals with monoallelic TAOK2 variants and with a neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.42 | LRRC45 |
Zornitza Stark gene: LRRC45 was added gene: LRRC45 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC45 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LRRC45 were set to 39638757 Phenotypes for gene: LRRC45 were set to Neurodevelopmental disorder MONDO:0700092, LRRC45-related Review for gene: LRRC45 was set to AMBER Added comment: Three individuals from two families reported with two homozygous variants, one splice site and the other missense. Features of a neurological ciliopathy with some supportive experimental evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.39 | NAV3 |
Zornitza Stark gene: NAV3 was added gene: NAV3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAV3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAV3 were set to 39708122; 38977784 Phenotypes for gene: NAV3 were set to Neurodevelopmental disorder, MONDO:0700092, NAV3-related Review for gene: NAV3 was set to GREEN Added comment: 17 individuals from 11 families reported with bi-allelic variants and neurodevelopmental phenotypes, including DD/ID and behavioural abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.37 | EEFSEC |
Zornitza Stark gene: EEFSEC was added gene: EEFSEC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EEFSEC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EEFSEC were set to 39753114 Phenotypes for gene: EEFSEC were set to Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related Review for gene: EEFSEC was set to GREEN Added comment: Nine individuals from 8 unrelated families reported with bi-allelic variants in this gene and progressive neurodevelopmental disorder manifesting with global developmental delay, progressive spasticity, ataxia, and seizures. Cerebral MRI primarily demonstrated a cerebellar pathology, including hypoplasia and progressive atrophy. In line with the clinical phenotype, an eEFSec-RNAi Drosophila model displays progressive impairment of motor function, which is reflected in the synaptic defects in this model organisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.33 | LRRC8C |
Sangavi Sivagnanasundram gene: LRRC8C was added gene: LRRC8C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC8C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LRRC8C were set to 39623139 Phenotypes for gene: LRRC8C were set to TIMES syndrome MIM#621056 Mode of pathogenicity for gene: LRRC8C was set to Other Review for gene: LRRC8C was set to AMBER Added comment: TIMES syndrome is a multisystem disorder characterised by considerable phenotypic variability, but overlapping features include telangiectasia, impaired intellectual development, microcephaly, metaphyseal dysplasia, eye abnormalities, and short stature. Patients exhibit striking cutis marmorata in infancy. Two individuals from unrelated families presenting with similar features consistent with TIMES syndrome. Leu400IlefsTer8 and Val390Leu variants were identified however the proposed mechanism of disease is GoF. Supporting in vitro functional assay was conducted however further evidence is required to upgrade the gene classification. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.30 | UBR5 |
Bryony Thompson gene: UBR5 was added gene: UBR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBR5 were set to 39721588 Phenotypes for gene: UBR5 were set to Neurodevelopmental disorder MONDO:0700092, UBR5-related Review for gene: UBR5 was set to GREEN Added comment: 29 individuals with a neurodevelopment syndrome (24 de novo variants) with a core phenotype characterised by developmental delay (26/28), autism (16/26), and intellectual disability (56%). Additionally, some individuals presented with epilepsy/seizures (11/27), movement disorders, and/or genital anomalies (35%). Loss of function is the expected mechanism of disease with functional experiments in C. elegans and in vitro ubiquitination assays. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.23 | RUNX1T1 |
chirag patel gene: RUNX1T1 was added gene: RUNX1T1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RUNX1T1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340 Phenotypes for gene: RUNX1T1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: RUNX1T1 was set to GREEN Added comment: RUNX1T1 encodes a transcription regulator for hematopoietic genes and is well-known for its involvement in hematologic malignancies. Germline RUNX1T1 variants may also play a role in human congenital neurodevelopmental disorders. PMID: 39568205 3 unrelated individuals with developmental delay, learning disability, ASD, ADHD, and dysmorphism (1 x heart defects). Trio WES identified de novo variants in RUNX1T1 gene (1 x nonsense variant in 5' region [p.Gln36Ter], 2 x missense variants in C-terminus [p.Gly412Arg and p.His521Tyr]). PMID: 19172993 1 individual with mild-moderate ID and congenital heart disease, and chromosome t(5;8)(q32;q21.3) translocation. Molecular characterization revealed that one of the break points was within the RUNX1T1 gene. Analysis of RUNX1T1 expression in human embryonic and fetal tissues suggests a role of RUNX1T1 in brain and heart development. PMID: 22644616 1 individual with mild ID and dysmorphism, and de novo deletion exons 3-7 in RUNX1T1. PMID: 31223340 1 individual with ID, anaemia, atrial septal defect, dysmorphism, and seizures. Found to have a 2.1 Mb deletion at 8q21.3q22.1 involving entire RUNX1T1 gene (and 2 adjacent genes - SLC26A7 and TRIQK), and a benign familial 4.3 Mb duplication at 1p22.1p21.3 (present in unaffected healthy brother). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.18 | CCT6A |
Ain Roesley gene: CCT6A was added gene: CCT6A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCT6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CCT6A were set to 39480921 Phenotypes for gene: CCT6A were set to neurodevelopmental disorder MONDO:0700092, CCT6A-related Penetrance for gene: CCT6A were set to Complete Review for gene: CCT6A was set to GREEN gene: CCT6A was marked as current diagnostic Added comment: previously known as CCT6 5x individuals including 4x de novo 3x PTCS + 1x +5C>G + 1x missense 4/5 DD/ID 2/5 visual impairment 2/5 seizures Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.16 | TCP1 |
Ain Roesley gene: TCP1 was added gene: TCP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TCP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TCP1 were set to 39480921 Phenotypes for gene: TCP1 were set to neurodevelopmental disorder MONDO:0700092, TCP1-related Penetrance for gene: TCP1 were set to Complete Review for gene: TCP1 was set to GREEN gene: TCP1 was marked as current diagnostic Added comment: previously known as CCT1 8x individuals including 5x de novo 6x PTCs + 2x missense 6/8 DD/ID 2/8 visual impairment 6/8 seizures 6/8 polymicrogyria + 1x Ventriculomegaly, white matter hyperintensities Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.10 | MGA |
Zornitza Stark gene: MGA was added gene: MGA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MGA were set to 39600096; 20044811 Phenotypes for gene: MGA were set to Syndromic disease, MONDO:0002254, MGA-related Review for gene: MGA was set to GREEN Added comment: Three individuals with de novo LoF variants reported in individuals with ID and congenital anomalies. Zebrafish model supports role of this transcription factor in organogenesis. Note there are previous, less clear reports of association with NDD/CHD. Gene is constrained for LoF variants in gnomad v4; however, note there are ~30 individuals with LoF variants present. Borderline Green/Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.1 | SLC35F1 | Zornitza Stark edited their review of gene: SLC35F1: Added comment: Likely second individual identified internally at VCGS, AS/Rett-like phenotype and de novo Gly226Arg variant.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6811 | IDUA | Zornitza Stark Marked gene: IDUA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6811 | IDUA | Zornitza Stark Gene: idua has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6811 | IDUA | Zornitza Stark Phenotypes for gene: IDUA were changed from to mucopolysaccharidosis type 1 MONDO:0001586 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6810 | IDUA | Zornitza Stark Publications for gene: IDUA were set to 20301341 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6809 | IDUA | Zornitza Stark Publications for gene: IDUA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6808 | IDUA | Zornitza Stark Mode of inheritance for gene: IDUA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6676 | PEX2 | Ain Roesley changed review comment from: Few individuals reported with variants in PEX19 however,; to: ID/DD is part of the Zellweger spectrum | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6676 | PEX2 | Ain Roesley commented on gene: PEX2: Few individuals reported with variants in PEX19 however, | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6654 | BHLHE22 |
Zornitza Stark gene: BHLHE22 was added gene: BHLHE22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BHLHE22 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: BHLHE22 were set to 39502664 Phenotypes for gene: BHLHE22 were set to Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related Review for gene: BHLHE22 was set to GREEN Added comment: Four individuals with de novo missense variants within the highly conserved helix-loop-helix domain and seven individuals from five unrelated families with a recurrent homozygous frameshift variant, p.(Gly74Alafs*18). Individuals presented with absent or limited speech, severely impaired motor abilities, intellectual disability (ID), involuntary movements, autistic traits with stereotypies, abnormal muscle tone. The majority of individuals had partial or complete agenesis of the corpus callosum (ACC). Additional symptoms comprised epilepsy, variable dysmorphic features, and eye anomalies. One additional individual had spastic paraplegia without delayed development and ACC, expanding the phenotype to milder and later onset forms. Mice lacking bhlhe22 show nearly complete loss of three brain comminsure, including the corpus callosum. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6628 | MARK2 |
chirag patel gene: MARK2 was added gene: MARK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MARK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MARK2 were set to PMID: 39419027, 39436150 Phenotypes for gene: MARK2 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: MARK2 was set to GREEN Added comment: 31 individuals with autism spectrum disorder (30/31), intellectual disability/developmental delay (100%), motor delay (62%), speech-language problems (100%), seizure/epilepsy (46%), behaviour disorders (ADHD, aggression, anxiety)(74%), and distinctive facial features (narrow face, abnormal or broad forehead, downslanting palpebral fissures, and large or dysplastic ears). WES/WGS identified 25 LOF and 6 missense variants in MARK2 gene (Microtubule affinity-regulating kinase 2) which contributes to establishing neuronal polarity and developing dendritic spines. LOF variants were de novo (16/25), inherited (4/25), or unk (5/25). All 6 missense variants were de novo and clustered in the kinase or KA1 domains. The mRNA and protein expression of MARK2 in PBMCs were significantly lower in affected individuals with LOF variants than in the control group. In vitro expression assay of missense variants supported the effect of MARK2 loss. Proband-derived and CRISPR-engineered isogenic induced pluripotent stem cells (iPSCs) showed MARK2 loss leads to early neuronal developmental and functional deficits, including anomalous polarity and disorganization in neural rosettes, as well as imbalanced proliferation and differentiation in neural progenitor cells (NPCs). Mark2+/- mice showed abnormal cortical formation and partition and ASD-like behaviour. Through the use of RNA sequencing (RNA-seq) and lithium treatment, they linked MARK2 loss to downregulation of the WNT/β-catenin signaling pathway and identified lithium as a potential drug for treating MARK2-associated ASD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6623 | RNU5B-1 |
Zornitza Stark gene: RNU5B-1 was added gene: RNU5B-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU5B-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1 Review for gene: RNU5B-1 was set to GREEN Added comment: 20 individuals reported in two preprints with de novo variants in this gene and a neurodevelopmental phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6604 | ANKRD31 |
Megan Ball gene: ANKRD31 was added gene: ANKRD31 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ANKRD31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKRD31 were set to 27541642 Review for gene: ANKRD31 was set to RED Added comment: 1 individual with Rett-like phenotype. De novo missense. C.196A>T, p.Ile66Phe. Onset of features at 3 years, delayed ambulation, epilepsy, developmental regression, stereotypies, non-verbal. 17 years old at time of publication. A C.elegans model of ANKRD31 with a deletion showed significantly defective locomotion and asymmetric dynamics of axonal and dendritic microtubule defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6580 | AJAP1 |
Zornitza Stark gene: AJAP1 was added gene: AJAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AJAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AJAP1 were set to 38985877 Phenotypes for gene: AJAP1 were set to neurodevelopmental disorder, MONDO:0700092, AJAP1-related Review for gene: AJAP1 was set to GREEN Added comment: PMID:38985877 reported five unrelated individuals with monoallelic variants or a deletion in AJAP1 gene and they presented with epilepsy, neurodevelopmental problems, or intellectual disability. There is also supporting functional evidence available. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6461 | PRKACB | Zornitza Stark edited their review of gene: PRKACB: Added comment: Additional individual reported with ID and de novo missense variant.; Changed rating: GREEN; Changed publications: 39095811 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6302 | ZDHHC16 |
Ain Roesley gene: ZDHHC16 was added gene: ZDHHC16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZDHHC16 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZDHHC16 were set to 39313616 Phenotypes for gene: ZDHHC16 were set to neurodevelopmental disorder MONDO:0700092, ZDHHC16-related Review for gene: ZDHHC16 was set to AMBER gene: ZDHHC16 was marked as current diagnostic Added comment: 6 families including a pair of siblings Amber because 5 of the families had non specific phenotypes listed Abnormality of: the nervous system, metabolism/homeostasis, head/neck, immune system, the integument, the digestive system, the respiratory system, the endocrine system, Growth abnormality the skeletal system, the musculature, the eye Specific HPOs were provided for one individual (homoyzygous for a canonical splice) Abnormality of the face; Cerebellar hypoplasia; Developmental regression; Encephalopathy; Hyperreflexia; Hypertonia; Hypotonia; Inguinal hernia; Laryngomalacia; Microcephaly; Motor delay; Optic atrophy; Seizure; Spastic paraparesis; Spasticity; Talipes equinovarus; Umbilical hernia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | IDUA | Sangavi Sivagnanasundram reviewed gene: IDUA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301341; Phenotypes: mucopolysaccharidosis type 1 MONDO:0001586; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6215 | DIAPH1 |
Ken Lee Wan changed review comment from: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development, and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632). Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).; to: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632). Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6205 | RNU2-2P |
Zornitza Stark gene: RNU2-2P was added gene: RNU2-2P was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU2-2P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 Phenotypes for gene: RNU2-2P were set to Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related Review for gene: RNU2-2P was set to GREEN Added comment: 15 individuals reported with de novo, recurrent variants in this gene at nucleotide positions 4 and 35. The disorder is characterized by intellectual disability, neurodevelopmental delay, autistic behavior, microcephaly, hypotonia, epilepsy and hyperventilation. All cases display a severe and complex seizure phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6195 | EIF3I |
Mark Cleghorn gene: EIF3I was added gene: EIF3I was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: EIF3I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EIF3I were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: EIF3I were set to unknown Review for gene: EIF3I was set to AMBER Added comment: Marcello Scala, Genoa ESHG presentation 4/6/24, unpublished De novo EIF3I missense variants as a cause for novel NDD syndrome EIF3 complex involved in regulating initiation of mRNA translation Negative regulator of the TGF beta pathway 8 individuals from 8 families Mod/severe GDD or ID Short stature Midline brain anomalies (hypoplasia/agenesis of corpus callosum and pituitary hypoplasia) Frontal bossing, hypertelorism, long philtrum All w rare de novo missense variants om EIF3I, clustering within highly conserved WD repeats Functional studies Transfected HEK293 cell studies suggested EIF3I protein from variant alleles (from patients above) had disrupted interaction with other EIF subunits, and cells had reduced protein synthesis overall No animal models Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6189 | FKBP4 |
Mark Cleghorn gene: FKBP4 was added gene: FKBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: FKBP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FKBP4 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: FKBP4 were set to unknown Review for gene: FKBP4 was set to AMBER Added comment: Rebecca Yarwood, University of Manchester ESHG presentation 4/6/24, unpublished Bilalleic FKBP4 w NDD + DSD Protein has functions in hormone receptor trafficking FKPB4 highly expressed in stem cell and progenitor cells in gonad and neuronal degeneration Index case Severe GDD abN external genitalia CV AbN FBBP4 p.E196* Via GeneMatcher 7 families (12 individuals) 12/12 severe GDD/ID 9/10 microcephaly 11/12 external genital abnormalities (details not provided) All w homozygous pLoF variants (mixture of canonical splice, frameshift, nonsense) Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | MED16 |
Mark Cleghorn gene: MED16 was added gene: MED16 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED16 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: MED16 were set to unknown Review for gene: MED16 was set to GREEN Added comment: MED16 Charlotte Guillouet, Imagine institute Paris ESHG presentation 4/6/24, unpublished MED16 is part of tail of ‘mediator complex’ Plays a role in enhancer/promotor regions Disruptive variants in other genes encoding proteins within this mediator complex (MED11/12/12/17/20, CDK8) are assoc w neurodevelopmental/neurodegenerative disorders Cases index family Sibs (M/F) to consanguineous parents w NDD/mod ID, tetralogy of Fallot or VSD, bilat deafness, micrognathia, malar hypoplasia, dental AbN, pre auricular tags, hypoplastic nails, brachydactly WES: biallelic MED16 p.Asp217Asn Via genematcher 16 families total, 22 individuals, homozygous or compound het rare MED16 variants Mixture of pLoF and missense variants Motor delay in 16/17 DD or ID in 17/17 Speech delay in 15/15 6/19 ToF 7/19 other septal/aortic defects 6/18 deafness 11/18 microretognathia 6/17 cleft palate 8/19 preauricular tags 9/20 puffy eyelids 12/20 nasal dysplasia (most commonly short columella w bulbous nasal tip) 7/20 corpus callosum anomalies Not clear that functional work recapitulated phenotype as yet? Immunofluroescence on HeLa cells transfected with variants observed ?conclusion MED16 knockout mouse > growth delay, pre weaning lethality MED16 knockout zebrafish > reduced body length, early death, no obvious craniofacial phenotype Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6155 | TTC19 |
Zornitza Stark changed review comment from: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances. At least 4 unrelated families reported.; to: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances. Included due to phenotypic overlap. At least 4 unrelated families reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6152 | ZNRF3 |
Bryony Thompson gene: ZNRF3 was added gene: ZNRF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNRF3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNRF3 were set to 39168120 Phenotypes for gene: ZNRF3 were set to Complex neurodevelopmental disorder MONDO:0100038 Review for gene: ZNRF3 was set to GREEN Added comment: 12 individuals with ZNRF3 variants and various phenotypes. 8 individuals with de novo missense and neurodevelopment disorders (NDD), including cluster of variants in the RING ligase domain with macrocephalic NDD. Plus 4 individuals from 3 families with de novo truncating or de novo/inherited large in-frame deletion variants with non-NDD phenotypes, including heart, adrenal, or nephrotic problems. Overall, 4 individuals had congenital heart defects and 2 had microcephaly. Also, supporting in vitro functional assays. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6134 | GPN2 |
Mark Cleghorn gene: GPN2 was added gene: GPN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: GPN2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPN2 were set to complex neurodevelopmental disorder MONDO:0100038; Perrault syndrome Review for gene: GPN2 was set to AMBER Added comment: GPN2 ESHG talk 2/6/24, unpublished Thomas Smith, University of Manchester Biallelic GPN2 proposed to cause Perrault syndrome (SNHL, ovarian dysfunction, NDD) RNA polymerase assembly factor 4 families (14 affected individuals) w biallalic GPN2 rare missense variants Segregated w phenotype Fam 2 and 3 may be distantly related (leaving 3 distinct kindreds) Clinical features 13/14 SNHL 3/4 families all females of adolescent age or older had primary ovarian insufficiency 4/4 GDD, ataxia (no data on family w 10 affected indiv.) Some functional work, not conclusive Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6127 | RFC4 |
chirag patel gene: RFC4 was added gene: RFC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RFC4 were set to PMID: 39106866 Phenotypes for gene: RFC4 were set to RFC4-related multisystem disorder Review for gene: RFC4 was set to GREEN gene: RFC4 was marked as current diagnostic Added comment: 9 affected individuals (aged birth to 47yrs) from 8 unrelated families with a multisystem disorder. Clinical features included: muscle weakness/myopathy (9/9), motor incoordination/gait disturbance (8/8), delayed gross motor development (6/9), dysarthria (5/5), peripheral neuropathy (3/3 adults), bilateral sensorineural hearing impairment (6/9), decreased body weight (8/9), short stature (5/9), microcephaly (4/9), respiratory issues/insufficiency (6/9), cerebellar atrophy (4/9), pituitary hypoplasia (3/9). WES or WGS identified biallelic loss-of-function variants in RFC4 (3 frameshift, 2 splice site, 1 single AA duplication, 2 single AA deletions, 2 missense), and almost all are likely to disrupt the C-terminal domain indispensable for Replication factor C (RFC) complex formation. All variants segregated with the disease. The RFC complex (with 5 subunits) is central to process of regulation of DNA replication, and it loads proliferating cell nuclear antigen onto DNA to facilitate the recruitment of replication and repair proteins and enhance DNA polymerase processivity. RFC1 is associated with CANVAS but the contributions of RFC2-5 subunits on human Mendelian disorders is unknown. Analysis of a previously determined cryo-EM structure of RFC bound to proliferating cell nuclear antigen suggested that the variants disrupt interactions within RFC4 and/or destabilize the RFC complex. Cellular studies using RFC4-deficient HeLa cells and primary fibroblasts demonstrated decreased RFC4 protein, compromised stability of the other RFC complex subunits, and perturbed RFC complex formation. Additionally, functional studies of the RFC4 variants affirmed diminished RFC complex formation, and cell cycle studies suggested perturbation of DNA replication and cell cycle progression. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6124 | PNPLA8 |
chirag patel gene: PNPLA8 was added gene: PNPLA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PNPLA8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PNPLA8 were set to PMID: 39082157 Phenotypes for gene: PNPLA8 were set to PNPLA8-related neurological diseases Review for gene: PNPLA8 was set to GREEN gene: PNPLA8 was marked as current diagnostic Added comment: Cohort analysis of clinical features of new and previously reported individuals with biallelic PNPLA8 variants (25 affected individuals across 20 families). They showed that PNPLA8-related neurological diseases manifest as a continuum ranging from variable developmental and/or degenerative epileptic-dyskinetic encephalopathy to childhood-onset neurodegeneration. Complete loss of PNPLA8 was associated with the more profound end of the spectrum. 13/19 individuals (info available) had developmental delay and/or severe intellectual disability. Using cerebral organoids generated from human induced pluripotent stem cells, they found that loss of PNPLA8 led to developmental defects by reducing the number of basal radial glial cells and upper-layer neurons. Neural progenitor cells lacking PNPLA8 showed a reduced amount of lysophosphatidic acid, lysophosphatidylethanolamine and phosphatidic acid. They show that PNPLA8 is crucial to meet phospholipid synthetic needs and to produce abundant basal radial glial cells in human brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | MED22 |
Mark Cleghorn gene: MED22 was added gene: MED22 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MED22 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED22 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: MED22 were set to unknown Review for gene: MED22 was set to AMBER Added comment: ESHG talk 2/6/24, unpublished Elisa Cali, UCL Recurrent homozygous MED22:c.397_399del (p.Glu133del) inframe variant in 8 individuals from 6 families w progressive NDD, microcepahly, cerebellar atrophy, dystonia, seizures Rare in gnomad v4.1 (9 het alleles, no homozygotes) Functional work on patient fibroblasts: quantity of protein comparable to controls, did not mentioned assays of protein function (?mechanism proposed) Drosophilia heterozygous model with equivalent of p.Glu133del variant: structural anomalies, less movements, all died prior to pupae stage Zebrafish: MED22 mutants less mobile, died prior to adulthood, reduced brain size Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | C12orf66 |
Mark Cleghorn gene: C12orf66 was added gene: C12orf66 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: C12orf66 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: C12orf66 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: C12orf66 were set to unknown Review for gene: C12orf66 was set to AMBER Added comment: KICS2 (previously known as C12ORF66) Rebecca Buchert, Universitatklinikum Tubingen ESHG talk 2/6/24, unpublished Proposed ID + epilepsy gene 8 families w 11 affected individuals Phenotypes: 11/11 ID, 9/11 epilepsy, 3/11 hearing impairment 3/8 homozygous missense variants (p.Asp296Glu, p.Tyr393Cys, p.Tyr393Cys), all highly conserved 1/8 compound het PTC (p.Lys262*) with 1.1Mb deletion 4/8 homozygous PTC (p.Glu3*, p.Gly79Valfs*18, p.Gly79Valfs*18, p.Lys260Asnfs*18) Gene appears to be involved in mTOR pathway, and cilia function mTORC1 activity in CRISPR-HEK293T cells – reduced activity in cells w variants above Zebrafish model: otolith defects, ciliary dysfunction ?not clear if truly mimics phenotype observed in patient cohort described Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | TTL |
Mark Cleghorn gene: TTL was added gene: TTL was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: TTL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTL were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: TTL was set to AMBER Added comment: TTL Valentina Serpieri, University of Pavia ESHG talk 1/6/24 FAM1 (Italy) 2 affected sisters born to consanguineous Pakistani parents GDD, spastic tetraparesis, optic atrophy, brain anomalies resembling tubulinopathies (dysplasia of corpus callosum, basal ganglia, brainstem) WES: homozygous TTL:c.1013G>A; p.Cys338Tyr in both affected sisters Via genematcher 5 more families (9 individuals) w similar phenotypes and biallelic variants in TTL FAM2 (Egypt): homozygous p.Arg46Pro FAM3 (Egypt): homozygous p.Arg46Pro FAM4 (Australia): homozygous p.Gln183Arg FAM5 (France): homozygous p.Trp147* FAM6 (Saudi Arabia): homozygous p.His243Tyr TTL KO mice: death soon after birth, no overt malformations, but defects in organisation of cerebral layers Functional work on patient fibroblasts FAM1 – reduced quantity of TTL protein compared to control on Western blot, decreased function of TTL protein (increase in detyrosinated tubulin) compared to controls – infer LoF as mechanism FAM3 – mentioned but no details FAM4– mentioned but no details Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6121 | CSMD1 |
Krithika Murali gene: CSMD1 was added gene: CSMD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD1 were set to PMID 38816421 Phenotypes for gene: CSMD1 were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: CSMD1 was set to GREEN Added comment: PMID 38816421 Werren et al 2024 report 8 individuals from 6 families with biallelic missense CSMD1 variants identified through exome sequencing and subsequent gene-sharing efforts. Shared phenotypic features included: GDD, ID, microcephaly and polymicrogyria. Other features included dysmorphism, IUGR, hypotonia, arthrogryposis, seizures, opthalmological anomalies and other brain white matter anomalies Heterozygous parents were unaffected. Loss of function is the postulated mechanism based on experimental data involving early-stage forebrain organoids differentiated from CSMD1 knockout human embryonic stem cells. ClinGen haploinsufficiency score of 1, however, this curation was last reviewed in 2018. This gene is within the scope of review for the ClinGen Autisim and ID GCEP. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6097 | TBC1D7 | Zornitza Stark edited their review of gene: TBC1D7: Added comment: PMID: 36669495 reports additional individuals with compound het variants identified via trio RNASeq.; Changed rating: GREEN; Changed publications: 24515783, 23687350, 36669495 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6093 | HDAC3 |
Zornitza Stark gene: HDAC3 was added gene: HDAC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HDAC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HDAC3 were set to 39047730 Review for gene: HDAC3 was set to GREEN Added comment: Six individuals with de novo missense variants in this gene and variable NDD phenotypes, including ID, seizures. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6078 | LEO1 |
Zornitza Stark gene: LEO1 was added gene: LEO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LEO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LEO1 were set to 38965372 Phenotypes for gene: LEO1 were set to neurodevelopmental disorder MONDO:0700092, LEO-1 related Review for gene: LEO1 was set to AMBER Added comment: cohort of individuals with delayed motor and speech development, ASD 8x de novo – 6x missense + 2x PTC 1x pat splice (father unaffected) 2x unknown_inh PTCs Of the missense variants, G370E has 8 hets in gnomad v4 This gene is not constraint for LoF with 4 hets with an NMD variant in gnomad v4 3 of the missense are said to lie within a region of missense constraint, however this isn't the case in v4 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6073 | PCBP2 |
Ain Roesley gene: PCBP2 was added gene: PCBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PCBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PCBP2 were set to 38965372 Phenotypes for gene: PCBP2 were set to neurodevelopmental disorder MONDO:0700092, PCBP2-related Review for gene: PCBP2 was set to GREEN gene: PCBP2 was marked as current diagnostic Added comment: 3x individuals with de novo variants Motor and speech delay and ASD 2x missense + 1x fs There are 2 NMD variants with 9 and 8 hets respectively in gnomad v4, however the IGV looks to be low quality Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6070 | SLC45A1 | Zornitza Stark edited their review of gene: SLC45A1: Added comment: PMID 39003656: additional individual with compound het missense variants and supportive functional data.; Changed rating: GREEN; Changed publications: 28434495, 39003656 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6068 | SRPK3 |
Zornitza Stark gene: SRPK3 was added gene: SRPK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRPK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SRPK3 were set to 38429495; 39073169 Phenotypes for gene: SRPK3 were set to Neurodevelopmental disorder, MONDO:0700092, SRPK3-related Review for gene: SRPK3 was set to GREEN Added comment: PMID 39073169: 9 individuals from 5 unrelated families reported with 4 missense and 1 putative truncating variant and a neurodevelopmental phenotype. The 8 patients ascertained postnatally shared common clinical features including intellectual disability, agenesis of the corpus callosum, abnormal eye movement, and ataxia. A ninth case, ascertained prenatally, had a complex structural brain phenotype. Supportive animal model data (mouse and zebrafish). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6057 | FDXR | Zornitza Stark edited their review of gene: FDXR: Added comment: Multiple reports of individuals with extra-ocular features, including ID and regression.; Changed rating: GREEN; Changed publications: 30250212, 29040572, 33348459, 37046037, 37481223; Changed phenotypes: Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887, Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6055 | SREBF2 |
Zornitza Stark gene: SREBF2 was added gene: SREBF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SREBF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SREBF2 were set to 38847193 Phenotypes for gene: SREBF2 were set to Neurocutaneous syndrome, MONDO:0042983, SREBF2-related Review for gene: SREBF2 was set to AMBER Added comment: Two individuals with de novo missense variants, presenting with neurological, cutaneous and skeletal features; supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6051 | PSMF1 |
Zornitza Stark gene: PSMF1 was added gene: PSMF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMF1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSMF1 were set to https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 Phenotypes for gene: PSMF1 were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related Review for gene: PSMF1 was set to GREEN Added comment: 22 individuals from 15 families reported with a range of neurological phenotypes ranging from early-onset Parkinson's disease; childhood conditions typified by ID and a range of movement disorders; through to perinatal lethal presentations with arthrogryposis multiplex. Genotype-phenotype correlation: biallelic missense variants resulted in the milder phenotypes, while bi-allelic LoF variants in the more severe phenotypes. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6038 | RDH14 |
Zornitza Stark gene: RDH14 was added gene: RDH14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RDH14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RDH14 were set to 34848785 Phenotypes for gene: RDH14 were set to Neurodevelopmental disorder, MONDO:0700092, RDH14-related Review for gene: RDH14 was set to RED Added comment: Two related individuals with ID and cerebellar atrophy and homozygous LoF variant reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6025 | ATXN7L3 |
chirag patel gene: ATXN7L3 was added gene: ATXN7L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATXN7L3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN7L3 were set to PMID: 38753057 Phenotypes for gene: ATXN7L3 were set to Neurodevelopmental disorder, MONDO_0100500 Review for gene: ATXN7L3 was set to GREEN gene: ATXN7L3 was marked as current diagnostic Added comment: This study reports 9 unrelated individuals with de novo heterozygous variants in ATXN7L3 identified through WES testing and GeneMatcher. Core clinical features included: global motor and language developmental delay, hypotonia, and dysmorphic features (hypertelorism, epicanthal folds, blepharoptosis, small nose, small mouth, and low-set posteriorly rotated ears). Variable features included: feeding difficulties, seizures, mild periventricular leukomalacia, and structural cardiac abnormalities. A recurrent nonsense variant [p.(Arg114Ter)] was found in 5/9 individuals. The other variants were 1 frameshift [p.(Ser112LysfsTer12)] and 3 missense variants [p.(Ile71Thr), p.(Ser92Arg), and p.(Leu106Pro)]. They investigated the effects of the recurrent nonsense variant [p.(Arg114Ter)] in fibroblasts of an affected individual. ATXN7L3 protein levels were reduced, and deubiquitylation was impaired (as indicated by an increase in histone H2Bub1 levels). This is consistent with the previous observation of increased H2Bub1 levels in Atxn7l3-null mouse embryos, which have developmental delay and embryonic lethality. Pathogenic variants in deubiquitinating enzymes (DUBs) have been implicated in neurodevelopmental disorders (ND) and congenital abnormalities. ATXN7L3 is a component of the DUB module of the SAGA complex, and two other related DUB modules, and serves as an obligate adaptor protein of 3 ubiquitin-specific proteases (USP22, USP27X or USP51). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6022 | FAM177A1 |
chirag patel gene: FAM177A1 was added gene: FAM177A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FAM177A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FAM177A1 were set to PMID: 38767059, 25558065 Phenotypes for gene: FAM177A1 were set to Neurodevelopmental disorder, MONDO_0100500 Review for gene: FAM177A1 was set to GREEN gene: FAM177A1 was marked as current diagnostic Added comment: PMID: 38767059 5 individuals from 3 unrelated families reported with with biallelic loss of function variants in FAM177A1. Clinical features included: global developmental delay, intellectual disability, seizures, behavioural abnormalities, hypotonia, gait disturbance, and macrocephaly. They showed that FAM177A1 localizes to the Golgi complex in mammalian and zebrafish cells. Intersection of the RNA-seq and metabolomic datasets from FAM177A1-deficient human fibroblasts and whole zebrafish larvae demonstrated dysregulation of pathways associated with apoptosis, inflammation, and negative regulation of cell proliferation. PMID: 25558065 A study of 143 multiplex consanguineous families identified a homozygous frameshift variant in FAM177A1 in 1 family with 4 affected siblings with intellectual disability, dolicocephaly, obesity, and macrocephaly. The variant segregated with all 4 affected siblings and parents were confirmed heterozygous carriers. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6013 | RELN |
Tashunka Taylor-Miller changed review comment from: 7 individuals from 4 families with biallelic variants, and 13 individuals from 7 families with monoallelic (heterozygous) variants of RELN and frontotemporal or temporal-predominant lissencephaly variant. Associated features: intellectual disability (16/20), seizures (5/20), unprovoked aggression (6/20), sleep disturbance (7/20) Variant spectrum includes: loss of function, missense, splice-site variants. MRI features include: anterior-predominant “thin”lisencephaly pachygyria with cerebellar hypoplasia Biallelic variants are associated with a severe phenotype that includes cerebellar hypoplasia. Monoallelic variants are associated with incomplete penetrance and variable expressivity (eg: one adult with abnormal MRI but normal intelligence and neurological profile).; to: 7 individuals from 4 families with biallelic variants, and 13 individuals from 7 families with monoallelic (heterozygous) variants of RELN and frontotemporal or temporal-predominant lissencephaly variant. Associated features: intellectual disability (16/20), seizures (5/20), unprovoked aggression (6/20), sleep disturbance (7/20) Variant spectrum includes: loss of function, missense, splice-site variants. MRI features include: anterior-predominant “thin” lisencephaly pachygyria with cerebellar hypoplasia. Biallelic variants are associated with a severe phenotype that includes cerebellar hypoplasia. Monoallelic variants are associated with incomplete penetrance and variable expressivity (eg: one adult with abnormal MRI but normal intelligence and neurological profile). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5873 | GABRA4 |
Adam Ivey gene: GABRA4 was added gene: GABRA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABRA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABRA4 were set to PMID: 38565639 Phenotypes for gene: GABRA4 were set to Developmental delay; Intellectual disability; Epileptic seizures Penetrance for gene: GABRA4 were set to Complete Review for gene: GABRA4 was set to GREEN Added comment: Four unrelated individuals with unique de novo missense variants in the transmembrane domain of GABRA4 have developmental delay and varying degrees of intellectual disability (PMID: 38565639). These variants are not present in gnomAD and three of the four variants have pathogenic REVEL scores. Two of the GABRA4 variants were heterozygous, while the remaining two were mosaic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 |
Sangavi Sivagnanasundram commented on gene: SETBP1: Classified DEFINITIVE for both conditions by ClinGen ID and Autism GCEP. SGS classified on 16/02/2021 - https://search.clinicalgenome.org/CCID:006117 Complex neurodevelopmental disorders on 20/10/2020 - https://search.clinicalgenome.org/CCID:006116 LoF is associated with complex neurodevelopmental disorder. There have been 20 LoF variants reported in individuals so far (nonsense, frameshift, large deletions) GoF is proposed to be the mechanism of disease for Schinzel-Giedion syndrome (SGS) due to an increase in SETBP1 protein production. Missense variants (especially affecting p.868-871) are known to be disease causing. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 |
Sangavi Sivagnanasundram commented on gene: SETBP1: Classified DEFINITIVE for both conditions by ClinGen ID and Autism GCEP. SGS classified on 16/02/2021 - https://search.clinicalgenome.org/CCID:006117 Complex neurodevelopmental disorders on 20/10/2020 - https://search.clinicalgenome.org/CCID:006116 LoF is associated with complex neurodevelopmental disorder. There have been 20 LoF variants reported in individuals so far (nonsense, frameshift, large deletions) GoF is proposed to be the mechanism of disease for Schinzel-Giedion syndrome (SGS) due to an increase in SETBP1 protein production. Missense variants (especially affecting p.868-871) are known to be disease causing. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5797 | SPR |
Amy Chiang edited their review of gene: SPR: Added comment: SPR has been classified to have definitive association with dopa-responsive dystonia (reviewed by the Aminoacidopathy Expert Panel on 06/04/2021). Clinical phenotypes are mainly neuromuscular with characteristic features of axial hypotonia, dystonia, delayed psychomotor development, oculogyric crises, diurnal fluctuation with improvement after sleep; though cognitive impairment ranging from mild to severe levels have been reported in patients with sepiapterin reductase deficiency (PMID: 16049044, 17188538) - 7 Maltese patients with the same homozygous spice variants in SPR (founder effect due to relative small Maltese population); note there was no significant improvement in cognitive ability with L-dopa treatment in these patients despite improvement in their motor abilities (PMID: 16049044) - ? other causes to cognitive impairment in these patients other than SPR associated sepiapterin reductase deficiency There are 271 SPR variants registered in ClinVar to date with only 1 submission from a research lab reported 2 affected individuals with intellectual disability + family history (ClinVar # 625209) - no publication available to verify, ? from BRIDGE consortium study: SPEED project cohort A start loss variant detected in 5 affected individuals with ID & epilepsy from a Persian consanguineous family - LOD score = 4.027 (PMID: 29302074); Changed publications: PMID: 29302074, 16049044, 17188538; Changed phenotypes: MONDO #0012994, OMIM #612716, axial hypotonia, dystonia with diurnal fluctuation, oculogyric crises, delayed psychomotor development, sepiapterin reductase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5796 | SPR |
Amy Chiang changed review comment from: SPR has been classified to have definitive association with dopa-responsive dystonia. This was reviewed by the Aminoacidopathy Expert Panel on 06/04/2021. There are 271 SPR variants registered in ClinVar to date with only 1 submission from a research lab reported 2 affected individuals with intellectual disability + family history (ClinVar # 625209) - no publication available to verify, ? from BRIDGE consortium study: SPEED project cohort A start loss variant detected in 5 affected individuals with ID & epilepsy from a Persian consanguineous family - LOD score = 4.027 (PMID: 29302074); to: SPR has been classified to have definitive association with dopa-responsive dystonia. This was reviewed by the Aminoacidopathy Expert Panel on 06/04/2021. There are 271 SPR variants registered in ClinVar to date with only 1 submission from a research lab reported 2 affected individuals with intellectual disability + family history (ClinVar # 625209) - no publication available to verify, ? from BRIDGE consortium study: SPEED project cohort A start loss variant detected in 5 affected individuals with ID & epilepsy from a Persian consanguineous family - LOD score = 4.027 (PMID: 29302074) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5794 | DAGLA |
Zornitza Stark gene: DAGLA was added gene: DAGLA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DAGLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DAGLA were set to 35737950 Phenotypes for gene: DAGLA were set to Neuroocular syndrome 2, paroxysmal type, MIM# 168885 Review for gene: DAGLA was set to GREEN Added comment: 9 individuals from 8 families reported with daily paroxysmal spells characterized by eye deviation or nystagmus with abnormal head posturing apparent from birth or early infancy. The episodes tend to be triggered after sleeping, and most patients show improvement of the ocular symptoms over time. Affected individuals also have hypotonia, mild developmental delay, dysarthria, and gait ataxia; most have mildly impaired intellectual development. Seizures are not observed. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5790 | NOTCH3 |
Ain Roesley changed review comment from: Pre-print (https://sciprofiles.com/publication/view/62eb776390415f0166f73fae7cd172ed) Review of research and diagnostic databases and literature review found 50 individuals from 31 families with biallelic variants. 13 PTCS (including splice) and 15 missense resulting in gain or loss of Cys residue. AR PTCs are associated with early onset leukoencephalopathy including cognitive decline, dev delay/ID and dysmorphism AR missense are associated with CADASIL-like phenotype; to: Pre-print (https://sciprofiles.com/publication/view/62eb776390415f0166f73fae7cd172ed) Review of research and diagnostic databases and literature review found 50 individuals from 31 families with biallelic variants. 13 PTCS (including splice) and 15 missense resulting in gain or loss of Cys residue. AR PTCs are associated with early onset leukoencephalopathy including cognitive decline, dev delay/ID and dysmorphism; seizures, spasticity, hypotonia, ataxia AR missense are associated with CADASIL-like phenotype |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5781 | RNU4-2 |
Zornitza Stark changed review comment from: Emerging evidence that de novo variants in this gene cause ID. Sources: Literature; to: Over 100 individuals with ID found to have de novo variants in this gene. Please note difficult to identify on ES. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5772 | SNF8 | Zornitza Stark commented on gene: SNF8: Four individuals from 3 families with NDD plus OA, rather than DEE. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5767 | BANF1 |
Zornitza Stark gene: BANF1 was added gene: BANF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BANF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BANF1 were set to 35982159 Phenotypes for gene: BANF1 were set to Neurodevelopmental disorder, MONDO:0700092, BANF1-related Review for gene: BANF1 was set to RED Added comment: Single individual reported with a de novo variant, p.Ala87Thr, and a neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5763 | YKT6 |
Zornitza Stark gene: YKT6 was added gene: YKT6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YKT6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YKT6 were set to 38522068 Phenotypes for gene: YKT6 were set to Syndromic disease, MONDO:0002254, YKT6-related Review for gene: YKT6 was set to AMBER Added comment: Two individuals homozygous for YKT6 [NM_006555.3:c.554A>G p.(Tyr185Cys)] exhibited normal prenatal course followed by failure to thrive, developmental delay and progressive liver disease. Haplotype analysis identified a shared homozygous region flanking the variant, suggesting a common ancestry. The third individual homozygous for YKT6 [NM_006555.3:c.191A>G p.(Tyr64Cys)] exhibited neurodevelopmental disorders and optic atrophy. Supportive functional data in Drosophila. Amber rating due to homozygous missense variants and founder effect in two of the families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5761 | SEPHS1 |
Zornitza Stark gene: SEPHS1 was added gene: SEPHS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SEPHS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SEPHS1 were set to 38531365 Phenotypes for gene: SEPHS1 were set to Neurodevelopmental disorder, MONDO:0700092, SEPHS1-related Review for gene: SEPHS1 was set to GREEN Added comment: Nine individuals from eight families with developmental delay, growth and feeding problems, hypotonia, and dysmorphic features, all with heterozygous missense variants in SEPHS1. Eight of these individuals had a recurrent variant at amino acid position 371 of SEPHS1 (p.Arg371Trp, p.Arg371Gln, and p.Arg371Gly); seven of these variants were known to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5756 | GTF3C5 |
Bryony Thompson gene: GTF3C5 was added gene: GTF3C5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GTF3C5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTF3C5 were set to 38520561; 35503477 Phenotypes for gene: GTF3C5 were set to neurodevelopmental disorder MONDO:0700092, GTF3C5-related Review for gene: GTF3C5 was set to GREEN gene: GTF3C5 was marked as current diagnostic Added comment: 4 families/probands with syndromic ID. Loss of function is the expected PMID: 38520561 - Biallelic variants identified (3 missense & 1 stopgain) in 4 individuals from 3 families presenting with multisystem developmental syndrome including the features: growth retardation, developmental delay, intellectual disability, dental anomalies, cerebellar malformations, delayed bone age, skeletal anomalies, and facial dysmorphism. Gene-disease relationship supported by: reduced protein expression in patient cells, yeast assays, and a zebrafish model PMID: 35503477 - 1 proband with biallelic missense variants and hypomelanosis of Ito, seizures, growth retardation, abnormal brain MRI, developmental delay, and facial dysmorphism Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5750 | DISP1 |
Zornitza Stark edited their review of gene: DISP1: Added comment: PMID: 38529886 25 individuals from 20 unrelated families with a phenotype associated with mild holoprosencephaly (HPE). A total of 23 different variants were identified in DISP1 (missense, frameshift and nonsense). 14 heterozygous individuals , 5 compound heterozygous individuals, 6 homozygous individuals (5 of the individuals were from 3 unrelated consanguineous families). HPE phenotype was also seen prenatally as one of the reported monoallelic individuals was a fetus at 20+6 GW prior to passing due to MTP.; Changed publications: 19184110, 26748417, 23542665, 38529886; Changed phenotypes: Holoprosencephaly (MONDO:0016296), DISP1-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5746 | DOCK4 |
Sangavi Sivagnanasundram changed review comment from: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).; to: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Two of the individuals are reportedly compound heterozygous. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5746 | DOCK4 |
Sangavi Sivagnanasundram changed review comment from: Well-established gene-disease association 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).; to: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5745 | FRYL |
Ain Roesley gene: FRYL was added gene: FRYL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FRYL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FRYL were set to 38479391 Phenotypes for gene: FRYL were set to neurodevelopmental disorder MONDO:0700092, FRYL-related Review for gene: FRYL was set to GREEN gene: FRYL was marked as current diagnostic Added comment: 14 individuals, all de novo except 1x duo testing (not present in tested father) 5x missense + 8x fs/stopgain + 1x canonical splice 13/13 with ID/DD (1x deceased) 4/14 seizures 7/14 with cardiac anomalies such as PDA, TOF, VSD, dextrocardia 1x also has a de novo fs variant in SF3B4 1x also has a de novo stop gain variant in SDHA functional studies using flies were performed Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5743 | KCNB2 |
Ain Roesley gene: KCNB2 was added gene: KCNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNB2 were set to 38503299 Phenotypes for gene: KCNB2 were set to neurodevelopmental disorder MONDO:0700092, KCNB2-related Review for gene: KCNB2 was set to GREEN gene: KCNB2 was marked as current diagnostic Added comment: 7 individuals, all missense 5 de novo + 1x inherited from father who has hypotonia + 1x from asymptomatic father 2/5 MRI anomalies 2/5 cardiac anomalies 2/7 urogenital anomalies 7/7 with ID 2/7 epilepsy 2/7 hypotonia Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5741 | PLXNB2 |
chirag patel gene: PLXNB2 was added gene: PLXNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLXNB2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLXNB2 were set to PMID: 38458752 Phenotypes for gene: PLXNB2 were set to Amelogenesis imperfecta MONDO:0019507, PLXNB2 -related; Sensorineural hearing loss disorder MONDO:0020678, PLXNB2 -related Review for gene: PLXNB2 was set to GREEN gene: PLXNB2 was marked as current diagnostic Added comment: 8 individuals from 6 families with core features of amelogenesis imperfecta and sensorineural hearing loss. Intellectual disability, ocular disease, ear developmental abnormalities and lymphoedema were also present in multiple cases. WES and WGS identified biallelic pathogenic variants in PLXNB2 (missense, nonsense, splice and a multiexon deletion variants). Variants segregated with disease. PLXNB2 is a large transmembrane semaphorin receptor protein, and semaphorin-plexin signalling controls cellular interactions that are critical during development as well as in adult life stages. Plxnb2 expression was detected in differentiating ameloblasts in mice. Human phenotype overlaps with that seen in Plxnb2 knockout mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5734 | USP27X | Zornitza Stark edited their review of gene: USP27X: Added comment: Ten additional individuals and further experimental data reported.; Changed rating: GREEN; Changed publications: 25644381, 38182161; Changed phenotypes: Intellectual disability, X-linked 105, MIM#300984 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5731 | FEM1B | Zornitza Stark edited their review of gene: FEM1B: Added comment: Five individuals reported now with same recurrent missense variant, NM_015322.5:c.377G>A NP_056137.1:p.(Arg126Gln). Affected individuals shared a severe neurodevelopmental disorder with behavioral phenotypes and a variable set of malformations, including brain anomalies, clubfeet, skeletal abnormalities, and facial dysmorphism. Overexpression of the the FEM1BR126Q variant but not FEM1B wild-type protein, during mouse brain development, resulted in delayed neuronal migration of the target cells.; Changed rating: GREEN; Changed publications: 31036916, 38465576; Changed phenotypes: Syndromic disease MONDO:0002254, FEM1B-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5729 | USP14 |
Zornitza Stark gene: USP14 was added gene: USP14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: USP14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: USP14 were set to 38469793; 35066879 Phenotypes for gene: USP14 were set to Syndromic disease MONDO:0002254, USP14-related Review for gene: USP14 was set to AMBER Added comment: AMBER rating as two of the families had affected fetuses, one had a severely affected newborn, and fourth had a progressive course: none fit well with ID, though there's likely to be a continuum. PMID 35066879: 3 fetuses from 2 different branches of a consanguineous family, presenting with distal arthrogryposis, underdevelopment of the corpus callosum, and dysmorphic facial features. Exome sequencing identified a biallelic 4-bp deletion (c.233_236delTTCC; p.Leu78Glnfs*11) in USP14, and sequencing of family members showed segregation with the phenotype. Ubiquitin-specific protease 14 (USP14) encodes a major proteasome-associated deubiquitinating enzyme with an established dual role as an inhibitor and an activator of proteolysis, maintaining protein homeostasis. Usp14-deficient mice show a phenotype similar to lethal human multiple congenital contractures phenotypes, with callosal anomalies, muscle wasting, and early lethality, attributed to neuromuscular junction defects due to decreased monomeric ubiquitin pool. RT-qPCR experiment in an unaffected heterozygote revealed that mutant USP14 was expressed, indicating that abnormal transcript escapes nonsense-mediated mRNA decay. PMID 38469793: biallelic USP14 variants in four individuals from three unrelated families: one fetus, a newborn with a syndromic NDD, and two siblings affected by a progressive neurological disease. Specifically, the two siblings from the latter family carried two compound heterozygous variants c.8T>C p.(Leu3Pro) and c.988C>T p.(Arg330*), while the fetus had a homozygous frameshift c.899_902del p.(Lys300Serfs*24) variant and the newborn patient harbored a homozygous frameshift c.233_236del p.(Leu78Glnfs*11) variant. The fetus and the newborn had extensive brain malformations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5717 | CELSR3 |
Crystle Lee gene: CELSR3 was added gene: CELSR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELSR3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CELSR3 were set to PMID: 38429302 Phenotypes for gene: CELSR3 were set to Neurodevelopmental disorder (MONDO#0700092), CELSR3-related Review for gene: CELSR3 was set to GREEN Added comment: PMID: 38429302:12 affected individuals from 11 families reported with bi-allelic variants. Phenotype ranged from CNS anomalies (7/12), CNS and CAKUT (3/12) and CAKUT only (2/12). 8/12 has ID/DD. Only missense variants reported and 1 inframe variant. Functional studies done in zebrafish demonstrate similar structural anomalies of the developing pronephros and neuronal abnormalities to affected individuals Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5715 | ZSCAN10 |
Rylee Peters gene: ZSCAN10 was added gene: ZSCAN10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZSCAN10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZSCAN10 were set to PMID: 38386308 Phenotypes for gene: ZSCAN10 were set to Syndromic disease MONDO:0002254 Review for gene: ZSCAN10 was set to GREEN Added comment: Bi-allelic ZSCAN10 loss-of-function variants were identified in seven affected individuals from five unrelated families with syndromic neurodevelopmental disorder. Highly consistent phenotypic features include global developmental delay, behavioural abnormalities, and variable facial asymmetry with outer and inner ear malformations leading to profound SNHL. Facial asymmetry was recapitulated in the Zscan10 mouse model along with inner and outer ear malformations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5714 | SLC12A9 |
Zornitza Stark gene: SLC12A9 was added gene: SLC12A9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC12A9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC12A9 were set to 38334070 Phenotypes for gene: SLC12A9 were set to Neurodevelopmental disorder, MONDO:0700092, SLC12A9-related Review for gene: SLC12A9 was set to GREEN Added comment: Three individuals from unrelated families with bi-allelic LoF variants and a neurodevelopmental phenotype, skeletal abnormalities, brain abnormalities, hypopigmentation, dysmorphic features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5712 | SNF8 |
Chern Lim gene: SNF8 was added gene: SNF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNF8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNF8 were set to 38423010 Phenotypes for gene: SNF8 were set to Severe developmental delay, epileptic encephalopathy, brain MRI abnormality; intellectual disability, childhood-onset optic atrophy, ataxia Review for gene: SNF8 was set to GREEN gene: SNF8 was marked as current diagnostic Added comment: PMID: 38423010 - Nine individuals from six families presenting with a spectrum of neurodevelopmental/neurodegenerative features caused by bi-allelic variants in SNF8. In total, three putative LoF variants and four missense variants were identified. - The phenotypic spectrum included four individuals with severe developmental and epileptic encephalopathy, massive reduction of white matter, hypo-/aplasia of the corpus callosum, neurodevelopmental arrest, and early death. A second cohort shows a milder phenotype with intellectual disability, childhood-onset optic atrophy, or ataxia. All mildly affected individuals shared the same hypomorphic variant, c.304G>A (p.Val102Ile) as compound heterozygous. - Functional studies using fibroblasts derived from patients and zebrafish model showed LoF is the disease mech. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5711 | RREB1 |
Zornitza Stark gene: RREB1 was added gene: RREB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RREB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RREB1 were set to 32938917; 38332451 Phenotypes for gene: RREB1 were set to Rasopathy, MONDO:0021060, RREB1-related Review for gene: RREB1 was set to AMBER Added comment: PMID 32938917: Single individual reported with Noonan syndrome-like features and a deletion encompassing RREB1. Overlapping deletions in publicly reported databases examined, and RREB1 postulated to be the key gene. Rreb1 hemizygous mice display orbital hypertelorism and age dependent cardiac hypertrophy. RREB1 recruits SIN3A and KDM1A to an RRE in target promoters in human and murine cells to control histone H3K4 methylation of MAPK pathway genes. In summary, single well phenotyped individual with a CNV and experimental data to support gene-disease association. PMID 38332451: de novo LoF variant in an individual with phenotype consistent with the previous reports. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5692 | ASCC3 |
Zornitza Stark gene: ASCC3 was added gene: ASCC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: ASCC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ASCC3 were set to 21937992; 35047834 Phenotypes for gene: ASCC3 were set to Intellectual developmental disorder, autosomal recessive 81, MIM# 620700 Review for gene: ASCC3 was set to GREEN Added comment: Combined neuromuscular and neurobehavioral phenotype. 11 individuals from 7 unrelated families with homozygous (missense) or compound heterozygous variants (missense with a presumed LoF variant or 2 missense, no biallelic LoF) with a neurologic phenotype that ranges from severe developmental delay to muscle fatigue Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5666 | PPFIA3 |
Zornitza Stark gene: PPFIA3 was added gene: PPFIA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPFIA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPFIA3 were set to 37034625 Phenotypes for gene: PPFIA3 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA3-related Review for gene: PPFIA3 was set to GREEN Added comment: 19 individuals with mono-allelic variants presenting with features including developmental delay, intellectual disability, hypotonia, micro/macrocephaly, autism, and epilepsy. One individual with compound het variants: insufficient evidence for bi-allelic variants causing disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5661 | MAX |
Rylee Peters gene: MAX was added gene: MAX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAX were set to 38141607 Phenotypes for gene: MAX were set to Syndromic disease (MONDO:0002254), MAX-related Review for gene: MAX was set to GREEN Added comment: Three individuals who each share a recurrent de novo germline variant in the MAX gene, resulting in a p.Arg60Gln substitution in the loop of the b-HLH-LZ domain. Affected individuals have a complex disorder consisting primarily of macrocephaly, polydactyly, and delayed ophthalmic development. Other phenotypes reported include intellectual disability, perianal abscesses, pectus carinatum, hypospadias, renal agenesis, single umbilical artery, flattened thoracic vertebrae. Functional analysis of the p.Arg60Gln variant shows a significant increase in CCND2 protein and a more efficient heterodimerization with c-Myc resulting in an increase in transcriptional activity of c-Myc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5660 | CACHD1 |
Suliman Khan gene: CACHD1 was added gene: CACHD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACHD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CACHD1 were set to PMID: 38158856 Phenotypes for gene: CACHD1 were set to syndromic complex neurodevelopmental disorder MONDO:0800439 Penetrance for gene: CACHD1 were set to unknown Review for gene: CACHD1 was set to GREEN Added comment: PMID: 38158856 - Six affected individuals from four unrelated families with homozygous CACHD1 variants (3 splice, 2 frameshift and 1 nonsense variant). Excluding the two fatal cases, all other were affected by syndromic neurodevelopmental abnormalities, multiple organ systems featuring global impairment of psychomotor development, dysmorphic facial features, genitourinary abnormalities, oculo-auricular and congenital malformation. Seizure was reported in one case. Whole exome sequencing identified bi-allelic loss of function variants in the CACHD1 gene. In vitro human neural models of CACHD1 depletion displayed dysregulated of Wnt signaling in the developing brain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5659 | GTPBP1 |
Lucy Spencer gene: GTPBP1 was added gene: GTPBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GTPBP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTPBP1 were set to 38118446 Phenotypes for gene: GTPBP1 were set to Neurodevelopmental disorder (MONDO#0700092), GTPBP1-related Review for gene: GTPBP1 was set to GREEN Added comment: PMID: 38118446- Cohort of individuals with variants in GTPBP2 (which has been previously described) and GTPBP1 (new) who have an identical neurodevelopmental syndrome. 4 homozygous individuals from 3 consanguineous families. 2 families have different NMD-predicted nonsense variants and the third has a missense, all are absent from gnomad v4. The shared cardinal features of GTPBP1 and 2 related disease are microcephaly, profound neurodevelopmental impairment, and distinctive craniofacial features. Epilepsy was present in 10 of 20 individuals but its not clear if those individuals had GTPBP1 or 2 variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5646 | MANF |
Zornitza Stark gene: MANF was added gene: MANF was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: MANF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MANF were set to 26077850; 33500254; 34815294 Phenotypes for gene: MANF were set to Diabetes, deafness, developmental delay, and short stature syndrome, MIM# 620651 Review for gene: MANF was set to AMBER Added comment: Two individuals reported with homozygous variants. Mouse model recapitulates deafness phenotype. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5641 | PRPF19 |
Zornitza Stark gene: PRPF19 was added gene: PRPF19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRPF19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRPF19 were set to 37962958 Phenotypes for gene: PRPF19 were set to Neurodevelopmental disorder (MONDO:0700092), PRPF19-related Review for gene: PRPF19 was set to GREEN Added comment: PMID: 37962958 Six unrelated individuals with de novo variants. Five had speech language motor delay, four had formal diagnosis of autism, three hypotonia and one fetus with multiple congenital abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5641 | PRPF19 |
Zornitza Stark gene: PRPF19 was added gene: PRPF19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRPF19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRPF19 were set to 37962958 Phenotypes for gene: PRPF19 were set to Neurodevelopmental disorder (MONDO:0700092), PRPF19-related Review for gene: PRPF19 was set to GREEN Added comment: PMID: 37962958 Six unrelated individuals with de novo variants. Five had speech language motor delay, four had formal diagnosis of autism, three hypotonia and one fetus with multiple congenital abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5631 | CRELD1 |
Naomi Baker gene: CRELD1 was added gene: CRELD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CRELD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRELD1 were set to PMID: 37947183 Phenotypes for gene: CRELD1 were set to Neurodevelopmental disorder (MONDO:0700092), CRELD1-related Review for gene: CRELD1 was set to GREEN Added comment: Publication reports 18 individuals from 14 unrelated families affected by biallelic recessive variants in CRELD1, presenting with early-onset neurodevelopmental features, most notably hypotonia and epilepsy, with developmental plateauing and slowly progressive nonneurologic medical complexities in survivors, including cardiac rhythm disturbances and frequent infections. Most individuals have a missense variant in trans with a putative null allele. Four variants were re-current: p.(Cys192Tyr) in 10 families, p.(Gln320Argfs) in 5 families, p.(Ala377Thrfs) in 2 families, and p.(Met369Val) also in 2 families. Some functional studies also reported (Xenopus tropicalis). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5631 | RAB1A |
Chris Ciotta gene: RAB1A was added gene: RAB1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB1A were set to PMID: 37924809 Phenotypes for gene: RAB1A were set to neurodevelopmental disorder MONDO:0700092, CASP2-related Review for gene: RAB1A was set to AMBER Added comment: 4 families and 5 individuals, 2/5 have speech delay and 4/5 have motor delay. Anxiety in 3/5 and autism in 2/5. Microcephaly in only one individual, spastic paraplegia observed in 2 individuals from one family. In 2 families variants were inherited from an affected parent. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5616 | DOT1L |
Zornitza Stark gene: DOT1L was added gene: DOT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DOT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DOT1L were set to 37827158 Phenotypes for gene: DOT1L were set to Neurodevelopmental disorder, MONDO:0700092, DOT1L-related Mode of pathogenicity for gene: DOT1L was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: DOT1L was set to GREEN Added comment: Nine individuals reported with seven de novo missense variants. All had DD/ID and variable patterns of associated congenital anomalies. Variants demonstrated to be GoF and lead to increased H3K79 methylation levels in flies and human cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5606 | VCP |
Manny Jacobs gene: VCP was added gene: VCP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: VCP were set to PMID: 37883978 Phenotypes for gene: VCP were set to Neurodevelopmental disorder (MONDO: 0700092) Review for gene: VCP was set to GREEN Added comment: 13 unrelated individuals with childhood onset ID/DD disorder including macrocephaly, hypotonia and dysmorphic features. Non-specific / mild MRI findings. 12 de novo - 1 inherited Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5603 | AGPAT3 |
Ee Ming Wong changed review comment from: - Single consanguineous family with four individuals with severe intellectual disability and retinitis pigmentosa - All affected individuals were homozygous for a nonsense variant in AGPAT3, healthy unaffected individuals who were tested were heterozygous for the variant - Overexpression of mutant transcript revealed absence of AGPAT3 protein compared to WT transcript via Western blot analysis - KO AGPAT3 mouse demonstrated impaired neuronal migration Sources: Literature; to: - Single consanguineous family with four individuals with severe intellectual disability and retinitis pigmentosa - All affected individuals were homozygous for a nonsense variant in AGPAT3, healthy unaffected individuals who were tested were heterozygous for the variant - Overexpression of mutant transcript revealed absence of AGPAT3 protein compared to WT transcript via Western blot analysis - KO AGPAT3 mouse demonstrated impaired neuronal migration Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5602 | SGSM3 |
Dean Phelan gene: SGSM3 was added gene: SGSM3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SGSM3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SGSM3 were set to PMID: 37833060 Phenotypes for gene: SGSM3 were set to Neurodevelopmental disorder (MONDO:0700092), SGSM3-related Review for gene: SGSM3 was set to GREEN Added comment: PMID: 37833060 - 13 patients from 8 families of Ashkenazi Jewish origin all had the same homozygous frameshift variant (c.981dup). Predicted to cause NMD. The variant co-segregated with disease in all available family members. The affected individuals displayed mild global developmental delay and mild to moderate intellectual disability. Additional prevalent phenotypes observed included hypotonia, behavioural challenges and short stature. Considered a founder variant (1 in 52 Ashkenazi Jews carry the variant). Also present in other populations but no homozygotes in gnomAD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5602 | AGPAT3 |
Ee Ming Wong gene: AGPAT3 was added gene: AGPAT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AGPAT3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AGPAT3 were set to PMID: 37821758 Phenotypes for gene: AGPAT3 were set to Neurodevelopmental disorder (MONDO#0700092), AGPAT3-related Review for gene: AGPAT3 was set to GREEN gene: AGPAT3 was marked as current diagnostic Added comment: - Single consanguineous family with four individuals with severe intellectual disability and retinitis pigmentosa - All affected individuals were homozygous for a nonsense variant in AGPAT3, healthy unaffected individuals who were tested were heterozygous for the variant - Overexpression of mutant transcript revealed absence of AGPAT3 protein compared to WT transcript via Western blot analysis - KO AGPAT3 mouse demonstrated impaired neuronal migration Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5595 | PTPN4 |
Bryony Thompson changed review comment from: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature; to: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines PMID: 34527963 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5514 | MYCN | Naomi Baker commented on gene: MYCN: Three individuals now reported with gain-of-function missense variants (identical variant in two individuals). Clinical presentation includes megalencephaly, hypoplastic corpus callosum, postaxial polydactyly, intellectual disability and motor delay. Knock-in mouse model showed morphological manifestations in multiple tissues including digits, female reproductive system and kidney. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5512 | MAST4 |
Ain Roesley gene: MAST4 was added gene: MAST4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAST4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAST4 were set to 36910266; 33057194 Phenotypes for gene: MAST4 were set to neurodevelopmental disorder MONDO:0700092, MAST4-related Penetrance for gene: MAST4 were set to Complete Review for gene: MAST4 was set to GREEN gene: MAST4 was marked as current diagnostic Added comment: PMID: 36910266 - 4 families with 4 affecteds, all de novo missense 2x borderline microcephaly (-2SD) 2x gross motor delay 2x dysmorphism 4x ID + seizures 3x abnormal brain MRI findings PMID: 33057194 - 5x de novos, 4x missense + 1x PTC Cohort of individuals with severe developmental disorder individual phenotypic information not provided Recurrent variants are Thr1471Ile (3x) and Ser1181Phe) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5509 | ATP2B2 |
Andrew Fennell gene: ATP2B2 was added gene: ATP2B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP2B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP2B2 were set to PMID: 37675773 Phenotypes for gene: ATP2B2 were set to Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related Mode of pathogenicity for gene: ATP2B2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: ATP2B2 was set to GREEN Added comment: 7 unrelated individuals reported with a variable phenotype including dystonia, ataxia, intellectual disability, behavioural symptoms, and seizures. All patients have either missense variants or frameshift variants in the penultimate exon not expected to lead to NMD. This is in contrast to patients with isolated deafness previously reported to have nonsense, frameshift, or splice-site variants outside of this region. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5509 | COG3 |
Daniel Flanagan gene: COG3 was added gene: COG3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: COG3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COG3 were set to PMID: 37711075 Phenotypes for gene: COG3 were set to Neurodevelopmental disorder (MONDO#0700092), COG3-related Review for gene: COG3 was set to AMBER Added comment: Two COG3 homozygous missense variants in four individuals from two unrelated consanguineous families. Clinical phenotypes of affected individuals include global developmental delay, severe intellectual disability, microcephaly, epilepsy, facial dysmorphism, and variable neurological findings. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5390 | COL4A3BP |
Ee Ming Wong changed review comment from: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo. - Several variants transfected into HeLa cells demonstrated gain of CERT activity - CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT; to: - current HGNC symbol: CERT1 - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo. - Several variants transfected into HeLa cells demonstrated gain of CERT activity - CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5390 | COL4A3BP |
Ee Ming Wong changed review comment from: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo. - Several variants transfected into HeLa cells demonstrated gain of CERT activity - CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT; to: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo. - Several variants transfected into HeLa cells demonstrated gain of CERT activity - CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5390 | COL4A3BP |
Ee Ming Wong changed review comment from: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo. - Several variants transfected into HeLa cells demonstrated gain of CERT activity - CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT; to: - Thirty-one unrelated individuals with twenty-two distinct missense variants. The majority of variants were de novo. - Several variants transfected into HeLa cells demonstrated gain of CERT activity - CERT gain of function in Drosophila melanogaster led to head and brain size defects and impaired locomotor activity, which was corrected by pharmacological inhibition of CERT |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5390 | RAB5C |
Rylee Peters changed review comment from: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature; to: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All have mild to severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5387 | RAB5C |
Rylee Peters gene: RAB5C was added gene: RAB5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB5C were set to PMID: 37552066 Phenotypes for gene: RAB5C were set to Neurodevelopmental disorder MONDO:0700092, RAB5C-related Penetrance for gene: RAB5C were set to Complete Review for gene: RAB5C was set to GREEN gene: RAB5C was marked as current diagnostic Added comment: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5387 | AXIN1 |
Elena Savva gene: AXIN1 was added gene: AXIN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AXIN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AXIN1 were set to PMID: 37582359 Phenotypes for gene: AXIN1 were set to Syndromic disease, (MONDO:0002254), AXIN1-related Review for gene: AXIN1 was set to GREEN Added comment: PMID: 37582359 - four families (7 individuals) with three homozygous truncating variants. - all variant shown to result in reduced protein, though 1/3 would be NMD predicted - Probands had macrocephaly (4/6), GDD (3/7), hip dysplasia (5/6), cardiac anomalies eg. VSD/ASD (3/7), cranial hyperostosis and vertebral endplate sclerosis Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5385 | PPP1R3F |
Andrew Fennell gene: PPP1R3F was added gene: PPP1R3F was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP1R3F was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: PPP1R3F were set to 37531237 Phenotypes for gene: PPP1R3F were set to Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related Review for gene: PPP1R3F was set to GREEN Added comment: 13 unrelated hemizygous individuals reported with functional evidence Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5377 | HIKESHI |
Zornitza Stark gene: HIKESHI was added gene: HIKESHI was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: HIKESHI was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HIKESHI were set to 34111619; 26545878 Phenotypes for gene: HIKESHI were set to Leukodystrophy, hypomyelinating, 13, MIM# 616881 Review for gene: HIKESHI was set to GREEN Added comment: Over 10 individuals reported with recurrent homozygous c.160G>C;p.(Val54Leu) variant, high carrier frequency in the Ashkenazi Jewish population. Optic atrophy reported in several. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5333 | HNRNPC |
Zornitza Stark gene: HNRNPC was added gene: HNRNPC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HNRNPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HNRNPC were set to 37541189 Phenotypes for gene: HNRNPC were set to Neurodevelopmental disorder (MONDO:0700092), HNRNPC-related Review for gene: HNRNPC was set to GREEN Added comment: 13 individuals with global developmental delay, intellectual disability, behavioral abnormalities, and subtle facial dysmorphology with heterozygous HNRNPC germline variants. Five had an identical in-frame deletion of nine amino acids in the extreme C terminus. Supportive functional data; haploinsufficiency is the mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5313 | SLC4A10 |
Krithika Murali gene: SLC4A10 was added gene: SLC4A10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC4A10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC4A10 were set to PMID: 37459438 Phenotypes for gene: SLC4A10 were set to Neurodevelopmental disorderMONDO:0700092, SLC4A10-related Review for gene: SLC4A10 was set to GREEN Added comment: PMID: 37459438 Fasham et al 2023 (Brain) report 10 affected individuals from 5 unrelated families with biallelic LoF variants in this gene with a novel neurodevelopmental disorder. Phenotypic features include hypotonia in infancy, delayed psychomotor development, typically severe ID, progressive postnatal microcephaly, ASD traits, corpus callosal abnormalities and 'slit-like' lateral ventricles. These phenotypic features were recapitulated in knockout mice with additional supportive functional studies. Isolated seizures was reported in 2/10 cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5312 | SLC4A10 |
Krithika Murali gene: SLC4A10 was added gene: SLC4A10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC4A10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC4A10 were set to PMID: 37459438 Phenotypes for gene: SLC4A10 were set to Neurodevelopmental disorderMONDO:0700092, SLC4A10-related Review for gene: SLC4A10 was set to GREEN Added comment: PMID: 37459438 Fasham et al 2023 (Brain) report 10 affected individuals from 5 unrelated families with biallelic LoF variants in this gene with a novel neurodevelopmental disorder. Phenotypic features include hypotonia in infancy, delayed psychomotor development, typically severe ID, progressive postnatal microcephaly, ASD traits, corpus callosal abnormalities and 'slit-like' lateral ventricles. These phenotypic features were recapitulated in knockout mice with additional supportive functional studies. Isolated seizures was reported in 2/10 cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5308 | TMEM63B |
Zornitza Stark gene: TMEM63B was added gene: TMEM63B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM63B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TMEM63B were set to 37421948 Phenotypes for gene: TMEM63B were set to developmental and epileptic encephalopathy, MONDO:0100062, TMEM63B-related Review for gene: TMEM63B was set to GREEN Added comment: 17 unrelated individuals with severe early-onset developmental and epileptic encephalopathy (DEE), intellectual disability, and severe motor and cortical visual impairment were identified with ten distinct heterozygous variants inTMEM63B. The variants occurred de novo in 16/17 individuals for whom parental DNA was available and either missense or in-frame. All individuals had global developmental delay, with moderate-to-profound intellectual disability and severe motor impairment. All individuals had early-onset drug-resistant epilepsy, whose onset ranged from birth to 3 years but occurred within the first year in 14/17 (82%) and in the first month of life in 6/17 (35%). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5306 | DHX9 |
Zornitza Stark gene: DHX9 was added gene: DHX9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DHX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DHX9 were set to 37467750 Phenotypes for gene: DHX9 were set to Neurodevelopmental disorder, MONDO:0700092, DHX9-related Review for gene: DHX9 was set to GREEN Added comment: PMID:37467750 - 17 unrelated individuals were identified with de novo, ultra-rare, heterozygous missense or loss-of-function DHX9 variants, of which 14 individuals were reported with a neurodevelopmental disorder (NDD) and three were reported with Charcot-Marie-Tooth disease (CMT). All 14 cases with NDD had developmental delay, of which eight were reported with intellectual disability (4 severe, 1 moderate, 3 mild). Two cases did not have ID, one had borderline ID and three cases were too young (0-5 years old). The three cases with CMT presented with adult-onset axonal neuropathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5298 | TEFM |
Zornitza Stark gene: TEFM was added gene: TEFM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TEFM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TEFM were set to 36823193 Phenotypes for gene: TEFM were set to Combined oxidative phosphorylation deficiency 58, MIM# 620451 Review for gene: TEFM was set to GREEN Added comment: Seven individuals from 5 families reported. Presentation predominantly with encephalopathy, seizures and ID, in addition to lactic acidosis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5282 | WBP4 |
chirag patel gene: WBP4 was added gene: WBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: WBP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WBP4 were set to Neurodevelopmental disorder Review for gene: WBP4 was set to GREEN gene: WBP4 was marked as current diagnostic Added comment: ESHG 2023: 11 individuals from 8 families with homozygous LOF variants in WBP4 gene (4 different variants). Presentation of severe DD and ID, hypotonia, abnormal outer ears, and varying congenital anomalies. WBP4 is spliceosome protein which binds/interacts with SNRNP200. In vivo and in vitro studies previously showed WBP4 enhances splicing and regulates alternative splicing. Patient fibroblasts showed loss of expression of WBP4. RNA sequencing analysis showed abnormal splicing patterns. Proposed spliceosomopathy. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5275 | INTS13 |
chirag patel gene: INTS13 was added gene: INTS13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: INTS13 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: INTS13 were set to PMID: 36229431 Phenotypes for gene: INTS13 were set to Oral-facial-digital syndrome Review for gene: INTS13 was set to GREEN Added comment: 2 families with 4 affected individuals with Oral-facial-digital (OFD) phenotype. Homozygosity mapping and WES found 2 homozygous variants in INTS13 gene. This is a subunit of the Integrator complex, which associates with RNA Polymerase II and cleaves nascent RNA to modulate gene expression. Variants segregated with disease. Depletion of INTS13 disrupts ciliogenesis in human cultured cells and causes dysregulation of a broad collection of ciliary genes. Knockdown in Xenopus embryos leads to motile cilia anomalies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5273 | DCAF15 |
chirag patel gene: DCAF15 was added gene: DCAF15 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: DCAF15 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DCAF15 were set to Cornelia de Lange syndrome Review for gene: DCAF15 was set to AMBER Added comment: ESHG 2023: 3 unrelated cases with CdLS (1 x TOP with MCA, 1 x death @20mths, 1 x living child) Features suggestive of CdLS - DD, microcephaly, CHD, dysmorphism, visual/hearing impairment. WES identified recurrent de novo variant (p.Ser470Phe) in DCAF15 gene. This mediates ubiquitination and degradation of target proteins, and interacts with cohesin complex members (SMC1/SMC3). Protein analysis from individuals showed increased accumulation of ubiquitination-modified proteins and SM3 (GOF mechanism). EpiSign analysis showed same DNA methylation pattern as other CdLS cases/genes. Zebrafish model showed reduced body length, reduced head size, reduced oligodendrocytes, heart defect, aberrant motor neurons, and abnormal response to visual/auditory stimuli. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5271 | CYHR1 |
chirag patel gene: CYHR1 was added gene: CYHR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CYHR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYHR1 were set to Neurodevelopmental disorder and microcephaly Review for gene: CYHR1 was set to AMBER gene: CYHR1 was marked as current diagnostic Added comment: ESHG 2023: 5 individuals from 3 families with biallelic LOF variants in CYHR1 (aka ZTRAF1). Presentation with microcephaly, hypotonia, DD, and ID. Expression studies showed mislocalisation of CYHR1. Mutant fibroblasts showed increased lysosomal markers and upregulated lysosomal proteins, leading to impaired autophagy. Zebrafish KO however did not show a phenotype. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5270 | GPATCH11 |
chirag patel gene: GPATCH11 was added gene: GPATCH11 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: GPATCH11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPATCH11 were set to Leber congenital amaurosis and developmental delay Review for gene: GPATCH11 was set to GREEN gene: GPATCH11 was marked as current diagnostic Added comment: ESHG 2023: 3 families with 8 individuals with leber congenital amaurosis, developmental delay, language disorder, and behavioural issues. GPATCH11 localises to nucleus and basal body of primary cilium (similar to other LCA genes). Biallelic variants found in GPATCH11 - 1 splice variant common to all 3 families (1 other variant in 3rd family). Splice variant leads to loss of exon 4 (mRNA studies). Mouse models showed i) abnormal rod/cone responses on ERG; ii) decreased outer nuclear layer in retina, and iii) abnormal associate/episodic memory Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5267 | KCNA3 |
chirag patel gene: KCNA3 was added gene: KCNA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: KCNA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNA3 were set to Neurodevelopmental disorder Review for gene: KCNA3 was set to GREEN gene: KCNA3 was marked as current diagnostic Added comment: ESHG 2023: 10 individuals with de novo missense variants in KCNA3 (K+ channel) Variable electrophysiology studies of effect of variants (5 x LOF, 4 x GOF, 1 no change) Presentation: abnormal speech development (8/8), ID (6/8), epilepsy (5/8), and ASD (7/8) Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5258 | HCN2 |
Elena Savva gene: HCN2 was added gene: HCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: HCN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: HCN2 were set to Febrile seizures, familial, 2 MIM#602477; Generalized epilepsy with febrile seizures plus, type 11 MIM#602477; {Epilepsy, idiopathic generalized, susceptibility to, 17} MIM#602477; Neurodevelopmental disorder (MONDO#0700092), HCN2-related Review for gene: HCN2 was set to AMBER Added comment: ICG 2023 conference - cohort of 20 individuals where >80% had a form of intellectual disability (half were severe) and/or seizures. Some had isolated intellectual disability, especially those with a recurring de novo p.E478del. - Patients were both mono- and biallelic. - Monoallelic individuals had de novo missense and an inframe deletion. Biallelic individuals had a mix of missense and PTC Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5252 | SART3 |
Daniel Flanagan gene: SART3 was added gene: SART3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: SART3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SART3 were set to PMID: 37296101 Phenotypes for gene: SART3 were set to Neurodevelopmental disorder (MONDO#0700092), SART3-related, with 46,XY gonadal dysgenesis Review for gene: SART3 was set to GREEN Added comment: Nine individuals from six families presenting with intellectual disability, global developmental delay, a subset of brain anomalies, together with gonadal dysgenesis in 46,XY individuals. Additionally, two individuals had seizures and two had epileptiform activity reported on EEG. Human induced pluripotent stem cells carrying patient variants in SART3 show disruption to multiple signalling pathways, upregulation of spliceosome components and demonstrate aberrant gonadal and neuronal differentiation in vitro. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5251 | ERI1 |
Elena Savva gene: ERI1 was added gene: ERI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ERI1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERI1 were set to 37352860 Phenotypes for gene: ERI1 were set to Intellectual disability (MONDO#0001071), ERI1-related Review for gene: ERI1 was set to GREEN Added comment: PMID: 37352860 - 8 individuals from 7 unrelated families - Patients with biallelic missense show a MORE severe spondyloepimetaphyseal dysplasia, syndactyly, brachydactyly/clinodactyly/camptodactyly - Patients with biallelic null/whole gene deletion had mild ID and digit anomalies including brachydactyly/clinodactyly/camptodactyly - Patient chet for a missense and PTC variant has a blended phenotype with short stature, syndactyly, brachydactyly/clinodactyly/camptodactyly, mild ID and failure to thrive - Missense variants were functionally shown to not be able to rescue 5.8S rRNA processing in KO HeLa cells - K/O mice had neonatal lethality with growth defects, brachydactyly. Skeletal-specific K/O had mild platyspondyly, had more in keeping with patients with null variants than missense More severe phenotype hypothesised due to "exonuclease-dead proteins may compete for the target RNA molecules with other exonucleases that have functional redundancy with ERI1, staying bound to those RNA molecules" Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5250 | DRG1 |
Dean Phelan gene: DRG1 was added gene: DRG1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DRG1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DRG1 were set to PMID: 37179472 Phenotypes for gene: DRG1 were set to Neurodevelopmental disorder (MONDO:0700092), DRG1-related Review for gene: DRG1 was set to GREEN Added comment: PMID: 37179472 - Biallelic variants were identified in four affected individuals from three distinct families with neurodevelopmental disorder with global developmental delay, primary microcephaly, short stature and craniofacial anomalies. Functional studies show the variants result in a loss of function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5244 | RHOBTB2 |
Zornitza Stark edited their review of gene: RHOBTB2: Added comment: PMID 37165955: 16 individuals with de novo heterozygous missense variants in the BTB domain region and a severe DEE as previously reported. In addition, 6 individuals with de novo missense variants in the GTPase domain and a more variable neurodevelopmental phenotypes with or without epilepsy. In contrast to variants in the BTB domain region, variants in the GTPase domain do not impair proteasomal degradation of RHOBTB2 in vitro, indicating different functional consequences. In addition, 9 families with observed bi-allelic splice-site and truncating variants with variable neurodevelopmental phenotypes, indicating that complete loss of RHOBTB2 is pathogenic as well.; Changed publications: 29768694, 29276004, 37165955; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5239 | UNC79 |
Krithika Murali gene: UNC79 was added gene: UNC79 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UNC79 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UNC79 were set to PMID:37183800 Phenotypes for gene: UNC79 were set to Complex neurodevelopmental disorder - MONDO:0100038 Review for gene: UNC79 was set to AMBER Added comment: PMID:37183800 Bayat et al 2023 report 6 unrelated patients with heterozygous NMD-predicted LoF variants in UNC79 - x1 canonical splice site variant, x5 nonsense/frameshift. 5 were confirmed de novo, 1 not identified in mother - father unavailable for testing. All variants absent in gnomAD and v2 pLI score for UNC79 is 1. Patients with UNC79 variants were identified through GeneMatcher or an international network of Epilepsy and Genetics departments. x1 patient underwent duo exome sequencing, remaining had trio exome sequencing - no other causative variants identified. Phenotypic features included: - 4/6 autistic features - 5/6 patients mild-moderate ID - 4/6 behavioural issues (aggression, stereotypies) - 4/6 epilepsy (focal to bilateral tonic-clonic seizures) - 5/6 hypotonia unc79 knockdown drosophila flies exhibited significantly higher rate of seizure-like behaviour than controls. unc79 haploinsufficiency shown to lead to significant reduction in protein levels of both unc79 and unc80 in mouse brains. Unc79 haploinsufficiency associated with deficiency in hippocampal-dependent learning and memory in mice. Authors have reviewed their own evidence in relation to the gene-disease criteria detailed by Strande et al 2017 and note that their clinical and experimental data provides moderate-level evidence supporting the association between UNC79 and a neurodevelopment disorder including ASD. Amber association favoured due to clinical phenotypic range reported between affected individuals and their lack of specificity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5234 | ACBD6 |
Lucy Spencer gene: ACBD6 was added gene: ACBD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ACBD6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ACBD6 were set to 36457943; 21937992; 35446914 Phenotypes for gene: ACBD6 were set to Neurodevelopmental disorder (MONDO#0700092), ACBD6-related Review for gene: ACBD6 was set to GREEN Added comment: PMID: 36457943 2 siblings with a neurodevelopmental disorder: severely delayed development, obesity, pancytopenia, diabetes, liver cirrhosis, intravertebral disc herniation, mild brain atrophy. Consanguineous family both siblings found to have a homozygous frameshift. This paper also mentioned 3 other reported variants in 6 individuals (only 3 unrelated) all homozygous, 2 frameshift, 1 canonical splice. All reported to have a neurodevelopmental disorder, some with limited information but one family also has obesity, spasticity, and dysmorphism. PMIDs: 21937992, 35446914 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5234 | POU3F2 |
Sarah Pantaleo gene: POU3F2 was added gene: POU3F2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POU3F2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: POU3F2 were set to PMID: 37207645 Phenotypes for gene: POU3F2 were set to Autism spectrum disorder, NDD, and adolescent-onset obesity Penetrance for gene: POU3F2 were set to unknown Mode of pathogenicity for gene: POU3F2 was set to Other Review for gene: POU3F2 was set to GREEN Added comment: We associate ultra-rare variants in POU3F2, encoding a central nervous system transcription factor, with syndromic obesity and neurodevelopment delay in 12 individuals. Demonstrate variant pathogenicity through in vitro analysis. Used exome sequencing, GeneMatcher and Genomics England 100,000 Genomes Project rare disease database. Both truncating and missense variants in over 10 individuals sharing autism spectrum disorder, NDD, and adolescent-onset obesity (may have had other features eg. CAKUT in 2 individuals, diabetes in two) . Affected individuals presented with low-to-normal birth weight and infantile feeding difficulties but developed insulin resistance and hyperplasia during childhood. With the exception of an early truncating variant, the variants showed adequate nuclear translocation but overall disturbed DNA-binding ability and promoter activation. Variants absent from population and clinical databases. Almost all constituted putatively non-inherited de novo variants (8/10). Functional studies provide evidence for loss of function in eight and gain of function in one obesity-associated POU3F2 variant. One variant did not impact POU3F2-promoter activation, leaving the possibility for further path-mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5230 | MAP4K4 | Zornitza Stark commented on gene: MAP4K4: 26 individuals from 21 families reported with Rasopathy-like phenotype, comprising ID/DD, dysmorphic features and congenital anomalies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5230 | MCM6 |
Suliman Khan gene: MCM6 was added gene: MCM6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MCM6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MCM6 were set to PMID: 37198333 Phenotypes for gene: MCM6 were set to Neurodevelopmental disorder, MONDO:0700092, MCM6-related Review for gene: MCM6 was set to GREEN Added comment: PMID: 37198333 reported 5 unrelated families with de novo variants in MCM6 gene. Two patients with the same missense variant p.(Cys158Tyr) in zinc finger domain presented with intra-uterine growth retardation, short stature, congenital microcephaly, endocrine features, developmental delay and urogenital anomalies. In other three unrelated individuals different de novo missense variants were identified in the oligo nucleotide binding (OB)-fold domain. These patients had variable neurodevelopmental features including autism spectrum disorder, developmental delay, and epilepsy. The clinical features and functional defects related to the zinc binding residue resembled those observed in syndromes related to other MCM components and DNA replication factors (Meier–Gorlin syndrome and Seckel syndrome), while de novo OB-fold domain missense variants were associated with more variable neurodevelopmental phenotypes (PMID: 37198333). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5219 | CNOT9 |
Karina Sandoval gene: CNOT9 was added gene: CNOT9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CNOT9 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: CNOT9 were set to PMID: 37092538 Phenotypes for gene: CNOT9 were set to neurodevelopmental disorder, MONDO:0700092 Review for gene: CNOT9 was set to GREEN Added comment: 7 individuals with de novo variants. In silico predictions of functional relevance. All affected persons have DD/ID, with five of them showing seizures. Other symptoms include. Symptoms: Neuro dev disorder. ID, Epilepsy. All affected persons have DD/ID, with five of them showing seizures. Other symptoms include muscular hypotonia, facial dysmorphism, and behavioral abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5219 | CBX1 |
Daniel Flanagan gene: CBX1 was added gene: CBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CBX1 were set to PMID: 37087635 Phenotypes for gene: CBX1 were set to Neurodevelopmental disorder (MONDO#0700092), CBX1-related Review for gene: CBX1 was set to GREEN Added comment: Three different de novo missense variants identified in three unrelated individuals with developmental delay, hypotonia, autistic features, and variable dysmorphic features such as broad forehead and head circumference above average. Mutant mice displayed increased latency-to-peak response, suggesting the possibility of synaptic delay or myelination deficits. Functional studies confirmed the reduction of mutant HP1β binding to heterochromatin. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5216 | INTS11 |
Melanie Marty gene: INTS11 was added gene: INTS11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: INTS11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: INTS11 were set to PMID: 37054711 Phenotypes for gene: INTS11 were set to Global developmental delay; launguage delay; intellectual disability; impaired motor development; brain atrophy Review for gene: INTS11 was set to GREEN Added comment: PMID: 37054711 - 15 individuals from 10 unrelated families with bi-allelic variants in INTS11 with global developmental and language delay, intellectual disability, impaired motor development, and brain atrophy. Functional studies in Drosophila showed that dIntS11 (fly ortholog of INTS11) is essential and expressed in the central nervous systems in a subset of neurons and most glia in larval and adult stages. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5216 | SRSF1 |
Paul De Fazio gene: SRSF1 was added gene: SRSF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRSF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SRSF1 were set to 37071997 Phenotypes for gene: SRSF1 were set to Neurodevelopmental disorder, SRSF1-related MONDO:0700092 Review for gene: SRSF1 was set to GREEN gene: SRSF1 was marked as current diagnostic Added comment: 17 individuals from 16 families reported with mostly de novo variants. Variants were a mixture of missense, nonsense/frameshift (both NMD-predicted and not NMD-predicted) and microdeletions. In one family, only one parent was available for testing. In another family, 2 affected siblings had the variant but the variant was not identified in either parent suggesting germline mosaicism. Functional testing of a subset of variants in Drosophila supported pathogenicity in most, but 2 missense variants showed no functional effect and were classified VUS. Episignature analysis (EpiSign) on patient DNA from blood showed a specific DNA methylation signature in patients with the variants classified pathogenic but not those classified VUS. Phenotypes included mainly neurological abnormalities (mild to moderate ID/dev delay, motor delay, speech delay, and behavioural disorders) and facial dysmorphisms. Other features included hypotonia (11/16), variable brain abnormalities on MRI (6/12), variable cardiac malformations (6/14). urogenital malformations e.g. hypospadias, cryptorchidism (6/13), scoliosis (5/17) and/or variable other skeletal abnormalities (10/17). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5214 | GATAD2A |
Bryony Thompson gene: GATAD2A was added gene: GATAD2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GATAD2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GATAD2A were set to https://doi.org/10.1016/j.xhgg.2023.100198; 17565372 Phenotypes for gene: GATAD2A were set to Neurodevelopmental disorder, MONDO:0700092, GATAD2A-related Review for gene: GATAD2A was set to GREEN Added comment: https://doi.org/10.1016/j.xhgg.2023.100198 - Five unrelated individuals with a neurodevelopmental disorder identified with 3 missense & 2 LoF (4 de novo & 1 unknown inheritance). The shared clinical features with variable expressivity include global developmental delay (4/4), craniofacial dysmorphism (3/5), structural brain defects (2/3), musculoskeletal anomalies (3/5), vision/hearing defects (2/3), gastrointestinal/renal defects (2/3). Loss of function is the expected mechanism of disease. In vitro assays of one of the missense variants (p.Cys420Tyr) demonstrates disruption of GATAD2A integration with CHD3, CHD4, and CHD5 PMID: 17565372 - null mouse model is embryonic lethal. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5198 | CRIPT |
Karina Sandoval commented on gene: CRIPT: PMID: 37013901 identified 6 individuals with Rothmund-Thomson syndrome characterised by poikiloderma, sparse hair, small stature, skeletal defects, cancer, cataracts, resembling features of premature aging. Two new variants identified and 4 were already published. 5 were hom, 1 was chet, all with different variants. All CRIPT individuals fulfilled the diagnostic criteria for RTS, and additionally had neurodevelopmental delay and seizures. CRIPT-deficient fibroblasts showed an unremarkable mitotic progression and unremarkable number of mitotic errors, c.132del p.(Ala45Glyfs*82), hom c.227G>A, p.(Cys76Tyr), hom c.133_134insGG,p.(Ala45Glyfs*82),hom c.141del p.(Phe47Leufs*84), hom c.8G>A p.(Cys3Tyr), 1,331 bp del exon 1, chet c.7_8del; p.(Cys3Argfs*4), hom |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5196 | SNAPC4 |
Ee Ming Wong changed review comment from: - Ten individuals from eight families with neurodevelopmental disorder found to be compound heterozygous for variants in SNAPC4 - Identified variants included 6x missense, 1x nonsense, 1x frameshift and 6x splice - Depletion of SNAPC4 levels in HeLa cell lines via genomic editing led to decreased snRNA expression and global dysregulation of alternative splicing, similarly observed in patient fibroblasts Sources: Literature; to: - Ten individuals from eight families with neurodevelopmental disorder found to be biallelic for variants in SNAPC4 - Identified variants included 6x missense, 1x nonsense, 1x frameshift and 6x splice - Depletion of SNAPC4 levels in HeLa cell lines via genomic editing led to decreased snRNA expression and global dysregulation of alternative splicing, similarly observed in patient fibroblasts Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5195 | SNAPC4 |
Ee Ming Wong gene: SNAPC4 was added gene: SNAPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNAPC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNAPC4 were set to 36965478 Phenotypes for gene: SNAPC4 were set to Neurodevelopmental disorder (MONDO#0700092), SNAPC4-related Review for gene: SNAPC4 was set to GREEN gene: SNAPC4 was marked as current diagnostic Added comment: - Ten individuals from eight families with neurodevelopmental disorder found to be compound heterozygous for variants in SNAPC4 - Identified variants included 6x missense, 1x nonsense, 1x frameshift and 6x splice - Depletion of SNAPC4 levels in HeLa cell lines via genomic editing led to decreased snRNA expression and global dysregulation of alternative splicing, similarly observed in patient fibroblasts Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5195 | ESAM |
Chern Lim gene: ESAM was added gene: ESAM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ESAM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ESAM were set to 36996813 Phenotypes for gene: ESAM were set to Neurodevelopmental disorder (MONDO#0700092), ESAM-related Review for gene: ESAM was set to GREEN gene: ESAM was marked as current diagnostic Added comment: PMID 36996813: - Thirteen affected individuals, including four fetuses, from eight unrelated families, with homozygous loss-of-function-type variants in ESAM – 2 of the variants are frameshifts, 1x nonsense, 1x canonical splice. - Affected individuals have profound global developmental delay/unspecified intellectual disability, epilepsy, absent or severely delayed speech, varying degrees of spasticity, ventriculomegaly, and ICH/cerebral calcifications, the latter being also observed in the fetuses. - One of the frameshift variant c.115del (p.Arg39Glyfs*33), was detected in six individuals from four unrelated families from the same geographic region in Turkey (southeastern Anatolia), suggesting a founder effect. - The c.451+1G>A variant was detected in three individuals from two independent families with the same ethnic origin (Arab Bedouin) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5183 | RRAS2 |
Elena Savva gene: RRAS2 was added gene: RRAS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RRAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: RRAS2 were set to PMID: 31130282; 31130285 Phenotypes for gene: RRAS2 were set to Noonan syndrome 12 MIM#618624 Mode of pathogenicity for gene: RRAS2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: RRAS2 was set to AMBER Added comment: Gene has an established GOF mechanism PMID: 31130282 - 3/9 individuals had mild learning difficulties or mild GDD PMID: 31130285 - 1/3 individuals had mild ID, 1/3 had severe ID, 1/3 normal Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5181 | AMOTL1 |
Lucy Spencer gene: AMOTL1 was added gene: AMOTL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AMOTL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AMOTL1 were set to 36751037 Phenotypes for gene: AMOTL1 were set to Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related Review for gene: AMOTL1 was set to GREEN Added comment: PMID: 36751037- 16 individuals from 12 families with orofacial clefting syndrome and het variants in AMOTL1. Many in 1 hotspot: 5 individuals from 3 families have R157C, 6 individuals from another 4 families have R157H, 1 has P160L, and another has Q161R. Out of this hostpaot- 1 with P368A, 1 with E507K, 1 with E579K. 7 are de novo. All but 2 have clefting, 7 are dysmorphic, 5 have hearing loss, 9 have CHD, 7 have tall stature, 6 have dev delay. Other features include liver disease, myopia, scoliosis and immune involvement. Another 2 families have been previously reported (described in the panelapp review in mendeliome) with variants in this hotspot 1 has 2 individuals with R157C, the other has 1 individual with P160L. All hotspot are absent from gnomad v2. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5180 | SLC35B2 |
Zornitza Stark gene: SLC35B2 was added gene: SLC35B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC35B2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC35B2 were set to 35325049 Phenotypes for gene: SLC35B2 were set to Leukodystrophy, hypomyelinating, 26, with chondrodysplasia, MIM# 620269 Review for gene: SLC35B2 was set to AMBER Added comment: 2 x individuals with homozygous variants (c.1218_1220del and c.1224_1225del) in SLC35B2. Phenotypes included pre- and postnatal growth retardation, scoliosis, severe motor and intellectual disabilities and hypomyelinating leukodystrophy. Functional analysis on patient cells showed that the variants result in a decreased expression of mRNA and affect protein subcellular localization leading to functional impairment of the protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5177 | ATG4D |
Suliman Khan gene: ATG4D was added gene: ATG4D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATG4D was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATG4D were set to PMID: 36765070 Phenotypes for gene: ATG4D were set to neurodevelopmental disorder; Abnormal facial shape Penetrance for gene: ATG4D were set to unknown Review for gene: ATG4D was set to GREEN Added comment: PMID: 36765070 reported three individuals from two unrelated families with a neurodevelopmental disorder characterized by speech and motor impairment with a similar facial gestalt comprising almond-shaped eyes, depressed nasal bridge, and a prominent Cupid’s bow with variable disease severity and progression. NGS analysis revealed bi-allelic loss-of-function variants in ATG4D gene. Based on the clinical, bioinformatic, and functional data, the author concluded that bi-allelic loss-of-function variants in ATG4D contribute to the pathogenesis of syndromic neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5160 | FICD |
Elena Savva gene: FICD was added gene: FICD was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FICD was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FICD were set to 36704923 Phenotypes for gene: FICD were set to Neurodevelopmental disorder, FICD-related (MONDO#0700092) Review for gene: FICD was set to AMBER Added comment: PMID: 36704923: - five individuals (3 families) w/ infancy onset diabetes mellitus (5/5) and severe neurodevelopmental delay (4/5) - all homozygous for p.R371S - variant expression in E. coli showed loss of affinity, deregulates BiP-AMP and affects secretion Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5159 | OGDH |
Zornitza Stark gene: OGDH was added gene: OGDH was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: OGDH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OGDH were set to 36520152; 32383294 Phenotypes for gene: OGDH were set to Oxoglutarate dehydrogenase deficiency, MIM# 203740 Review for gene: OGDH was set to GREEN Added comment: 6 individuals reported with bi-allelic variants in this gene and DD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5158 | CCDC84 |
Lucy Spencer gene: CCDC84 was added gene: CCDC84 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC84 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC84 were set to 34009673 Phenotypes for gene: CCDC84 were set to Mosaic variegated aneuploidy syndrome 4 (MIM#620153) Review for gene: CCDC84 was set to AMBER Added comment: PMID: 34009673- patients with constitutional mosaic aneuploidy were found to have biallelic mutations in CENATAC(CCDC84). 2 adult siblings with mosaic aneuploidies, microcephaly, dev delay, and maculopathy. Both chet for a missense and a splice site deletion- but the paper days these both result in the creation of a novel splice site that leads to frameshifts and loss of the c-terminal 64 amino acids. Gene is shown to be part of a spliceosome. CENATAC depletion or expression of disease mutants resulted in retention of introns in ~100 genes enriched for nucleocytoplasmic transport and cell cycle regulation, and caused chromosome segregation errors. Functional analysis in CENATAC-depleted HeLa cells demonstrated chromosome congression defects and subsequent mitotic arrest, which could be fully rescued by wildtype but not mutant CENATAC. Expression of the MVA-associated mutants exacerbated the phenotype, suggesting that the mutant proteins dominantly repress the function of any residual wildtype protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5154 | FGF13 | Zornitza Stark edited their review of gene: FGF13: Added comment: PMID 34184986: 3 individuals reported with moderate to severe ID and maternally inherited 5' variant c.-32C-G; Changed publications: 33245860, 34184986; Changed phenotypes: Developmental and epileptic encephalopathy 90, MIM# 301058, Intellectual developmental disorder, X-linked 110, MIM# 301095 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5150 | NAE1 |
Zornitza Stark gene: NAE1 was added gene: NAE1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAE1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAE1 were set to 36608681 Phenotypes for gene: NAE1 were set to Neurodevelopmental disorder, MONDO:0700092, NAE1-related Review for gene: NAE1 was set to GREEN Added comment: Four individuals reported with bi-allelic variants and intellectual disability, ischiopubic hypoplasia, stress-mediated lymphopenia and neurodegeneration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5148 | TRPC5 |
Zornitza Stark gene: TRPC5 was added gene: TRPC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRPC5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890 Phenotypes for gene: TRPC5 were set to Neurodevelopmental disorder, MONDO:0700092, TRPC5-related Review for gene: TRPC5 was set to AMBER Added comment: PMID: 36323681; Leitão E. et al. (2022) Nat Commun.13(1):6570: Missense variant NM_012471.2:c.523C>T, p.(Arg175Cys in three brothers with intellectual disability (ID) and autistic spectrum disorder (ASD), inherited from an asymptomatic mother and absent in the maternal grandparents. Whole cell patch clamp studies of HEK293 created by site-directed mutagenesis showed increased current of this calcium channel (constitutively opened). (This variant is absent in gnomAD v2.1.1). Also, the nonsense variant, c.965G> A, p.(Trp322*) was found in a high functioning ASD male (maternally inherited), NMD-predicted. Other papers and TRPC5 variants that were cited to associate this gene with X-linked ID and/or ASD include: PMID: 24817631; Mignon-Ravix, C. et al. (2014) Am. J.Med. Genet. A 164A: 1991–1997: A hemizygous 47-kb deletion in Xq23 including exon 1 of the TRPC5 gene. He had macrocephaly, delayed psychomotor development, speech delay, behavioural problems, and autistic features. Maternally inherited, and a family history compatible with X-linked inheritance (i.e., maternal great uncle was also affected, although not tested). In addition, PMID: 36323681; Leitão E. et al. (2022) cites papers with the variants p.(Pro667Thr), p.(Arg71Gln) and p.(Trp225*). NB. p.(Pro667Thr) is absent in gnomAD (v2.1.1), p.(Arg71Gln) is also absent (the alternative variant p.(Arg71Trp) is present once as heterozygous only). p.(Trp225*) is absent, and it should be noted that PTCs / LoF variants are very rare (pLI = 1). However, looking further into the three references, the evidence is not as clear or as accurate as was stated. The missense variant c.1999C>A, p.(Pro667Thr), was stated as de novo, but was actually maternally inherited but was still considered a candidate for severe intellectual disability (shown in the Appendix, Patient 93, with severe speech delay, autism spectrum disorder and Gilles de la Tourette). This patient also has a de novo MTF1 variant. Reference: PMID: 23033978; de Ligt, J. et al. (2012) N. Engl. J. Med. 367: 1921–1929). Missense variant (de novo): c.212G>A, p.(Arg71Gln), was found as part of the Deciphering Developmental Disorders (DDD) study and is shown in individual 164 in Supplementary Table 2 of PMID: 33504798; Martin, HC. et al. (2021) Nat. Commun.12: 627. Also displayed in DECIPHER (DDD research variant) with several phenotype traits, but ID and ASD are not specifically mentioned. Nonsense variant: c.674G>A. p.(Trp225*) was stated as de novo but was inherited (reference PMID: 28191890; Kosmicki, JA. et al. (2017) Nat. Genet. 49: 504–510. Supplement Table 7). This was a study of severe intellectual delay, developmental delay / autism. (NB. The de novo p.(Arg71Gln) variant from the DDD study is also listed (subject DDD 342 in Supplement 4 / Table 2). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5134 | EIF4A2 |
Dean Phelan gene: EIF4A2 was added gene: EIF4A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF4A2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: EIF4A2 were set to PMID: 36528028 Phenotypes for gene: EIF4A2 were set to Neurodevelopmental disorder (MONDO:0700092), EIF4A2-related Mode of pathogenicity for gene: EIF4A2 was set to Other Review for gene: EIF4A2 was set to GREEN Added comment: PMID: 36528028 - EIF4A2 variants were observed in 15 individuals from 14 families. Affected individuals had a range of symptoms including global developmental delay (9/15), ID (7/15), epilepsy (11/15) and structural brain alterations (10/15). Monoallelic and biallelic variants were reported and functional studies showed both LOF and GOF disease mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5134 | TRA2B |
Elena Savva gene: TRA2B was added gene: TRA2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRA2B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TRA2B were set to PMID: 36549593 Phenotypes for gene: TRA2B were set to Neurodevelopmental disorder, TRA2B-related (MONDO#0700092) Review for gene: TRA2B was set to GREEN Added comment: PMID: 36549593 - 12 individuals with ID and dev delay. Additional features include infantile spams 6/12, hypotonia 12/12, dilated brain ventricles 6/12, microcephaly 5/12 - All variants result in the loss of 1/2 transcripts (start-losses or PTCs upstream of a second translation start position). Shorter transcript expression is increased, longer transcript expression is decreased. - Apparently het mice K/O are normal, but complete K/O cannot develop embryonically. - DN mechanism suggested Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5127 | SETD2 |
Zornitza Stark edited their review of gene: SETD2: Added comment: PMID 32710489: 12 unrelated patients, ranging from 1 month to 12 years of age, with a multisystemic neurodevelopmental disorder associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740W). Key clinical features: severely impaired global development apparent from infancy, feeding difficulties with failure to thrive, small head circumference, and dysmorphic facial features. Affected individuals have impaired intellectual development and hypotonia; they do not achieve walking or meaningful speech. Other neurologic findings may include seizures, hearing loss, ophthalmologic defects, and brain imaging abnormalities. There is variable involvement of other organ systems, including skeletal, genitourinary, cardiac, and possibly endocrine. Further 3 unrelated patients identified with mild to moderately impaired intellectual development associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740Q). These are distinct clinically from Luscan-Lumish syndrome, which is characterised by overgrowth.; Changed publications: 29681085, 32710489; Changed phenotypes: Luscan-Lumish syndrome, MIM#616831, Rabin-Pappas syndrome,MIM# 620155, Intellectual developmental disorder, autosomal dominant 70, MIM# 620157 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5121 | FZR1 |
Zornitza Stark gene: FZR1 was added gene: FZR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: FZR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FZR1 were set to 34788397 Phenotypes for gene: FZR1 were set to Developmental and epileptic encephalopathy 109, MIM# 620145 Review for gene: FZR1 was set to GREEN Added comment: Four unrelated individuals reported with de novo missense variants in this gene. Affected individuals had developmental delay before and concurrent with the onset of seizures. Features included impaired intellectual development with poor speech, ataxic gait, coordination problems, and behavioral abnormalities. Drosophila model supports gene-disease association. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5060 | CBS |
Lloyd Pereira changed review comment from: Listed in OMIM with a strong disease association (MIM #236200 homocysteinuria). Multiple experimental and clinical studies demonstrate link between CBS and homocysteinuria (see below): Multiple LOF variants classified as pathogenic or likely pathogenic in ClinVar and reported in the literature in multiple homozygote and compound heterozygote individuals affected with homocystinuria, e.g. c.19dup p.(Gln7fs) (PMID: 25218699; 12124992) and c.919G>A p.(Gly307Ser) (PMID: 7506602, 7581402, 8744616, 9889017, 23733603). Multiple CBS variants reported in CBS deficiency (PMID: 12124992). ClinGen classify as definitive for Homocysteinuria. Clingen states- Twenty-one unique variants were curated (missense, nonsense, frameshift, and splice site) in 15 probands from 8 publications, and three of these probands each had two affected siblings in whom CBS variants were identified (PMID 1301198, 10408774, 7762555, 12815602, 16307898, 25455305, 26667307, 29508359). Gene-disease relationship is supported by the biochemical function of CBS, which is consistent with the biochemical features in patients with homocystinuria (including elevated plasma total homocysteine and methionine) (PMID 13654400, 15890029), functional studies in yeast, bacteria, and cultured cells, including chaperone studies in fibroblasts from patients with homocystinuria (PMID 9590298, 25331909), as well as the biochemical and clinical features of mouse models (PMID 18987302) and enzyme replacement studies in mice (PMID 29398487). Recent review reports on role of CBS in down syndrome (PMID: 31955501). However, caveat that multiple genes are associated with down syndrome. Not a strong body of research available linking CBS variants and down syndrome.; to: Listed in OMIM with a strong disease association (MIM #236200 homocysteinuria). Multiple experimental and clinical studies demonstrate link between CBS and homocysteinuria (see below): Multiple LOF variants classified as pathogenic or likely pathogenic in ClinVar and reported in the literature in multiple homozygote and compound heterozygote individuals affected with homocystinuria, e.g. c.19dup p.(Gln7fs) (PMID: 25218699; 12124992) and c.919G>A p.(Gly307Ser) (PMID: 7506602, 7581402, 8744616, 9889017, 23733603). Multiple CBS variants reported in CBS deficiency (PMID: 12124992). ClinGen classify as definitive for Homocysteinuria. Clingen states- Twenty-one unique variants were curated (missense, nonsense, frameshift, and splice site) in 15 probands from 8 publications, and three of these probands each had two affected siblings in whom CBS variants were identified (PMID 1301198, 10408774, 7762555, 12815602, 16307898, 25455305, 26667307, 29508359). Gene-disease relationship is supported by the biochemical function of CBS, which is consistent with the biochemical features in patients with homocystinuria (including elevated plasma total homocysteine and methionine) (PMID 13654400, 15890029), functional studies in yeast, bacteria, and cultured cells, including chaperone studies in fibroblasts from patients with homocystinuria (PMID 9590298, 25331909), as well as the biochemical and clinical features of mouse models (PMID 18987302) and enzyme replacement studies in mice (PMID 29398487). Recent review reports on role of CBS in down syndrome (PMID: 31955501). However, caveat that multiple genes are associated with down syndrome. Not a strong body of research available linking CBS variants and down syndrome. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5053 | TCEAL1 |
Melanie Marty gene: TCEAL1 was added gene: TCEAL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TCEAL1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: TCEAL1 were set to PMID: 36368327 Phenotypes for gene: TCEAL1 were set to hypotonia; abnormal gait; developmental delay; intellectual disability; autism; dysmorphic facial features. Review for gene: TCEAL1 was set to GREEN Added comment: 7 individuals (males and females) with de novo variants involving TCEAL1 with an X-linked dominant neurodevelopmental syndrome. Individuals had hypotonia, abnormal gait, developmental delay/intellectual disability especially affecting expressive language, autistic-like behavior, and mildly dysmorphic facial features. Additional features included strabismus, refractive errors, variable nystagmus, gastroesophageal reflux, constipation, dysmotility, recurrent infections, seizures, and structural brain anomalies. 1 additional male individual with a maternally inherited missense variant (unaffected mother), which was considered a VUS. This individual had hypertonia and spasticity without syndromic features. 4 PTCs, 2 CNVs, 2 missense reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5050 | KDM2B |
Ain Roesley gene: KDM2B was added gene: KDM2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KDM2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KDM2B were set to 36322151 Phenotypes for gene: KDM2B were set to neurodevelopmental disorder MONDO#070009, KDM2B-related Review for gene: KDM2B was set to GREEN gene: KDM2B was marked as current diagnostic Added comment: 27 individuals from 22 families were recruited 13 SNV classified LP/P, all de novo except 2 familial cases 5 variants were classified as VUS if more than 1 het is present in gnomAD or does result in a KDM2B-specific episignature (therefore suggesting normal function) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5041 | ARPC4 |
Zornitza Stark gene: ARPC4 was added gene: ARPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARPC4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARPC4 were set to 35047857 Phenotypes for gene: ARPC4 were set to Developmental delay, language impairment, and ocular abnormalities, MIM# 620141 Review for gene: ARPC4 was set to GREEN Added comment: 7 affected individuals from 6 families (gonadal mosaicism was confirmed in the mother of the 2 affected siblings) with a recurrent missense variant (NM_005718.4:c.472C>T; p.R158C). 6/7 affected individuals had microcephaly. The variant was associated with a decreased amount of F-actin in cells from two affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5040 | EXOSC3 |
Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration, with functional effects of the mutation reproduced with knocked down endogenous expression of exosc3 in zebrafish embryos and subsequent rescue of the phenotype by co-injection with wild-type zebrafish exosc3 mRNA. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5040 | EXOSC3 | Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5040 | EXOSC3 | Michelle Dang edited their review of gene: EXOSC3: Added comment: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; Changed phenotypes: Cerebellar atrophy, Developmental delay, Lower motor neuron degeneration, Upper motor neuron features, Spasticity/hyperreflexia (+/-) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5040 | EXOSC3 | Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy. Variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment (to varying degrees) reported in all cases across various severity.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5029 | SPTAN1 | Zornitza Stark edited their review of gene: SPTAN1: Added comment: Another 21 individuals reported in PMID 36331550; some had DEE and others had isolated ID.; Changed publications: 20493457, 22258530, 32811770, 36331550 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5023 | SMC5 |
Zornitza Stark gene: SMC5 was added gene: SMC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SMC5 were set to 36333305 Phenotypes for gene: SMC5 were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID Review for gene: SMC5 was set to GREEN Added comment: Four individuals from three families with a chromosome breakage disorder and bi-allelic variants in this gene. However, three of the individuals had the same homozygous missense variant. Evidence for functional impact of the variant was limited. However, zebrafish model recapitulated the phenotype and was not rescued by the introduction of this variant, arguing for functional effect. Borderline Amber/Green. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5021 | SLF2 |
Zornitza Stark gene: SLF2 was added gene: SLF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLF2 were set to 36333305 Phenotypes for gene: SLF2 were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID Review for gene: SLF2 was set to GREEN Added comment: Seven individuals from 6 families with a chromosome breakage disorder and bi-allelic variants in this gene (LoF). Functional data including zebrafish model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5016 | WDR5 |
Bryony Thompson gene: WDR5 was added gene: WDR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WDR5 were set to DOI:https://doi.org/10.1016/j.xhgg.2022.100157 Phenotypes for gene: WDR5 were set to Neurodevelopmental disorder MONDO:0700092, WDR5-related Mode of pathogenicity for gene: WDR5 was set to Other Review for gene: WDR5 was set to GREEN Added comment: Six different missense variants were identified (de novo) in 11 affected individuals with neurodevelopmental disorders, with a broad spectrum of additional features, including epilepsy, aberrant growth parameters, skeletal and cardiac abnormalities. 9/11 probands have ID. In vivo and in vitro functional suggest that loss-of-function is not the mechanism of disease. The mechanism of disease is yet to be established. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4991 | FRMD5 |
Zornitza Stark gene: FRMD5 was added gene: FRMD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FRMD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Review for gene: FRMD5 was set to GREEN Added comment: Eight individuals reported with missense variants in this gene, de novo in 6 where parents were available. Clinical presentation was with ID, seizures, ataxia. Fly model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4986 | DPH5 |
Zornitza Stark gene: DPH5 was added gene: DPH5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DPH5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DPH5 were set to Neurodevelopmental disorder with short stature, prominent forehead, and feeding difficulties 620070 Review for gene: DPH5 was set to GREEN Added comment: 5 individuals from 3 unrelated families reported with severe ID, feeding difficulties, dysmorphic features and congenital anomalies, though there was no consistent pattern to these. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4975 | GABBR1 |
Zornitza Stark gene: GABBR1 was added gene: GABBR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABBR1 were set to 36103875 Phenotypes for gene: GABBR1 were set to Neurodevelopmental disorder, GABBR1-related, MONDO:0700092 Review for gene: GABBR1 was set to GREEN Added comment: Four individuals with de novo variants in this gene and varying severity of DD/ID, seizures and hypotonia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4974 | LETM1 |
Ee Ming Wong gene: LETM1 was added gene: LETM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LETM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LETM1 were set to 36055214 Phenotypes for gene: LETM1 were set to Mitochondrial disease MONDO#0044970, LETM1-related Review for gene: LETM1 was set to GREEN gene: LETM1 was marked as current diagnostic Added comment: -18 affected individuals from 11 unrelated families harbouring ultra-rare bi-allelic missense and loss-of-function LETM1 variants -Most of the affected individuals (14/18, 78%) had an infantile-onset disease manifestation, and 4/18 (22%) presented first symptoms between the ages of 1.5 and 2 years -Variant types included missense, frameshift, stop loss, in-frame deletion and splice defect -From biochemical and morphological studies, bi-allelic LETM1 variants are associated with defective mitochondrial K efflux, swollen mitochondrial matrix structures, and loss of important mitochondrial oxidative phosphorylation protein components Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4965 | MTSS1 |
Elena Savva gene: MTSS1 was added gene: MTSS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MTSS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MTSS1 were set to PMID: 36067766 Phenotypes for gene: MTSS1 were set to Intellectual disability, MTSS1-related (MONDO#0001071) Review for gene: MTSS1 was set to GREEN Added comment: Alt gene name: MTSS2 Huang (2022): recurring de novo missense variant (p.R671W) causing syndromic intellectual disability in 5 unrelated individuals. - Individuals present with GDD, mild ID (5/5), nystagmus (3/5), optic atrophy (1/5), ptosis (2/5), sensorineural hearing loss (2/4), microcephaly or relative microcephaly (5/5), and shared mild facial dysmorphisms. - Overexpression supports a DN mechanism Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4964 | MTSS1L |
Elena Savva gene: MTSS1L was added gene: MTSS1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MTSS1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MTSS1L were set to PMID: 36067766 Phenotypes for gene: MTSS1L were set to Intellectual disability, MTSS2-related (MONDO#0001071) Review for gene: MTSS1L was set to GREEN Added comment: Alt gene name: MTSS2 Huang (2022): recurring de novo missense variant (p.R671W) causing syndromic intellectual disability in 5 unrelated individuals. - Individuals present with GDD, mild ID (5/5), nystagmus (3/5), optic atrophy (1/5), ptosis (2/5), sensorineural hearing loss (2/4), microcephaly or relative microcephaly (5/5), and shared mild facial dysmorphisms. - Overexpression supports a DN mechanism Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4962 | RABGAP1 |
Zornitza Stark gene: RABGAP1 was added gene: RABGAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RABGAP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RABGAP1 were set to 36083289 Phenotypes for gene: RABGAP1 were set to Neurodevelopmental disorder, RABGAP1-related,MONDO:0700092 Review for gene: RABGAP1 was set to GREEN Added comment: 5 individuals from three families reported with ID, microcephaly, SNHL and seizures. Mouse model recapitulated the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4959 | NSD2 | Zornitza Stark edited their review of gene: NSD2: Added comment: PMID 36189577: two individuals reported with a GoF variant, p.Glu1099Lys, and a distinct phenotype: intellectual disability, coarse/ square facial gestalt, abnormalities of the hands, and organomegaly.; Changed publications: 30345613, 31171569, 36189577; Changed phenotypes: Rauch-Steindl syndrome, MIM# 619695, Microcephaly, intellectual disability, Neurodevelopmental disorder, NSD2-associated, GoF, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4959 | FOSL2 |
Krithika Murali gene: FOSL2 was added gene: FOSL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FOSL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOSL2 were set to 36197437 Phenotypes for gene: FOSL2 were set to Neurodevelopmental disorder, MONDO:0700092, FOSL2-related Review for gene: FOSL2 was set to GREEN Added comment: PMID 36197437 Cospain et al 2022 report 11 individuals from 10 families with heterozygous PTC variants in exon 4/4 of the FOSL2 gene. All variants were predicted to escape NMD resulting in a truncated protein, with the truncation occurring proximal to the C-terminal domain (supportive functional studies). In 10/11 families the variant occurred de novo in a single affected proband. In one family with 2 affected siblings, the variant was present in the siblings but absent in the unaffected parent likely due to gonadal mosaicism. Clinical features included: - Cutis aplasia congenital of the scalp (10/11) - Tooth enamel hypoplasia and discolouration (8/9) - Multiple other ectodermal features also noted e.g. small brittle nails, hypotrichosis/hypertrichosis, lichen sclerosis - 5 individuals had cataracts (mostly bilateral, congenital/early childhood onset) - 6/9 IUGR - 5/9 postnatal growth restriction - 7/9 developmental delay/ID (mild to severe) - 5/7 ADHD/ASD - 2/9 seizures Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4939 | PTPA |
Konstantinos Varvagiannis changed review comment from: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature; to: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp UK or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4939 | PTPA |
Konstantinos Varvagiannis gene: PTPA was added gene: PTPA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTPA were set to 36073231 Phenotypes for gene: PTPA were set to Intellectual disability; Parkinsonism Penetrance for gene: PTPA were set to Complete Review for gene: PTPA was set to AMBER Added comment: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4928 | UBAP2L |
Konstantinos Varvagiannis gene: UBAP2L was added gene: UBAP2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBAP2L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: UBAP2L were set to 35977029 Phenotypes for gene: UBAP2L were set to Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system Penetrance for gene: UBAP2L were set to unknown Review for gene: UBAP2L was set to GREEN Added comment: Based on Jia et al (2022 - PMID: 35977029) speech, motor delay as well as ID are observed in individuals harboring de novo pLoF variants in UBAP2L. The gene encodes a regulator of the stress granule (SG) assembly. Extensive evidence is provided on the effect of variants as well as the role of UBAP2L and other genes for components and/or regulation of SG in pathogenesis of NDDs. Among others a Ubap2l htz deletion mouse model (behavioral and cognitive impairment, abnormal cortical development due to impaired SG assembly, etc). Data from 26 previous studies, aggregating 40,853 probands with NDDs (mostly DD/ID, also ASD) suggest enrichment for DNMs in UBAP2L or other genes previously known and further shown to be important for SG formation (incl. G3BP1/G3BP2, CAPRIN1). Details provided below. Not associated with any phenotype in OMIM, G2P or SysNDD. -------- Jia et al (2022 - PMID: 35977029) describe 12 affected individuals with heterozygous de novo pLoF variants in UBAP2L. Phenotype: Features included hypotonia, speech (11/11) and motor delay (8/12), ID (8/10 with formal evaluation), variable behavioral concerns (ADHD 5/11, ASD in 4/10, etc). Seizures were reported in 7/12 with 3/10 having a formal diagnosis of epilepsy. Few had microcephaly (3/10). Facial dysmorphisms were common (9/9) and included abnormal palpebral fissures, deep prominent concha, high broad forehead, hypertelorism, thin upper lip and mild synophrys (each in 4 or less individuals). Short stature or skeletal alterations were described in some (4/10 each). Role of the gene: UBAP2L encodes an essential regulator of stress granule assembly. Stress granules are membraneless cytoplasmic compartments in eukaryotic cells, induced upon a variety of stressors and playing a role in regulation of gene expression. Variants identified : 9 nonsense/frameshift UBAP2L variants and 3 splicing ones were reported, in all cases as de novo events, upon trio/quad exome sequencing. All were absent from gnomAD. There were no other causative variants. Variant effect/studies (NM_014847.4 / NP_055662.3) : - Minigene assays revealed that the 3 splice variants all resulted in out-of-frame exon skipping. - In patient fibroblasts one of these splice variants was demonstrated to result to reduced protein levels. - 8 of the 9 nonsense/frameshift variants were predicted to result to NMD. - 1 nonsense variant (c.88C>T/p.Q30*) was shown to result to decreased protein expression in patient fibroblasts, with detection of the protein using an antibody for the C terminus but not the N terminus. Protein N-terminal sequencing confirmed that the protein lacked the N terminus, with utilization of an alternative start site (11 codons downstream). - Generation of HeLa UBAP2L KO cell lines resulted in significant reduction of SG numbers which was also the case for 4 variants studied, under stress conditions. - The protein has a DUF domain (aa 495-526) known to mediate interaction of UBAP2L with G3BP1 (a stress granule marker) with deletions of this domain leading to shuttling of UBAP2L from the cytoplasm to the nucleus. Truncating variants upstream of the DUF domain were shown to result in nuclear localization. Mouse model : - The authors generated Ubap2l KO model with hmz deletion of Ubap2l resulting in a lethal phenotype (2.6% survived) and htz deletion leading to behavioral issues (low preference for social novelty, anxious-like behaviors) and cognitive impairment. - Ubap2l haploinsufficiency resulted in abnormal cortical development and lamination with reduction of neural progenitor proliferation. - Ubap2l deficiency was shown to impair SG assembly during cortical development both under physiological stress conditions or upon utilization of an oxidative stress inducer. Additional evidence of UBAP2L and SG overall in pathogenesis of NDDs: - Based on DNMs from 40,853 individuals with NDDs from 26 studies (9,228 with ASD, 31,625 with DD/ID) the authors demonstrate significant excess of DNM in 31 genes encoding SG components, regulators or both, the latter being the case for UBAP2L and 2 further genes (G3BP1 and G3BP2 - both with crucial roles in SG assembly). - Excess dn splice-site (N=3) and missense (N=5) variants in G3BP1 were observed in the above cohort [c.95+1G>A, c.353+1G>T, c.539+1G>A / p.S208C, R320C, V366M]. - Excess dn missense (N=7) variants in G3BP2 were observed in the above cohort [p.R13W, D151N, E158K, L209P, E399D, K408E, R438C]. - Generation of G3BP1 or G3BP2 KO HeLa cell lines and immunofluorescence upon use of oxidative stress inducer revealed significant reduction of stress granules. - Generation of HeLa cell lines for 5 G3BP1 mutants (R78C*, R132I*, S208C*, R320C*, V366M) and 7 G3BP2 mutants (p.R13W*, D151N*, E158K, L209P*, E399D, K408E, R438C) revealed that several (those in asterisk) resulted in significantly fewer SG formation under oxidative stress compared to WT while the subcellular distribution of the proteins under stress was identical to WT. - Among the identified genes for SG enriched for DNMs, CAPRIN1 was implicated in previous publications as a NDD risk gene with 3 dn missense SNVs reported (p.I373K, p.Q446H, p.L484P). CAPRIN1 binding to G3BP1/2 has been shown to promote SG formation. Significant reduction of SG was observed in CAPRIN1 KO HeLa lines. p.I373K abolished interaction with G3BP1/2 and disrupted SG formation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4925 | PDZD8 |
Zornitza Stark gene: PDZD8 was added gene: PDZD8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PDZD8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDZD8 were set to 35227461 Phenotypes for gene: PDZD8 were set to Intellectual developmental disorder with autism and dysmorphic facies, MIM# 620021 Review for gene: PDZD8 was set to GREEN Added comment: Four individuals from two unrelated families, Drosophila and mouse models support gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4915 | TMEM147 |
Naomi Baker gene: TMEM147 was added gene: TMEM147 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM147 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM147 were set to PMID: 36044892 Phenotypes for gene: TMEM147 were set to Neurodevelopmental disorder (MONDO:0700092), TMEM147-related Review for gene: TMEM147 was set to GREEN Added comment: PMID: 36044892; Twelve different variants reported in 23 affected individuals from 15 unrelated families with biallelic variants. All individuals had global developmental delay and intellectual disability. Consistent facial dysmorphisms included coarse facies, prominent forehead, board depressed nasal root, tented mouth, long smooth philtrum, and low-set ears. In vitro studies of missense variants demonstrated accelerated protein degradation via the autophagy-lysosomal pathway, while analysis of primary fibroblasts and granulocytes provided functional evidence of ER and nuclear envelope dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4915 | TMEM163 |
Teresa Zhao gene: TMEM163 was added gene: TMEM163 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM163 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TMEM163 were set to PMID: 35953447 Phenotypes for gene: TMEM163 were set to Hypomyelinating leukodystrophy Review for gene: TMEM163 was set to GREEN Added comment: Four unrelated families with a hypomyelinating leukodystrophy phenotype. Genomic testing identified three distinct heterozygous missense variants in TMEM163 with two unrelated individuals sharing the same de novo variant. All have global developmental delay, three of them have seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | NOTCH1 |
Chern Lim changed review comment from: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Missense and small inframe insertion variants in the negative regulatory region. Sources: Literature; to: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Other clinical features include intellectual disability, spasticity and etc. Childhood onset in most individuals however 15y and 40y reported in two individuals. - Missense and small inframe insertion variants in the negative regulatory region. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | LGI3 |
Melanie Marty changed review comment from: Six individuals from eight unrelated families with loss-of-function (LoF) bi-allelic variants in LGI3. Lgi3-null mice showed reduced and mis-local-ized Kv1 channel complexes in myelinated peripheral axons. Sources: Literature; to: Sixteen individuals from eight unrelated families with loss-of-function (LoF) bi-allelic variants in LGI3. Lgi3-null mice showed reduced and mis-local-ized Kv1 channel complexes in myelinated peripheral axons. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | LGI3 |
Melanie Marty gene: LGI3 was added gene: LGI3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LGI3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LGI3 were set to PMID: 35948005 Phenotypes for gene: LGI3 were set to Global developmental delay; Intellectual disability; Distal deformities; Diminished reflexes; Facial myokymia; Hyporeflexia/areflexi Review for gene: LGI3 was set to GREEN Added comment: Six individuals from eight unrelated families with loss-of-function (LoF) bi-allelic variants in LGI3. Lgi3-null mice showed reduced and mis-local-ized Kv1 channel complexes in myelinated peripheral axons. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | CAPRIN1 |
Paul De Fazio gene: CAPRIN1 was added gene: CAPRIN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CAPRIN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CAPRIN1 were set to 35979925 Phenotypes for gene: CAPRIN1 were set to Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092 Review for gene: CAPRIN1 was set to GREEN gene: CAPRIN1 was marked as current diagnostic Added comment: 12 individuals reported with ID and language impairment. Other features included seizures (4 individuals), hands and feet malformations (5 individuals), breathing problems (6 individuals), ocular problems (4 individuals) and hearing problems (3 individuals). All of the variants were nonsense (NMD-predicted) or splicing variants. 10 were de novo, 1 was inherited from an affected father. Functional studies supported pathogenicity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4904 | CCDC82 |
chirag patel gene: CCDC82 was added gene: CCDC82 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC82 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC82 were set to PMID: 35373332, 35118659, 27457812 Phenotypes for gene: CCDC82 were set to Intellectual disability and spastic paraparesis, no OMIM # Review for gene: CCDC82 was set to GREEN Added comment: 4 consanguineous families with 9 affected individuals with developmental delay/intellectual disability, and 2 families had spasticity and 1 had epilepsy. WES identified 3 homozgyous truncating variants, segregating with disease and parents as carriers. No functional studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4895 | ZMYND8 |
Konstantinos Varvagiannis gene: ZMYND8 was added gene: ZMYND8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZMYND8 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ZMYND8 were set to 35916866; 32530565 Phenotypes for gene: ZMYND8 were set to Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures Penetrance for gene: ZMYND8 were set to unknown Review for gene: ZMYND8 was set to GREEN Added comment: Dias et al (2022 - PMID: 35916866) describe the phenotype of 11 unrelated individuals with monoallelic de novo (or suspected de novo) missense (N=9) or truncating (N=2) ZMYND8 variants. One of these subjects was previously reported by Suzuki et al (2020 - PMID: 32530565). Features included speech delay/language difficulties (9/11), motor delay (9/11), ID (in 10/11 - profound in 1, moderate in 2), CHD (7/11 - PDA, VSD, ASD, pulmonary stenosis, etc), hearing or vision impairment (7/11). Seizures were reported in few (in text 5/11, table 2/11). Variable non-familial facial features were present in (9/11). As the authors discuss, ZMYND8 encodes a multidomain protein playing a role in transcription regulation, chromatin remodeling, regulation of super enhancers, DNA damage response/tumor suppression. The protein is broadly expressed in brain and shows highest expression in early development. Molecular modeling and/or a yeast two-hybrid system were suggestive of disrupted interaction of ZMYND8 with Drebrin (missense variants in PWWP domain) or GATAD2A (variants in MYND domain). Neuronal Zmynd8 knockdown in Drosophila resulted in deficits in habituation learning. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4874 | SMG9 | Zornitza Stark edited their review of gene: SMG9: Added comment: PMID 35087184: 5 individuals from 3 unrelated Finnish families reported with same homozygous missense variant (founder effect) and predominantly neurological phenotype. Uncertain if this is a distinct disorder or part of a spectrum with the previously reported cases.; Changed publications: 27018474, 31390136, 35087184; Changed phenotypes: Heart and brain malformation syndrome, MIM# 616920, Neurodevelopmental disorder with intention tremor, pyramidal signs, dyspraxia, and ocular anomalies, MIM# 619995 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4867 | WARS |
Anna Ritchie gene: WARS was added gene: WARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WARS were set to PMID: 35815345; 35790048 Phenotypes for gene: WARS were set to Neurodevelopmental disorder (MONDO:0700092), WARS-related Review for gene: WARS was set to GREEN Added comment: At least seven affected individuals from four families with biallelic variants, showing varying severities of developmental delay, intellectual disability and microcephaly. Hearing impairment and, as well as brain anomalies, skeletal system, movement/gait, and behaviour were variable features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4865 | DOHH |
Daniel Flanagan gene: DOHH was added gene: DOHH was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: DOHH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DOHH were set to PMID: 35858628 Phenotypes for gene: DOHH were set to Neurodevelopmental disorder, DOHH-related (MONDO#0700092) Review for gene: DOHH was set to GREEN Added comment: Bi-allelic missense and truncating DOHH variants segregating with disease in five affected individuals from four unrelated families. Clinical features were developmental delay and/or intellectual disability (5/5), microcephaly (5/5), visual impairment (nystagmus (3/5), strabismus (3/5), and cortical visual impairment (1/5)) and congenital heart malformations (3/5 individuals). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4854 | KMT2B | Zornitza Stark edited their review of gene: KMT2B: Added comment: Nine individuals reported in PMID 33150406 with heterozygous variants in this gene and intellectual disability, speech delay, microcephaly, growth delay, feeding problems, and dysmorphic features, including epicanthic folds, posteriorly rotated ears, syndactyly/clinodactyly of toes, and fifth finger clinodactyly, normal MRIs and NO dystonia.; Changed publications: 33150406; Changed phenotypes: Dystonia 28, childhood-onset 617284, MONDO:0015004, Intellectual developmental disorder, autosomal dominant 68, MIM# 619934 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4846 | CHMP3 |
Chern Lim gene: CHMP3 was added gene: CHMP3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHMP3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHMP3 were set to PMID: 35710109 Phenotypes for gene: CHMP3 were set to Hereditary spastic paraplegia (MONDO:0019064), CHMP3-related Review for gene: CHMP3 was set to AMBER gene: CHMP3 was marked as current diagnostic Added comment: PMID: 35710109 - Single large family with consanguinity, homozygous missense variant in 5 affected individuals with intellectual and progressive motor disabilities, seizures and spastic quadriplegia. - Functional studies showed reduced CHMP3 protein in patient's fibroblasts, lenti-rescue study showed improved cellular phenotypes associated with impaired autophagy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4843 | WNK3 |
Lucy Spencer gene: WNK3 was added gene: WNK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WNK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: WNK3 were set to 35678782 Phenotypes for gene: WNK3 were set to Neurodevelopmental disorder, WNK3-related (MONDO#0700092) Review for gene: WNK3 was set to GREEN Added comment: 6 maternally inherited hemizygous variants, 3 missense, 2 canonical splice, and a nonsense. Seen in 14 individuals from 6 families, all 14 are male who inherited hemizygous variants from their unaffected heterozygous mothers. The variants cosegregated with disease in 3 families with multiple affected individuals. All 14 patients have ID, 11 have speech delay, 10 have facial abnormalities, 5 have seizures, 6 with microcephaly and 7 with anomalies in brain imaging. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4839 | TAF8 |
Zornitza Stark changed review comment from: Further 7 individuals reported from 4 families, three of which were consanguineous. Clinical features included severe psychomotor retardation with almost absent development, feeding problems, microcephaly, growth retardation, spasticity and epilepsy. Five had the previously reported c.781-1G > A variant in homozygous state. This is likely to be a founder variant. One family with different compound heterozygous variants.; to: Further 7 individuals reported from 4 families, three of which were consanguineous. Clinical features included severe psychomotor retardation with almost absent development, feeding problems, microcephaly, growth retardation, spasticity and epilepsy. Five had the previously reported c.781-1G > A variant in homozygous state. Unclear if this is a founder variant, families of different ethnicities. One family with different compound heterozygous variants. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4834 | KCNK9 | Zornitza Stark edited their review of gene: KCNK9: Added comment: Additional 47 individuals reported with 15 variants, including another hotspot at p.Arg131.; Changed publications: 28333430, 27151206, 24980697, 18678320, 35698242 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4831 | GRIA1 | Zornitza Stark changed review comment from: Single individual reported with bi-allelic LoF variant.; to: Single individual reported with bi-allelic LoF variant. RED/AMBER for bi-allelic variants. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4829 | GRIA1 | Zornitza Stark edited their review of gene: GRIA1: Added comment: Single individual reported with bi-allelic LoF variant.; Changed publications: 35675825; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 76, MIM# 619931 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4820 | IREB2 | Zornitza Stark edited their review of gene: IREB2: Added comment: Additional individual reported in PMID 35602653; Changed publications: 30915432, 31243445, 11175792, 35602653 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4818 | PAN2 |
Naomi Baker gene: PAN2 was added gene: PAN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PAN2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PAN2 were set to PMID:35304602; 29620724 Phenotypes for gene: PAN2 were set to Syndromic disease MONDO:0002254 Review for gene: PAN2 was set to GREEN Added comment: PMID:35304602 reports five individuals from 3 families with biallelic (homozygous) loss-of-function variants. Clinical presentation incudes mild-moderate intellectual disability, hypotonia, sensorineural hearing loss, EEG abnormalities, congenital heart defects (tetralogy of Fallot, septal defects, dilated aortic root), urinary tract malformations, ophthalmological anomalies, short stature with other skeletal anomalies, and craniofacial features including flat occiput, ptosis, long philtrum, and short neck. PMID:29620724 reports one individual with biallelic (homozygous) loss-of-function variant who presented with global developmental delay, mild hypotonia, craniosynostosis, severe early-onset scoliosis, imperforate anus, and double urinary collecting system. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4814 | PRPF8 |
Krithika Murali gene: PRPF8 was added gene: PRPF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRPF8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRPF8 were set to 35543142 Phenotypes for gene: PRPF8 were set to Intellectual disability; epilepsy; Retinitis pigmentosa 13 - MIM#600059 Review for gene: PRPF8 was set to GREEN Added comment: PMID 35543142 O'Grady et al 2022 report 14 unrelated individuals with heterozygous PRPF8 variants and ID, dymorphic features and epilepsy (7/14). Short stature, abnormal gait and cardiac anomalies also reported. 11 variants identified were de novo, 1 variant - maternal mosaicism, 1 variant - duo sequencing (not identified in mother, father could not be sequenced). 1 individual did not have parental testing. Cardiac anomalies varied and included benign cardiac tumour, dilated cardiomyopathy, dilated aortic root (COL5A2 VUS also identified), bicuspid aortic valve, cardiac arrest, self-resolving ASD/VSD. Heterozygous PRPF8 variants previously associated with retinitis pigmentosa. 1 out of the 14 individuals in this cohort had a diagnosis of RP. RP variants noted to cluster in the C'terminal MPN domain. The individual with RP in this paper had a variant in the preceding RNAase H homology domain near the C-terminus. Not all of the individuals in this paper had formal ophthalmological examination Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4814 | SEMA6B |
Dean Phelan gene: SEMA6B was added gene: SEMA6B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SEMA6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SEMA6B were set to PMID: 35604360 Phenotypes for gene: SEMA6B were set to Intellectual disability, MONDO:0001071, SEMA6B related Penetrance for gene: SEMA6B were set to Complete Review for gene: SEMA6B was set to GREEN Added comment: PMID: 35604360 - 14 heterozygous variants were observed in 16 unrelated individuals referred for intellectual disability. Majority of the variants 9/14 were PTCs in the last exon and predicted to escape NMD. Functional studies of selected variants and shRNA knock down studies showed mislocalisation and abnormal protein function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4813 | HEATR3 |
Chern Lim gene: HEATR3 was added gene: HEATR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HEATR3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HEATR3 were set to PMID: 35213692 Phenotypes for gene: HEATR3 were set to Bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability; Diamond Blackfan anaemia MONDO:0015253, HEATR3 related Review for gene: HEATR3 was set to AMBER gene: HEATR3 was marked as current diagnostic Added comment: PMID: 35213692: - 4 unrelated individuals with biallelic HEATR3 variants (missense and splice site variants), exhibiting bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability. - Functional analysis showed HEATR3 variants destabilised the protein, resulting in a reduction of nuclear uL18 and impaired ribosome biogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4790 | GFM2 |
chirag patel gene: GFM2 was added gene: GFM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: GFM2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GFM2 were set to PMID: 22700954, 26016410, 29075935 Phenotypes for gene: GFM2 were set to Combined oxidative phosphorylation deficiency 39, OMIM #618397 Review for gene: GFM2 was set to GREEN Added comment: Combined oxidative phosphorylation deficiency-39 (COXPD39) is an autosomal recessive multisystem disorder resulting from a defect in mitochondrial energy metabolism. Affected individuals show global developmental delay, sometimes with regression after normal early development, axial hypotonia with limb spasticity or abnormal involuntary movements, and impaired intellectual development with poor speech. More variable features may include hypotonia, seizures, and features of Leigh syndrome on brain imaging. There are variable deficiencies of the mitochondrial respiratory chain enzyme complexes in patient tissues. 4 families reported with biallelic variants with functional evidence in 1 family. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4776 | ADD1 |
chirag patel gene: ADD1 was added gene: ADD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADD1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: ADD1 were set to PMID: 34906466 Phenotypes for gene: ADD1 were set to Intellectual disability, corpus callosum dysgenesis, and ventriculomegaly; no OMIM # Review for gene: ADD1 was set to GREEN Added comment: 4 unrelated individuals affected by ID and/or complete or partial agenesis of corpus callosum, and enlarged lateral ventricles. WES found loss-of-function variants - 1 recessive missense variant and 3 de novo variants. The recessive variant is associated with ACC and enlarged lateral ventricles, and the de novo variants were associated with complete or partial agenesis of corpus callosum, mild ID and attention deficit. Human variants impair ADD1 protein expression and/or dimerization with ADD2. Add1 knockout mice recapitulate corpus callosum dysgenesis and ventriculomegaly phenotypes. Three adducin genes (ADD1, ADD2, and ADD3) encode cytoskeleton proteins that are critical for osmotic rigidity and cell shape. ADD1, ADD2, and ADD3 form heterodimers (ADD1/ADD2, ADD1/ADD3), which further form heterotetramers. Adducins interconnect spectrin and actin filaments to form polygonal scaffolds beneath the cell membranes and form ring-like structures in neuronal axons. Adducins regulate mouse neural development, but their function in the human brain is unknown. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4741 | CTR9 |
Dean Phelan gene: CTR9 was added gene: CTR9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CTR9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CTR9 were set to PMID: 35499524 Phenotypes for gene: CTR9 were set to Neurodevelopmental disorder (MONDO:0700092), CTR9-related; Intellectual disability (MONDO:0001071); hypotonia (HP:0001252); joint hyperlaxity (HP:0001388); speech delay; coordination problems; tremor (HP:0001337); autism spectrum disorder (MONDO:0005258) Review for gene: CTR9 was set to GREEN Added comment: PMID: 35499524 - Thirteen individuals with variables degrees of intellectual disability, hypotonia, joint hyperlaxity, speech delay, coordination problems, tremor, autism spectrum disorder. Mild dysmorphism and cardiac anomalies were less frequent. Eleven of the variants were shown to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4740 | DROSHA |
Lucy Spencer gene: DROSHA was added gene: DROSHA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DROSHA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DROSHA were set to 35405010 Phenotypes for gene: DROSHA were set to Neurodevelopmental disorder (MONDO#0700092), DROSHA-related Review for gene: DROSHA was set to AMBER Added comment: 2 individuals with profound intellectual disability, epilepsy, white matter atrophy, microcephaly, and dysmorphic features, who carry damaging de novo heterozygous variants in DROSHA. Both variants are missense, absent from gnomad. Both individuals noted to have Rett-like features. Functional studies in patient fibroblasts showed one of the missense altered the expression of mature miRNA. Fruit fly models with homozygous LOF variants die during larval stages. introduction of the missense seen in the patients was able to partially rescue this phenotype suggesting LOF is not the mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4736 | KCNH5 |
Elena Savva gene: KCNH5 was added gene: KCNH5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNH5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KCNH5 were set to https://www.medrxiv.org/content/10.1101/2022.04.26.22274147v1 Phenotypes for gene: KCNH5 were set to Neurodevelopmental disorder MONDO#0700092, KCNH5-related Mode of pathogenicity for gene: KCNH5 was set to Other Review for gene: KCNH5 was set to GREEN Added comment: Happ (2022), preprint: Screen of 893 patients with DEE found 17 patients with missense variants (16/17 de novo, 1/17 inherited). GOF mechanism suggested. Patient phenotypes included focal/generalized seizures, Cognitive outcome for the ten individuals >5 years ranged from normal (3/10) to mild (3/10), moderate (2/10), severe (1/10) and profound (1/10) intellectual disability (ID) p.Arg327His (7 probands), p.Arg333His (4 probands) were recurring Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4733 | STX1A |
Ain Roesley gene: STX1A was added gene: STX1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: STX1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: STX1A were set to neurodevelopmental disorder MONDO#0700092, STX1A-related Review for gene: STX1A was set to GREEN gene: STX1A was marked as current diagnostic Added comment: Preprint: https://www.medrxiv.org/content/10.1101/2022.04.20.22274073v1 8 individuals - 2x hom (related) and 6x hets (all de novo except 1x unknown) 7 unrelated since the 2 siblings share similar features: 7/7 ID, 7/7 motor delay, 4/7 epilepsy, 5/7 neonatal hypotonia 2/7 regression, 2/7 ASD excluding 1 with features but did not meet criteria Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4732 | PPFIBP1 |
Zornitza Stark gene: PPFIBP1 was added gene: PPFIBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: PPFIBP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PPFIBP1 were set to https://www.medrxiv.org/content/10.1101/2022.04.04.22273309v1 Phenotypes for gene: PPFIBP1 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIBP1-related Review for gene: PPFIBP1 was set to GREEN Added comment: 16 individuals from 10 unrelated families reported with moderate to profound developmental delay, often refractory early-onset epilepsy and progressive microcephaly. Drosophila model. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4706 | ENTPD1 |
Zornitza Stark gene: ENTPD1 was added gene: ENTPD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ENTPD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ENTPD1 were set to 35471564 Phenotypes for gene: ENTPD1 were set to Spastic paraplegia 64, autosomal recessive, MIM# 615683 Review for gene: ENTPD1 was set to GREEN Added comment: 27 individuals from 17 families published, expanding the phenotype to a complex neurodevelopmental disorder characterised by ID, white matter abnormalities and spastic paraplegia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4662 | PIGA | Zornitza Stark edited their review of gene: PIGA: Added comment: PMID 34875027: variants in PIGA causing a neurodevelopment disorder and a juvenile form of hereditary hemochromatosis reported in > three unrelated patients. All patients had increased serum iron, ferritin and transferrin saturation levels, high ALP and low hepcidin. All patients had generalised seizures and intellectual disability. A subpopulation of patient blood cells showed a slight reduction of GPI-anchored proteins, suggesting that the mutations were hypomorphic and retained some residual activity. CRISPR/Cas12a-mediated knockdown of PIGA in Hep3B liver cells eliminated the cell surface expression of GPI-anchored proteins CD59 and hemojuvelin (HJV; 608374), as well as caused decreased expression of hepcidin (606464) compared to controls. These hypomorphic alleles could explain the milder neurologic phenotype, which allowed for sufficiently long survival for the iron overload phenotype to manifest.; Changed publications: 22305531, 24357517, 24706016, 26545172, 33333793, 32694024, 34875027; Changed phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466, Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4658 | CACNA2D1 |
Michelle Torres gene: CACNA2D1 was added gene: CACNA2D1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACNA2D1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CACNA2D1 were set to 35293990 Phenotypes for gene: CACNA2D1 were set to developmental and epileptic encephalopathy disorder MONDO:0100062 CACNA2D1-related Review for gene: CACNA2D1 was set to GREEN Added comment: PMID 35293990: WES of 2x unrelated individuals with early-onset developmental epileptic encephalopathy, microcephaly, severe hypotonia, absent speech, spasticity, choreiform movements, orofacial dyskinesia, and 2 cortical visual impairment, corpus callosum hypoplasia and progressive volume loss. Patient 2 also had a tiny patent foramen ovale. Patient 1 is homozygous for p.(Ser275Asnfs*13). mRNA and protein expression were reduced to ~10% of WT in fibroblasts Patient 2 is cHet for p.(Leu9Alafs*5) and p.(Gly209Asp). mRNA expression in patients fibroblasts was similar to controls, and protein expression reduced to 31-38%. Functional of the p.(Gly209Asp) showed impaired localization and mutagenesis showed complete loss of channel function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4658 | ATP2B1 |
Daniel Flanagan changed review comment from: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense. Sources: Expert list; to: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), dissimilar forms of seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4658 | TRAPPC10 |
Naomi Baker gene: TRAPPC10 was added gene: TRAPPC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRAPPC10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC10 were set to PMID: 35298461; 30167849 Phenotypes for gene: TRAPPC10 were set to neurodevelopmental disorder (MONDO:0700092), TRAPPC10-related Review for gene: TRAPPC10 was set to GREEN Added comment: PMID: 35298461 – two Pakistani families reported with homozygous variants. Family 1 has frameshift variant in 8 affected individual and family 2 has missense variant in 2 affected individuals. Patients present with microcephaly, short stature, hypotonia, severe ID and behavioural abnormalities. Seizures also reported in 4/10 individuals. Paper also reported brain abnormalities in null mouse model and other functional in transfected cell lines. PMID: 30167849 – initial report of family 2 above. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4658 | ATP2B1 |
Daniel Flanagan gene: ATP2B1 was added gene: ATP2B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ATP2B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP2B1 were set to PMID: 35358416 Phenotypes for gene: ATP2B1 were set to Neurodevelopmental disorder, MONDO:0700092, ATP2B1-related Review for gene: ATP2B1 was set to GREEN Added comment: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4642 | RBMX |
Zornitza Stark gene: RBMX was added gene: RBMX was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: RBMX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: RBMX were set to 25256757; 34260915 Phenotypes for gene: RBMX were set to Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238 Review for gene: RBMX was set to AMBER Added comment: Hemizygous truncating variant reported segregating in multiple affected individuals in a single family. Some supportive functional data. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4571 | ITCH | Zornitza Stark edited their review of gene: ITCH: Added comment: Unrelated individual reported in PMID 31091003 had normal intellect.; Changed publications: 20170897, 31091003 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4546 | NAT8L |
Krithika Murali gene: NAT8L was added gene: NAT8L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAT8L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAT8L were set to 11310630; 19807691; 32275776 Phenotypes for gene: NAT8L were set to ?N-acetylaspartate deficiency - MIM#614063 Review for gene: NAT8L was set to AMBER Added comment: Absence of brain N-acetylaspartate, has been described in only one patient, with truncal ataxia, marked developmental delay, seizures and secondary microcephaly (first described by - PMID: 11310630 Martin et al 2001). PMID: 19807691 - Wiame et al 2009 identified in this patient a homozygous 19 bp NAT8L gene deletion, resulting in a change in reading frame and the absence of production of a functional protein. The affected individual is adopted and testing of the biological parents was not possible. The authors provide supportive functional studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4524 | HIST1H4D |
Paul De Fazio changed review comment from: Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD). A zebrafish model has developmental defects. Sources: Literature; to: HGNC recognised gene name: H4C4 Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD). A zebrafish model has developmental defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | HIST1H4E |
Paul De Fazio changed review comment from: 17 patients identified with de novo missense variants affecting Lys31, Pro32, Arg35, Leu37, Arg40 (recurrent), Arg45 (recurrent), Tyr98 (recurrent). All individuals had ID/dev delay. Additional phenotypes in some but not all individuals included epilepsy, hypotonia, facial dysmorphism. Most had reduced birth length, OFC, weight (-1 to -3SD). A zebrafish model has developmental defects. Sources: Literature; to: HGNC recognised gene: H4C5 17 patients identified with de novo missense variants affecting Lys31, Pro32, Arg35, Leu37, Arg40 (recurrent), Arg45 (recurrent), Tyr98 (recurrent). All individuals had ID/dev delay. Additional phenotypes in some but not all individuals included epilepsy, hypotonia, facial dysmorphism. Most had reduced birth length, OFC, weight (-1 to -3SD). A zebrafish model has developmental defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | HIST1H4C |
Paul De Fazio changed review comment from: 6 additional individuals with ID and dev delay. All variants were de novo. Lys92 (Lys91 in H4 nomenclature) and Pro33 (Pro32) were the only variants identified. Additional phenotypes in some but not all patients included hypotonia, facial dysmorphisms, conductive hearing loss. Most had reduced birth length, OFC, weight (-1 to -2.5SD). A zebrafish model has developmental defects.; to: HGNC recognised gene name: H4C3 6 additional individuals with ID and dev delay. All variants were de novo. Lys92 (Lys91 in H4 nomenclature) and Pro33 (Pro32) were the only variants identified. Additional phenotypes in some but not all patients included hypotonia, facial dysmorphisms, conductive hearing loss. Most had reduced birth length, OFC, weight (-1 to -2.5SD). A zebrafish model has developmental defects. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | HIST1H4E |
Paul De Fazio gene: HIST1H4E was added gene: HIST1H4E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HIST1H4E was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HIST1H4E were set to 35202563 Phenotypes for gene: HIST1H4E were set to Neurodevelopmental disorder, HIST1H4E-related MONDO:0700092 Review for gene: HIST1H4E was set to GREEN gene: HIST1H4E was marked as current diagnostic Added comment: 17 patients identified with de novo missense variants affecting Lys31, Pro32, Arg35, Leu37, Arg40 (recurrent), Arg45 (recurrent), Tyr98 (recurrent). All individuals had ID/dev delay. Additional phenotypes in some but not all individuals included epilepsy, hypotonia, facial dysmorphism. Most had reduced birth length, OFC, weight (-1 to -3SD). A zebrafish model has developmental defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | NRCAM |
Ee Ming Wong gene: NRCAM was added gene: NRCAM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NRCAM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NRCAM were set to PMID: 35108495 Phenotypes for gene: NRCAM were set to neurodevelopmental disorder, MONDO:0700092 Penetrance for gene: NRCAM were set to unknown Review for gene: NRCAM was set to GREEN gene: NRCAM was marked as current diagnostic Added comment: -Ten individuals from 8 families with developmental delay/intellectual disability, hypotonia, peripheral neuropathy, and/or spasticity - Affected individuals are biallelic for missense and/or LoF variants which are mainly in the fibronectin type III (Fn-III) domain - Zebrafish mutants lacking the third Fn-III domain displayed significantly altered swimming behavior compared to wild-type larvae (p < 0.03) and a trend toward increased amounts of alpha-tubulin fibers in the dorsal telencephalon, demonstrating an alteration in white matter tracts and projections Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | HIST1H4D |
Paul De Fazio gene: HIST1H4D was added gene: HIST1H4D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HIST1H4D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HIST1H4D were set to 35202563 Phenotypes for gene: HIST1H4D were set to Neurodevelopmental disorder, HIST1H4D-related MONDO:0700092 Review for gene: HIST1H4D was set to AMBER gene: HIST1H4D was marked as current diagnostic Added comment: Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD). A zebrafish model has developmental defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | CRLS1 |
Michelle Torres gene: CRLS1 was added gene: CRLS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CRLS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRLS1 were set to 35147173 Phenotypes for gene: CRLS1 were set to Mitochondrial disease MONDO:0044970 CRLS1-related Added comment: - Three families (4 individuals) with cardiolipin deficiency. - Two families (one consanguineous with 2 affected siblings) with homozygous the p.(Ile109Asn) had infantile progressive encephalopathy, bull’s eye maculopathy, auditory neuropathy, diabetes insipidus, autonomic instability, cardiac defects and early death. - The fourth individual cHet p.(Ala172Asp) and p.(Leu217Phe) presented with chronic encephalopathy with neurodevelopmental regression, congenital nystagmus with decreased vision, sensorineural hearing loss, failure to thrive and acquired microcephaly. - Functional studies on patient cells showed increased levels of the substrate of CRLS1 and impaired mitochondrial morphology and biogenesis Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | ZBTB7A |
Daniel Flanagan gene: ZBTB7A was added gene: ZBTB7A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ZBTB7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZBTB7A were set to 34515416; 31645653 Phenotypes for gene: ZBTB7A were set to Macrocephaly, neurodevelopmental delay, lymphoid hyperplasia, and persistent fetal hemoglobin (MIM#619769) Review for gene: ZBTB7A was set to GREEN Added comment: PMID: 34515416. Monoallelic ZBTB7A variants identified in 12 individuals from 11 families, with macrocephaly (11/12), some degree of ID (12/12), autistic features (7/12) and hypertrophy of pharyngeal lymphoid tissue (12/12). Variants included LoF variants and missense, 8 variants were de novo. PMID: 31645653. De novo ZBTB7A missense identified in a boy with macrocephaly, intellectual disability, and sleep apnea. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4511 | TIAM1 |
Alison Yeung gene: TIAM1 was added gene: TIAM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TIAM1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TIAM1 were set to Neurodevelopmental disorder, TIAM1-related, MONDO:0700092 Review for gene: TIAM1 was set to GREEN Added comment: Reported in 4 unrelated individuals. Phenotype of developmental delay/intellectual disability and seizures. Loss of ortholog in Drosophila reduces the survival rate, and the surviving adults exhibit climbing defects, are prone to severe seizures, and have a short lifespan. Functional studies in 3 variants from two probands showed loss of function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4507 | CHKA |
Konstantinos Varvagiannis gene: CHKA was added gene: CHKA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHKA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHKA were set to 35202461 Phenotypes for gene: CHKA were set to Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature Penetrance for gene: CHKA were set to Complete Review for gene: CHKA was set to GREEN Added comment: Klöckner (2022 - PMID: 35202461) describe the phenotype of 6 individuals (from 5 unrelated families) harboring biallelic CHKA variants. Shared features incl. abnormal muscle tone(6/6 - hypertonia or hypotonia, 3/6 each), DD/ID (6/6,severe in 4, severe/profound in 2), epilepsy (6/6 - onset: infancy - 3y2m | epileptic spasms or GS at onset), microcephaly (6/6), movement disorders (3/6 - incl. dyskinesia, rigidity, choreoatetotic movements). 2/5 individuals exhibited MRI abnormalities, notably hypomyelination. Short stature was observed in 4/6. Eventual previous genetic testing was not discussed. Exome sequencing (quattro ES for 2 sibs, trio ES for 1 individual, singleton for 3 probands) revealed biallelic CHKA variants in all affected individuals. Sanger sequencing was performed for confirmation and segregation studies. Other variants (in suppl.) were not deemed to be causative for the neurodevelopmental phenotype. 3 different missense, 1 start-loss and 1 truncating variant were identified, namely (NM_0012772.2): - c.421C>T/p.(Arg141Trp) [3 hmz subjects from 2 consanguineous families], - c.580C>T/p.Pro194Ser [1 hmz individual born to consanguineous parents], - c.2T>C/p.(Met1?) [1 hmz individual born to related parents], - c.14dup/p.(Cys6Leufs*19) in trans with c.1021T>C/p.(Phe341Leu) in 1 individual. CHKA encodes choline kinase alpha, an enzyme catalyzing the first step of phospholipid synthesis in the Kennedy pathway. The pathway is involved in de novo synthesis of glycerophospholipids, phosphatidylcholine and phosphatidylethanolamine being the most abundant in eukaryotic membranes. CHKA with its paralog (CHKB) phosphorylates either choline or ethanolamine to phosphocholine or phosphoethanolamine respectively with conversion of ATP to ADP. As the authors comment, biallelic pathogenic variants in CHKB cause a NDD with muscular dystrophy, hypotonia, ID, microcephaly and structural mitochondrial anomalies (MIM 602541). [Prominent mitochondrial patterning was observed in a single muscle biopsy available from an individual with biallelic CHKA variants]. Other disorders of the Kennedy pathway (due to biallelic PCYT2, SELENOI, PCYT1A variants) present with overlapping features incl. variable DD/ID (no-severe), microcephaly, seizures, visual impairment etc. CHKA variants were either absent or observed once in gnomAD, affected highly conserved AAs with multiple in silico predictions in favor of a deleterious effect. In silico modeling suggests structural effects for several of the missense variants (Arg141Trp, Pro194Ser presumably affect ADP binding, Phe341 lying close to the binding site of phosphocholine). Each of the missense variants was expressed in yeast cells and W. Blot suggested expression at the expected molecular weight at comparative levels. The 3 aforementioned variants exhibited reduced catalytic activity (20%, 15%, 50% respectively). NMD is thought to underly the deleterious effect of the frameshift one (not studied). The start-loss variant is expected to result in significantly impaired expression and protein function as eventual utilization of the next possible start codon - occurring at position 123 - would remove 26% of the protein. Chka(-/-) is embryonically lethal in mice, suggesting that complete loss is not compatible with life. Reduction of choline kinase activity by 30% in heterozygous mice did not appear to result in behavioral abnormalities although this was not studied in detail (PMID cited: 18029352). Finally, screening of 1566 mouse lines identified 198 genes whose disruption yields neuroanatomical phenotypes, Chka(+/-) mice being among these (PMID cited: 31371714). There is no associated phenotype in OMIM, Gene2Phenotype or SysID. Overall this gene can be considered for inclusion in the ID and epilepsy panes with green or amber rating (>3 individuals, >3 variants, variant studies, overlapping phenotype of disorders belonging to the same pathway, etc). Consider also inclusion in the microcephaly panel (where available this seemed to be of postnatal onset). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4495 | THUMPD1 |
Chern Lim changed review comment from: Broly, M. et al. (2022), AJHG: - 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other; to: Broly, M. et al. (2022), AJHG: - 13 individuals from 8 families, biallelic loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4495 | THUMPD1 |
Chern Lim changed review comment from: Broly, M. et al. (2022) manuscript accepted in AJHG: - 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other; to: Broly, M. et al. (2022), AJHG: - 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4495 | THUMPD1 |
Chern Lim gene: THUMPD1 was added gene: THUMPD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: THUMPD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: THUMPD1 were set to Syndromic form of intellectual disability associated with developmental delay, behavioral abnormalities, hearing loss and facial dysmorphism, AR gene: THUMPD1 was marked as current diagnostic Added comment: Broly, M. et al. (2022) manuscript accepted in AJHG: - 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4494 | PAX5 |
Bryony Thompson gene: PAX5 was added gene: PAX5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PAX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PAX5 were set to 35094443; 31452935; 28263302; 25418537; 8001127; 27626380 Phenotypes for gene: PAX5 were set to neurodevelopmental disorder MONDO:0700092 Review for gene: PAX5 was set to GREEN Added comment: 5 individuals from 4 families with large deletions involving PAX5 and 11 individuals from 9 families with frameshift/stopgain/missense variants and neurodevelopmental phenotypes that included delayed developmental milestones (DD), intellectual disability (ID), and/or ASD. 6 of the variants are de novo. Null mouse have retarded growth and altered patterning of the posterior midbrain. Pax5+/− mice of both sexes are hyperactive and have abnormal auditory brainstem responses. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4485 | BAP1 |
Anna Ritchie gene: BAP1 was added gene: BAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BAP1 were set to PMID: 35051358 Phenotypes for gene: BAP1 were set to syndromic intellectual disability MONDO:0000508 Penetrance for gene: BAP1 were set to unknown Review for gene: BAP1 was set to GREEN Added comment: 11 de novo germline heterozygous missense BAP1 variants associated with a rare syndromic neurodevelopmental disorder. Functional analysis showed that most of the variants cannot rescue the consequences of BAP1 inactivation, suggesting a loss-of-function mechanism. All affected individuals harboring a de novo BAP1 variant had DD or ID (11/11) characterized notably by speech (11/ 11) and motor delay (6/11). Most of them had hypotonia (7/11), seizures (6/11), and abnormal behavior (8/10), including autism spectrum disorder, attention deficit hyperactivity disorder, and hypersensitivity. Almost all individuals showed dysmorphic facial features (10/11), and more than half (6/11) had skeletal malformations (involving the hands [4/11], feet [3/11], or spine [2/11]). Most of the individuals had growth failure (9/11), including four individuals with a very short stature. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4484 | SOD1 |
Naomi Baker gene: SOD1 was added gene: SOD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SOD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SOD1 were set to PMID: 31314961; 31332433; 34788402 Phenotypes for gene: SOD1 were set to Spastic tetraplegia and axial hypotonia, progressive, MIM#618598 Review for gene: SOD1 was set to GREEN Added comment: Phenotypes include one individual with axial hypotonia and loss of gross and fine motor function beginning at 6 months of age, after which severe, progressive spastic tetraparesis developed and Babinski’s sign was present in both feet. MRI of brain detected mild frontoparietal atrophy. The second individual had severe and marked by progressive loss of motor abilities from 9 months of age, tetraspasticity with predominance in the lower extremities, mild cerebellar atrophy, and hyperekplexia-like symptoms. Dysmorphic features such as low set, posteriorly rotated ears, and overlapping toes The third individual is an infant with severe global developmental delay, axial hypotonia and limb spasticity. No dysmorphic facial features were noted, but she had a high arched palate, bilateral 5th finger clinodactyly, partial toe syndactyly of the second and third toes, and a single hyperpigmented macule tongue fasciculations, axial hypotonia with limb spasticity (more pronounced in the lower limbs), ankle clonus, and brisk patellar deep tendon reflexes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4484 | ITSN1 |
Ee Ming Wong changed review comment from: -10 individuals from eight unrelated with neurodevelopmental disorder spectrum including ASD, ID, major behavioral difficulties and/or verbal impairment. -variants included heterozygous premature truncating and missense variants -Majority of variants were de novo; in two patients the reported variant was inherited from paucisymptomatic father Sources: Literature; to: -10 individuals from eight unrelated families with neurodevelopmental disorder spectrum including ASD, ID, major behavioral difficulties and/or verbal impairment. -variants included heterozygous premature truncating and missense variants -Majority of variants were de novo; in two patients the reported variant was inherited from paucisymptomatic father Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4484 | ITSN1 |
Ee Ming Wong gene: ITSN1 was added gene: ITSN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ITSN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ITSN1 were set to PMID: 34707297 Phenotypes for gene: ITSN1 were set to neurodevelopmental disorder MONDO:0700092 ITSN1-related Penetrance for gene: ITSN1 were set to unknown gene: ITSN1 was marked as current diagnostic Added comment: -10 individuals from eight unrelated with neurodevelopmental disorder spectrum including ASD, ID, major behavioral difficulties and/or verbal impairment. -variants included heterozygous premature truncating and missense variants -Majority of variants were de novo; in two patients the reported variant was inherited from paucisymptomatic father Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4482 | MAN2C1 |
Michelle Torres gene: MAN2C1 was added gene: MAN2C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAN2C1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAN2C1 were set to 35045343 Phenotypes for gene: MAN2C1 were set to neurodevelopmental disorder MONDO:0700092 MAN2C1-related Review for gene: MAN2C1 was set to GREEN Added comment: Six individuals from four different families, including two fetuses, exhibiting dysmorphic facial features, congenital anomalies such as tongue hamartoma, variable degrees of intellectual disability, and brain anomalies including polymicrogyria, interhemispheric cysts, hypothalamic hamartoma, callosal anomalies, and hypoplasia of brainstem and cerebellar vermis. Variants include PTC and missense. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4481 | FRA10AC1 |
Zornitza Stark gene: FRA10AC1 was added gene: FRA10AC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FRA10AC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FRA10AC1 were set to 34694367 Phenotypes for gene: FRA10AC1 were set to Neurodevelopmental disorder, MONDO:0700092, FRA10AC1-related Review for gene: FRA10AC1 was set to GREEN Added comment: PMID 34694367: 5 individuals from 3 unrelated families reported. Variable ID, possibly related to variant type with LoF variants associated with more severe ID. All individuals had microcephaly, hypoplasia or agenesis of the corpus callosum, growth retardation, and craniofacial dysmorphism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4465 | CAMK2G |
Zornitza Stark gene: CAMK2G was added gene: CAMK2G was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CAMK2G was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CAMK2G were set to 30184290 Phenotypes for gene: CAMK2G were set to Intellectual disability Mode of pathogenicity for gene: CAMK2G was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: CAMK2G was set to AMBER Added comment: Two unrelated individuals reported with de novo (p.Arg292Pro) variant. Functional data suggests GoF. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4438 | ANAPC7 |
Zornitza Stark gene: ANAPC7 was added gene: ANAPC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ANAPC7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ANAPC7 were set to 34942119 Phenotypes for gene: ANAPC7 were set to Ferguson-Bonni neurodevelopmental syndrome, MIM# 619699 Review for gene: ANAPC7 was set to AMBER Added comment: 11 individuals of Amish heritage reported homozygous for an intragenic deletion. Clinical features included ID, hypotonia, deafness in 5, relatively small head size (but microcephaly only in 1), and occasional congenital anomalies. Supportive mouse model. Amber rating in light of this being a founder variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4408 | NAA20 |
chirag patel gene: NAA20 was added gene: NAA20 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAA20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAA20 were set to PMID: 34230638 Phenotypes for gene: NAA20 were set to Autosomal recessive developmental delay, intellectual disability, and microcephaly Added comment: 2 consanguineous families with 5 affected individuals with developmental delay, intellectual disability, and microcephaly (-2-4SD). Exome and genome sequencing identified 2 different homozygous variants in NAA20 gene (p.Met54Val and p.Ala80Val), and segregated with affected individuals. N-terminal acetyltransferases modify proteins by adding an acetyl moiety to the first amino acid and are vital for protein and cell function. The NatB complex acetylates 20% of the human proteome and is composed of the catalytic subunit NAA20 and the auxiliary subunit NAA25. Both NAA20-M54V and NAA20-A80V were impaired in their capacity to form a NatB complex with NAA25, and in vitro acetylation assays revealed reduced catalytic activities toward different NatB substrates. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4391 | CSTF2 |
Zornitza Stark gene: CSTF2 was added gene: CSTF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSTF2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: CSTF2 were set to 32816001 Phenotypes for gene: CSTF2 were set to Intellectual disability Review for gene: CSTF2 was set to AMBER Added comment: Four individuals from a single family, spanning two generations, segregating a missense variant. Functional data, including a mouse model and a gene reporter assay. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4370 | KCND2 |
Zornitza Stark gene: KCND2 was added gene: KCND2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCND2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCND2 were set to 24501278; 16934482; 29581270; 34245260 Phenotypes for gene: KCND2 were set to Neurodevelopmental disorder MONDO:0700092; global developmental delay, HP:0001263; seizure, HP:0001250 Review for gene: KCND2 was set to GREEN Added comment: 6 new unrelated cases with developmental delay reported in PMID: 34245260 (Zhang et al 2021), 3 of whom had seizures. All had heterozygous missense variants of KCND2 in sites known to be critical for channel gating (E323K, P403A, two individuals, V404L, two individuals and V404M). Functional studies suggest that these missense changes cause both a partial loss-of-function (LOF) and gain-of-function (GOF). The V404 change appears to increase epileptic seizure susceptibility with the 3 patients with a V404 change showing this phenotype. PMID:24501278 - Lee et al, 2014 - reports pair of monozygotic twin boys with infantile onset severe refractory epilepsy and autism. A de novo heterozygous missense variant was identified by WES - V404M. PMID: 29581270 - Lin et al, 2018 - performed functional work that shows V404M enhances inactivation of channels that have not yet opened and dramatically impairs the inactivation of channels that have opened. PMID:16934482 - Singh et al, 2006 - reports a patient with cognative impairment who also went on to have seizures starting from age 13 with a 5 bp deletion in KCND2 leading to premature stop codon. The proband's asymptomatic father also shared this variant. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4358 | ADCY5 | Zornitza Stark edited their review of gene: ADCY5: Added comment: Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD) is an autosomal recessive complex neurologic disorder characterized by severe global developmental delay with axial hypotonia, impaired intellectual development, poor overall growth, and abnormal involuntary hyperkinetic movements, including dystonia, myoclonus, spasticity, and orofacial dyskinesia. It is the most severe manifestation of ADCY5-related dyskinetic disorders. Five individuals from 2 families reported.; Changed rating: AMBER; Changed publications: 22782511, 24700542, 33051786, 32647899, 33704598, 34631954, 28971144, 30975617; Changed phenotypes: Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4351 | ASXL2 |
Zornitza Stark commented on gene: ASXL2: Shashi-Pena syndrome is a neurodevelopmental syndrome characterized by delayed psychomotor development, variable intellectual disability, hypotonia, facial dysmorphism, and some unusual features, including enlarged head circumference, glabellar nevus flammeus, and deep palmar creases. Some patients may also have atrial septal defect, episodic hypoglycaemia, changes in bone mineral density, and/or seizures. At least 7 unrelated individuals reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4347 | BLOC1S1 |
Zornitza Stark gene: BLOC1S1 was added gene: BLOC1S1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BLOC1S1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BLOC1S1 were set to 33875846 Phenotypes for gene: BLOC1S1 were set to severe intellectual disability; severe global developmental delay; epilepsy Review for gene: BLOC1S1 was set to GREEN Added comment: 4 individuals reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4345 | CLCN7 |
Zornitza Stark gene: CLCN7 was added gene: CLCN7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLCN7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CLCN7 were set to 31155284 Phenotypes for gene: CLCN7 were set to Hypopigmentation, organomegaly, and delayed myelination and development, MIM# 618541 Mode of pathogenicity for gene: CLCN7 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: CLCN7 was set to AMBER Added comment: Two individuals reported with same missense variant and hypopigmentation, organomegaly, and delayed myelination and development. Variant is GoF. No osteopetrosis, biopsy findings from skin and other organs are consistent with a lysosomal storage disorder. IUGR, prematurity and polyhydramnios are features. Bi-allelic variants in this gene are associated with osteopetrosis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4342 | TAF4 |
Zornitza Stark gene: TAF4 was added gene: TAF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TAF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TAF4 were set to 33875846; 28191890 Phenotypes for gene: TAF4 were set to Neurodevelopmental disorder Review for gene: TAF4 was set to AMBER Added comment: Three individuals reported with de novo LoF variants as part of large cohorts, limited phenotypic information available. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4338 | PLK1 |
Zornitza Stark gene: PLK1 was added gene: PLK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLK1 were set to 33875846 Phenotypes for gene: PLK1 were set to Epilepsy; microcephaly; intellectual disability Review for gene: PLK1 was set to GREEN Added comment: More than 5 individuals reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4334 | TMEM218 |
Zornitza Stark gene: TMEM218 was added gene: TMEM218 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: TMEM218 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM218 were set to 33791682; 25161209 Phenotypes for gene: TMEM218 were set to Joubert syndrome 39, MIM#619562 Review for gene: TMEM218 was set to GREEN Added comment: 11 cases in 6 families with homozygous or compound heterozygous missense and nonsense (1) variants, with a Joubert/Meckel syndrome phenotype. Clinical features included the molar tooth sign (N=2), occipital encephalocele (N=5, all fetuses), retinal dystrophy (N=4, all living individuals), polycystic kidneys (N=2), and polydactyly (N=2), without liver involvement. A null mouse model had nephronophthisis and retinal degeneration. No OMIM entry. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty edited their review of gene: OGDHL: Added comment: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function.; Changed rating: GREEN |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty commented on gene: OGDHL: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty changed review comment from: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. Sources: Literature; to: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty gene: OGDHL was added gene: OGDHL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: OGDHL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OGDHL were set to PMID: 34800363 Phenotypes for gene: OGDHL were set to Neurodevelopmental disorder featuring epilepsy, hearing loss and visual impairment Added comment: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4255 | MYH10 |
Krithika Murali gene: MYH10 was added gene: MYH10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list,Literature Mode of inheritance for gene: MYH10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MYH10 were set to 24825879; 24901346; 25356899; 22495309; 25003005 Phenotypes for gene: MYH10 were set to Microcephaly; Intellectual Disability Review for gene: MYH10 was set to GREEN Added comment: De novo variants were identified in 5 unrelated individuals with moderate-severe ID and developmental delay. Other reported phenotypic features include microcephaly (4/5), IUGR/failure to thrive (4/5), cerebral atrophy (3/5), hydrocephalus (2/5), congenital bilateral hip dysplasia (2/5), cerebellar atrophy (1/5), congenital diaphragmatic hernia (1/5), cranial nerve palsy (1/5), nystagmus (1/5), dysplastic kidney (1/5). Defects in heart development, body wall closure and other birth defects noted in mouse models. Sources: Expert list, Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4244 | NUP85 |
Zornitza Stark gene: NUP85 was added gene: NUP85 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NUP85 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NUP85 were set to 34170319; 30179222 Phenotypes for gene: NUP85 were set to Intellectual disability Review for gene: NUP85 was set to AMBER Added comment: Bi-allelic variants in this gene are associated with nephrotic syndrome in 3 families. Phenotype expansion: PMID: 34170319 - Ravindran et al 2021 report two pedigrees with an MCPH-SCKS phenotype spectrum without SRNS. In the first family, a 9 yo female, with consanguineous parents, is reported to have a missense variant in NUP85 (c.932G > A; p.R311Q). Intrauterine growth restriction was noticed. At birth microcephaly was observed (OFC < 3rd centile, < −3.6 SD) as well as hypotrophy [weight −2.8 SD), length 45 cm (−2.7 SD), both <3rd centile], facial dysmorphism, syndactyly, long and thin fingers, and bilateral pes adductus. She has severe developmental delay with strongly delayed motor milestones and absent speech. Drug-resistant, genetic epilepsy with focal-onset seizures started in the first year of life. She had no clinical, laboratory or radiological findings indicative of kidney dysfunction. In the second family, compound heterozygous missense variants in NUP85 were detected (c.1109A > G, c.1589 T > C;p.N370S, p.M530T ) in a fetus. MRI of the fetal brain at 24 + 2 GW indicated complete agenesis of the corpus callosum, abnormal sulcation in the left frontal lobe, nodularity of the frontal horn and trigone with focal puckering of the left lateral ventricle. PMID: 30179222 - Braun et al 2018 - 2 individuals from 1 of the families reported with steroid-resistant nephrotic syndrome were also reported to have intellectual disability but showed no structural brain defects. The degree of intellectual disability is not stated. They were found to have 2 compound heterozygous alleles (c.405+1G>A and c.1741G>C, p.Ala581Pro) in NUP85. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4233 | SPRED2 |
Dean Phelan gene: SPRED2 was added gene: SPRED2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPRED2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPRED2 were set to PMID: 34626534 Phenotypes for gene: SPRED2 were set to developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt Review for gene: SPRED2 was set to GREEN Added comment: PMID: 34626534 Homozygosity for three different variants c.187C>T (p.Arg63∗), c.299T>C (p.Leu100Pro), and c.1142_1143delTT (p.Leu381Hisfs∗95) were identified in four subjects from three families. All variants severely affected protein stability, causing accelerated degradation, and variably perturbed SPRED2 functional behaviour. The clinical phenotype of the four affected individuals included developmental delay, intellectual disability, cardiac defects, short stature, skeletal anomalies, and a typical facial gestalt as major features, without the occurrence of the distinctive skin signs characterizing Legius syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4233 | SPATA5L1 |
Paul De Fazio changed review comment from: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly. In 25 patients for whom full phenotype datasets were available, all 25 had ID. Sources: Literature; to: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly. ~53% of patients had ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4233 | SPATA5L1 |
Paul De Fazio gene: SPATA5L1 was added gene: SPATA5L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPATA5L1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPATA5L1 were set to 34626583 Phenotypes for gene: SPATA5L1 were set to Intellectual disability; spastic-dystonic cerebral palsy; epilepsy; hearing loss Review for gene: SPATA5L1 was set to GREEN gene: SPATA5L1 was marked as current diagnostic Added comment: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly. In 25 patients for whom full phenotype datasets were available, all 25 had ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4214 | ZNHIT3 |
Zornitza Stark gene: ZNHIT3 was added gene: ZNHIT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNHIT3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNHIT3 were set to 28335020; 28335020; 31048081 Phenotypes for gene: ZNHIT3 were set to PEHO syndrome, MIM# 260565 Review for gene: ZNHIT3 was set to GREEN Added comment: PEHO is a severe autosomal recessive neurodevelopmental disorder characterized by extreme cerebellar atrophy due to almost total loss of granule neurons. Affected individuals present in early infancy with hypotonia, profoundly delayed psychomotor development, optic atrophy, progressive atrophy of the cerebellum and brainstem, and dysmyelination. Most patients also develop infantile seizures that are often associated with hypsarrhythmia on EEG, and many have peripheral oedema. More than 20 affected individuals reported of Finnish origin, p.Ser31Leu is a founder variant. One compound het reported and supportive animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4213 | KIAA0556 |
Paul De Fazio gene: KIAA0556 was added gene: KIAA0556 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIAA0556 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIAA0556 were set to 26714646; 27245168 Phenotypes for gene: KIAA0556 were set to Joubert syndrome 26, MIM# 616784 Review for gene: KIAA0556 was set to GREEN gene: KIAA0556 was marked as current diagnostic Added comment: 5 individuals from two families reported, supportive mouse model. Individuals were reported to have (global) developmental delay. New HGNC approved name is KATNIP. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4207 | NDUFA8 |
Krithika Murali gene: NDUFA8 was added gene: NDUFA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NDUFA8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA8 were set to 32385911; 33153867 Phenotypes for gene: NDUFA8 were set to Mitochondrial complex I deficiency, nuclear type 37- 619272; Epilepsy; Microcephaly; Developmental Delay Review for gene: NDUFA8 was set to AMBER Added comment: 3 individuals from 2 unrelated families reported with phenotypic features including microcephaly (1/3), seizures (2/3), developmental delay (3/3) and MRI-B changes (3/3). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4203 | NSRP1 |
Krithika Murali gene: NSRP1 was added gene: NSRP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NSRP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NSRP1 were set to 34385670 Phenotypes for gene: NSRP1 were set to Epilepsy; Cerebral palsy; microcephaly; Intellectual disability Review for gene: NSRP1 was set to AMBER Added comment: Novel gene regulating splicing. Biallelic LoF pathogenic variants reported in 6 individuals from 3 unrelated families associated with a phenotype characterized by developmental delay, epilepsy, microcephaly, and spastic cerebral palsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4202 | GABRD |
Zornitza Stark gene: GABRD was added gene: GABRD was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABRD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABRD were set to 15115768; 34633442 Phenotypes for gene: GABRD were set to Intellectual disability; Epilepsy; Susceptibility to epilepsy, MIM#613060 Review for gene: GABRD was set to GREEN Added comment: Susceptibility to epilepsy, MIM#613060: Limited reports. The variant originally reported in PMID 15115768 in association with epilepsy is present in >4,000 hets in gnomad and 55 homs which is not consistent with a Mendelian disorder. PMID 34633442: 10 individuals with 7 unique variants reported in individuals with neurodevelopmental disorders and epilepsy. Six of the variants were demonstrated to be GoF, and those individuals with neurodevelopmental disorders with behavioural issues, various degrees of intellectual disability, generalized epilepsy with atypical absences and generalized myoclonic and/or bilateral tonic-clonic seizures. In contrast, the one individual carrying a loss-of-function variant had normal intelligence, no seizure history but has a diagnosis of autism spectrum disorder and suffering from elevated internalizing psychiatric symptoms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4194 | THG1L |
Krithika Murali gene: THG1L was added gene: THG1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: THG1L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: THG1L were set to 33682303 Phenotypes for gene: THG1L were set to Spinocerebellar ataxia, autosomal recessive 28 - 618800; Epilepsy; Intellectual Disability Review for gene: THG1L was set to AMBER Added comment: 3 individuals from 2 unrelated families of Ashkenazi Jewish descent with compound heterozygous variants ( p.Cys51Trp and p.Val55Ala) presented with profound developmental delays, microcephaly, intractable epilepsy, and cerebellar hypoplasia. Homozygous variants associated with ataxia phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4179 | BPTF | Zornitza Stark commented on gene: BPTF: Over 30 unrelated individuals reported, mostly de novo, some inherited variants. Clinical features include intellectual disability, seizures, poor growth with small head size, dysmorphic facial features, and mild abnormalities of the hands and feet. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4175 | SNIP1 | Zornitza Stark changed review comment from: Three Amish individuals with same homozygous variant, founder effect.; to: Four Amish individuals with same homozygous variant, founder effect. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4163 | ABHD16A |
Lucy Spencer gene: ABHD16A was added gene: ABHD16A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ABHD16A were set to PMID: 34587489 Phenotypes for gene: ABHD16A were set to Spastic paraplegia Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4148 | CPE | Zornitza Stark edited their review of gene: CPE: Added comment: Bosch et al. 2021 (PMID: 34383079) reported on 4 individuals from 3 additional families harbouring 2 different homozygous truncating variants in this gene. Clinical presentation was prominent for obesity and intellectual disability. Hypogonadotropic hypogonadism was confirmed in one individual and was suspected but not tested for in another two subjects.; Changed rating: GREEN; Changed publications: 26120850, 32936766, 34383079; Changed phenotypes: Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4140 | ATP6V0C |
Zornitza Stark gene: ATP6V0C was added gene: ATP6V0C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: ATP6V0C. Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V0C were set to 33190975; 33090716 Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly Review for gene: ATP6V0C was set to AMBER Added comment: 9 individuals reported with deletions and ID/seizures/microcephaly, minimum overlapping region implicates ATP6V0C as the causative gene. Single case report of de novo SNV and ID/seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4138 | ARFGEF1 |
Zornitza Stark gene: ARFGEF1 was added gene: ARFGEF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARFGEF1 were set to 34113008 Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy Review for gene: ARFGEF1 was set to GREEN Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | COPB2 |
Belinda Chong gene: COPB2 was added gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: COPB2 were set to PMID: 34450031 Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay Review for gene: COPB2 was set to AMBER Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis 3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to GREEN gene: ZNF668 was marked as current diagnostic Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4097 | ARF1 |
Zornitza Stark gene: ARF1 was added gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARF1 were set to 28868155; 34353862 Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185 Review for gene: ARF1 was set to GREEN Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4070 | ZNF699 |
Zornitza Stark gene: ZNF699 was added gene: ZNF699 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF699 were set to 33875846 Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488 Review for gene: ZNF699 was set to GREEN Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections. 12 unrelated families reported, 5 different homozygous frameshift variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4058 | ARF3 |
Konstantinos Varvagiannis gene: ARF3 was added gene: ARF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ARF3 were set to 34346499 Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system Penetrance for gene: ARF3 were set to unknown Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality. Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu. Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both. ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively. Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons. There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185). In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val). This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia. Evidence to support the effect of each variant include: Arg99Leu: Had identical Golgi localization to that of wt Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF) In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF). In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu) Asp67Val: Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant) Displayed decreased protein stability In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF) In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye. There is no associated phenotype in OMIM, G2P or SysID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4053 | PLXNA2 |
Konstantinos Varvagiannis gene: PLXNA2 was added gene: PLXNA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLXNA2 were set to 34327814 Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology Penetrance for gene: PLXNA2 were set to Incomplete Review for gene: PLXNA2 was set to AMBER Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants. The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members. Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)). Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed). The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed). Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved. Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele. As the authors discuss: *PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration. *Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch. *Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD. *Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus. Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg: - Cyanotic heart disease explaining discordance in cognitive outcome among sibs - Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or - Additional pathogenic variants possibly explaining the CHD in the first subject. There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4051 | VPS50 |
Konstantinos Varvagiannis gene: VPS50 was added gene: VPS50 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS50 were set to 34037727 Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum Penetrance for gene: VPS50 were set to Complete Review for gene: VPS50 was set to AMBER Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants. Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging. Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)). VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor. As discussed by Schneeberger et al (refs provided in text): - VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development. - Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality. Studies performed by Schneeberger et al included: - Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del). - Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels. - Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts. - Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function. As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders". There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes. Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4040 | PIDD1 |
Konstantinos Varvagiannis gene: PIDD1 was added gene: PIDD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010 Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum Penetrance for gene: PIDD1 were set to Complete Review for gene: PIDD1 was set to GREEN Added comment: There is enough evidence to include this gene in the current panel with green rating. Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested. The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families]. Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants. Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder. PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage. There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation. Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants. Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26 Evidence so far provided includes: - Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern. - Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability. - Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp] - Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain. - Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD. Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects. There is currently no associated phenotype in OMIM, PanelApp Australia. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes. Overall the gene appears to be relevant for the epilepsy panel, panels for gyration and/or corpus callosum anomalies etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4033 | ACTL6A |
Zornitza Stark changed review comment from: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain.; to: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain. PMID 31994175: fourth individual reported, recurrent de novo p.Arg377Trp |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4033 | ACTL6A | Zornitza Stark changed review comment from: Two individuals from unrelated families reported with missense variants in this gene. Part of the BAF complex. Only one confirmed de novo.; to: Two individuals from unrelated families reported with missense variants in this gene, and one with a splice-site variant. Part of the BAF complex. Only one missense confirmed de novo, pathogenicity of the other variant uncertain. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4028 | MAST3 |
Zornitza Stark gene: MAST3 was added gene: MAST3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAST3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAST3 were set to 34185323 Phenotypes for gene: MAST3 were set to Developmental and epileptic encephalopathy Review for gene: MAST3 was set to GREEN Added comment: Eleven individuals reported with de novo missense variants in the STK domain, including two recurrent variants p.G510S (n = 5) and p.G515S (n = 3). All 11 individuals had developmental and epileptic encephalopathy, with 8 having normal development prior to seizure onset at <2 years of age. All patients developed multiple seizure types, 9 of 11 patients had seizures triggered by fever and 9 of 11 patients had drug-resistant seizures. Limited functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4023 | AP1G1 |
Zornitza Stark changed review comment from: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. Sources: Literature; to: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. GREEN for mono-allelic, AMBER for bi-allelic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4023 | AP1G1 |
Zornitza Stark gene: AP1G1 was added gene: AP1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AP1G1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: AP1G1 were set to 34102099 Phenotypes for gene: AP1G1 were set to Neurodevelopmental disorder (NDD); Intellectual Disability; Epilepsy Review for gene: AP1G1 was set to GREEN Added comment: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4020 | CLCN3 |
Zornitza Stark gene: CLCN3 was added gene: CLCN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLCN3 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: CLCN3 were set to 34186028 Phenotypes for gene: CLCN3 were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CLCN3 was set to Other Review for gene: CLCN3 was set to GREEN Added comment: 11 individuals reported, 9 that carried 8 different rare heterozygous missense variants in CLCN3, and 2 siblings that were homozygous for an NMD-predicted frameshift variant likely abolishing ClC-3 function. All missense variants were confirmed to be de novo in eight individuals for whom parental data was available. The 11 individuals in the cohort share clinical features of variable severity. All 11 have GDD or ID and dysmorphic features, and a majority has mood or behavioural disorders and structural brain abnormalities: - Structural brain abnormalities on MRI (9/11) included partial or full agenesis of the corpus callosum (6/9), disorganized cerebellar folia (4/9), delayed myelination (3/9), decreased white matter volume (3/9), pons hypoplasia (3/9), and dysmorphic dentate nuclei (3/9). Six of those with brain abnormalities also presented with seizures. - Nine have abnormal vision, including strabismus in four and inability to fix or follow in the two with homozygous loss-of-function variants. - Hypotonia ranging from mild to severe was reported in 7 of the 11 individuals. - Six have mood or behavioural disorders, particularly anxiety (3/6). - Consistent dysmorphic facial features included microcephaly, prominent forehead, hypertelorism, down-slanting palpebral fissures, full cheeks, and micrognathia. The severity of disease in the two siblings with homozygous disruption of ClC-3 is consistent with the drastic phenotype seen in Clcn3 KO mice. The disease was more severe in two siblings carrying homozygous loss-of-function variants with the presence of GDD, absent speech, seizures, and salt and pepper fundal pigmentation in both individuals, with one deceased at 14 months of age. The siblings also had significant neuroanatomical findings including diffusely decreased white matter volume, thin corpora callosa, small hippocampi, and disorganized cerebellar folia. Supporting biallelic inheritance for LoF variants, disruption of mouse Clcn3 results in drastic neurodegeneration with loss of the hippocampus a few months after birth and early retinal degeneration. Clcn3−/− mice display severe neurodegeneration, whereas heterozygous Clcn3+/− mice appear normal. Patch-clamp studies were used to investigate four of the missense variants. These suggested a gain of function in two variants with increased current in HEK cells, however they also showed reduced rectification of voltage and a loss of transient current, plus decreased current amplitude, glycosylation and surface expression when expressed in oocytes, and were suspected to interfere with channel gating and a negative feedback mechanism. These effects were also shown to vary depending on pH levels. The current of the remaining two variants did not differ from WT. For heterozygous missense variants, the disruption induced may be at least partially conferred to mutant/WT homodimers and mutant/ClC-4 heterodimers. Both loss and gain of function in this gene resulted in the same phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4016 | SPTBN1 |
Belinda Chong changed review comment from: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature; to: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures (9/29); behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4015 | SPTBN1 |
Belinda Chong gene: SPTBN1 was added gene: SPTBN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPTBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPTBN1 were set to PMID: 34211179 PMID: 33847457 Phenotypes for gene: SPTBN1 were set to Neurodevelopmental Syndrome Review for gene: SPTBN1 was set to GREEN Added comment: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4013 | EDEM3 |
Michelle Torres gene: EDEM3 was added gene: EDEM3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EDEM3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EDEM3 were set to 34143952 Phenotypes for gene: EDEM3 were set to EDEM3-congenital disorder of glycosylation Review for gene: EDEM3 was set to GREEN Added comment: PMID: 34143952: 7 families (11 individuals) with 6x PTV and 2x missense variants with neurodevelopmental delay and variable facial dysmorphisms. The unaffected parents were all heterozygous carriers. Functional show LoF of EDEM3 enzymatic activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4002 | SYNCRIP |
Konstantinos Varvagiannis gene: SYNCRIP was added gene: SYNCRIP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SYNCRIP were set to 34157790; 30504930; 27479843; 23020937 Phenotypes for gene: SYNCRIP were set to Global developmental delay; Intellectual disability; Autism; Myoclonic atonic seizures; Abnormality of nervous system morphology Review for gene: SYNCRIP was set to AMBER Added comment: Semino et al (2021 - PMID: 34157790) provide clinical details on 3 unrelated individuals with de novo SYNCRIP variants and provide a review of 5 additional subjects previously identified within large cohorts in the literature and databases. Features included DD, ID (7/7 for whom this information was available), ASD or autistic features (4/7). MRI abnormalities were observed in 3 (widening of CSF spaces, periventricular nodular heterotopia, prominent lat. ventricles). Epilepsy (myoclonic-astatic epilepsy / Doose syndrome) was reported for 2(/8) individuals. The 3 patients here reported were identified following trio/singleton exome with Sanger confirmation of the variants and their de novo occurrence. Variants are in almost all cases de novo (7/7 for whom this was known) and in 5/8 cases were pLoF, in 2/8 missense SNVs while a case from DECIPHER had a 77.92 kb whole gene deletion not involving other genes with unknown inheritance. Overall the variants reported to date include [NM_006372.5]: 1 - c.858_859del p.(Gly287Leufs*5) 2 - c.854dupA p.(Asn285Lysfs*8) 3 - c.734T>C p.(Leu245Pro) 4 - chr6:85605276-85683190 deletion (GRCh38) 5 - c.629T>C p.(Phe210Ser) 6 - c.1573_1574delinsTT p.(Gln525Leu) 7 - c.1247_1250del p.(Arg416Lysfs*145) 8 - c.1518_1519insC p.(Ala507Argfs*14) [P1-3: this report, P4: DECIPHER 254774, P5-6: Guo et al 2019 - PMID: 30504930, P7: Lelieveld et al 2016 - PMID: 27479843, P8: Rauch et al 2012 - PMID: 23020937 / all other Refs not here reviewed, clinical details summarized by Semino et al in table 1] SYNCRIP (also known as HNRNPQ) encodes synaptotagmin‐binding cytoplasmic RNA‐interacting protein. As the authors note, this RNA-binding protein is involved in multiple pathways associated with neuronal/muscular developmental disorders. Several references are provided for its involvement in regulation of RNA metabolism, among others sequence recognition, pre-mRNA splicing, translation, transport and degradation. Mutations in other RNA-interacting proteins and hnRNP members (e.g. HNRNPU, HNRNPD) are associated with NDD. The missense variant (p.Leu245Pro) is within RRM2 one of the 3 RNA recognition motif (RRM) domains of the protein. These 3 domains, corresponding to the central part of the protein (aa 150-400), are relatively intolerant to variation (based on in silico predictions and/or variation in gnomAD). Leu245 localizes within an RNA binding pocket and in silico modeling suggests alteration of the tertiary structure and RNA-binding capacity of RRM2. There are no additional studies performed. Overall haploinsufficiency appears to be the underlying disease mechanism based on the truncating variants and the gene deletion. [pLI in gnomAD : 1, %HI : 2.48%] Animal models are not discussed. There is no associated phenotype in OMIM. This gene is included in the DD panel of G2P (monoallelic LoF variants / SYNCRIP-related developmental disorder). SysID also lists SYNCRIP within the current primary ID genes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4001 | CAMK4 |
Konstantinos Varvagiannis gene: CAMK4 was added gene: CAMK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: CAMK4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CAMK4 were set to 30262571; 33098801; 33211350 Phenotypes for gene: CAMK4 were set to Global developmental delay; Intellectual disability; Autism; Behavioral abnormality; Abnormality of movement; Dystonia; Ataxia; Chorea; Myoclonus Penetrance for gene: CAMK4 were set to Complete Review for gene: CAMK4 was set to GREEN Added comment: 3 publications by Zech et al (2018, 2020 - PMIDs : 30262571, 33098801, 33211350) provide clinical details on 3 individuals, each harboring a private de novo CAMK4 variant. Overlapping features included DD, ID, behavoral issues, autism and abnormal hyperkinetic movements. Dystonia and chorea in all 3 appeared 3-20 years after initial symptoms. CAMK4 encodes Calcium/Calmodulin-dependent protein kinase IV, an important mediator of calcium-mediated activity and dynamics, particularly in the brain. It is involved in neuronal transmission, synaptic plasticity, and neuronal gene expression required for brain development and neuronal homeostasis (summary by OMIM based on Zech et al, 2018). The 473 aa enzyme has a protein kinase domain (aa 46-300) and a C-terminal autoregulatory domain (aa 305-341) the latter comprising an autoinhibitory domain (AID / aa 305-321) and a calmodulin-binding domain (CBD / aa 322-341) [NP_001735.1 / NM_001744.4 - also used below]. Variants in all 3 subjects were identified following trio-WES and were in all cases protein-truncating, mapping to exon 10 or exon 10-intron 10 junction, expected to escape NMD and cause selective abrogation of the autoinhibitory domain (aa 305-321) leading overall to gain-of-function. Variation databases include pLoF CAMK4 variants albeit in all cases usptream or downstream of this region (pLI of this gene in gnomAD: 0.51). Variants leading to selective abrogation of the autoregulatory domain have not been reported. Extensive evidence for the GoF effect of the variant has been provided in the first publication. Several previous studies have demonstrated that abrogation of the AID domain leads to consitutive activation (details below). Mouse models - though corresponding to homozygous loss of function - support a role for CAMKIV in cognitive and motor symptoms. Null mice display tremulous and ataxic movements, deficiencies in balance and sensorimotor performance associated with reduced number of Purkinje neurons (Ribar et al 2000, PMID: 11069976 - not reviewed). Wei et al (2002, PMID: 12006982 - not reviewed) provided evidence for alteration in hippocampal physiology and memory function. Heterozygous mutations in other genes for calcium/calmodulin-dependent protein kinases (CAMKs) e.g. CAMK2A/CAMK2B (encoding subunits of CAMKII) have been reported in individuals with ID. --- The proband in the first publication (PMID: 30262571) was a male with DD, ID, behavioral difficulties (ASD, autoaggression, stereotypies) and hyperkinetic movement disorder (myoclonus, chorea, ataxia) with severe generalized dystonia (onset at the age of 13y). Brain MRI demonstrated cerebellar atrophy. Extensive work-up incl. karyotyping, CMA, DYT-TOR1A, THAP1, GCH1, SCA1/2/3/6/7/8/12/17, Friedreich's ataxia and FMR1 analysis was negative.F Trio WES identified a dn splice site variant (c.981+1G>A) in the last exon-intron junction. RT-PCR followed by gel electrophoresis and Sanger in fibroblasts from an affected and control subject revealed that the proband had - as predicted by the type/location of the variant - in equal amount 2 cDNA products, a normal as well as a truncated one. Sequencing of the shortest revealed utilization of a cryptic donor splice site upstream of the mutated donor leading to a 77bp out-of-frame deletion and introduction of a premature stop codon in the last codon (p.Lys303Serfs*28). Western blot in fibroblast cell lines revealed 2 bands corresponding to the normal protein product as well as to the p.Lys303Serfs*28 although expression of the latter was lower than that of the full length protein. Several previous studies have shown that mutant CAMKIV species that lack the autoinhibitory domain are consitutively active (several Refs provided). Among others Chatila et al (1996, PMID: 8702940) studied an in vitro-engineered truncation mutant (Δ1-317 - truncation at position 317 of the protein) with functionally validated gain-of-function effect. To prove enhanced activity of the splicing variant, Zech et al assessed phosphorylation of CREB (cyclic AMP-responsive element binding protein), a downstream substrate of CAMKIV. Immunobloting revealed significant increase of CREB phosphorylation in patient fibroblasts compared to controls. Overactivation of CAMKIV signaling was reversed when cells were treated with STO-609 an inhibitor of CAMKK, the ustream activator of CAMKIV. Overall the authors demonstrated that loss of CAMKIV autoregulatory domain due to this splice variant had a gain-of-function effect. ---- Following trio-WES, Zech et al (2020 - PMID: 33098801) identified another relevant subject within cohort of 764 individuals with dystonia. This 12-y.o. male, harboring a different variant affecting the same donor site (c.981+1G>T), presented DD, ID, dystonia (onset at 3y) and additional movement disorders (myoclonus, ataxia) as well as similar behavior (ASD, autoaggression, stereotypies). [Details in suppl. p20]. ---- Finally Zech et al (2020 - PMID: 33211350) reported on a 24-y.o. woman with adolescence onset choreodystonia. Other features included DD, moderate ID, absence seizures in infancy, OCD with anxiety and later diagnosis of ASD. Trio WES revealed a dn stopgain variant (c.940C>T; p.Gln314*). ---- There is no associated phenotype in OMIM, G2P. In SysID CAMK4 is listed among the current primary ID genes. ---- Please consider inclusion in other relevant panels. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3982 | CEP85L |
Zornitza Stark gene: CEP85L was added gene: CEP85L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CEP85L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CEP85L were set to 32097630 Phenotypes for gene: CEP85L were set to Lissencephaly, posterior predominant Review for gene: CEP85L was set to GREEN Added comment: Thirteen individuals reported with mono allelic variants in this gene, inherited in two of the families. Mouse model had neuronal migration defects. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3978 | LINGO4 |
Laura Raiti gene: LINGO4 was added gene: LINGO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LINGO4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LINGO4 were set to PMID: 33098801 Phenotypes for gene: LINGO4 were set to Developmental Delay, Intellectual disability, speech disorder Review for gene: LINGO4 was set to GREEN Added comment: 3 unrelated individuals 1 x individual compound heterozygous for 2x missense variants: c.679C>A; c.1262G>A p.Leu227Met; p.Arg421Gln comp het. Phenotype: infancy-onset generalized dystonia; DD/hypo, ID, speech disorder (isolated plus non-MD symptoms) NDD 1 x individual homozygous for missense variant: c.679C>A p.Leu227Met Phenotype: DD/hypo, ID, speech disorder 1 x individual homozygous for missense variant: c.1673G>A p.Ser558Asn Phenotype: DD/hypo, ID, speech disorder Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3978 | IMPDH2 |
Laura Raiti gene: IMPDH2 was added gene: IMPDH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IMPDH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: IMPDH2 were set to PMID: 33098801 Added comment: 6 unrelated individuals 1x individual in a dystonia cohort index case with infancy-onset dystonia and other neurological manifestations with a de-novo missense variant, c.338G>A (p.Gly113Glu) in IMPDH2, predicted to disrupt an invariant residue within the cystathionine-β-synthase (CBS) domain pair of the encoded protein. IMPDH2 encodes IMPDH2, a key enzyme in the purine biosynthetic pathway, expressed throughout the brain and not linked previously to any human Mendelian condition. 1x individual with a de-novo substitution, c.337G>A (p.Gly113Arg), was found in in-house whole-exome sequencing data from 500 individuals with neurodevelopmental disorders. Through GeneMatcher, de novo variants identified: 3 x missense: c.729G>C (p.Gln243His), c.619G>C (p.Gly207Arg), and c.619G>A (p.Gly207Arg) 1 x deletion: c.478_480delTCC (p.Ser160del) The six variants were predicted to be deleterious and none of them seen in control databases. All affected conserved amino acids and resided in and around the cystathionine-β-synthase domain pair. The described variants are situated in and around the CBS domain pair, a regulatory element in which clustering of pathogenic missense variants has already been shown for the homologue of IMPDH2, IMPDH1. The variant carriers shared similar neurodevelopmental phenotypes. Apart from the dystonia cohort index case, one participant had evidence of dystonic posturing. Modelling of the variants on 3D protein structures revealed spatial clustering near specific functional sites, predicted to result in deregulation of IMPDH2 activity. Additionally, thermal-shift assays showed that the c.619G>A (p.Gly207Arg) variant, identified as within the CBS domain pair, and c.729G>C (p.Gln243His), which is in close vicinity, affected the stability or folding behaviour of IMPDH2. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3978 | ATG7 |
Zornitza Stark changed review comment from: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk. Functional data including mouse model. Sources: Literature; to: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk. Functional data including mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3978 | ATG7 |
Zornitza Stark changed review comment from: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The ore severely affected individuals had spastic paraplegia and inability to walk. Functional data including mouse model. Sources: Literature; to: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk. Functional data including mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3977 | ATG7 |
Zornitza Stark gene: ATG7 was added gene: ATG7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATG7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATG7 were set to 34161705 Phenotypes for gene: ATG7 were set to Spinocerebellar ataxia, SCAR31, MIM#619422 Review for gene: ATG7 was set to GREEN Added comment: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The ore severely affected individuals had spastic paraplegia and inability to walk. Functional data including mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3975 | C2orf69 |
Zornitza Stark gene: C2orf69 was added gene: C2orf69 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: C2orf69 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C2orf69 were set to 34038740; 33945503 Phenotypes for gene: C2orf69 were set to Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423 Review for gene: C2orf69 was set to GREEN Added comment: PMID 34038740: 20 affected children from 8 unrelated families reported, presenting with fatal syndrome consisting of severe autoinflammation and progredient leukoencephalopathy with recurrent seizures; 12 of these subjects, whose DNA was available, segregated homozygous loss-of-function C2orf69 variants. Endogenous C2ORF69 was found to be (1) loosely bound to mitochondria, (2) affects mitochondrial membrane potential and oxidative respiration in cultured neurons, and (3) controls the levels of the glycogen branching enzyme 1 (GBE1) consistent with a glycogen-storage-associated mitochondriopathy. Zebrafish model. PMID 33945503: 8 individuals from 5 families reported with muscle hypotonia, developmental delay, progressive microcephaly, and brain MRI abnormalities. Age at onset ranged from birth to 6 months of age. Six patients had vision impairment, liver abnormalities, inflammation/inflammatory arthritis, and 5 patients had seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3955 | HID1 |
Zornitza Stark gene: HID1 was added gene: HID1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HID1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HID1 were set to 33999436 Phenotypes for gene: HID1 were set to Syndromic infantile encephalopathy; Hypopituitarism Review for gene: HID1 was set to GREEN Added comment: 7 individuals from 6 unrelated families reported. Clinical features included: hypopituitarism in combination with brain atrophy, thin corpus callosum, severe developmental delay, visual impairment, and epilepsy Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3951 | JPH3 |
Seb Lunke gene: JPH3 was added gene: JPH3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: JPH3 was set to Unknown Publications for gene: JPH3 were set to 33824468 Phenotypes for gene: JPH3 were set to Intellectual disability; dystonia Review for gene: JPH3 was set to RED Added comment: One homozygous truncating variant (NM_020655.4: c.1740dup; p.(Val581Argfs*137)) found in a female individual affected with genetically undetermined neurodevelopmental anomalies (including delayed motor milestones, abnormal social communication, language difficulties and borderline cognitive impairment) and paroxysmal attacks of dystonia since her early infancy. No functional work were performed. Only STRs disease causing, see separate STR list. No evidence for SNVs etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3945 | ATP1A2 | Zornitza Stark edited their review of gene: ATP1A2: Added comment: PMID 33880529: six individuals with de novo missense variants reported and DD/EE/PMG.; Changed publications: 33880529; Changed phenotypes: Alternating hemiplegia of childhood 1, MIM# 104290, Developmental and epileptic encephalopathy, polymicrogyria | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3943 | ATP1A3 | Zornitza Stark edited their review of gene: ATP1A3: Added comment: PMID 33880529: 16 individuals reported with DD/EE and PMG.; Changed rating: GREEN; Changed publications: 33880529; Changed phenotypes: Alternating hemiplegia of childhood 2, MIM#614820, Developmental and epileptic encephalopathy, polymicrogyria | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3937 | EPHA7 |
Zornitza Stark gene: EPHA7 was added gene: EPHA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: EPHA7. Mode of inheritance for gene: EPHA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPHA7 were set to 34176129 Phenotypes for gene: EPHA7 were set to Intellectual disability Review for gene: EPHA7 was set to AMBER Added comment: Lévy et al (2021 - PMID: 34176129) provide evidence that haploinssuficiency of EPHA7 results in a neurodevelopmental disorder. The authors report on 12 individuals belonging to 9 unrelated families, all harboring with 6q microdeletions spanning EPHA7. Overlapping features included DD (13/13), ID (10/10 - mild in most cases, individuals with larger CNVs/additional variants had more severe phenotype), speech delay and behavioral disorders. Variable other features incl. hypotonia (70%), non specific facial features, eye abnormalities (40%) and cardiac defects (25%). The CNVs ranged from 152 kb to few Mb in size but in 4 subjects (P5-8) were only minimal, involving only EPHA7. 9 out of 12 individuals had inherited the deletion (5 subjects paternal, 4 maternal), in 1 subject (P12) this occured de novo, while for 2 others inheritance was not specified. Most deletions were inherited from an unaffected parent (in 6/7 families), with unclear contribution in a further one. The authors discuss on previous studies suggesting an important role for EphA7 in brain development (modulation of cell-cell adhesion and repulsion, regulation of dendrite morphogenesis in early corticogenesis, role in dendritic spine formation later in development. EphA7 has also been proposed to drive neuronal maturation and synaptic function). Haploinsufficiency for other ephrins or ephrin receptors has been implicated in other NDDs. Overall Lévy et al promote incomplete penetrance and variable expressivity with haploinsufficiency of this gene being a risk factor for NDD. [The gene has also an %HI of 2.76% and a pLI of 1]. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3929 | ATP9A |
Zornitza Stark gene: ATP9A was added gene: ATP9A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP9A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATP9A were set to http://dx.doi.org/10.1136/jmedgenet-2021-107843 Phenotypes for gene: ATP9A were set to Neurodevelopmental delay; Postnatal microcephaly; Failure to thrive; Gastrointestinal symptoms Review for gene: ATP9A was set to AMBER Added comment: Vogt et al. 2021 report on 3 individuals from 2 unrelated consanguineous families with different homozygous truncating variants in ATP9A, presenting with DD/ID of variable degree (2 mild, 1 severe), postnatal microcephaly (OFC range: −2.33 SD to −3.58 SD), failure to thrive, and gastrointestinal symptoms. Patient-derived fibroblasts showed reduced expression of ATP9A, and consistent with previous findings also overexpression of interacting partners, ARPC3 and SNX3. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3913 | CEP164 |
Zornitza Stark gene: CEP164 was added gene: CEP164 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CEP164 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CEP164 were set to 34132027; 34013113; 32055034; 27708425; 22863007 Phenotypes for gene: CEP164 were set to Bardet-Biedl syndrome; Nephronophthisis 15, MIM# 614845; Oro-facio-digital syndrome Review for gene: CEP164 was set to GREEN Added comment: More than 10 unrelated families reported. Although this is labelled as a nephronophthisis gene in OMIM, some of the reported individuals have had features such as retinal involvement, ID and polydactyly to suggest a more BBS-like phenotype. Also note one individual reported with OFD-like phenotype. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3875 | IFT74 |
Zornitza Stark gene: IFT74 was added gene: IFT74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IFT74 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT74 were set to 27486776; 32144365; 33531668 Phenotypes for gene: IFT74 were set to Bardet-Biedl syndrome 20, MIM# 617119; Joubert syndrome Review for gene: IFT74 was set to GREEN Added comment: Two individuals reported with BBS phenotype. PMID 33531668: Identified IFT74 as a JBTS-associated gene in 3 unrelated families through WES. All the affected individuals carried truncated variants and shared one missense variant (p.Q179E) found only in East Asians. The expression of the human p.Q179E-IFT74 variant displayed compromised rescue effects in zebrafish ift74 morphants. Attenuated ciliogenesis; altered distribution of IFT proteins and ciliary membrane proteins, including ARL13B, INPP5E, and GPR161; and disrupted hedgehog signaling were observed in patient fibroblasts with IFT74 variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3864 | RFX4 |
chirag patel gene: RFX4 was added gene: RFX4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RFX4 were set to PMID: 33658631 Phenotypes for gene: RFX4 were set to ID, ASD, ADHD Review for gene: RFX4 was set to GREEN Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3864 | RFX3 |
chirag patel gene: RFX3 was added gene: RFX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RFX3 were set to PMID: 33658631 Phenotypes for gene: RFX3 were set to ID, ASD, ADHD Review for gene: RFX3 was set to GREEN Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3864 | RFX7 |
chirag patel gene: RFX7 was added gene: RFX7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFX7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RFX7 were set to PMID: 33658631 Phenotypes for gene: RFX7 were set to ID, ASD, ADHD Review for gene: RFX7 was set to GREEN Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3862 | FARSA |
chirag patel gene: FARSA was added gene: FARSA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FARSA were set to PMID: 33598926 Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2 Review for gene: FARSA was set to GREEN gene: FARSA was marked as current diagnostic Added comment: FARSA is a subunit with FARSB to form FARS1 enzyme. Bi-allelic mutations in FARSB are well described. Schuch et al. (2021) report 3 unrelated individuals with bi-allelic variants in FARSA. Identified through WES and variants segregated with disease. Functional evidence was obtained with reduced FARS1 enzyme activity levels in fibroblasts or EBV-transformed lymphoblastoid cell lines (EBV-LCLs) of patients. Common to all was a chronic interstitial lung disease starting early in life and characterized by bilateral ground-glass opacification on HR-CT, and cholesterol pneumonitis in lung histology. Additional abnormalities in other organ systems include liver disease, neurological manifestations, and growth restriction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3847 | LTBP1 |
Chern Lim changed review comment from: PMID:33991472 - Premature truncating variants in multiple affected individuals from 4 unrelated consanguineous families. - Affected individuals present with connective tissue features (cutis laxa and inguinal hernia), craniofacial dysmorphology, variable heart defects, and prominent skeletal features (craniosynostosis, short stature, brachydactyly, and syndactyly). - Most of the affected individuals have developmental delay and other neurological features. - Functional studies done on patient fibroblasts and zebrafish models. Sources: Literature; to: PMID:33991472 - Premature truncating variants in multiple affected individuals from 4 unrelated consanguineous families. - Affected individuals present with connective tissue features (cutis laxa and inguinal hernia), craniofacial dysmorphology, variable heart defects, and prominent skeletal features (craniosynostosis, short stature, brachydactyly, and syndactyly). - Most of the affected individuals have developmental delay and other neurological features. - Functional studies done on patient fibroblasts and zebrafish models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3847 | LTBP1 |
Chern Lim gene: LTBP1 was added gene: LTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LTBP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LTBP1 were set to 33991472 Phenotypes for gene: LTBP1 were set to cutis laxa syndrome Review for gene: LTBP1 was set to GREEN gene: LTBP1 was marked as current diagnostic Added comment: PMID:33991472 - Premature truncating variants in multiple affected individuals from 4 unrelated consanguineous families. - Affected individuals present with connective tissue features (cutis laxa and inguinal hernia), craniofacial dysmorphology, variable heart defects, and prominent skeletal features (craniosynostosis, short stature, brachydactyly, and syndactyly). - Most of the affected individuals have developmental delay and other neurological features. - Functional studies done on patient fibroblasts and zebrafish models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3847 | PGM2L1 |
Chern Lim gene: PGM2L1 was added gene: PGM2L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PGM2L1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PGM2L1 were set to 33979636 Phenotypes for gene: PGM2L1 were set to Neurodevelopmental disorder Review for gene: PGM2L1 was set to GREEN gene: PGM2L1 was marked as current diagnostic Added comment: PMID: 33979636: - Hom/chet PTVs in 4 unrelated individuals. All four affected individuals had severe developmental and speech delay, dysmorphic facial features, ear anomalies, high arched palate, strabismus, hypotonia, and keratosis pilaris. Early obesity and seizures were present in three individuals. - Studies on patient fibroblasts and cell lines indicated that PGM2L1 deficiency causes a decrease, but not a disappearance, of the sugar bisphosphates needed for the formation of NDP-sugars and that there is no evidence that this leads to a glycosylation defect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3845 | BCAS3 |
Paul De Fazio gene: BCAS3 was added gene: BCAS3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BCAS3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BCAS3 were set to 34022130 Phenotypes for gene: BCAS3 were set to Syndromic neurodevelopmental disorder Review for gene: BCAS3 was set to GREEN gene: BCAS3 was marked as current diagnostic Added comment: 15 individuals from eight unrelated families with germline bi-allelic loss-of-function variants in BCAS3. All probands share a global developmental delay accompanied by pyramidal tract involvement, microcephaly, short stature, strabismus, dysmorphic facial features, and seizures. Patient fibroblasts confirmed absence of BCAS3 protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3845 | SRCAP |
Paul De Fazio changed review comment from: Truncating variants in exons 33 and 34 of the SNF2-related CREBBP activator protein (SRCAP) gene cause the neurodevelopmental disorder Floating-Harbor syndrome (FLHS). A cohort of 33 individuals with mostly de novo truncating variants both proximal and distal to the FLHS locus were found to have a distinct phenotype and DNA methylation pattern to FLHS.; to: Truncating variants in exons 33 and 34 of the SNF2-related CREBBP activator protein (SRCAP) gene cause the neurodevelopmental disorder (NDD) Floating-Harbor syndrome (FLHS). A cohort of 33 individuals with mostly de novo truncating variants both proximal and distal to the FLHS locus were found to have a distinct phenotype and DNA methylation pattern to FLHS, referred to by the authors as "non-FLHS SRCAP-related NDD". |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3820 | EHMT1 | Zornitza Stark commented on gene: EHMT1: Well established gene-disease association. Deletions are common. Key features includeID/seizures/microcephaly/dysmorphism/congenital anomalies. More than 100 individuals reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3802 | PSMC3 |
Zornitza Stark gene: PSMC3 was added gene: PSMC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSMC3 were set to 32500975 Phenotypes for gene: PSMC3 were set to Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354 Review for gene: PSMC3 was set to AMBER Added comment: Three affected individuals from a single consanguineous family reported with homozygous intronic variant. Animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3800 | GEMIN5 |
Zornitza Stark gene: GEMIN5 was added gene: GEMIN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GEMIN5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GEMIN5 were set to 33963192 Phenotypes for gene: GEMIN5 were set to Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, MIM# 619333 Review for gene: GEMIN5 was set to GREEN Added comment: Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction (NEDCAM) is an autosomal recessive disorder characterized by global developmental delay with prominent motor abnormalities, mainly axial hypotonia, gait ataxia, and appendicular spasticity. Affected individuals have cognitive impairment and speech delay; brain imaging shows cerebellar atrophy. 30 individuals from 22 unrelated families reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3787 | PARP6 |
Zornitza Stark gene: PARP6 was added gene: PARP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PARP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PARP6 were set to Cells 2021, 10(6), 1289; https://doi.org/10.3390/cells10061289 Phenotypes for gene: PARP6 were set to Intellectual disability; Epilepsy; Microcephaly Review for gene: PARP6 was set to GREEN Added comment: Four unrelated individuals reported with de novo variants in this gene and a neurodevelopmental phenotype. Supportive functional data. One pair of siblings with a homozygous missense: limited evidence for bi-allelic variants causing disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3786 | UFSP2 |
Konstantinos Varvagiannis changed review comment from: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature; to: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. **Monoallelic** (correction to previous review) UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3785 | UFSP2 |
Konstantinos Varvagiannis gene: UFSP2 was added gene: UFSP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UFSP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UFSP2 were set to 33473208 Phenotypes for gene: UFSP2 were set to Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus Penetrance for gene: UFSP2 were set to Complete Review for gene: UFSP2 was set to AMBER Added comment: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3775 | CPE |
Zornitza Stark gene: CPE was added gene: CPE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CPE was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CPE were set to 26120850; 32936766 Phenotypes for gene: CPE were set to Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326 Review for gene: CPE was set to AMBER Added comment: Four affected individuals from two unrelated families reported, bi-allelic LoF variants. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3771 | SMARCA5 |
Zornitza Stark gene: SMARCA5 was added gene: SMARCA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMARCA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMARCA5 were set to 33980485 Phenotypes for gene: SMARCA5 were set to Neurodevelopmental disorder; microcephaly; dysmorphic features Review for gene: SMARCA5 was set to GREEN Added comment: 12 individuals reported with either de novo or appropriately segregating variants in this gene and mild developmental delay, frequent postnatal short stature and microcephaly, and recurrent dysmorphic features. Functional data supports gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3753 | TMEM222 |
Konstantinos Varvagiannis gene: TMEM222 was added gene: TMEM222 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM222 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM222 were set to 33824500 Phenotypes for gene: TMEM222 were set to Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality Penetrance for gene: TMEM222 were set to Complete Review for gene: TMEM222 was set to GREEN Added comment: Polla et al (2021 - PMID: 33824500) report 17 individuals from 9 unrelated families, with biallelic TMEM222 pathogenic variants. The phenotype included motor, speech delay and moderate to severe ID (as universal features). Other manifestations included hypotonia (10/15), broad gait (5/12), seizures (7/17 - belonging to 6/9 families), MRI abnormalities (5/8). Variable behavioral abnormalities were observed (aggressive behavior, shy character, stereotypic movements etc). Abnormal OFC was a feature in several with microcephaly in 7 subjects from 4 families (measurements not available for all 17). Nonspecific facial features were reported in 10/17. Rare features incl. body tremors, decreased lower extremity muscle mass or disorder of motor neurons. TMEM222 variants were identified following exome sequencing. Previous investigations incl. metabolic studies, FMR1, chromosomes by standard karyotype or CMA, SMA, CMT1A were reported to be normal (available for some individuals). TMEM222 variants missense and pLoF ones mostly found in homozygosity (7/9 families were consanguineous, compound heterozygosity reported in a single case from the 9 families). Sanger sequencing was used for confirmation of variants, parental carrier state as well as testing of sibs (unaffected sibs tested in 4 families). Few individuals had additional genetic findings in other genes, though classified as VUS (3 families). The gene encodes transmembrane protein 222 (208 residues) which however has unknown function. The protein comprises 3 transmembrane domains and a domain of unknown function. TMEMs are a group of transmembrane proteins spanning membranes with - most commonly - unclear function. The authors measured expression by qPCR mRNA analysis, demonstrating highest fetal and adult brain expression (incl. parietal and occipital cortex). Expression levels from GTEx data also support a role in neurodevelopment. Immunocytochemistry revealed highest levels in mature human iPSC-derived glutaminergic cortical neurons and moderate in immature ones. Additional studies supported that the gene is highly expressed in dendrites and might play a role in postsynaptic vesicles (colocalization with postsynaptic and early endosomal markers). A previous study by Riazuddin et al (2017 - PMID: 27457812) had identified TMEM222 as a candidate gene for ID. This family (PKMR213) however appears to be included as family 2 in the aforementioned publication (same pedigree, variant and phenotype in both articles). In OMIM there is currently no associated phenotype. The gene is listed among the primary ID genes in SysID. Please consider inclusion in the ID panel with green (or amber) rating. This gene may also be included in other panels e.g. for epilepsy, microcephaly, etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3752 | CHD5 |
Zornitza Stark gene: CHD5 was added gene: CHD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHD5 were set to 33944996 Phenotypes for gene: CHD5 were set to Intellectual disability; Epilepsy Review for gene: CHD5 was set to GREEN Added comment: 16 unrelated individuals reported with language deficits (81%), behavioral symptoms (69%), intellectual disability (64%), epilepsy (62%), and motor delay (56%). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3747 | FBXO31 | Zornitza Stark edited their review of gene: FBXO31: Added comment: PMIDs 33675180; 32989326: three unrelated individuals with de novo missense variant, (p.Asp334Asn) and spastic-dystonic CP, including ID.; Changed rating: GREEN; Changed publications: 24623383, 33675180, 32989326; Changed phenotypes: Mental retardation, autosomal recessive 45, MIM#615979, Spastic-dystonic cerebral palsy, de novo dominant; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3746 | DPYSL5 |
Zornitza Stark gene: DPYSL5 was added gene: DPYSL5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DPYSL5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DPYSL5 were set to 33894126 Phenotypes for gene: DPYSL5 were set to Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities Review for gene: DPYSL5 was set to GREEN Added comment: Nine individuals with brain malformations, including corpus callosum agenesis and/or posterior fossa abnormalities, associated with variable degrees of intellectual disability. The recurrent de novo p.Glu41Lys was found in eight unrelated patients, and a p.Gly47Arg variant was identified in one individual from the first family reported with Ritscher-Schinzel syndrome. Both impaired DPYSL5 function on dendritic outgrowth regulation by preventing the formation of the ternary complex with MAP2 and βIII-tubulin, ultimately leading to abnormal brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3741 | VPS41 |
Zornitza Stark edited their review of gene: VPS41: Added comment: Another 9 individuals from 5 unrelated families reported. Affected individuals were born after uneventful pregnancies and presented in most cases early in life with developmental delay. Various degrees of ataxia, hypotonia, and dystonia were present in all affected individuals, preventing independent ambulation. Likewise, nystagmus was commonly described. In addition, all affected individuals displayed intellectual disability and speech delay, and one sib pair had treatment-resistant epilepsy.; Changed rating: GREEN; Changed publications: 32808683, 33764426 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3738 | PTPN4 |
Bryony Thompson gene: PTPN4 was added gene: PTPN4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN4 were set to 17953619; 25424712; 30238967; DOI: https://doi.org/10.1016/j.xhgg.2021.100033 Phenotypes for gene: PTPN4 were set to Intellectual disability; developmental delay Review for gene: PTPN4 was set to GREEN Added comment: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3730 | MED25 | Zornitza Stark changed review comment from: Basel-Vanagaite-Smirin-Yosef syndrome is an autosomal recessive multiple congenital anomaly disorder characterized by severely delayed psychomotor development resulting in mental retardation, as well as variable eye, brain, cardiac, and palatal abnormalities. 7 individuals from 4 families reported initially, founder variant p.Tyr39Cys. Over 20 individuals reported since, including other variants.; to: Basel-Vanagaite-Smirin-Yosef syndrome is an autosomal recessive multiple congenital anomaly disorder characterized by severely delayed psychomotor development resulting in intellectual disability, as well as variable eye, brain, cardiac, and palatal abnormalities. 7 individuals from 4 families reported initially, founder variant p.Tyr39Cys. Over 20 individuals reported since, including other variants. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3717 | KCNJ6 |
Zornitza Stark changed review comment from: Keppen-Lubinsky syndrome characterised by severely delayed psychomotor development, hypertonia, hyperreflexia, generalized lipodystrophy giving an aged appearance, and distinctive dysmorphic features, including microcephaly, prominent eyes, narrow nasal bridge, and open mouth. Three unrelated individuals reported with de novo variants in this gene (one recurred in 2), mouse model.; to: Keppen-Lubinsky syndrome characterised by severely delayed psychomotor development, hypertonia, hyperreflexia, generalized lipodystrophy giving an aged appearance, and distinctive dysmorphic features, including microcephaly, prominent eyes, narrow nasal bridge, and open mouth. Four unrelated individuals reported with de novo variants in this gene (one recurred in 2), mouse model. One of the individuals did not have lipodystrophy but had a prominent hyperkinetic movement disorder. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3713 | AFF4 |
Zornitza Stark changed review comment from: Comment when marking as ready: At least 15 unrelated individuals reported.; to: Comment when marking as ready: At least 15 unrelated individuals reported. CdL-like, clinically recognisable phenotype, characterised by cognitive impairment, coarse facies, heart defects, obesity, pulmonary involvement, short stature, and skeletal dysplasia. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3713 | AFF4 | Zornitza Stark Added comment: Comment when marking as ready: At least 15 unrelated individuals reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3700 | NEUROD2 |
Zornitza Stark gene: NEUROD2 was added gene: NEUROD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NEUROD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NEUROD2 were set to 33438828; 30323019 Phenotypes for gene: NEUROD2 were set to Epileptic encephalopathy, early infantile, 72, MIM# 618374 Review for gene: NEUROD2 was set to GREEN Added comment: Four unrelated individuals altogether with de novo variants in this gene, two presenting predominantly with seizures, and two with ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3681 | EMC10 | Zornitza Stark changed review comment from: Additional 12 individuals from 7 Middle Eastern families reported. Same variant in all, suggestive of founder effect.; to: Additional 12 individuals from 7 Middle Eastern families reported. Same variant in all, suggestive of founder effect (but different to the previously reported family). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3679 | PLCH1 |
Zornitza Stark gene: PLCH1 was added gene: PLCH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLCH1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLCH1 were set to 33820834 Phenotypes for gene: PLCH1 were set to Holoprosencephaly spectrum; Severe developmental delay; Brain malformations Review for gene: PLCH1 was set to AMBER Added comment: PMID: 33820834 (2021) - Two sibling pairs from two unrelated families with a holoprosencephaly spectrum phenotype and different homozygous PLCH1 variants (c.2065C>T, p.Arg689* and c.4235delA, p.Cys1079ValfsTer16, respectively). One family presented with congenital hydrocephalus, epilepsy, significant developmental delay and a monoventricle or fused thalami; while sibs from the second family had alobar holoprosencephaly and cyclopia. 3/4 individuals also displayed a cleft palate and congenital heart disease. Human embryo immunohistochemistry showed PLCH1 to be expressed in the notorcord, developing spinal cord (in a ventral to dorsal gradient), dorsal root ganglia, cerebellum and dermatomyosome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3664 | MAPKAPK5 |
chirag patel gene: MAPKAPK5 was added gene: MAPKAPK5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAPKAPK5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAPKAPK5 were set to PMID: 3344202 Phenotypes for gene: MAPKAPK5 were set to Developmental delay, variable brain anomalies, congenital heart defects, dysmorphic Review for gene: MAPKAPK5 was set to GREEN Added comment: 3 individuals from 2 families with severe developmental delay, variable brain anomalies, congenital heart defects, dysmorphic facial features, and a distinctive type of synpolydactyly with an additional hypoplastic digit between the fourth and fifth digits of hands and/or feet. Exome sequencing identified different homozygous truncating variants in MAPKAPK5 in both families, segregating with disease and unaffected parents as carriers. Patient-derived cells showed no expression of MAPKAPK5 protein isoforms and reduced levels of the MAPKAPK5-interacting protein ERK3. F-actin recovery after latrunculin B treatment was found to be less efficient in patient-derived fibroblasts than in control cells, supporting a role of MAPKAPK5 in F-actin polymerization. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3662 | UBE4A |
chirag patel gene: UBE4A was added gene: UBE4A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBE4A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UBE4A were set to PMID: 33420346 Phenotypes for gene: UBE4A were set to Intellectual disability and global developmental delay Review for gene: UBE4A was set to GREEN Added comment: 8 individuals, from 4 unrelated families, with syndromic intellectual disability and global developmental delay (other clinical features included hypotonia, short stature, seizures, and behaviour disorder. Exome sequencing identified biallelic loss-of-function variants in UBE4A in the 4 families, with variants segregating with disease and parents carriers. They demonstrated that UBE4A loss-of-function variants reduced RNA expression and protein levels in clinical samples. Mice generated to mimic patient-specific Ube4a loss-of-function variant exhibited muscular and neurological/behavioural abnormalities, some of which are suggestive of the clinical abnormalities seen in the affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3604 | NMNAT1 |
Zornitza Stark gene: NMNAT1 was added gene: NMNAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV, founder tags were added to gene: NMNAT1. Mode of inheritance for gene: NMNAT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NMNAT1 were set to 32533184; 33668384 Phenotypes for gene: NMNAT1 were set to Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual disability, and Leber congenital amaurosis (SHILCA), MIM#619260; Leber congenital amaurosis 9, MIM# 608553 Review for gene: NMNAT1 was set to AMBER Added comment: Three families reported, but two are distantly related (shared haplotype). The affected children in those two families were homozygous for 7.4-kb duplication involving the last 2 exons of the NMNAT1 gene, spanning the beginning of intron 3 to the middle of the 3-prime UTR (chr1:10,036,359-10,043,727, GRCh37). The third affected individual was compound het for the duplication and a splicing variant. Note bi-allelic variants in this gene are associated with non-syndromic LCA, multiple families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3538 | SATB1 |
Zornitza Stark edited their review of gene: SATB1: Added comment: Kohlschutter-Tonz syndrome-like (KTZSL) is characterized by global developmental delay with moderately to severely impaired intellectual development, poor or absent speech, and delayed motor skills. Although the severity of the disorder varies, many patients are nonverbal and have hypotonia with inability to sit or walk. Early-onset epilepsy is common and may be refractory to treatment, leading to epileptic encephalopathy and further interruption of developmental progress. Most patients have feeding difficulties with poor overall growth and dysmorphic facial features, as well as significant dental anomalies resembling amelogenesis imperfecta. This phenotype was reported in 28 patients (patients 13 to 40, PMID 33513338), including 9 patients from 3 families. Most variants were de novo, though some were inherited, suggestive of incomplete penetrance and variable expressivity. Developmental delay with dysmorphic facies and dental anomalies (DEFDA) is characterized by generally mild global developmental delay with variably impaired intellectual development, walking by 2 to 3 years, and slow language acquisition. The severity of the disorder ranges from moderate cognitive deficits to mild learning difficulties or behavioral abnormalities. Most patients have dysmorphic facial features, often with abnormal dentition and nonspecific visual defects, such as myopia, astigmatism, and strabismus. Although rare, involvement of other systems, such as skeletal, cardiac, and gastrointestinal, may be present. 12 individuals from 11 families reported (one inherited variant, affected parent).; Changed phenotypes: Kohlschutter-Tonz syndrome-like, MIM# 619229, Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228, Developmental disorders |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3526 | TPP2 |
Zornitza Stark gene: TPP2 was added gene: TPP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TPP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TPP2 were set to 25525876; 25414442; 33586135; 18362329 Phenotypes for gene: TPP2 were set to Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220 Review for gene: TPP2 was set to GREEN Added comment: Immunodeficiency-78 with autoimmunity and developmental delay (IMD78) is an autosomal recessive systemic disorder characterized by onset of symptoms in early childhood. Affected individuals present with features of immune deficiency, such as recurrent sinopulmonary or skin infections, as well as autoimmunity, including autoimmune cytopenias, hemolytic anemia, and thrombocytopenia. Autoimmune hepatitis or thyroid disease and central nervous system vasculitis with stroke may also occur. There is increased susceptibility to bacterial, viral, and fungal infections. Laboratory studies show lymphopenia with advanced differentiation and premature senescence of CD8+ T cells and B cells; some patients may have hypergammaglobulinemia. The findings indicate immune dysregulation. Patients also have global developmental delay with speech delay and variable intellectual disability. Five unrelated families and a mouse model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3482 | SIAH1 |
Zornitza Stark gene: SIAH1 was added gene: SIAH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SIAH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SIAH1 were set to 32430360 Phenotypes for gene: SIAH1 were set to Developmental delay; Infantile hypotonia; Dysmorphic features; Laryngomalacia Review for gene: SIAH1 was set to GREEN Added comment: - PMID: 32430360 (2021) - Five unrelated individuals with shared features of developmental delay, infantile hypotonia, dysmorphic features and laryngomalacia. All had speech delay and where cognitive assessment was age appropriate individuals exhibited learning difficulties. Trio WES revealed distinct de novo variants in SIAH1. In vitro assays demonstrated that SIAH1 mutants induce loss of Wnt stimulatory activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3474 | EIF5A |
Zornitza Stark gene: EIF5A was added gene: EIF5A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF5A were set to 33547280 Phenotypes for gene: EIF5A were set to Intellectual disability; microcephaly; dysmorphism Review for gene: EIF5A was set to GREEN Added comment: 7 unrelated individuals reported with de novo variants in this gene and variable combinations of developmental delay, microcephaly, micrognathia and dysmorphism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3472 | POLRMT |
Zornitza Stark gene: POLRMT was added gene: POLRMT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POLRMT was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: POLRMT were set to 33602924 Phenotypes for gene: POLRMT were set to Mitochondrial disorder; intellectual disability; hypotonia Review for gene: POLRMT was set to GREEN Added comment: 8 individuals from 7 families reported. 5 families with bi-allelic variants and 2 with heterozygous variants. Affected individuals presented with global developmental delay, hypotonia, short stature, and speech/intellectual disability in childhood; one subject displayed an indolent progressive external ophthalmoplegia phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3452 | MSL3 | Zornitza Stark commented on gene: MSL3: Well established ID gene. 2021 paper documents findings in 25 individuals. Variants found to be clustering in the terminal eight exons suggesting that truncating variants in the first five exons might be compensated by an alternative MSL3 transcript. Three-dimensional modeling of missense and splice variants indicated that these have a deleterious effect. The main clinical findings comprised developmental delay and intellectual disability ranging from mild to severe. Autism spectrum disorder, muscle tone abnormalities, and macrocephaly were common as well as hearing impairment and gastrointestinal problems. Hypoplasia of the cerebellar vermis emerged as a consistent magnetic resonance image (MRI) finding. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3427 | PIGF |
Paul De Fazio gene: PIGF was added gene: PIGF was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIGF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGF were set to 33386993 Phenotypes for gene: PIGF were set to Glycosylphosphatidylinositol deficiency, onychodystrophy, osteodystrophy, intellectual disability, and seizures Review for gene: PIGF was set to RED gene: PIGF was marked as current diagnostic Added comment: The same homozygous missense variant identified in 2 individuals from different families from the same region of India. Individuals had a phenotype similar to DOORS syndrome without deafness. Impaired glycosylphosphatidylinositol (GPI) biosynthesis was demonstrated. Rated Red as the two families are likely to be related (founder mutation?). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3426 | HIRA |
Paul De Fazio gene: HIRA was added gene: HIRA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HIRA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HIRA were set to 33417013; 28135719; 25363760 Phenotypes for gene: HIRA were set to Neurodevelopmental disorder Review for gene: HIRA was set to GREEN gene: HIRA was marked as current diagnostic Added comment: Two unrelated patients with different de novo loss of function variants identified in PMID 33417013: Individual 1: intragenic deletion, phenotype included psychomotor retardation, ID, growth retardation, microcephaly, and facial features reminiscent of 22q deletion syndrome. Individual 2: canonical splice variant, phenotype mostly confined to ASD Another two de novo variants were identified in the literature by the authors of that paper, one stop-gain (DDD study, PMID 28135719) and one missense (large autism cohort, PMID 25363760). PMID 33417013 also showed that HIRA knockdown in mice results in neurodevelopmental abnormalities. Rated Green due to 4 unrelated individuals (albeit 2 in large cohort studies) and a mouse model. NB: HIRA is within the common 22q deletion region. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3420 | OTUD5 |
chirag patel gene: OTUD5 was added gene: OTUD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: OTUD5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: OTUD5 were set to PMID: 33131077 Phenotypes for gene: OTUD5 were set to X-linked severe neurodevelopmental delay, hydrocephalus, and early lethality Review for gene: OTUD5 was set to RED Added comment: 13 male patients from a single family with three generations affected. Patients presented prenatally or during the neonatal period with IUGR, ventriculomegaly, hydrocephalus, hypotonia, congenital heart defects, hypospadias, and severe neurodevelopmental delay. The disease is typically fatal during infancy, mainly due to sepsis (pneumonias). Female carriers are asymptomatic. WGS in four individuals identified a unique candidate variant in the OTUD5 gene (NM_017602.3:c.598G > A, p.Glu200Lys). The variant cosegregated with the disease in 10 tested individuals. No functional studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3384 | SCAMP5 | Zornitza Stark edited their review of gene: SCAMP5: Added comment: PMID 33390987: Four unrelated individuals reported with same de novo missense variant, p. Gly180Trp. The onset age of seizures was ranged from 6 to 15 months. Patients had different types of seizures, including focal seizures, generalized tonic-clonic seizures and tonic seizure. One patient showed typical autism spectrum disorder (ASD) symptoms. Electroencephalogram (EEG) findings presented as focal or multifocal discharges, sometimes spreading to generalization. Brain magnetic resonance imaging (MRI) abnormalities were present in each patient. Severe intellectual disability and language and motor developmental disorders were found in our patients, with all patients having poor language development and were nonverbal at last follow-up. All but one of the patients could walk independently in childhood, but the ability to walk independently in one patient had deteriorated with age. All patients had abnormal neurological exam findings, mostly signs of extrapyramidal system involvement. Dysmorphic features were found in 2/4 patients, mainly in the face and trunk.; Changed rating: GREEN; Changed publications: 33390987; Changed phenotypes: Intellectual disability, seizures, autism; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3383 | ZNF526 |
Zornitza Stark gene: ZNF526 was added gene: ZNF526 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF526 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF526 were set to 21937992; 25558065; 33397746 Phenotypes for gene: ZNF526 were set to Intellectual disability; Microcephaly; Cataracts; Epilepsy; Hypertonia; Dystonia Review for gene: ZNF526 was set to GREEN Added comment: Currently not associated with any phenotype in OMIM (last updated on 09/12/2011), but has a 'possible' disease confidence rating for 'Autosomal Recessive Mental Retardation' in Gene2Phenotype. - PMID: 21937992 (2011) - Two unrelated families (with 4 affected individuals in each) with non-syndromic ID (mild or moderate, respectively) identified harbouring different biallelic missense variants in the ZNF526 gene. - PMID: 25558065 (2015) - One family with ID, Noonan-like facies, pulmonary stenosis and a homozygous missense variant in this gene. No further details provided. - PMID: 33397746 (2021) - Five individuals from four unrelated families with homozygous ZNF526 variants. Four harboured truncating variants, and were all affected by profound DD and severe ID, microcephaly (ranging from -4 SD to -8 SD), bilateral progressive cataracts, hypertonic-dystonic movements, epilepsy and brain MRI anomalies. The fifth patient had a homozygous missense variant and a slightly less severe disorder, with postnatal microcephaly (-2 SD), progressive bilateral cataracts, severe ID, and normal brain MRI. Zebrafish model demonstrated brain and eye malformations resembling findings seen in the human holoprosencephaly spectrum Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3380 | CELF2 |
Zornitza Stark gene: CELF2 was added gene: CELF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CELF2 were set to 33131106 Phenotypes for gene: CELF2 were set to Developmental and epileptic encephalopathy Review for gene: CELF2 was set to GREEN Added comment: Five unrelated individuals reported. Four with de novo variants, and one inherited from a mosaic mother. Notably, all identified variants, except for c.272‐1G>C, were clustered within 20 amino acid residues of the C‐terminus, which might be a nuclear localization signal. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3376 | UBR7 |
Zornitza Stark gene: UBR7 was added gene: UBR7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBR7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UBR7 were set to 33340455 Phenotypes for gene: UBR7 were set to Intellectual disability; epilepsy; hypothyroidism; congenital anomalies; dysmorphic features Review for gene: UBR7 was set to GREEN Added comment: Seven individuals from 6 unrelated families. All had developmental delay, and all males had urogenital anomalies, namely cryptorchidism in 5/6 and small penis in 1/6. Six individuals had seizures and hypotonia. Hypothyroidism was present in 4/7 individuals, and ptosis was noted in 6/7 individuals. Five individuals exhibited cardiac abnormalities: two had ventricular septal defect, one had atrial septal defect, one had a patent ductus arteriosus requiring surgery, and the other had a patent ductus arteriosus and a patent foramen ovale that both closed spontaneously. Five individuals had short stature (height < 3rd percentile). Physical examination revealed various dysmorphic features, including prominent forehead (3/7), hypertelorism (4/7), telecanthus (1/7), epicanthus(1/7), downslanting palpebral fissures (3/7), thick eyebrow (1/7), low-set ears (3/7), long philtrum (2/7), unilateral single transverse palmar crease (1/7), and hypertrichosis (1/7). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3368 | RNU7-1 |
Paul De Fazio gene: RNU7-1 was added gene: RNU7-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU7-1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNU7-1 were set to 33230297 Phenotypes for gene: RNU7-1 were set to Aicardi–Goutières syndrome-like Review for gene: RNU7-1 was set to GREEN gene: RNU7-1 was marked as current diagnostic Added comment: Review originally submitted by Ming Wong - 16 affected individuals from 11 families - Compared to control fibroblasts, patient fibroblasts were enriched for misprocessed forms of replication-dependent histone (RDH) mRNAs Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3273 | PPIL1 |
Zornitza Stark gene: PPIL1 was added gene: PPIL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPIL1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PPIL1 were set to 33220177 Phenotypes for gene: PPIL1 were set to Pontocerebellar hypoplasia; microcephaly; seizures Review for gene: PPIL1 was set to GREEN Added comment: 17 individuals from 9 unrelated families reported with bi-allelic variants in the gene and PCH, microcephaly, hypotonia, seizures, severe DD/ID. Mouse models support gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3270 | FRA12A |
Bryony Thompson STR: FRA12A was added STR: FRA12A was added to Intellectual disability syndromic and non-syndromic. Sources: Other 5'UTR tags were added to STR: FRA12A. Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FRA12A were set to 17236128 Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630 Review for STR: FRA12A was set to AMBER Added comment: NM_173602.2:c.-137CGG[X] All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp. 70 controls used to determine the "normal" repeat range. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3265 | RAP1B | Zornitza Stark edited their review of gene: RAP1B: Added comment: Another individual with de novo missense variant from a Kabuki-like cohort but note facial gestalt was not typical, had DD.; Changed rating: GREEN; Changed publications: 32627184, 26280580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3263 | EMC10 |
chirag patel gene: EMC10 was added gene: EMC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EMC10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EMC10 were set to PMID: 32869858 Phenotypes for gene: EMC10 were set to Developmental delay and intellectual disability, no OMIM# Review for gene: EMC10 was set to RED Added comment: Homozygous variants of EMC1 are associated with GDD, scoliosis, and cerebellar atrophy, indicating the relevance of this pathway for neurogenetic disorders. One Saudi family with 2 affected individuals with mild ID, speech delay, and GDD. WES and Sanger sequencing revealed a homozygous splice acceptor site variant (c.679‐1G>A) in EMC10 . Variant segregated within the family. RT‐qPCR showed a substantial decrease in the relative EMC10 gene expression in the patients. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3262 | FBXO28 |
Zornitza Stark changed review comment from: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All patients had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features. Sources: Literature; to: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3261 | FBXO28 |
Zornitza Stark gene: FBXO28 was added gene: FBXO28 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXO28 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FBXO28 were set to 33280099 Phenotypes for gene: FBXO28 were set to Developmental and epileptic encephalopathy Review for gene: FBXO28 was set to GREEN Added comment: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All patients had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3251 | VPS4A |
Elena Savva changed review comment from: Comment when marking as ready: PMID: 33186543 - 2x de novo hetorozygous missense variants in the AAA (large ATPase) domain. 1x homozygous missense in the MIT domain (milder phenotype and unaffected parents - possibly just a simple LoF mechanism for AR inheritance). Demonstrated defective CD71 trafficking in all 3 patients. PMID: 33186545 - 6x probands with de novo missense variants in the AAA domain. 5 of the variants were at amino acid position 284 (changes to Trp and Gly). Demonstrated that the variants had a dominant-negative effect on VPS4A function. "The six probands with de novo substitutions affecting Glu206 or Arg284 had a consistent phenotype characterized by severe DD, profound ID, and dystonia. Children were very delayed in establishing head control and none achieved independent walking. Other common findings were cerebellar hypoplasia (five individuals out of six, the other showing uncharacterized severe cerebral atrophy) with a variable degree of corpus callosum hypoplasia. One individual also had bilateral polymicrogyria. Epilepsy was present in three and dystonia in five subjects. Eye involvement was also a common finding, including congenital cataract, retinal dystrophy, and in one case congenital Leber amaurosis. Four individuals were diagnosed with hepatosplenomegaly and/or steatosis. Three subjects had anemia, which was characterized as dyserythropoietic in two. Severe feeding difficulties were present in four individuals, requiring assisted feeding in three. Two had sensorineural deafness. Severe growth retardation, generally for all parameters, was present in most cases. Notably, severe microcephaly (typically with Z scores < −5) was universal. Overall, the disorder seems to have a poor prognosis as two affected individuals died in childhood or early adult life."; to: PMID: 33186543 - 2x de novo hetorozygous missense variants in the AAA (large ATPase) domain. 1x homozygous missense in the MIT domain (milder phenotype and unaffected parents - possibly just a simple LoF mechanism for AR inheritance). Demonstrated defective CD71 trafficking in all 3 patients. PMID: 33186545 - 6x probands with de novo missense variants in the AAA domain. 5 of the variants were at amino acid position 284 (changes to Trp and Gly). Demonstrated that the variants had a dominant-negative effect on VPS4A function. "The six probands with de novo substitutions affecting Glu206 or Arg284 had a consistent phenotype characterized by severe DD, profound ID, and dystonia. Children were very delayed in establishing head control and none achieved independent walking. Other common findings were cerebellar hypoplasia (five individuals out of six, the other showing uncharacterized severe cerebral atrophy) with a variable degree of corpus callosum hypoplasia. One individual also had bilateral polymicrogyria. Epilepsy was present in three and dystonia in five subjects. Eye involvement was also a common finding, including congenital cataract, retinal dystrophy, and in one case congenital Leber amaurosis. Four individuals were diagnosed with hepatosplenomegaly and/or steatosis. Three subjects had anemia, which was characterized as dyserythropoietic in two. Severe feeding difficulties were present in four individuals, requiring assisted feeding in three. Two had sensorineural deafness. Severe growth retardation, generally for all parameters, was present in most cases. Notably, severe microcephaly (typically with Z scores < −5) was universal. Overall, the disorder seems to have a poor prognosis as two affected individuals died in childhood or early adult life." |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3251 | VPS4A | Elena Savva Added comment: Comment when marking as ready: PMID: 33186543 - 2x de novo hetorozygous missense variants in the AAA (large ATPase) domain. 1x homozygous missense in the MIT domain (milder phenotype and unaffected parents - possibly just a simple LoF mechanism for AR inheritance). Demonstrated defective CD71 trafficking in all 3 patients. PMID: 33186545 - 6x probands with de novo missense variants in the AAA domain. 5 of the variants were at amino acid position 284 (changes to Trp and Gly). Demonstrated that the variants had a dominant-negative effect on VPS4A function. "The six probands with de novo substitutions affecting Glu206 or Arg284 had a consistent phenotype characterized by severe DD, profound ID, and dystonia. Children were very delayed in establishing head control and none achieved independent walking. Other common findings were cerebellar hypoplasia (five individuals out of six, the other showing uncharacterized severe cerebral atrophy) with a variable degree of corpus callosum hypoplasia. One individual also had bilateral polymicrogyria. Epilepsy was present in three and dystonia in five subjects. Eye involvement was also a common finding, including congenital cataract, retinal dystrophy, and in one case congenital Leber amaurosis. Four individuals were diagnosed with hepatosplenomegaly and/or steatosis. Three subjects had anemia, which was characterized as dyserythropoietic in two. Severe feeding difficulties were present in four individuals, requiring assisted feeding in three. Two had sensorineural deafness. Severe growth retardation, generally for all parameters, was present in most cases. Notably, severe microcephaly (typically with Z scores < −5) was universal. Overall, the disorder seems to have a poor prognosis as two affected individuals died in childhood or early adult life." | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3250 | VPS4A |
Kristin Rigbye gene: VPS4A was added gene: VPS4A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VPS4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: VPS4A were set to 33186543; 33186545 Phenotypes for gene: VPS4A were set to Neurodevelopmental disorder Review for gene: VPS4A was set to GREEN Added comment: PMID: 33186543 - 2x de novo hetorozygous missense variants in the AAA (large ATPase) domain. 1x homozygous missense in the MIT domain (milder phenotype and unaffected parents - possibly just a simple LoF mechanism for AR inheritance). Demonstrated defective CD71 trafficking in all 3 patients. PMID: 33186545 - 6x probands with de novo missense variants in the AAA domain. 5 of the variants were at amino acid position 284 (changes to Trp and Gly). Demonstrated that the variants had a dominant-negative effect on VPS4A function. "The six probands with de novo substitutions affecting Glu206 or Arg284 had a consistent phenotype characterized by severe DD, profound ID, and dystonia. Children were very delayed in establishing head control and none achieved independent walking. Other common findings were cerebellar hypoplasia (five individuals out of six, the other showing uncharacterized severe cerebral atrophy) with a variable degree of corpus callosum hypoplasia. One individual also had bilateral polymicrogyria. Epilepsy was present in three and dystonia in five subjects. Eye involvement was also a common finding, including congenital cataract, retinal dystrophy, and in one case congenital Leber amaurosis. Four individuals were diagnosed with hepatosplenomegaly and/or steatosis. Three subjects had anemia, which was characterized as dyserythropoietic in two. Severe feeding difficulties were present in four individuals, requiring assisted feeding in three. Two had sensorineural deafness. Severe growth retardation, generally for all parameters, was present in most cases. Notably, severe microcephaly (typically with Z scores < −5) was universal. Overall, the disorder seems to have a poor prognosis as two affected individuals died in childhood or early adult life." Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3248 | BICRA | Elena Savva Added comment: Comment when marking as ready: 12 individuals reported, 11 de novo (1 not resolved), "with neurodevelopmental phenotypes—developmental delay (HP:0001263), intellectual disability (HP:0001249), autism spectrum disorder (HP:0000729), and/or behavioral phenotypes (HP:0000708)—and variable structural birth defects and dysmorphic features". Mostly LoF or gene deletions, but 2 missense reported. Zebrafish model supports the gene-disease association. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3248 | KDM4B |
Kristin Rigbye gene: KDM4B was added gene: KDM4B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KDM4B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KDM4B were set to PMID: 33232677 Phenotypes for gene: KDM4B were set to Global developmental delay, intellectual disability and neuroanatomical defects Review for gene: KDM4B was set to GREEN Added comment: Nine individuals with mono-allelic de novo or inherited variants in KDM4B. All individuals presented with dysmorphic features and global developmental delay (GDD) with language and motor skills most affected. Three individuals had a history of seizures, and four had anomalies on brain imaging ranging from agenesis of the corpus callosum with hydrocephalus to cystic formations, abnormal hippocampi, and polymicrogyria. In a knockout mouse the total brain volume was significantly reduced with decreased size of the hippocampal dentate gyrus, partial agenesis of the corpus callosum, and ventriculomegaly. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3248 | BICRA |
Paul De Fazio gene: BICRA was added gene: BICRA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BICRA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BICRA were set to 33232675 Phenotypes for gene: BICRA were set to Developmental delay, intellectual disability, autism spectrum disorder,behavioral abnormalities, dysmorphic features Review for gene: BICRA was set to GREEN gene: BICRA was marked as current diagnostic Added comment: 12 individuals reported, 11 de novo (1 not resolved), "with neurodevelopmental phenotypes—developmental delay (HP:0001263), intellectual disability (HP:0001249), autism spectrum disorder (HP:0000729), and/or behavioral phenotypes (HP:0000708)—and variable structural birth defects and dysmorphic features". Mostly LoF or gene deletions, but 2 missense reported. Zebrafish model supports the gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3246 | AGO2 |
Zornitza Stark gene: AGO2 was added gene: AGO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AGO2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AGO2 were set to 33199684 Phenotypes for gene: AGO2 were set to Intellectual disability Review for gene: AGO2 was set to GREEN Added comment: 21 individuals reported, five variants (p.L192P, p.G201V, p.T357M, p.M364T, p.C751Y) were recurrent. Variable ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3240 | H3F3B | Zornitza Stark edited their review of gene: H3F3B: Added comment: 13 unrelated individuals reported with missense variants in H3F3B. Phenotype primarily comprised intellectual disability and minor congenital anomalies, regression in significant proportion. Seizures in 50%.; Changed rating: GREEN; Changed publications: 33268356; Changed phenotypes: Intellectual disability, regression, seizures; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3236 | H3F3A | Zornitza Stark edited their review of gene: H3F3A: Added comment: 33 unrelated individuals reported with missense variants in H3F3A. Phenotype primarily comprised intellectual disability and minor congenital anomalies, regression in significant proportion. Seizures in 50%.; Changed rating: GREEN; Changed publications: 33268356; Changed phenotypes: Intellectual disability, regression, seizures; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3217 | DPM2 | Zornitza Stark edited their review of gene: DPM2: Added comment: Further unrelated individual reported, main clinical features were truncal hypotonia, hypertonicity, congenital heart defects, intellectual disability, and generalized muscle wasting.; Changed rating: GREEN; Changed publications: 23109149, 33129689 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3173 | ZFHX4 |
Zornitza Stark gene: ZFHX4 was added gene: ZFHX4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZFHX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZFHX4 were set to 33057194; 24038936; 21802062 Phenotypes for gene: ZFHX4 were set to Developmental disorders; intellectual disability, dysmorphic features Review for gene: ZFHX4 was set to GREEN Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 16 de novo variants (5 frameshift, 5 missense, 4 stopgain, 2 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided). PMID: 24038936 - a single case with developmental delay, macrocephaly, ventriculomegaly, hypermetropia, recurrent infections, dysmorphism and a de novo deletion of the last 7 exons of the gene. PMID:21802062 (2011) report 8 individuals with ID and overlapping deletions of 8q21.11 (0.66-13.55 Mb in size); the smallest region of overlap encompasses 3 genes including ZFHX4. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3143 | ATP6V0A1 |
Zornitza Stark gene: ATP6V0A1 was added gene: ATP6V0A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP6V0A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V0A1 were set to 30842224; 33057194 Phenotypes for gene: ATP6V0A1 were set to Developmental disorder; Rett syndrome-like Review for gene: ATP6V0A1 was set to AMBER Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio developmental disorder study. 11 de novo missense identified in ~10,000 cases with developmental disorders (no other phenotype info provided, hence Amber rating). PMID: 30842224 - identified a de novo missense variant in a single individual with atypical Rett syndrome phenotype Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3139 | FOXP4 |
Zornitza Stark changed review comment from: Eight unrelated individuals reported, seven de novo missense, and one individual with a truncating variant. Detailed phenotypic information available on 6. Overlapping features included speech and language delays, growth abnormalities, congenital diaphragmatic hernia (2/6), cervical spine abnormalities, and ptosis. Intellectual disability described as mild in 2, some had normal intellect despite the early challenges. Sources: Literature; to: Eight unrelated individuals reported, seven de novo missense, and one individual with a truncating variant. Detailed phenotypic information available on 6. Overlapping features included speech and language delays, growth abnormalities, congenital diaphragmatic hernia (2/6), cervical spine abnormalities, and ptosis. Intellectual disability described as mild in 2, some had normal intellect despite the early speech and language delays. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3139 | FOXP4 |
Zornitza Stark changed review comment from: Six unrelated individuals reported, 5 with missense variants in the forkhead box DNA-binding domain of FOXP4, and one individual with a truncating variant. Overlapping features included speech and language delays, growth abnormalities, congenital diaphragmatic hernia, cervical spine abnormalities, and ptosis. Sources: Literature; to: Eight unrelated individuals reported, seven de novo missense, and one individual with a truncating variant. Detailed phenotypic information available on 6. Overlapping features included speech and language delays, growth abnormalities, congenital diaphragmatic hernia (2/6), cervical spine abnormalities, and ptosis. Intellectual disability described as mild in 2, some had normal intellect despite the early challenges. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3139 | FOXP4 |
Zornitza Stark gene: FOXP4 was added gene: FOXP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FOXP4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOXP4 were set to 33110267 Phenotypes for gene: FOXP4 were set to Neurodevelopmental disorder; multiple congenital abnormalities Review for gene: FOXP4 was set to GREEN Added comment: Six unrelated individuals reported, 5 with missense variants in the forkhead box DNA-binding domain of FOXP4, and one individual with a truncating variant. Overlapping features included speech and language delays, growth abnormalities, congenital diaphragmatic hernia, cervical spine abnormalities, and ptosis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3128 | PRKAR1B |
Konstantinos Varvagiannis gene: PRKAR1B was added gene: PRKAR1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRKAR1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PRKAR1B were set to https://doi.org/10.1101/2020.09.10.20190314; 33057194 Phenotypes for gene: PRKAR1B were set to Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Aggressive behavior; Abnormality of movement; Upslanted palpebral fissure Penetrance for gene: PRKAR1B were set to unknown Review for gene: PRKAR1B was set to AMBER Added comment: Please consider inclusion of this gene with amber rating pending publication of the preprint and/or additional evidence. Marbach et al. (2020 - medRxiv : https://doi.org/10.1101/2020.09.10.20190314 - last author : C. Schaaf) report 6 unrelated individuals with heterozygous missense PRKAR1B variants. All presented formal ASD diagnosis (6/6), global developmental delay (6/6) and intellectual disability (all - formal evaluations were lacking though). Additional features included neurologic anomalies (movement disorders : dyspraxia, apraxia, clumsiness in all, with tremor/dystonia or involuntary movements as single occurrences). Three displayed high pain tolerance. Regression in speech was a feature in two. Additional behavior anomalies included ADHD (4-5/6) or aggression (3/6). There was no consistent pattern of malformations, physical anomalies or facial features (with the exception of uplsanted palpebral fissures reported in 4). 3 different missense variants were identified (NM_00116470:c.1003C>T - p.Arg335Trp, c.586G>A - p.Glu196Lys, c.500_501delAAinsTT - p.Gln167Leu) with Arg355Trp being a recurrent one within this cohort (4/6 subjects). A possible splicing effect may apply for the MNV. All variants are absent from gnomAD and the SNVs had CADD scores > 24. In all cases were parental samples were available (5/6), the variant had occurred as a de novo event. Protein kinase A (PKA) is a tetrameric holoenzyme formed by the association of 2 catalytic (C) subunits with a regulatory (R) subunit dimer. Activation of PKA is achieved through binding of 2 cAMP molecules to each R-subunit, and unleashing(/dissociation) of C-subunits to engage substrates. PRKACA/B genes encode the Cα- and Cβ-subunits while the 4 functionally non-redundant regulatory subunits are encoded by PRKAR1A/1B/2A/2B genes. As the authors comment, the RIβ subunit is primarily expressed in brain with higher expression in cortex and hypothalamus. The functional consequences of the variants at cellular level were not studied. Previous studies have demonstrated that downregulation of RIβ in murine hippocampal cultures, reduced phosphorylation of CREB, a transcription factor involved in long-term memory formation. The authors speculate that a similar effect on cAMP/PKA/CREB cascade may mediate the cognitive effects in humans. RIβ deficient mice also display diminished nociceptive pain, similar to the human phenotype. [Several refs provided]. The authors cite the study by Kaplanis et al (2020 - PMID: 33057194), where in a large sample of 31,058 trio exomes of children with developmental disorders, PRKAR1B was among the genes with significant enrichment for de novo missense variants. [The gene has a pLI score of 0.18 in gnomAD / o/e = 0.26 - so pLoF variants may not be deleterious]. Please note that a specific PRKAR1B variant (NM_002735.2:c.149T>G - p.Leu50Arg) has been previous reported to segregate with a late-onset neurodegenerative disorder characterized by dementia and/or parkinsonism within a large pedigree with 12 affected individuals [Wong et al 2014 - PMID: 25414040]. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3127 | MPP5 |
Konstantinos Varvagiannis gene: MPP5 was added gene: MPP5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MPP5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MPP5 were set to 33073849 Phenotypes for gene: MPP5 were set to Global developmental delay; Intellectual disability; Delayed speech and language development; Developmental regression; Behavioral abnormality Penetrance for gene: MPP5 were set to unknown Review for gene: MPP5 was set to GREEN Added comment: Sterling et al (2020 - PMID: 33073849) provide information on the phenotype of 3 individuals with de novo MPP5 variants. Common features included global developmental delay, intellectual disability (3/3 - severe in 2/3), speech delay/regression (the latter in at least 2) and behavioral abnormalities. Variable other features were reported, among others microcephaly (1/3), abnormal vision (1/3 : CVI, retinal dystrophy, nystagmus), brain MRI abnormalities (2/3), late-onset seizures (1/3). These subjects displayed variable and non-specific dysmorphic features. All were investigated by exome sequencing (previous investigations not mentioned). One subject was found to harbor a de novo mosaic (5/25 reads) stopgain variant, further confirmed by Sanger sequencing [NM_022474.4:c.1555C>T - p.(Arg519Ter). The specific variant is reported once in gnomAD (1/251338). Two de novo missense variants were identified in the remaining individuals [c.1289A>G - p.Glu430Gly / c.974A>C - p.His325Pro). All variants had in silico predictions in favor of a deleterious effect (CADD score >24). The authors comment that MPP5 encodes an apical complex protein with asymmetric localization to the apical side of polarized cells. It is expressed in brain, peripheral nervous system and other tissues. MPP5 is a member of the membrane-associated guanylate kinase family of proteins (MAGUK p55 subfamily), determining cell polarity at tight junctions. Previous animal models suggest that complete Mpp5(Pals1) KO in mice leads to near absence of cerebral cortical neurons. Htz KO display reduction in size of cerebral cortex and hippocampus. The gene is expressed in proliferating cell populations of cerebellum and important for establishment cerebellar architecture. Conditional KO of Mpp5(Pals1) in retinal progenitor cells mimics the retinal pathology observed in LCA. [Several refs. provided] The authors studied a heterozygous CNS-specific Mpp5 KO mouse model. These mice presented microcephaly, decreased cerebellar volume and cortical thickness, decreased ependymal cells and Mpp5 at the apical surface of cortical vertrical zone. The proportion of cortical cells undergoing apoptotic cell death was increased. Mice displayed behavioral abnormalities (hyperactivity) and visual deficits, with ERG traces further suggesting retinal blindness. Overall the mouse model was thought to recapitulate the behavioral abnormalities observed in affected subjects as well as individual rare features such as microcephaly and abnormal vision. Haploinsufficiency (rather than a dominant negative effect) is favored as the underlying disease mechanism. This is also in line with a dose dependent effect observed in mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3126 | ODC1 | Zornitza Stark edited their review of gene: ODC1: Added comment: Fifth individual reported in PMID 30239107: de novo nonsense variant identified, molecular modeling suggested that due to lack of a C terminus in the mutant protein, antizyme binding does not induce ODC degradation, leading to accumulation of active protein.; Changed publications: 30475435, 30239107 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3102 | PRKACB |
Konstantinos Varvagiannis gene: PRKACB was added gene: PRKACB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRKACB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PRKACB were set to 33058759 Phenotypes for gene: PRKACB were set to Postaxial hand polydactyly; Postaxial foot polydactyly; Common atrium; Atrioventricular canal defect; Narrow chest; Abnormality of the teeth; Intellectual disability Penetrance for gene: PRKACB were set to Complete Review for gene: PRKACB was set to AMBER Added comment: ID was a feature in 2/4 individuals with PRKACB pathogenic variant reported to date. ------ Palencia-Campos et al (2020 - PMID: 33058759) report on the phenotype of 3 individuals heterozygous for PRKACA and 4 individuals heterozygous for PRKACB pathogenic variants. The most characteristic features in all individuals with PRKACA/PRKACB mutation, included postaxial polydactyly of hands (6/7 bilateral, 1/7 unilateral) and feet (4/7 bilateral, 1/7 unilateral), brachydactyly and congenital heart defects (CHD 5/7) namely a common atrium or AVSD. Two individuals with PRKACA variant who did not have CHD had offspring with the same variant and an AVSD. Other variably occurring features included short stature, limbs, narrow chest, abnormal teeth, oral frenula, nail dysplasia. One individual with PRKACB variant presented tumors. Intellectual disability was reported in 2/4 individuals with PRKACB variant (1/4: mild, 1/4: severe). The 3 individuals with PRKACA variant did not present ID. As the phenotype was overall suggestive of Ellis-van Creveld syndrome (or the allelic Weyers acrofacial dysostosis), although these diagnoses were ruled out following analysis of EVC and EVC2 genes. WES was carried out in all. PRKACA : A single heterozygous missense variant was identified in 3 individuals from 3 families (NM_002730.4:c.409G>A / p.Gly137Arg) with 1 of the probands harboring the variant in mosaic state (28% of reads) and having 2 similarly affected offspring. The variant was de novo in one individual and inherited in a third one having a similarly affected fetus (narrow thorax, postaxial polyd, AVSD). PRKACB : 4 different variants were identified (NM_002731.3: p.His88Arg/Asn, p.Gly235Arg, c.161C>T - p.Ser54Leu). One of the individuals was mosaic for the latter variant, while in all other cases the variant had occurred de novo. Protein kinase A (PKA) is a tetrameric holoenzyme formed by the association of 2 catalytic (C) subunits with a regulatory (R) subunit dimer. Activation of PKA is achieved through binding of 2 cAMP molecules to each R-subunit, and unleashing(/dissociation) of C-subunits to engage substrates. PRKACA/B genes encode the Cα- and Cβ-subunits while the 4 functionally non-redundant regulatory subunits are encoded by PRKAR1A/1B/2A/2B genes. The authors provide evidence that the variants confer increased sensitivity of PKA holoenzymes to activation by cAMP (compared to wt). By performing ectopic expression of wt or mt PRKACA/B (variants studied : PRKACA p.Gly137Arg / PRKACB p.Gly235Arg) in NIH 3T3 fibroblasts, the authors demonstrate that inhibition of hedgehog signaling likely underlyies the developmental defects observed in affected individuals. As for PRKACA, the authors cite another study where a 31-month old female with EvC syndrome diagnosis was found to harbor the aforementioned variant (NM_001304349.1:c.637G>A:p.Gly213Arg corresponding to NM_002730.4:c.409G>A / p.Gly137Arg) as a de novo event. Without additional evidence at the time, the variant was considered to be a candidate for this subject's phenotype (Monies et al 2019 – PMID: 31130284). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3098 | DPH1 | Zornitza Stark edited their review of gene: DPH1: Added comment: Four unrelated families reported, 11 affected individuals. Common clinical features include abnormal skull shape (trigonocephaly, scaphocephaly, or prominent forehead accompanied with metopic ridge), distinctive face (downslanted palpebral fissures, low set ears, depressed nasal bridge, and sparse hair on the scalp, eyelashes, and/or eyebrows), short stature, developmental delay, and intellectual disability. Heart and brain malformations are also frequently observed.; Changed publications: 29362492, 29410513, 25558065, 26220823 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3095 | JARID2 | Zornitza Stark changed review comment from: 13 additional individuals reported, note CNVs common.; to: 13 additional individuals reported, note CNVs common but LOF sequence variants identified too. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3095 | JARID2 | Zornitza Stark edited their review of gene: JARID2: Added comment: 13 additional individuals reported, note CNVs common.; Changed rating: GREEN; Changed publications: 23294540, 33077894 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3092 | NUDT2 | Zornitza Stark changed review comment from: Two additional families reported with a different homozygous variant and ID/polyneuropathy phenotype. Upgrade to Green.; to: Three individuals from two additional families reported with a different homozygous variant and ID/polyneuropathy phenotype. Upgrade to Green. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | CSNK1G1 |
Konstantinos Varvagiannis changed review comment from: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) are also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature; to: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presented ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) are also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | CSNK1G1 |
Konstantinos Varvagiannis changed review comment from: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature; to: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) are also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | CSNK1G1 |
Konstantinos Varvagiannis gene: CSNK1G1 was added gene: CSNK1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSNK1G1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CSNK1G1 were set to 33009664 Phenotypes for gene: CSNK1G1 were set to Global developmental delay; Intellectual disability; Autism; Seizures; Abnormality of the face; Abnromality of limbs Penetrance for gene: CSNK1G1 were set to unknown Review for gene: CSNK1G1 was set to AMBER Added comment: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | LMNB2 |
Konstantinos Varvagiannis changed review comment from: Please consider inclusion of LMNB2 in the ID panel with amber/green rating. Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6). LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event. LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His. LMNB1/2 common phenotypes : All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) appart from one individual, without history of IUGR or postnatally abnormal height (the latter in most). Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2. LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13). LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occured at the age of 6y in 1/6). Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some). Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some). Animal model: Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different. Variant effect : variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments. Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency. [Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed] Sources: Literature; to: Please consider inclusion of LMNB2 in the ID panel with amber/green rating. Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6). LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event. LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His. LMNB1/2 common phenotypes : All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) apart from one individual, without history of IUGR or postnatally abnormal height (the latter in most). Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2. LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13). LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occurred at the age of 6y in 1/6). Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some). Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some). Animal model: Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different. Variant effect : variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments. Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency. [Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed] Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | LMNB2 |
Konstantinos Varvagiannis gene: LMNB2 was added gene: LMNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LMNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LMNB2 were set to 33033404 Phenotypes for gene: LMNB2 were set to Congenital microcephaly; Global developmental delay; Intellectual disability Penetrance for gene: LMNB2 were set to Complete Mode of pathogenicity for gene: LMNB2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: LMNB2 was set to GREEN Added comment: Please consider inclusion of LMNB2 in the ID panel with amber/green rating. Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6). LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event. LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His. LMNB1/2 common phenotypes : All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) appart from one individual, without history of IUGR or postnatally abnormal height (the latter in most). Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2. LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13). LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occured at the age of 6y in 1/6). Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some). Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some). Animal model: Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different. Variant effect : variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments. Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency. [Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed] Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | LMNB1 |
Konstantinos Varvagiannis commented on gene: LMNB1: There is an additional report on LMBN1/2-associated phenotypes supporting green rating of the gene in the current panel. Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6). LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event. LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His. LMNB1/2 common phenotypes : All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) appart from one individual, without history of IUGR or postnatally abnormal height (the latter in most). Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2. LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13). LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occured at the age of 6y in 1/6). Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some). Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some). Animal model: Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different. Variant effect : variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments. Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency. [Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed] -------- |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3071 | WDPCP | Zornitza Stark changed review comment from: Two families reported; the first one with a BBS phenotype, and in the second one affected individual had polysyndactyly and tongue hamartomas, so phenotype consistent with OFD rather than BBS.; to: At least four families reported with ciliopathy phenotypes (BBS, OFD, syndromic retinopathy). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3062 | ITFG2 |
Konstantinos Varvagiannis gene: ITFG2 was added gene: ITFG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ITFG2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ITFG2 were set to 28397838; https://doi.org/10.1038/s41525-020-00150-z Phenotypes for gene: ITFG2 were set to Neurodevelopmental abnormality; Intellectual disability; Developmental regression; Ataxia Penetrance for gene: ITFG2 were set to Complete Review for gene: ITFG2 was set to AMBER Added comment: ITFG2 was suggested to be a candidate gene for autosomal recessive ID in the study by Harripaul et al (2018 - PMID: 28397838). The authors performed microarray and exome sequencing in 192 consanguineous families and identified a homozygous ITGF2 stopgain variant (NM_018463.3:c.472G>T / p.Glu158*) along with 3 additional variants segregating with ID within an investigated family (PK51). Cheema et al (2020 - https://doi.org/10.1038/s41525-020-00150-z) report briefly on a male, born to consanguineous parents presenting with NDD, seizures, regression and ataxia. There was a similarly affected female sibling. Evaluation of ROH revealed a homozygous ITFG2 nonsense variant [NM_018463.3:c.361C>T / p.(Gln121*)]. Families in this study were investigated by trio WES or WGS. Evaluation of data of the same lab revealed 3 additional unrelated subjects with overlapping phenotypes, notably NDD and ataxia. These individuals were - each - homozygous for pLoF variants [NM_018463.3:c.848-1G>A; NM_018463.3:c.704dupC, p.(Ala236fs), NM_018463.3:c.1000_1001delAT, p.(Ile334fs)]. As discussed in OMIM, ITFG2 encodes a subunit of the KICSTOR protein complex, having a role in regulating nutrient sensing by MTOR complex-1 (Wolfson et al 2017 - PMID : 28199306). Please consider inclusion in the ID panel with amber rating, pending further details. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3062 | SHMT2 |
Konstantinos Varvagiannis gene: SHMT2 was added gene: SHMT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SHMT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SHMT2 were set to 33015733 Phenotypes for gene: SHMT2 were set to Congenital microcephaly; Infantile axial hypotonia; Spastic paraparesis; Global developmental delay; Intellectual disability; Abnormality of the corpus callosum; Abnormal cortical gyration; Hypertrophic cardiomyopathy; Abnormality of the face; Proximal placement of thumb; 2-3 toe syndactyly Penetrance for gene: SHMT2 were set to Complete Review for gene: SHMT2 was set to GREEN Added comment: García‑Cazorla et al. (2020 - PMID: 33015733) report 5 individuals (from 4 families) with a novel brain and heart developmental syndrome caused by biallelic SHMT2 pathogenic variants. All affected subjects presented similar phenotype incl. microcephaly at birth (5/5 with OFC < -2 SD though in 2/5 cases N OFC was observed later), DD and ID (1/5 mild-moderate, 1/5 moderate, 3/5 severe), motor dysfunction in the form of spastic (5/5) paraparesis, ataxia/dysmetria (3/4), intention tremor (in 3/?) and/or peripheral neuropathy (2 sibs). They exhibited corpus callosum hypoplasia (5/5) and perisylvian microgyria-like pattern (4/5). Cardiac problems were reported in all, with hypertrophic cardiomyopathy in 4/5 (from 3 families) and atrial-SD in the 5th individual (1/5). Common dysmorphic features incl. long palpebral/fissures, eversion of lateral third of lower eylids, arched eyebrows, long eyelashes, thin upper lip, short Vth finger, fetal pads, mild 2-3 toe syndactyly, proximally placed thumbs. Biallelic variants were identified following exome sequencing in all (other investigations not mentioned). Identified variants were in all cases missense SNVs or in-frame del, which together with evidence from population databases and mouse model might suggest a hypomorphic effect of variants and intolerance/embryonic lethality for homozygous LoF ones. SHMT2 encodes the mitohondrial form of serine hydroxymethyltransferase. The enzyme transfers one-carbon units from serine to tetrahydrofolate (THF) and generates glycine and 5,10,methylene-THF. Mitochondrial defect was suggested by presence of ragged red fibers in myocardial biopsy of one patient. Quadriceps and myocardial biopsies of the same individual were overall suggestive of myopathic changes. While plasma metabolites were within N range and SHMT2 protein levels not significantly altered in patient fibroblasts, the authors provide evidence for impaired enzymatic function eg. presence of the SHMT2 substrate (THF) in patient but not control (mitochondria-enriched) fibroblasts , decrease in glycine/serine ratios, impared folate metabolism. Patient fibroblasts displayed impaired oxidative capacity (reduced ATP levels in a medium without glucose, diminished oxygen consumption rates). Mitochondrial membrane potential and ROS levels were also suggestive of redox malfunction. Shmt2 ko in mice was previously shown to be embryonically lethal attributed to severe mitochondrial respiration defects, although there was no observed brain metabolic defect. The authors performed Shmt2 knockdown in motoneurons in Drosophila, demonstrating neuromuscular junction (# of satellite boutons) and motility defects (climbing distance/velocity). Overall this gene can be considered for inclusion with (probably) green rating in gene panels for ID, metabolic / mitochondrial disorders, cardiomyopathy, congenital microcephaly, corpus callosum anomalies, etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3062 | VPS41 |
Zornitza Stark gene: VPS41 was added gene: VPS41 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VPS41 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS41 were set to 32808683 Phenotypes for gene: VPS41 were set to Dystonia; intellectual disability Review for gene: VPS41 was set to RED Added comment: Single individual reported with homozygous canonical splice site variant resulting in exon 7 skipping, and global developmental delay and generalized dystonia. He attained a few words and voluntary limb movements but never sat unsupported. He had pale optic discs and an axonal neuropathy. From 6 years of age, his condition began to deteriorate, with reduced motor abilities and alertness. An MRI of the brain showed atrophy of the superior cerebellar vermis and slimming of the posterior limb of the corpus callosum. VPS41 is component of the HOPS complex and other genes in the complex have been implicated in movement disorders. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides produced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration in mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could be ruled out that the de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3051 | SETD1A |
Zornitza Stark gene: SETD1A was added gene: SETD1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SETD1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SETD1A were set to 31197650; 32346159 Phenotypes for gene: SETD1A were set to Epilepsy, early-onset, with or without developmental delay, MIM# 618832 Review for gene: SETD1A was set to GREEN Added comment: 19 unrelated individuals reported with de novo variants in this gene and a neurodevelopmental phenotype, primarily manifesting and ID and seizures. LOF mechanism supported by functional data. Three mouse models. SNPs in this gene have also been associated with risk of developing schizophrenia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3050 | HPDL |
Zornitza Stark changed review comment from: Intellectual impairment is variable, ranging from poor visual contact with inability to walk or speak to milder intellectual disability with the ability to say some words.; to: 17 individuals from 13 families, with a spectrum of neurologic impairment ranging from a severe congenital form without any neurological development (n = 2/17, 12%) to infantile-onset presentations (n = 10/17, 59%) with moderate to severe neurodevelopmental issues, partly with a pathology reminiscent of mitochondrial disease (Leigh-like syndrome), to juvenile-onset spastic paraplegia (n = 5/17, 29%). Intellectual impairment is variable, ranging from poor visual contact with inability to walk or speak to milder intellectual disability with the ability to say some words. Frequently observed additional clinical findings included chronic progression of neurological signs (n = 16/17, 94%), microcephaly (n = 9/16, 56%), and seizures/epilepsy (n = 9/17, 53%). Other relevant clinical findings were visual disturbances/strabismus (n = 9/17, 53%) and loss of developmental milestones (n = 6/17, 35%). Acute central respiratory failure leading to life-threatening events requiring partly mechanically assisted ventilation occurred in half of individuals with infantile presentation (n = 5/10, 50%), respectively one third of all individuals (n = 5/17, 29%). Demyelinating neuropathy was present in three individuals (n = 3/11, 27%), with reduced sensory nerve conduction velocity (NCV) in all and severely reduced motor NCV in one. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3049 | PRKD1 | Zornitza Stark Added comment: Comment when marking as ready: Literature reviewed again: ID/DD reported in 2/5 but unclear at present if this is part of the phenotype given low number of affected individuals. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3013 | ZMYM2 |
Konstantinos Varvagiannis gene: ZMYM2 was added gene: ZMYM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZMYM2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ZMYM2 were set to 32891193 Phenotypes for gene: ZMYM2 were set to Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly Penetrance for gene: ZMYM2 were set to unknown Review for gene: ZMYM2 was set to AMBER Added comment: Heterozygous pathogenic (pLoF) ZMYM2 variants have been reported in individuals with syndromic presentation including CAKUT (in several cases) and variable neurological manifestations among extra-renal features. DD and ID were reported in some of the families described to date as summarized below. You might consider inclusion with green/amber rating in the ID panel and green in the panel for CAKUT. -- Connaughton et al (2020 - PMID: 32891193) report on 19 individuals (from 15 unrelated families) with heterozygous pathogenic ZMYM2 variants. [Article not reviewed in detail]. Affected individuals from 7 families presented with CAKUT while all of them displayed extra-renal features. Neurological manifestations were reported in 16 individuals from 14 families (data not available for 1 fam), among others hypotonia (3/14 fam), speech delay (4/14 fam), global DD (9/14 fam), ID (4/14 fam), microcephaly (4/14 fam). ASD was reported in 4 fam (4 indiv). Seizures were reported in 2 fam (2 indiv). Variable other features included cardiac defects, facial dysmorphisms, small hands and feet with dys-/hypo-plastic nails and clinodactyly. 14 pLoF variants were identified, in most cases as de novo events (8 fam). In 2 families the variant was inherited from an affected parent. Germline mosaicism occurred in 1 family. The human disease features were recapitulated in a X. tropicalis morpholino knockdown, with expression of truncating variants failing to rescue renal and craniofacial defects. Heterozygous Zmym2-deficient mice also recapitulated the features of CAKUT. ZMYM2 (previously ZNF198) encodes a nuclear zinc finger protein localizing to the nucleus (and PML nuclear body). It has previously been identified as transcriptional corepressor interacting with nuclear receptors and the LSD1-CoREST-HDAC1 complex. It has also been shown to interact with FOXP transcription factors. The authors provide evidence for loss of interaction of the truncated ZMYM2 with FOXP1 (mutations in the latter having recently been reported in syndromic CAKUT). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3012 | NEMF |
Zornitza Stark gene: NEMF was added gene: NEMF was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NEMF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NEMF were set to 32934225 Phenotypes for gene: NEMF were set to Intellectual disability; neuropathy Review for gene: NEMF was set to GREEN Added comment: Nine individuals from 7 unrelated families reported with a mixed CNS/PNS phenotype. 7/9 had ID, 4/9 had formal assessments demonstrating axonal neuropathy, 3/9 had ataxia; muscular atrophy, hypotonia, respiratory distress, scoliosis also described in some. Three independently generated mouse models had progressive motor neuron degeneration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2982 | SLC16A2 | Zornitza Stark changed review comment from: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability.; to: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. In a recent review of 24 affected individuals (PMID 31410843), 16 presented with profound developmental delay, three had severe intellectual disability with poor language and walking with an aid, four had moderate intellectual disability with language and walking abilities, and one had mild intellectual disability with hypotonia. Overall, eight had learned to walk, all had hypotonia, 17 had spasticity, 18 had dystonia, 12 had choreoathetosis, 19 had hypomyelination, and 10 had brain atrophy. Kyphoscoliosis (n=12), seizures (n=7), and pneumopathies (n=5) were the most severe complications. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2960 | FITM2 |
Zornitza Stark gene: FITM2 was added gene: FITM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: FITM2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FITM2 were set to 28067622; 30214770; 30288795 Phenotypes for gene: FITM2 were set to Siddiqi syndrome MIM#618635 Review for gene: FITM2 was set to GREEN Added comment: Autosomal recessive condition characterised by global developmental delay, early-onset progressive sensorineural hearing impairment, regression of motor skills, dystonia, poor overall growth, and low body mass index (BMI). More variable features may include ichthyosis-like skin abnormalities or sensory neuropathy. 7 individuals from three unrelated families reported, supportive Drosophila model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2958 | FDXR | Zornitza Stark changed review comment from: ID is not part of the phenotype.; to: Bi-allelic variants in FDXR cause an autosomal recessive neurologic disorder characterised by onset of visual and hearing impairment in the first or second decades. Two individuals described with a more severe phenotype, including one with intellectual disability. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2954 | TRIP13 | Zornitza Stark changed review comment from: Early-onset Wilms tumor and either aneuploidy or premature chromatid separation in cells. Some individuals described as having additional developmental features, such as microcephaly, growth retardation, or developmental delay but these are highly variable.; to: Early-onset Wilms tumor and either aneuploidy or premature chromatid separation in cells. Some individuals described as having additional developmental features, such as microcephaly, growth retardation, or developmental delay but these are highly variable. Also note 5/6 reported families had the same homozygous variant, p.Arg354X, suggestive of founder effect. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2949 | DHX37 |
Naomi Baker gene: DHX37 was added gene: DHX37 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DHX37 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: DHX37 were set to PMID: 26539891; 31256877 Phenotypes for gene: DHX37 were set to Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731 Review for gene: DHX37 was set to GREEN Added comment: Two unrelated patients from consanguineous families reported with biallelic missense variants. Clinical presentation included severe microcephaly, DD/ID, and cortical atrophy (PMID: 26539891). Five individuals who share a phenotype of DD and/or ID and CNS dysfunction. Three out of five individuals also have scoliosis, and two have cardiac phenotypes (PMID: 31256877). Three of the patients had bialleleic missense variants, while two patients had a de novo monoallelic missense variant. Note that OMIM lists inheritance as biallelic, however two monoallelic cases reportes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2939 | TRAPPC2L |
Zornitza Stark gene: TRAPPC2L was added gene: TRAPPC2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC2L were set to 30120216; 32843486 Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 Review for gene: TRAPPC2L was set to AMBER Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2920 | CTNND1 |
Zornitza Stark gene: CTNND1 was added gene: CTNND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CTNND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CTNND1 were set to 28301459; 32196547 Phenotypes for gene: CTNND1 were set to Blepharocheilodontic syndrome 2, MIM# 617681 Review for gene: CTNND1 was set to AMBER Added comment: 4 individuals from 3 unrelated families with blepharocheilodontic syndrome and mutations in the CTNND1 gene reported originally in PMID 28301459. All had eyelid anomalies, including ectropion of the lower lids, euryblepharon, lagophthalmia, and distichiasis. In addition, all 4 showed typical facial dysmorphism with hypertelorism, flat face, and high forehead, and all had conical teeth and tooth agenesis. Three had cleft lip and palate, 3 had hair anomalies, and 1 had hypothyroidism due to hypoplasia or aplasia of the thyroid gland. None of the patients exhibited anal atresia or neural tube defects. PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13). This more recent publication suggests a broader phenotype associated with CTNND1 variants including dev delay, ADHD/ASD, behavioural issues. Unclear from description whether significant ID present. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2874 | PDE2A |
Zornitza Stark gene: PDE2A was added gene: PDE2A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: PDE2A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDE2A were set to 32467598; 32196122; 29392776 Phenotypes for gene: PDE2A were set to Paroxysmal dyskinesia Review for gene: PDE2A was set to AMBER Added comment: Four unrelated families reported with childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. One of the reports characterises the disorder as 'Rett-like'. Unclear at this time what proportion of affected individuals have ID as part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2849 | LMBRD2 |
Konstantinos Varvagiannis gene: LMBRD2 was added gene: LMBRD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LMBRD2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LMBRD2 were set to 32820033; https://doi.org/10.1101/797787 Phenotypes for gene: LMBRD2 were set to Global developmental delay; Intellectual disability; Microcephaly; Seizures; Abnormality of nervous system morphology; Abnormality of the eye Penetrance for gene: LMBRD2 were set to unknown Mode of pathogenicity for gene: LMBRD2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: LMBRD2 was set to AMBER Added comment: You may consider inclusion with green (13 individuals with dn missense SNVs overall, overlapping features for 10 with available phenotype / a recurring variant has been identified in 2 different studies) or amber rating (role of the gene not known, no variant studies, animal model probably not available). ► Malhotra et al (2020 - PMID: 32820033) report on 10 unrelated individuals with de novo missense LMBRD2 variants. Features included DD (9/10), ID (6/8 of relevant age), microcephaly (7/10), seizures (5/10 - >=3 different variants), structural brain abnormalities (e.g. thin CC in 6/9), highly variable ocular abnormalities (5/10) and dysmorphic features in some (7/10 - nonspecific). All had variable prior non-diagnostic genetic tests (CMA, gene panel, mendeliome, karyotype). WES/WGS revealed LMBRD2 missense variants, in all cases de novo. A single individual had additional variants with weaker evidence of pathogenicity. 5 unique missense SNVs and 2 recurrent ones (NM_001007527:c.367T>C - p.Trp123Arg / c.1448G>A - p.Arg483His) were identified. These occurred in different exons. Variants were not present in gnomAD and all had several in silico predictions in favor of a deleterious effect. There was phenotypic variability among individuals with the same variant (e.g. seizures in 1/3 and microchephaly in 2/3 of those harboring R483H). The gene has a pLI of 0 (although o/e ranges from 0.23 to 0.55), %HI of 15.13 and z-score of 2.27. The authors presume that haploinsufficiency may not apply, and consider a gain-of-function/dominant-negative effect more likely. As the authors comment LMBRD2 (LMBR1 domain containing 2) encodes a membrane bound protein with poorly described function. It is widely expressed across tissues with notable expression in human brain (also in Drosophila, or Xenopus laevis). It displays high interspecies conservation. It has been suggested (Paek et al - PMID: 28388415) that LMBRD2 is a potential regulator of β2 adrenoreceptor signalling through involvement in GPCR signalling. ► Kaplanis et al (2020 - https://doi.org/10.1101/797787) in a dataset of 31058 parent-offspring trios (WES) previously identified 3 individuals with developmental disorder, harboring c.1448G>A - p.Arg483His. These individuals (1 from the DDD study, and 2 GeneDx patients) appear in Decipher. [ https://decipher.sanger.ac.uk/ddd/research-variant/40e17c78cc9655a6721006fc1e0c98db/overview ]. The preprint by Kaplanis et al is cited by Malhotra et al, with Arg483His reported in 6 patients overall in both studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2840 | TAOK1 | Sue White commented on gene: TAOK1: Monoallelic de novo variants reported in 8 individuals with nonspecific phenotype of intellectual disability and hypotonia. Most were LOF, 2 missense. 3 had macrocephaly. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2836 | TAF1C |
Konstantinos Varvagiannis gene: TAF1C was added gene: TAF1C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TAF1C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TAF1C were set to 32779182 Phenotypes for gene: TAF1C were set to Global developmental delay; Intellectual disability; Spasticity; Strabismus; Seizures; Abnormality of nervous system morphology Penetrance for gene: TAF1C were set to Complete Review for gene: TAF1C was set to AMBER Added comment: Knuutinen et al (2020 - PMID: 32779182) report on 2 individuals from 2 consanguineous families, homozygous for TAF1C missense variants. Both presented with an early onset neurological phenotype with severe global DD, ID (2/2 - moderate and profound), spasticity (2/2), ophthalmic findings (strabismus 2/2, nystagmus 1/2). Epilepsy, abnormal brain MRI (cerebral and cerebellar atrophy and white matter hyperintensities) as well and additional findings were reported in one (always the same individual). Following a normal CMA, exome in the first case revealed a homozygous missense SNV (NM_005679.3:c.1165C>T / p.Arg389Cys) supported by in silico predictions. mRNA and protein levels were substantially reduced in fibroblasts from this subject. Only the patient and parents were tested for the variant but not 3 unaffected sibs (fig1). The second individual was homozygous for another missense variant (p.Arg405Cys) also supported by in silico predictions. The girl was the single affected person within the family with an unaffected sib and parents heterozygous for the variant. Several other unaffected relatives in the extended pedigree were either carriers for this variant or homozygous for the wt allele. TAF1C encodes the TATA-box binding protein associated factor (TAF) RNA polymerase I subunit. RNA polymerase I (Pol I) transcribes genes to produce rRNA. For Pol I to initiate transcription, two transcription factors are required : UBF (upstream binding factor encoded by UBTF) and SL1 (selectivity factor 1). The latter is formed by TBP (TATA-binding protein) and 3 Pol I-specific TBP-associated factors (TAFs). A recurrent de novo missense variant in UBTF (encoding the other Pol I transcription factor) causes a disorder with highly similar features. The specific variant acts through a gain-of-function mechanism (and not by LoF which appears to apply for TAF1C based on expression data). The authors hypothesize that altered Pol I activity and resulting ribosomal stress could cause the microcephaly and leukodystrophy (both reported in 1 - the same - individual). As a result, TAF1C may be considered for inclusion in the ID panel with amber rating pending further evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2833 | FAM50A |
Konstantinos Varvagiannis gene: FAM50A was added gene: FAM50A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FAM50A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: FAM50A were set to 32703943 Phenotypes for gene: FAM50A were set to Mental retardation syndrome, X-linked, Armfield type (MIM #300261) Penetrance for gene: FAM50A were set to unknown Review for gene: FAM50A was set to GREEN Added comment: Lee et al (2020 - PMID: 32703943) provide evidence that Armfield X-Linked intellectual disability syndrome is caused by monoallelic FAM50A pathogenic variants. The current review is based only on this reference. The authors provide clinical details on 6 affected individuals from 5 families. Features included postnatal growth delay, DD and ID (6/6 - also evident for those without formal IQ assesment), seizures (3/6 from 2 families), prominent forehead with presence of other facial features and variable head circumference (5th to >97th %le), ocular anomalies (5/6 - strabismus/nystagmus/Axenfeld-Rieger), cardiac (3/6 - ASD/Fallot) and genitourinary anomalies (3/6). In the first of these families (Armfield et al 1999 - PMID: 10398235), linkage analysis followed by additional studies (Sanger, NGS of 718 genes on chrX, X-exome NGS - several refs provided) allowed the identification of a FAM50A variant. Variants in other families were identified by singleton (1 fam) or trio-ES (3 fam). In affected individuals from 3 families, the variant had occurred de novo. Carrier females in the other families were unaffected (based on pedigrees and/or the original publication). XCI was rather biased in most obligate carrier females from the 1st family (although this ranged from 95:5 to 60:40). Missense variants were reported in all affected subjects incl. Trp206Gly, Asp255Gly, Asp255Asn (dn), Glu254Gly (dn), Arg273Trp (dn) (NM_004699.3). Previous studies have demonstrated that FAM50A has ubiquitous expression in human fetal and adult tissues (incl. brain in fetal ones). Immunostaining suggests a nuclear localization for the protein (NIH/3T3 cells). Comparison of protein levels in LCLs from affected males and controls did not demonstrate significant differences. Protein localization for 3 variants (transfection of COS-7 cells) was shown to be similar to wt. Complementation studies in zebrafish provided evidence that the identified variants confer partial loss of function (rescue of the morpholino phenotype with co-injection of wt but not mt mRNA). The zebrafish ko model seemed to recapitulate the abnormal development of cephalic structures and was indicative of diminished/defective neurogenesis. Transcriptional dysregulation was demonstrated in zebrafish (altered levels and mis-splicing). Upregulation of spliceosome effectors was demonstrated in ko zebrafish. Similarly, mRNA expression and splicing defects were demonstrated in LCLs from affected individuals. FAM50A pulldown followed by mass spectrometry in transfected HEK293T cells demonstrated enrichment of binding proteins involved in RNA processing and co-immunoprecipitation assays (transfected U-87 cells) suggested that FAM50A interacts with spliceosome U5 and C-complex proteins. Overall aberrant spliceosome C-complex function is suggested as the underlying pathogenetic mechanism. Several other neurodevelopmental syndromes are caused by variants in genes encoding C-complex affiliated proteins (incl. EFTUD2, EIF4A3, THOC2, etc.). Please consider inclusion in the ID panel with green rating and epilepsy panel with amber (seizures in individuals from 2 families). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2828 | HYLS1 | Zornitza Stark changed review comment from: Given that generally most affected individuals die in utero or shortly after birth, this is probably not the right panel for this gene.; to: Single family reported with Joubert phenotype, generally most affected individuals with hydrolethalus die in utero or shortly after birth so would not present with ID. Note founder variant in Finnish population associated with the hydrolethalus phenotype. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2813 | PIGQ |
Konstantinos Varvagiannis gene: PIGQ was added gene: PIGQ was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIGQ was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGQ were set to 32588908; 24463883; 25558065; 31148362 Phenotypes for gene: PIGQ were set to Epileptic encephalopathy, early infantile, 77 (MIM #618548) Penetrance for gene: PIGQ were set to Complete Review for gene: PIGQ was set to GREEN Added comment: Homozygous or compound heterozygous mutations in PIGQ cause Epileptic encephalopathy, early infantile, 77 (MIM #618548). Johnstone et al (2020 - PMID: 32588908) describe the phenotype of 7 children (from 6 families) with biallelic PIGQ pathogenic variants. The authors also review the phenotype of 3 subjects previously reported in the literature (by Martin et al, Alazami et al, Starr et al - respective PMIDs: 24463883, 25558065, 31148362). Affected individuals displayed severe to profound global DD/ID and seizures with onset in the first year of life. There were variable other features incl. - among others - genitourinary, cardiac, skeletal, ophthalmological anomalies, gastrointestinal issues. Within the cohort there was significant morbidity/mortality. PIGQ encodes phosphatidylinositol glycan anchor biosynthesis class Q protein, playing a role (early) in the biosynthesis of the GPI-anchor. Several genes in the GPI biosynthesis pathway cause multi-system disease with DD/ID and seizures. Flow cytometry has been used in individuals with PIGQ-related disorder. Serum ALP was elevated in some (4) although - as the authors comment - elevations are more typical in disorders affecting later steps of GPI biosynthesis. More than 10 variants have been reported to date (missense / pLoF). Overall PIGQ can be considered for green rating in both ID and epilepsy gene panels. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2807 | PJA1 |
Zornitza Stark gene: PJA1 was added gene: PJA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PJA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: PJA1 were set to 32530565 Phenotypes for gene: PJA1 were set to Intellectual disability; trigonocephaly Review for gene: PJA1 was set to AMBER Added comment: Recurrent variant, p.Arg376Cys, reported in 7 Japanese individuals, supportive mouse model. Individuals shared a common haplotype, suggestive of founder effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2806 | SCAF4 |
Crystle Lee gene: SCAF4 was added gene: SCAF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: SCAF4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SCAF4 were set to 32730804 Phenotypes for gene: SCAF4 were set to Mild intellectual disability; seizures; behavioral abnormalities Review for gene: SCAF4 was set to GREEN Added comment: > 5 variants reported in individuals with variable neurodevelopmental disorder characterized by mild intellectual disability, seizures, behavioral abnormalities, and various skeletal and structural anomalies. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2805 | NARS |
Konstantinos Varvagiannis changed review comment from: [Please note that HGNC Approved Gene Symbol for this gene is NARS1] Manole et al (2020 - PMID: 32738225) provide evidence that both biallelic and monoallelic (de novo) pathogenic NARS1 variants cause a neurodevelopmental disorder. In total 32 individuals from 21 families are reported, with biallelic variants identified in individuals from 13 families and de novo in 8 families. Similar features were reported for AR/AD occurrences of the disorder and included of microcephaly (90% - most often primary), epilepsy (23/32 or 74% - variable semiology incl. partial/myoclonic/generalized tonic-clonic seizures), DD and ID (as a universal feature), abnormal tone in several (hypotonia/spasticity), ataxia, demyelinating peripheral neuropathy (in 3 or more for each inheritance mode - or a total of 25%). Some individuals had dysmorphic features. NARS1 encodes an aminoacyl-tRNA synthetase (ARS) [asparaginyl-tRNA synthetase 1]. Aminoacyl-tRNA synthetases constitute a family of enzymes catalyzing attachment of amino-acids to their cognate tRNAs. As the authors comment, mutations in genes encoding several other ARSs result in neurological disorders ranging from peripheral neuropathy to severe multi-systemic NDD. Dominant, recessive or both modes for inheritance for mutations in the same gene (e.g. AARS1, YARS1, MARS1, etc) have been reported. Some variants were recurrent, e.g. the c.1600C>T / p.Arg534* which occurred in 6 families as a de novo event or c.1633C>T p.Arg545Cys (homozygous in 6 families). 3 different variants were reported to have occured de novo (c.965G>T - p.Arg322Leu, c.1525G>A - p.Gly509Ser, p.Arg534*) with several other variants identified in hmz/compound htz individuals. A single SNV (c.1067A>C - p.Asp356Ala) was suggested to be acting as modifier and pathogenic only when in trans with a severe variant. [NM_004539.4 used as RefSeq for all]. The authors provide several lines of evidence for a partial loss-of-function effect (e.g. reduction in mRNA expression, enzyme levels and activity in fibroblasts or iNPCs) underlying pathogenicity of the variants identified in individuals with biallelic variants. A gain-of-function (dominant-negative) effect is proposed for de novo variants (such effect also demonstrated for the p.Arg534* in a zebrafish model). As also Manole et al suggest, NARS1 can be considered for inclusion in gene panels for DD/ID, epilepsy and/or demyelinating neuropathy. Sources: Literature; to: [Please note that HGNC Approved Gene Symbol for this gene is NARS1] Manole et al (2020 - PMID: 32738225) provide evidence that both biallelic and monoallelic (de novo) pathogenic NARS1 variants cause a neurodevelopmental disorder. In total 32 individuals from 21 families are reported, with biallelic variants identified in individuals from 13 families and de novo in 8 families. Similar features were reported for AR/AD occurrences of the disorder and included microcephaly (90% - most often primary), epilepsy (23/32 or 74% - variable semiology incl. partial/myoclonic/generalized tonic-clonic seizures), DD and ID (as a universal feature), abnormal tone in several (hypotonia/spasticity), ataxia, demyelinating peripheral neuropathy (in 3 or more for each inheritance mode - or a total of 25%). Some individuals had dysmorphic features. NARS1 encodes an aminoacyl-tRNA synthetase (ARS) [asparaginyl-tRNA synthetase 1]. Aminoacyl-tRNA synthetases constitute a family of enzymes catalyzing attachment of amino-acids to their cognate tRNAs. As the authors comment, mutations in genes encoding several other ARSs result in neurological disorders ranging from peripheral neuropathy to severe multi-systemic NDD. Dominant, recessive or both modes for inheritance for mutations in the same gene (e.g. AARS1, YARS1, MARS1, etc) have been reported. Some variants were recurrent, e.g. the c.1600C>T / p.Arg534* which occurred in 6 families as a de novo event or c.1633C>T p.Arg545Cys (homozygous in 6 families). 3 different variants were reported to have occured de novo (c.965G>T - p.Arg322Leu, c.1525G>A - p.Gly509Ser, p.Arg534*) with several other variants identified in hmz/compound htz individuals. A single SNV (c.1067A>C - p.Asp356Ala) was suggested to be acting as modifier and pathogenic only when in trans with a severe variant. [NM_004539.4 used as RefSeq for all]. The authors provide several lines of evidence for a partial loss-of-function effect (e.g. reduction in mRNA expression, enzyme levels and activity in fibroblasts or iNPCs) underlying pathogenicity of the variants identified in individuals with biallelic variants. A gain-of-function (dominant-negative) effect is proposed for de novo variants (such effect also demonstrated for the p.Arg534* in a zebrafish model). As also Manole et al suggest, NARS1 can be considered for inclusion in gene panels for DD/ID, epilepsy and/or demyelinating neuropathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2805 | NARS |
Konstantinos Varvagiannis gene: NARS was added gene: NARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NARS was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: NARS were set to 32738225 Phenotypes for gene: NARS were set to Abnormal muscle tone; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Ataxia; Abnormality of the face; Demyelinating peripheral neuropathy Penetrance for gene: NARS were set to Complete Review for gene: NARS was set to GREEN Added comment: [Please note that HGNC Approved Gene Symbol for this gene is NARS1] Manole et al (2020 - PMID: 32738225) provide evidence that both biallelic and monoallelic (de novo) pathogenic NARS1 variants cause a neurodevelopmental disorder. In total 32 individuals from 21 families are reported, with biallelic variants identified in individuals from 13 families and de novo in 8 families. Similar features were reported for AR/AD occurrences of the disorder and included of microcephaly (90% - most often primary), epilepsy (23/32 or 74% - variable semiology incl. partial/myoclonic/generalized tonic-clonic seizures), DD and ID (as a universal feature), abnormal tone in several (hypotonia/spasticity), ataxia, demyelinating peripheral neuropathy (in 3 or more for each inheritance mode - or a total of 25%). Some individuals had dysmorphic features. NARS1 encodes an aminoacyl-tRNA synthetase (ARS) [asparaginyl-tRNA synthetase 1]. Aminoacyl-tRNA synthetases constitute a family of enzymes catalyzing attachment of amino-acids to their cognate tRNAs. As the authors comment, mutations in genes encoding several other ARSs result in neurological disorders ranging from peripheral neuropathy to severe multi-systemic NDD. Dominant, recessive or both modes for inheritance for mutations in the same gene (e.g. AARS1, YARS1, MARS1, etc) have been reported. Some variants were recurrent, e.g. the c.1600C>T / p.Arg534* which occurred in 6 families as a de novo event or c.1633C>T p.Arg545Cys (homozygous in 6 families). 3 different variants were reported to have occured de novo (c.965G>T - p.Arg322Leu, c.1525G>A - p.Gly509Ser, p.Arg534*) with several other variants identified in hmz/compound htz individuals. A single SNV (c.1067A>C - p.Asp356Ala) was suggested to be acting as modifier and pathogenic only when in trans with a severe variant. [NM_004539.4 used as RefSeq for all]. The authors provide several lines of evidence for a partial loss-of-function effect (e.g. reduction in mRNA expression, enzyme levels and activity in fibroblasts or iNPCs) underlying pathogenicity of the variants identified in individuals with biallelic variants. A gain-of-function (dominant-negative) effect is proposed for de novo variants (such effect also demonstrated for the p.Arg534* in a zebrafish model). As also Manole et al suggest, NARS1 can be considered for inclusion in gene panels for DD/ID, epilepsy and/or demyelinating neuropathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2804 | ZNF407 |
Konstantinos Varvagiannis gene: ZNF407 was added gene: ZNF407 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF407 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ZNF407 were set to 24907849; 32737394; 23195952 Phenotypes for gene: ZNF407 were set to Global developmental delay; Intellectual disability Penetrance for gene: ZNF407 were set to unknown Review for gene: ZNF407 was set to AMBER Added comment: You may consider inclusion of this gene probably with amber rating (or green if the evidence for biallelic variants is considered sufficient). Biallelic variants: - Kambouris et al. (2014 - PMID: 24907849) described 2 brothers with severe DD and ID, born to first cousin parents. Homozygosity mapping, following other non-diagnostic investigations (incl. aCGH), revealed 4 major homozygosity intervals. Exome sequencing in one identified 5 variants within these intervals, ZNF407 (c.5054C>G, p.Ser1685Trp) being the best candidate, supported also by segregation studies. The authors commented that zinc finger proteins act as transcriptional regulators, with mutations in genes encoding for other zinc finger proteins interfering with normal brain development. - Zahra et al. (2020 - PMID: 32737394) report on 7 affected individuals (from 3 families) homozygous or compound heterozygous for ZNF407 variants. Features included hypotonia, DD and ID (in all) and variable occurrence of short stature (6/6), microcephaly (in at least 5), behavioural, visual problems and deafness. Linkage analysis in the first family revealed a 4.4 Mb shared homozygosity region and exome (30x) revealed a 3-bp duplication, confirmed by Sanger sequencing and segregating with the disease (NM_001146189:c.2814_2816dup, p.Val939dup). Affected subjects from the 2 other families were each found to be homozygous (c.2405G>T) or compound heterozygous (c.2884C>G, c.3642G>C) for other variants. Segregation was compatible in all families. Other studies were not performed. The authors comment than only the 3-bp duplication fullfilled ACMG criteria for classification as LP, the other variants being all formally classified as VUS (also due to in silico predictions predicting a LB effect). In addition, while several features such as DD/ID and short stature appeared to be frequent among all patients reported, Zahra et all comment that there was partial clinical overlap with the sibs described by Kambouris et al (additional variants?). Monoallelic disruption of ZNF407: - Ren et al (2013 - PMID: 23195952) described an 8 y.o. boy with ID and ASD. The boy was found to harbor a de novo translocation between chromosomes 3 and 18 [46,XY,t(3;18)(p13;q22.3)]. Array CGH did not reveal any P/LP CNV. Delineation of the breakpoints (FISH, long-range PCR) revealed that the chr18 breakpoint disrupted intron 3 of ZNF407 (isoform 1) with the other breakpoint within a gene-free region of exon 3. There was a loss of 4-8 nt in chr18 and 2-6 in chr3. Sequencing of ZNF407 did not reveal additional variants. RNA isolation in blood followed by RT-PCR studied expression of all 3 ZNF407 isoforms (the intronic region being shared by isoforms 1 and 2). Expression of isoform 1 was shown to be significantly reduced compared to controls. Isoform 2 was undetectable (in blood) while isoform 3 expression was similar to controls. Sequencing of 105 additional patients with similar clinical presentation (ID & ASD) revealed 2 further individuals with de novo missense variants. - Based on the discussion by Kambouris et al (PMID: 24907849 - cited literature not here reviewed) ZNF407 may be deleted in patients with congenital aural atresia due to deletion of a critical region of 18q22.3 (though TSHZ1 is responsible for this phenotype) or 18q- although such deletions span several other genes (cited PMID: 16639285). In one case the breakpoint was shown to be disrupting ZNF407 (cited PMID: 24092497). - The denovo db and Decipher (research variant tab) list few individuals with de novo ZNF407 SNVs although these do not seem to allow conclusions. https://denovo-db.gs.washington.edu/denovo-db/QueryVariantServlet?searchBy=Gene&target=ZNF407 https://decipher.sanger.ac.uk/search/ddd-research-variants/results?q=znf407 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2803 | MAPK1 |
Konstantinos Varvagiannis gene: MAPK1 was added gene: MAPK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAPK1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAPK1 were set to 32721402 Phenotypes for gene: MAPK1 were set to Global developmental delay; Intellectual disability; Behavioral abnormality; Growth delay; Abnormality of the face; Abnormality of the neck; Abnormality of the cardiovascular system; Abnormality of the skin Penetrance for gene: MAPK1 were set to unknown Mode of pathogenicity for gene: MAPK1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: MAPK1 was set to GREEN Added comment: Motta et al (2020 - PMID: 32721402) report on 7 unrelated individuals harboring de novo missense MAPK1 pathogenic variants. The phenotype corresponded to a neurodevelopmental disorder and - as the authors comment - consistently included DD, ID , behavioral problems. Postnatal growth delay was observed in approximately half. Hypertelorism, ptosis, downslant of palpebral fissures, wide nasal bridge as low-set/posteriorly rotated ears were among the facial features observed (each in 3 or more subjects within this cohort). Together with short/webbed neck and abnormalities of skin (lentigines / CAL spots) and growth delay these led to clinical suspicion of Noonan s. or disorder of the same pathway in some. Congenital heart defects (ASD, mitral valve insufficiency, though not cardiomyopathy) occurred in 4/7. Bleeding diathesis and lymphedema were reported only once. MAPK1 encodes the mitogen-activated protein kinase 1 (also known as ERK2) a serine/threonine kinase of the RAS-RAF-MEK-(MAPK/)ERK pathway. MAPK1 de novo variants were identified in all individuals following trio exome sequencing (and extensive previous genetic investigations which were non-diagnostic). The distribution of variants, as well as in silico/vitro/vivo studies suggest a GoF effect (boosted signal through the MAPK cascade. MAPK signaling also upregulated in Noonan syndrome). The authors comment that screening of 267 additional individuals with suspected RASopathy (without mutations in previously implicated genes) did not reveal other MAPK1 variants. Overall this gene can be considered for inclusion in the ID panel with green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2790 | LARS |
Konstantinos Varvagiannis gene: LARS was added gene: LARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LARS were set to 32699352 Phenotypes for gene: LARS were set to Infantile liver failure syndrome 1, MIM# 615438 Penetrance for gene: LARS were set to Complete Review for gene: LARS was set to GREEN Added comment: Please consider inclusion with amber/green rating in the current panel. Biallelic pathogenic LARS1 variants cause Infantile liver failure syndrome 1, MIM# 615438. Lenz et al (2020 - PMID: 32699352) review the phenotype of 25 affected individuals from 15 families. Seizures occurred in 19/24 and were commonly associated with infections. Encephalopathic episodes (in 13 patients) accompanied by seizures up to status epilepticus occurred independently of hepatic decompensation. In addition 22/24 presented with neurodevelopmental delay. The authors comment that cognitive impairment was present in 13/17 individuals (mild-severe) whereas most presented with learning disabilities. These patients will most likely investigated for their liver disease (although presentation was highly variable and/or very mild in few). The gene encodes a cytoplasmic amino-acyl tRNA synthetase (ARS) with neurologic manifestations observed in almost all patients (and seizures / DD and ID common to other disorders due to mutations in other genes encoding for ARSs). Please note that the HGNC approved symbol for this gene is LARS1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2783 | MORC2 |
Konstantinos Varvagiannis gene: MORC2 was added gene: MORC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MORC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MORC2 were set to https://doi.org/10.1016/j.ajhg.2020.06.013 Phenotypes for gene: MORC2 were set to Charcot-Marie-Tooth disease, axonal, type 2Z, MIM #616688 Penetrance for gene: MORC2 were set to unknown Mode of pathogenicity for gene: MORC2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: MORC2 was set to GREEN Added comment: The current review is based on a recent report by Sacoto et al (2020 - https://doi.org/10.1016/j.ajhg.2020.06.013). While several previous studies focused on the phenotype of axonal motor and senory neuropathy in individuals with heterozygous MORC2 pathogenic variants (Charcot-Marie-Tooth disease, axonal, type 2Z, MIM #616688) some of them presented among others with hypotonia, muscle weakness, intellectual disability, microcephaly or hearing loss [refs provided by Sacoto et al - learning disabilities (in some patients) also listed in OMIM's clinical synopsis]. Sacoto et al present a cohort of 20 individuals having genetic testing for developmental delay or growth failure (with a single one for a diagnosis of sensorimotor neuropathy). Overlapping features included DD, ID (18/20 - mild to severe), short stature (18/20), microcephaly (15/20) and variable craniofacial dysmorphisms. The authors comment that features suggestive of neuropathy (weakness, hyporeflexia, abnormal EMG/NCS) were frequent but not the predominant complaint. EMG/NCS abnormalities were abnormal in 6 out of 10 subjects investigated in this cohort. Other findings included brain MRI abnormalities (12/18 - in 5/18 Leigh-like lesions), hearing loss (11/19) and pigmentary retinopathy in few (5). Affected subjects were found to harbor in all cases missense variants in the ATPase module of MORC2 [residues 1 to 494 - NM_001303256.1 - the module consists of an ATPase domain (aa 1-265), a transducer S5-like domain (266-494) and a coiled-coiled domain (CC1 - aa 282-361)]. Variants had occured mostly as de novo events although inheritance from a similarly affected parent was also reported. Some of them were recurring within this cohort and/or the literature eg. c.79G>A/p.Glu27Lys (x5), c.260C>T/p.Ser87Leu (x2), c.394C>T/p.Arg132Cys (4x), c.1164C>G/p.Ser388Arg (x2), c.1181A>G/p.Tyr394Cys (x3). MORC2 encodes an ATPase involved in chromatin remodeling, DNA repair and transcriptional regulation. Chromatin remodeling and epigenetic silencing by MORC2 is mediated by the HUSH (Human Silencing Hub) complex. Functional studies (MORC2-knockout HeLa cells harboring a HUSH-sensitive GFP reporter were transduced with wt or mt MORC2 followed by measurement of reporter repression) supported the deleterious effect of most variants known at the time (hyperactivation of HUSH-mediating silencing, in line with previous observations). Overall this gene can be considered for inclusion in the ID panel with green rating. Also other gene panels (e.g. for short stature, microcephaly, hearing loss, pigmentary retinopathy, etc) if it meets the respective criteria for inclusion. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | KIF21B |
Konstantinos Varvagiannis gene: KIF21B was added gene: KIF21B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIF21B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KIF21B were set to 32415109 Phenotypes for gene: KIF21B were set to Global developmental delay; Intellectual disability; Abnormality of brain morphology; Microcephaly Penetrance for gene: KIF21B were set to unknown Mode of pathogenicity for gene: KIF21B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: KIF21B was set to GREEN Added comment: Asselin et al (2020 - PMID: 32415109) report on 4 individuals with KIF21B pathogenic variants. DD/ID (borderline intellectual functioning to severe ID) was a feature in all. Variable other findings included brain malformations (CCA) and microcephaly. 3 missense variants and a 4-bp insertion were identified, in 3 cases as de novo events while in a single subject the variant was inherited from the father who was also affected. The authors provide evidence for a role of KIF21B in the regulation of processes involved in cortical development and deleterious effect of the missense variants impeding neuronal migration and kinesin autoinhibition. Phenotypes specific to variants (e.g. CCA or microcephaly) were recapitulated in animal models. Missense variants are thought to exert a gain-of-function effect. As commented on, the 4-bp duplication (/frameshift) variant might not be pathogenic. In blood sample from the respective individual, RT-qPCR analysis suggested that haploinsufficiency (NMD) applies. Although Kif21b haploinsufficiency in mice was shown to lead to impaired neuronal positioning, the gene might partially tolerate LoF variants as also suggested by 28 such variants in gnomAD. Homozygous Kif21b ko mice display severe morphological abnormalities, partial loss of commissural fibers, cognitive deficits and altered synaptic transmission (several refs to previous studies provided by the authors). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | PAX1 |
Konstantinos Varvagiannis gene: PAX1 was added gene: PAX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: PAX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PAX1 were set to 29681087; 23851939; 28657137 Phenotypes for gene: PAX1 were set to Otofaciocervical syndrome 2, 615560 Penetrance for gene: PAX1 were set to Complete Review for gene: PAX1 was set to AMBER Added comment: Biallelic PAX1 pathogenic variants cause Otofaciocervical syndrome 2 (OMIM 615560). Brief review of the literature suggests 3 relevant publications to date (04-07-2020). 2 individuals with DD and ID have been reported (Patil et al, 2018 - PMID: 29681087 and Pohl et al, 2013 - PMID: 23851939). Other subjects reported were only evaluated as newborns(mostly)/infants [Paganini et al, 2017 - PMID: 28657137, Patil et al, 2018 - PMID: 29681087]. While the first report by Pohl et al identified a homozygous missense variant supported by functional studies [NM_006192.5:c.497G>T - p.(Gly166Val)] subsequent ones identified homozygosity for pLoF mutations [Patil et al: NM_006192.4:c.1173_1174insGCCCG / Paganini et al: NM_006192:c.1104C>A - p.(Cys368*)]. As discussed by Pohl et al: PAX1 encodes a transcription factor with critical role in pattern formation during embryogenesis. Study of the mouse Gly157Val (equivalent to human Gly166Val) Pax1 variant suggested reduced binding affinity (reduced transactivation of a regulatory sequence of the Nkx3-2 promoter) and hypofunctional nature of this variant. Mouse models seem to recapitulate features of the disorder (skeletal, immunodeficiency) while the role of Pax1 in hearing process was thought to be supported by early expression (P6) in mouse cochlea. Overall this gene can be considered for inclusion in the ID panel with amber/green rating. Sources: Literature, Radboud University Medical Center, Nijmegen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | TMEM106B |
Konstantinos Varvagiannis gene: TMEM106B was added gene: TMEM106B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM106B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TMEM106B were set to 29186371; 29444210; 32595021 Phenotypes for gene: TMEM106B were set to Leukodystrophy, hypomyelinating, 16 (MIM #617964) Penetrance for gene: TMEM106B were set to Complete Mode of pathogenicity for gene: TMEM106B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: TMEM106B was set to GREEN Added comment: 6 unrelated individuals with Leukodystrophy, hypomyelinating, 16 (MIM #617964) due to a recurrent TMEM106B variant have been reported to date in the literature (Simons et al 2017 - PMID: 29186371, Yan et al 2018 - PMID: 29444210, Ikemoto et al 2020 - PMID: 32595021). While a 3 y.o. female described by Yan et al had DD (eg sitting at 9m, walking at 25m) with normal cognitive functioning, and a 38 y.o. female had borderline intellectual functioning (IQ 76), 4 affected individuals had ID. Among them, a 19 y.o. male with severe ID was also found to harbor a second de novo possibly damaging USP7 variant. Seizures have been reported in 2 unrelated subjects. [Clinical features are also summarized in table 1 - Ikemoto et al]. All harbored NM_001134232.2(TMEM106B):c.754G>A (p.Asp252Asn) which in almost all cases occurred as a de novo event. In a single case this variant was inherited from a mosaic parent with mild DD in infancy but normal cognition (reported by Simons et al). As discussed by Ito et al (2018 - PMID: 30643851) the encoded protein is a structural component of the lysosomal membrane, playing a role on lysosome acidification. Acidity of the lysosome mediates multiple aspects of lysosomal function. Ito et al, using patient-derived fibroblasts assessed mRNA and protein levels. These were unaltered compared with controls. While TMEM106B had been previously shown to affect lysosome number, morphology and acidification, Ito et al demonstrated increased number of lysosomes in patient cells as well as impaired acidification compared to controls. As commented lysosomes are required for generation of myelin. Recurrence of this missense variant, the presence of pLoF TMEM106B variants in gnomAD as well as the phenotypically normal Tmem106b null mice suggest that this variant may have a gain-of-function or dominant negative effect. Genes for other forms of hypomyelinating lipodystrophy (incl. PLP1) have green rating in the ID panel. Overall TMEM106B can be considered for the ID panel with green rating and the epilepsy panel with amber rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | TBC1D2B |
Konstantinos Varvagiannis gene: TBC1D2B was added gene: TBC1D2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TBC1D2B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBC1D2B were set to 32623794 Phenotypes for gene: TBC1D2B were set to Global developmental delay; Intellectual disability; Seizures; Gingival overgrowth; Behavioral abnormality; Abnormality of the mandible; Abnormality of brain morphology; Abnormality of the eye; Hearing abnormality Penetrance for gene: TBC1D2B were set to Complete Review for gene: TBC1D2B was set to AMBER Added comment: Harms et al (2020 - PMID: 32623794) report on 3 unrelated individuals with biallelic pLoF TBC1D2B variants. Features included cognitive impairment (mild ID in one case, regression at the age of 12y in another, hypotonia and delayed milestones in a third aged 8m), seizures (3/3 - variable age of onset) and/or gingival overgrowth (2/3 - prior to initiation of AEDs). Other findings included behavioral abnormalities, mandibular anomalies, abnormal brain imaging and ophthalmologic or (rarely) audiometric evaluations. All were born to non-consanguineous couples and additional investigations were performed in some. Variants were identified by WES or trio WGS, with Sanger confirmation/compatible segregation analyses. In line with the pLoF variants, mRNA studies in fibroblasts from 2 unrelated affected individuals demonstrated significantly reduced (~80-90%) TBC1C2D mRNA levels compared to controls, restored following cycloheximide treatment. Protein was absent in patient fibroblasts. TBC-domain containing GTPase activating proteins are known as key regulators of RAB GTPase activity. TBC1D2B was shown to colocalize with RAB5-positive endocytic vesicles. CRISPR/Cas9-mediated ko of TBC1D2B in HeLa cells suggested a role in EGF receptor endocytosis and decreased cell viability of TBC1D2B-deficient HeLa cells upon serum deprivation. Genes encoding other TBC domain-containg GTPase-activating proteins, e.g. TBC1D7 and TBC1D20, TBC1D24 are associated with recessive neurodevelopmental disorders (with ID and/or seizures) and the pathophysiological defect in TBC1D2B-related disorder (deficit in vesicle trafficking and/or cell survival) is proposed to be similar to that of TBC1D24. Overall this gene can be considered for inclusion with amber/green rating in the ID panel and green in epilepsy panel. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | EXOC2 |
Konstantinos Varvagiannis gene: EXOC2 was added gene: EXOC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EXOC2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOC2 were set to 32639540 Phenotypes for gene: EXOC2 were set to Global developmental delay; Intellectual disability; Abnormality of the face; Abnormality of brain morphology Penetrance for gene: EXOC2 were set to Complete Review for gene: EXOC2 was set to AMBER Added comment: Van Bergen et al (2020 - PMID: 32639540) report on 3 individuals from 2 families, harboring biallelic EXOC2 mutations. Clinical presentation included DD, ID (severe in 2 subjects from fam1, borderline intellectual functioning in fam2), dysmorphic features and brain abnormalities. Cerebellar anomalies were common to all with a molar tooth sign observed in one (1/3). Other findings limited to subjects from one family included acquired microcephaly, congenital contractures, spastic quadriplegia (each observed 2/3). Previous investigations were in all cases non-diagnostic. WES identified biallelic EXOC2 mutations in all affected individuals. EXOC2 encodes an exocyst subunit. The latter is an octameric complex, component of the membrane transport machinery, required for tethering and fusion of vesicles at the plasma membrane. As discussed ,vesicle transport is important for the development of brain and the function of neurons and glia. Exocyst function is also important for delivery of Arl13b to the primary cilium (biallelic ARL13B mutations cause Joubert syndrome 8) and ciliogenesis. Affected subjects from a broader consanguineous family (fam1) were homozygous for a truncating variant. Fibroblast studies revealed mRNA levels compatible with NMD (further restored in presence of CHX) as well as reduced protein levels. The female belonging to the second non-consanguineous family was found to harbor 2 missense variants in trans configuration. An exocytosis defect was demonstrated in fibroblasts from individuals belonging to both families. Ciliogenesis appeared to be normal, however Arl13b localization/recruitment to the cilia was reduced compared with control cells with the defect rescued upon exogenous expression of wt EXOC2. Mutations in other genes encoding components of the exocyst complex have been previously reported in individuals with relevant phenotypes (e.g. EXOC8 in a boy with features of Joubert s. or EXOC4 in nephrotic syndrome). The authors discuss on the essential role of EXOC2 based on model organism studies (e.g. impaired neuronal membrane traffic, failure of neuronal polarization and neuromuscular junction expansion seen in Drosophila Sec5 (EXOC2) null mutants). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | CEP120 |
Konstantinos Varvagiannis gene: CEP120 was added gene: CEP120 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CEP120 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CEP120 were set to 27208211 Phenotypes for gene: CEP120 were set to Joubert syndrome 31 (MIM 617761); Short-rib thoracic dysplasia 13 with or without polydactyly (MIM 616300) Penetrance for gene: CEP120 were set to Complete Review for gene: CEP120 was set to GREEN Added comment: Pathogenic CEP120 variants have been reported in recessive ciliopathies, namely Short-rib thoracic dysplasia 13 with or without polydactyly (MIM 616300) and Joubert syndrome 31 (MIM 617761). The former is associated with a severe/lethal outcome (4 unrelated infants described by Shaheen et al 2015 - PMID: 25361962, 2 fetuses reported by Roosing et al 2016 - PMID: 27208211). Roosing et al however, also provided details on 4 unrelated subjects with Joubert syndrome diagnosis. All presented with a neurologic phenotype of hypotonia, DD, cognitive impairment and exhibited a molar tooth sign. As a result, this gene can be considered for inclusion in the ID panel with green rating (>3 individuals/variants, consistent ciliopathy phenotype). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | ABCA2 |
Konstantinos Varvagiannis gene: ABCA2 was added gene: ABCA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABCA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ABCA2 were set to 30237576; 29302074; 31047799 Phenotypes for gene: ABCA2 were set to Intellectual developmental disorder with poor growth and with or without seizures or ataxia, 618808 Penetrance for gene: ABCA2 were set to Complete Review for gene: ABCA2 was set to GREEN Added comment: Biallelic pathogenic ABCA2 variants cause Intellectual developmental disorder with poor growth and with or without seizures or ataxia (MIM 618808). There are 3 relevant publications (01-07-2020) : - Maddirevula et al [2019 - PMID: 30237576] described briefly 2 unrelated subjects (16-2987, 16DG0071) both DD and seizures among other manifestations. - Hu et al [2019 - PMID: 29302074] reported 3 sibs (M8600615 - III:1-3) born to consanguineous parents (M8600615 - III:1-3) with DD/ID (formal confirmation of moderate ID, in those (2) evaluated). One also presented with seizures. - Aslam and Naz [2019 - PMID: 31047799] provided clinical details on 2 siblings born to consanguineous parents. ID was reported for the older sib but was absent in the younger one. Seizures were not part of the phenotype. All subjects harbored biallelic pLoF variants. N.B. : Steinberg et al [2015 - PMID: 25773295], within a cohort of patients with ALS, identified one with biallelic ABCA2 variants. As however Aslam and Naz comment, this person harbored a single pathogenic variant, with a second one rather unlikely to be pathogenic due to high allele frequency. Overall this gene can be considered for inclusion with green rating in both ID and epilepsy panels (each in >=3 unrelated individuals). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2744 | GLS | Zornitza Stark edited their review of gene: GLS: Added comment: Another three individuals from two unrelated families reported with early neonatal refractory seizures, structural brain abnormalities and oedema; significantly increased glutamine levels (PMID: 30575854).; Changed rating: GREEN; Changed publications: 30970188, 30239721, 30575854; Changed phenotypes: Epileptic encephalopathy, early infantile, 71, MIM# 618328, Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2733 | RAP1GDS1 |
Zornitza Stark gene: RAP1GDS1 was added gene: RAP1GDS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAP1GDS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RAP1GDS1 were set to 32431071 Phenotypes for gene: RAP1GDS1 were set to Intellectual disability; dysmorphic features Review for gene: RAP1GDS1 was set to AMBER Added comment: Four individuals from two consanguineous families, same homozygous splice site variant detected. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2731 | SETD1B | Zornitza Stark changed review comment from: At least 4 unrelated individuals reported.; to: At least 7 unrelated individuals reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2722 | EXOC7 |
chirag patel gene: EXOC7 was added gene: EXOC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EXOC7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOC7 were set to PMID: 32103185 Phenotypes for gene: EXOC7 were set to brain atrophy; seizures; developmental delay; microcephaly Review for gene: EXOC7 was set to GREEN Added comment: 4 families with 8 affected individuals with brain atrophy, seizures, and developmental delay, and in more severe cases microcephaly and infantile death. Four novel homozygous or comp.heterozygous variants found in EXOC7, which segregated with disease in the families. They showed that EXOC7, a member of the mammalian exocyst complex, is highly expressed in developing human cortex. In addition, a zebrafish model of Exoc7 deficiency recapitulates the human disorder with increased apoptosis and decreased progenitor cells during telencephalon development, suggesting that the brain atrophy in human cases reflects neuronal degeneration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2677 | GRM7 |
Zornitza Stark gene: GRM7 was added gene: GRM7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GRM7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GRM7 were set to 32286009; 32248644 Phenotypes for gene: GRM7 were set to Epilepsy, microcephaly, developmental delay Review for gene: GRM7 was set to GREEN Added comment: Eleven individuals from six families reported, three different homozygous variants (two missense, one LoF). Developmental delay, neonatal‐ or infantile‐onset epilepsy, and microcephaly were universal. Supportive mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2665 | DSCR3 |
chirag patel gene: DSCR3 was added gene: DSCR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DSCR3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DSCR3 were set to PMID: 31845315 Phenotypes for gene: DSCR3 were set to Intellectual disability, no OMIM # yet Review for gene: DSCR3 was set to RED Added comment: 1 family/2 cousins with cognitive impairment, growth failure, skeletal abnormalities, and distinctive facial features. Both shared the homozygous nonsense variant c.178G>T (p.Glu60*) in the VPS26C gene. This gene encodes VPS26C, a member of the retriever integral membrane protein recycling pathway. The nature of the variant which is predicted to result in loss‐of‐function, expression studies revealing significant reduction in the mutant transcript, and the co‐segregation of the homozygous variant with the phenotype in two affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2663 | KMT2D |
chirag patel changed review comment from: KMT2D missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism.; to: KMT2D missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism. - 7 unrelated families with choanal atresia, athelia or hypoplastic nipples, branchial sinus abnormalities, neck pits, lacrimal duct anomalies, hearing loss, external ear malformations, and thyroid abnormalities. None of the individuals had intellectual disability. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2659 | TTC5 |
Konstantinos Varvagiannis gene: TTC5 was added gene: TTC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TTC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC5 were set to 29302074; 32439809 Phenotypes for gene: TTC5 were set to Central hypotonia; Global developmental delay; Intellectual disability; Abnormality of nervous system morphology; Microcephaly; Abnormality of the face; Behavioral abnormality; Abnormality of the genitourinary system Penetrance for gene: TTC5 were set to Complete Review for gene: TTC5 was set to GREEN Added comment: Hu et al (2019 - PMID: 29302074) reported briefly on 3 individuals from 2 consanguineous families (from Turkey and Iran) with biallelic TTC5 variants. Features included DD (3/3), ID (severe in 2/2 with relevant age), microcephaly (3/3), brain abnormalities, etc. A nonsense and a variant affecting splice site were identified by WES/WGS. --- In a recent report, Rasheed et al (2020 - PMID: 32439809) report on the phenotype of 8 individuals - belonging to 5 consanguineous families - all 8 harboring homozygous TTC5 mutations. Frequent features included hypotonia (6/8), motor and speech delay, moderate to severe ID (10/10 of relevant age - inclusion of less severely affected subjects was not considered by study design), brain MRI abnormalities (8/8). Other findings included microcephaly in some (6/11), behavioral abnormalities in few (autistic behavior in 2/8, aggression in 2/8), genitourinary anomalies (2/8), seizures (1/11). Facial phenotype incl. thin V-shaped upper lip, low-set ears (in most) and/or additional features. TTC5 encodes a 440 aa protein, functioning as a scaffold to stabilise p300-JMY interactions. Apart from this role in nucleus, it has functions in the cytoplasm (inhibiting actin nucleataion, autophagosome formation, etc). The gene has ubiquitous expression, highest in brain. All variants were identified following WES - as the best candidates - in affected individuals with compatible Sanger studies in all affected family members and carrier parents. 2 missense and 2 nonsense variants were identified with the 2 missense SNVs localizing within TPR domains. qRT-PCR studies for a nonsense variant localizing 19 nt before the last exon, revealed fourfold decreased expression in affected individuals compared to carriers. Families from Egypt shared a homozygous ~6.3 Mb haplotype block spanning TTC5, suggesting that p.(Arg263Ter) is likely a founder mutation. The authors underscore some phenotypic (though not facial) similarities with Rubinstein-Taybi syndrome 2 due to EP300 mutations (in line with the role of TTC5). Biallelic variants in genes encoding other members of the TTC family (containing a TPR motif), e.g. TTC8 or TTC15 cause disorders with neurologic manifestations (and DD/ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2659 | SOX6 | Zornitza Stark Added comment: Comment when marking as ready: Most individuals had ID, ranging from mild to severe. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2658 | SOX6 |
Paul De Fazio changed review comment from: 6 LoF, 4 missense, and 6 intragenic deletion variants identified in individuals with a neurodevelopmental syndrome, however the number of families is unclear to me (paper says 19 individuals from 17 families). 12 were de novo. Sources: Literature; to: 6 LoF, 4 missense, and 6 intragenic deletion variants identified in individuals with a neurodevelopmental syndrome. Paper says 19 individuals from 17 families. 12 were de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2658 | SOX6 |
Paul De Fazio changed review comment from: 6 LoF, 4 missense, and 6 intragenic deletion variants identified in individuals with a neurodevelopmental syndrome, however the number of families is unclear to me. Sources: Literature; to: 6 LoF, 4 missense, and 6 intragenic deletion variants identified in individuals with a neurodevelopmental syndrome, however the number of families is unclear to me (paper says 19 individuals from 17 families). 12 were de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2658 | SOX6 |
Paul De Fazio gene: SOX6 was added gene: SOX6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SOX6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SOX6 were set to 32442410 Phenotypes for gene: SOX6 were set to ADHD; Craniosynostosis; Osteochondromas Review for gene: SOX6 was set to GREEN Added comment: 6 LoF, 4 missense, and 6 intragenic deletion variants identified in individuals with a neurodevelopmental syndrome, however the number of families is unclear to me. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2640 | B9D1 | Zornitza Stark changed review comment from: Two unrelated individuals with JS and bi-allelic variants in this gene, plus one individual with a more severe Meckel phenotype described. Intellectual disability is part of the phenotype.; to: Two unrelated individuals with JS and bi-allelic variants in this gene, plus one individual with a more severe Meckel phenotype described. Intellectual disability is part of the phenotype. However note that in Meckel individual one of the variants identified is a multi-gene deletion and in addition a likely path CEP290 variant also reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2632 | NR4A2 | Zornitza Stark Added comment: Comment when marking as ready: Upgrade to Green in view of new publication reporting 9 additional individuals. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2629 | CUL3 |
Konstantinos Varvagiannis gene: CUL3 was added gene: CUL3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CUL3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CUL3 were set to 32341456 Phenotypes for gene: CUL3 were set to Global developmental delay; Intellectual disability; Seizures; Abnormality of cardiovascular system morphology; Abnormality of the palate; Pseudohypoaldosteronism, type IIE - MIM #614496 Penetrance for gene: CUL3 were set to unknown Review for gene: CUL3 was set to GREEN Added comment: Please consider inclusion with amber / green rating. -- Nakashima et al (2020 - PMID:32341456) provide clinical details on 3 unrelated individuals with de novo CUL3 variants. Features included DD, variable degrees of ID (P1: severe, P3: mild, P2: NA although he displayed motor and severe speech and language delay and had severe learning difficulties). Two out of three had intractable seizures (onset 2 - 6 months). One presented with congenital heart defects (ASD, PV stenosis) and another submucosal palatoschisis/bifid uvula. There were no facial dysmorphisms reported. CUL3 encodes Cullin-3, a core piece of the E3 ubiquitin ligase complex, thus playing a role in the ubiquitin-proteasome system. [ https://ghr.nlm.nih.gov/gene/CUL3 ]. Germline variants in some other Cullin family genes (eg. CUL4B, CUL7) cause disorders with ID as a feature. The 3 individuals reported by Nakashima had variable previous investigations (karyotype, CMA, metabolic testing) which were non-diagnostic. Singleton or trio exome sequencing identified 2 frameshift and 1 missense variant (NM_003590.4:c.854T>C / p.Val285Ala), further confirmed with Sanger sequencing. De novo occurrence was confirmed by analysis of microsatellite markers in an individual with singleton ES. While the frameshift variants were presumed to lead to NMD (not studied), studies in HEK293T cells suggested that the Val285Ala reduced binding ability with KEAP1, possibly leading to instability of the Cullin-RING ligase (CRL) complex and impairment of the ubiquitin-proteasome system. In OMIM, the phenotype associated with heterozygous CUL3 mutations is Pseudohypoaldosteronism type IIE (PHA2E - # 614496). As OMIM and Nakashima et al comment, PHA2E-associated variants are clustered around exon 9, most lead to skipping of exon 9 and produce an in-frame deletion of 57 aa in the cullin homology domain. Few (probably 3) missense variants in exon 9 have also been reported. Individuals with PHA2E do not display DD/ID and conversely individuals with NDD did not display features of PHA2E. Nakashima et al summarize the phenotypes associated with 12 further de novo CUL3 variants in the literature with most pLOF ones detected in individuals with autism and/or developmental disorders and in few cases with congenital heart disease. Few additional missense variants and a stoploss one have been reported in individuals with NDD and one in SCZ. Heterozygous Cul3 (/tissue-specific) deletion in mice resulted in autism-like behavior. Cul3 deficient mice also demonstrated NMDAR hypofunction and decreased spine density. [PMIDs cited : 31455858, 31780330] Overall haploinsufficiency is favored as the underlying mechanism of variants associated with NDD. Nakashima et al comment that the pathogenesis of missense variants remains unknown and/or that a dominant-negative effect on CRL may be possible. Studies on larger cohorts reporting on individuals with relevant phenotypes due to de novo CUL3 variants (eg. DDD study - PMID: 28135719, Lelieveld et al - PMID: 27479843), are summarized in denovo-db (after filtering for coding variants): http://denovo-db.gs.washington.edu/denovo-db/QueryVariantServlet?searchBy=Gene&target=cul3 Overall, this gene can be considered for inclusion in the ID (amber/green), epilepsy (amber) and/or ASD panels. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2627 | UGDH |
Konstantinos Varvagiannis gene: UGDH was added gene: UGDH was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UGDH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGDH were set to 32001716 Phenotypes for gene: UGDH were set to Epileptic encephalopathy, early infantile, 84 - MIM #618792 Penetrance for gene: UGDH were set to Complete Review for gene: UGDH was set to GREEN Added comment: Hengel et al (2020 - PMID: 32001716) report on 36 individuals with biallelic UGDH pathogenic variants. The phenotype corresponded overall to a developmental epileptic encephalopathy with hypotonia, feeding difficulties, severe global DD, moderate or commonly severe ID in all. Hypotonia and motor disorder (incl. spasticity, dystonia, ataxia, chorea, etc) often occurred prior to the onset of seizures. A single individual did not present seizures and 2 sibs had only seizures in the setting of fever. Affected subjects were tested by exome sequencing and UGDH variants were the only/best candidates for the phenotype following also segregation studies. Many were compound heterozygous or homozygous (~6 families were consanguineous) for missense variants and few were compound heterozygous for missense and pLoF variants. There were no individuals with biallelic pLoF variants identified. Parental/sib studies were all compatible with AR inheritance mode. UGDH encodes the enzyme UDP-glucose dehydrogenase which converts UDP-glucose to UDP-glucuronate, the latter being a critical component of the glycosaminoglycans, hyaluronan, chondroitin sulfate, and heparan sulfate [OMIM]. Patient fibroblast and biochemical assays suggested a LoF effect of variants leading to impairment of UGDH stability, oligomerization or enzymatic activity (decreased UGDH-catalyzed reduction of NAD+ to NADH / hyaluronic acid production which requires UDP-glucuronate). Attempts to model the disorder using an already developped zebrafish model (for a hypomorphic LoF allele) were unsuccessful as fish did not exhibit seizures spontaneously or upon induction with PTZ. Modelling of the disorder in vitro using patient-derived cerebral organoids demonstrated smaller organoids due to reduced number of proliferating neural progenitors. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2625 | YIF1B |
Konstantinos Varvagiannis gene: YIF1B was added gene: YIF1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YIF1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YIF1B were set to 32006098 Phenotypes for gene: YIF1B were set to Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement Penetrance for gene: YIF1B were set to Complete Review for gene: YIF1B was set to GREEN Added comment: AlMuhaizea et al (2020 - PMID: 32006098) report on the phenotype of 6 individuals (from 5 families) with biallelic YIF1B truncating variants. Affected subjects presented hypotonia, failure to thrive, microcephaly (5/6), severe global DD and ID (as evident from best motor/language milestones achieved - Table S1) as well as features suggestive of a motor disorder (dystonia/spasticity/dyskinesia). Seizures were reported in 2 unrelated individuals (2/6). MRI abnormalities were observed in some with thin CC being a feature in 3. Variable initial investigations were performed including SNP CMA, MECP2, microcephaly / neurotransmitter disorders gene panel testing did not reveal P/LP variants. YIF1B variants were identified in 3 families within ROH. Following exome sequencing, affected individuals were found to be homozygous for truncating variants (4/5 families being consanguineous). The following 3 variants were identified (NM_001039672.2) : c.186dupT or p.Ala64fs / c.360_361insACAT or p.Gly121fs / c.598G>T or p.Glu200*. YIF1B encodes an intracellular transmembrane protein. It has been previously demonstrated that - similarly to other proteins of the Yip family being implicated in intracellular traffic between the Golgi - Yif1B is involved in the anterograde traffic pathway. Yif1B KO mice demonstrate a disorganized Golgi architecture in pyramidal hippocampal neurons (Alterio et al 2015 - PMID: 26077767). The rat ortholog interacts with serotonin receptor 1 (5-HT1AR) with colocalization of Yif1BB and 5-HT1AR in intermediate compartment vesicles and involvement of the former in intracellular trafficing/modulation of 5-HT1AR transport to dendrites (PMID cited: 18685031). Available mRNA and protein expression data (Protein Atlas) suggest that the gene is widely expressed in all tissues incl. neuronal cells. Immunochemistry data from the Human Brain Atlas also suggest that YIF1B is found in vesicles and localized to the Golgi apparatus. Immunohistochemistry in normal human brain tissue (cerebral cortex) demonstrated labeling of neuronal cells (Human Protein Atlas). Functional/network analysis of genes co-regulated with YIF1B based on available RNAseq data, suggest enrichement in in genes important for nervous system development and function. Please consider inclusion in other panels that may be relevant (e.g. microcephaly, etc). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2619 | CDC42BPB |
Konstantinos Varvagiannis gene: CDC42BPB was added gene: CDC42BPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDC42BPB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CDC42BPB were set to 32031333 Phenotypes for gene: CDC42BPB were set to Central hypotonia; Global developmental delay; Intellectual disability; Seizures; Autistic behavior; Behavioral abnormality Penetrance for gene: CDC42BPB were set to unknown Review for gene: CDC42BPB was set to GREEN Added comment: Chilton et al (2020 - PMID: 32031333) report on 14 individuals with missense and loss-of-function CDC42BPB variants. Features included hypotonia (8/11), DD (12/13 - the 14th was a fetus), ID (7/13), ASD (8/12), clinical seizures (in 3 - a 4th had abnormal EEG without seizures), behavioral abnormalities. Variable non-specific dysmorphic features were reported in some (sparse hair being the most frequent - 4/8). Additional features were observed in few (=<4) incl. cryptorchidism, ophthalmological issues, constipation, kidney abnormalities, micropenis, etc. All individuals had non-diagnostic prior genetic testing (incl. CMA, FMR1, MECP2, Angelman/Prader-Willi methylation studies, autism gene panel - suggesting relevance to the current panel) or metabolic testing. Variants were identified following clinical exome sequencing with Sanger confirmation. Most occurred as de novo events (11/14) while inheritance was not available for few (3/14). Missense variants did not display (particular) clustering. Almost all variants were absent from gnomAD and were predicted to be deleterious in silico (among others almost all had CADD scores >25). As the authors comment, CDC42BPB encodes myotonic dystrophy-related Cdc42-binding kinase β (MRCKβ) a serine/threonine protein kinase playing a role in regulation of cytoskeletal reorganization and cell migration in nonmuscle cells (through phosporylation of MLC2). Previous studies have demonstrated that it is ubiquitously expressed with prenatal brain expression. The gene appears to be intolerant to pLoF (pLI of 1) as well as to missense variants (Z-score of 3.66). CDC42BPB is a downstream effector of CDC42. Mutations of the latter cause Takenouchi-Kosaki syndrome with DD/ID and some further overlapping features (with CDC42BPB-associated phenotypes). Homozygous Cdc42bpb KO in mouse appears to be nonviable (MGI:2136459). Loss of gek in the eyes of Drosophila results in disrupted growth cone targeting to the lamina (gek is the fly CDC42BPB ortholog). Please consider inclusion with amber / green rating in the ID panel (>=4 relevant individuals / variants) and other panels (e.g. for epilepsy, ASD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2597 | CDK19 |
Zornitza Stark gene: CDK19 was added gene: CDK19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDK19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDK19 were set to 32330417 Phenotypes for gene: CDK19 were set to Intellectual disability; epileptic encephalopathy Review for gene: CDK19 was set to GREEN Added comment: Three unrelated individuals with de novo missense variants reported, and intellectual disability/epileptic encephalopathy. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2589 | CEP55 |
Zornitza Stark gene: CEP55 was added gene: CEP55 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CEP55 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CEP55 were set to 32100459 Phenotypes for gene: CEP55 were set to Multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly, MIM# 236500; Microcephaly; Intellectual disability Review for gene: CEP55 was set to GREEN Added comment: Homozygous nonsense variants in CEP55 are associated with a lethal condition characterized by multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly (MARCH syndrome) also known as Meckel-like syndrome. New report of seven living individuals from five families with biallelic CEP55 variants. Four unrelated individuals with microcephaly, speech delays, and bilateral toe syndactyly all had a common CEP55 variant c.70G>A p.(Glu24Lys) in trans with nonsense variants. Three siblings were homozygous for a consensus splice site variant near the end of the gene. These affected girls all had severely delayed development, microcephaly, and varying degrees of lissencephaly/pachygyria. This series suggests that individuals with compound heterozygosity for nonsense and missense variants in CEP55 have a different viable phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2587 | LRRC32 |
Zornitza Stark gene: LRRC32 was added gene: LRRC32 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC32 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LRRC32 were set to 30976112 Phenotypes for gene: LRRC32 were set to Intellectual disability; cleft palate; proliferative retinopathy Review for gene: LRRC32 was set to AMBER Added comment: Three individuals from two consanguineous families segregated the same homozygous bi-allelic variant, c.1630C>T; p.(Arg544Ter), shared haplotype indicative of founder effect. Mouse model has cleft palate and neonatal death. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2578 | RSRC1 | Zornitza Stark edited their review of gene: RSRC1: Added comment: 2020: 17 additional individuals reported.; Changed rating: GREEN; Changed publications: 28640246, 29522154, 32227164; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 70, MIM# 618402 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2575 | GAD1 | Zornitza Stark edited their review of gene: GAD1: Added comment: 2020: 11 individuals from 6 consanguineous families reported with bi-allelic LOF variant and a developmental/epileptic encephalopathy. Seizure onset occurred in the first 2 months of life in all. All 10 individuals, from whom early disease history was available, presented with seizure onset in the first month of life, mainly consisting of epileptic spasms or myoclonic seizures. Early EEG showed suppression-burst or pattern of burst attenuation or hypsarrhythmia if only recorded in the post-neonatal period. Eight individuals had joint contractures and/or pes equinovarus. Seven presented a cleft palate and two also had an omphalocele, reproducing the phenotype of the knockout Gad1−/− mouse model. Four individuals died before 4 years of age.; Changed publications: 15571623, 32282878; Changed phenotypes: Cerebral palsy, spastic quadriplegic, 1, MIM#603513, Developmental and epileptic encephalopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2574 | GALNT2 |
Zornitza Stark gene: GALNT2 was added gene: GALNT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GALNT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GALNT2 were set to 32293671 Phenotypes for gene: GALNT2 were set to Congenital disorder of glycosylation Review for gene: GALNT2 was set to GREEN Added comment: Seven individuals from four families reported with bi-allelic LOF variants and global developmental delay, intellectual disability with language deficit, autistic features, behavioural abnormalities, epilepsy, chronic insomnia, white matter changes on brain MRI, dysmorphic features, decreased stature, and decreased high density lipoprotein cholesterol levels. Rodent (mouse and rat) models of GALNT2-CDG recapitulated much of the human phenotype, including poor growth and neurodevelopmental abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2548 | GNAI2 |
Zornitza Stark changed review comment from: Single individual with de novo variant reported. Sources: Literature; to: Two individuals reported, some functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2548 | GNAI2 |
Zornitza Stark gene: GNAI2 was added gene: GNAI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GNAI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GNAI2 were set to 31036916 Phenotypes for gene: GNAI2 were set to Syndromic intellectual disability Review for gene: GNAI2 was set to RED Added comment: Single individual with de novo variant reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2546 | FEM1B |
Zornitza Stark gene: FEM1B was added gene: FEM1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FEM1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FEM1B were set to 31036916 Phenotypes for gene: FEM1B were set to Syndromic intellectual disability Review for gene: FEM1B was set to AMBER Added comment: No OMIM phenotype PMID: 31036916 - a single de novo patient reported in a neurodevelopmental disorder cohort. Authors note another de novo case with the exact same variant (p.Arg126Gln) from the DDD study, and a 3rd patient from GeneMatcher with the same de novo missense again. Decipher shows this variant to be in a highly constrained region of the protein. Cannot be certain the DDD and GeneMatcher individuals are unrelated, therefore treat as two reports for now. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2545 | WIPI2 |
Zornitza Stark gene: WIPI2 was added gene: WIPI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WIPI2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WIPI2 were set to 30968111 Phenotypes for gene: WIPI2 were set to Intellectual developmental disorder with short stature and variable skeletal anomalies 618453 Review for gene: WIPI2 was set to RED Added comment: Four homozygous individuals from one consanguineous family with intellectual disability, short stature and variable skeletal anomalies. Functional studies in patient cells showed impaired protein function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2539 | YARS |
Zornitza Stark gene: YARS was added gene: YARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YARS were set to 30304524; 29232904; 27633801 Phenotypes for gene: YARS were set to Intellectual disability; deafness; nystagmus; liver dysfunction Review for gene: YARS was set to GREEN Added comment: Mono-allelic variants are associated with CMT. However, 10 individuals from three unrelated families reported with bi-allelic variants and a severe phenotype, comprising ID, nystagmus, deafness, liver dysfunction and a range of other features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2536 | SLC44A1 |
Sebastian Lunke gene: SLC44A1 was added gene: SLC44A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC44A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC44A1 were set to 31855247 Phenotypes for gene: SLC44A1 were set to progressive ataxia; tremor; cognitive decline; dysphagia; optic atrophy; dysarthria Review for gene: SLC44A1 was set to GREEN gene: SLC44A1 was marked as current diagnostic Added comment: Four affected individuals from three families with homozygous frameshift variants. Functional evidence points to impaired choline transporter function yet unchanged membrane phosphatidylcholine content. Choline treatments may be beneficial. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2527 | BAZ2B |
Zornitza Stark gene: BAZ2B was added gene: BAZ2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BAZ2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BAZ2B were set to 31999386 Phenotypes for gene: BAZ2B were set to Intellectual disability; autism Review for gene: BAZ2B was set to GREEN Added comment: Postulated as a candidate gene for ID/ASD by large-scale studies. Case series reports two individuals with small CNVs and and six with SNVs, mostly LoF type variants. Although the gene is generally intolerant of LoF, some LoF variants present in gnomad ?incomplete penetrance. Additional reported features were inconsistent Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2518 | NUP188 | Zornitza Stark changed review comment from: Additional 6 unrelated individuals reported, promoted to Green.; to: Additional 6 unrelated individuals with bi-allelic LoF variants reported, promoted to Green. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2518 | NUP188 | Zornitza Stark edited their review of gene: NUP188: Added comment: Additional 6 unrelated individuals reported, promoted to Green.; Changed rating: GREEN; Changed publications: 32021605, 28726809, 32275884; Changed phenotypes: microcephaly, ID, cataract, structural brain abnormalities, hypoventilation | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2511 | TFE3 |
Zornitza Stark gene: TFE3 was added gene: TFE3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TFE3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TFE3 were set to 30595499; 31833172 Phenotypes for gene: TFE3 were set to TFE3-associated neurodevelopmental disorder; Intellectual disability; Epilepsy; Coarse facial features Review for gene: TFE3 was set to GREEN Added comment: Seven individuals reported; so far, all have been found to harbour de novo variants affecting exons 3 or 4. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2509 | TOP2B |
Zornitza Stark gene: TOP2B was added gene: TOP2B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TOP2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TOP2B were set to 31953910; 28343847; 12773624 Phenotypes for gene: TOP2B were set to Intellectual disability Review for gene: TOP2B was set to AMBER Added comment: Two unrelated individuals reported with the same de novo variant, c.187C > T, p.(His63Tyr) and also mouse model data supports role in brain development. Gene has also been associated independently with deafness and with immunodeficiency and the variant-disease relationship remains to be fully elucidated. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2502 | PIGK |
Zornitza Stark gene: PIGK was added gene: PIGK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIGK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGK were set to 32220290 Phenotypes for gene: PIGK were set to Intellectual disability; seizures; cerebellar atrophy Review for gene: PIGK was set to GREEN Added comment: 12 individuals from 9 unrelated families reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2499 | ADARB1 |
Zornitza Stark gene: ADARB1 was added gene: ADARB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADARB1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADARB1 were set to 32220291 Phenotypes for gene: ADARB1 were set to Intellectual disability; microcephaly; seizures Review for gene: ADARB1 was set to GREEN Added comment: Four unrelated individuals with bi-allelic variants in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2491 | AGTPBP1 |
Zornitza Stark gene: AGTPBP1 was added gene: AGTPBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: NHS GMS Mode of inheritance for gene: AGTPBP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AGTPBP1 were set to 30420557 Phenotypes for gene: AGTPBP1 were set to Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy; Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 Review for gene: AGTPBP1 was set to GREEN Added comment: Thirteen individuals reported, clinical presentation was with developmental delay, though six went on to have a progressive neurological course. Other features include cerebellar atrophy and neuropathy. Sources: NHS GMS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2489 | NR2F2 |
Sue White gene: NR2F2 was added gene: NR2F2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NR2F2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NR2F2 were set to 29478779; 29663647 Phenotypes for gene: NR2F2 were set to mild intellectual disability; congenital heart disease; disorder of sexual differentiation; dysmorphic features Penetrance for gene: NR2F2 were set to Complete Review for gene: NR2F2 was set to AMBER Added comment: Established gene for congenital heart disease and DSD and emerging gene for ID. 2 unrelated individuals published with mild or borderline ID, dysmorphism and de novo truncating/missense variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2487 | EIF2AK2 |
Zornitza Stark gene: EIF2AK2 was added gene: EIF2AK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF2AK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF2AK2 were set to 32197074 Phenotypes for gene: EIF2AK2 were set to Intellectual disability; white matter abnormalities; ataxia; regression with febrile illness Review for gene: EIF2AK2 was set to GREEN Added comment: Eight individuals with de novo variants and complex neurodevelopmental phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2486 | EIF2AK1 |
Zornitza Stark gene: EIF2AK1 was added gene: EIF2AK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF2AK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF2AK1 were set to 32197074 Phenotypes for gene: EIF2AK1 were set to Intellectual disability; white matter abnormalities Review for gene: EIF2AK1 was set to RED Added comment: Single individual reported with de novo variant in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2484 | NOVA2 |
Zornitza Stark gene: NOVA2 was added gene: NOVA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NOVA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NOVA2 were set to 32197073 Phenotypes for gene: NOVA2 were set to Intellectual disability; autism; hypotonia; spasticity; ataxia Mode of pathogenicity for gene: NOVA2 was set to Other Review for gene: NOVA2 was set to GREEN Added comment: Six individuals with de novo frameshift variants resulting in C-terminal extension suggesting partial LoF as mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2479 | CNOT3 | Zornitza Stark Added comment: Comment when marking as ready: 16 unrelated individuals reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2469 | ISCA1 |
Zornitza Stark gene: ISCA1 was added gene: ISCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ISCA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ISCA1 were set to 28356563; 32092383; 31016283; 30113620; 30105122 Phenotypes for gene: ISCA1 were set to Multiple mitochondrial dysfunctions syndrome 5, MIM# 617613 Review for gene: ISCA1 was set to GREEN gene: ISCA1 was marked as current diagnostic Added comment: Multiple unrelated families reported. Severe disorder characterised by progressive neurologic deterioration beginning in early infancy. Affected individuals have essentially no psychomotor development and have early-onset seizures with neurologic decline and spasticity. Brain imaging shows severe leukodystrophy with evidence of dys- or delayed myelination. Rat model results in early lethality. Founder variant c.259G > A, p.(Glu87Lys) reported in Indian families. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2462 | SUPT16H |
Zornitza Stark gene: SUPT16H was added gene: SUPT16H was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SUPT16H was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SUPT16H were set to 31924697 Phenotypes for gene: SUPT16H were set to Intellectual disability; Abnormality of the corpus callosum Review for gene: SUPT16H was set to GREEN Added comment: Four unrelated individuals with de novo missense variants in this gene. Publication also reports on a deletion, but note this includes other genes and the individual also had another CNV. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2456 | TNR |
Zornitza Stark gene: TNR was added gene: TNR was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TNR was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TNR were set to 32099069 Phenotypes for gene: TNR were set to Spastic para- or tetraparesis; Axial muscular hypotonia; Intellectual disability; Transient opisthotonus Review for gene: TNR was set to GREEN Added comment: 13 individuals from 8 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2455 | RSPRY1 |
Zornitza Stark changed review comment from: Two unrelated individuals reported, some functional evidence. Sources: Expert list; to: Two unrelated individuals reported, some functional evidence. Dev delay/autism part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2454 | RSPRY1 |
Zornitza Stark gene: RSPRY1 was added gene: RSPRY1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: RSPRY1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RSPRY1 were set to 26365341 Phenotypes for gene: RSPRY1 were set to Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type, 616585 Review for gene: RSPRY1 was set to AMBER Added comment: Two unrelated individuals reported, some functional evidence. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2448 | RNF13 |
Zornitza Stark gene: RNF13 was added gene: RNF13 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: RNF13 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNF13 were set to 30595371 Phenotypes for gene: RNF13 were set to Epileptic encephalopathy, early infantile, 73 618379 Mode of pathogenicity for gene: RNF13 was set to Other Review for gene: RNF13 was set to GREEN Added comment: Three unrelated individuals with de novo variants in this gene and severe neurological phenotype, including microcephaly, seizures, visual impairment, profound developmental delay. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2439 | MRPS34 |
Zornitza Stark gene: MRPS34 was added gene: MRPS34 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: MRPS34 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MRPS34 were set to 28777931 Phenotypes for gene: MRPS34 were set to Combined oxidative phosphorylation deficiency 32, MIM# 617664 Review for gene: MRPS34 was set to GREEN gene: MRPS34 was marked as current diagnostic Added comment: Six individuals from 4 unrelated families; clinical presentation is with developmental delay/regression. More variable features include movement disorders, microcephaly, strabismus, nystagmus, optic atrophy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2432 | MED12L |
Zornitza Stark gene: MED12L was added gene: MED12L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: MED12L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MED12L were set to 31155615 Phenotypes for gene: MED12L were set to Intellectual disability; Seizures; Autism Review for gene: MED12L was set to GREEN Added comment: 7 individuals reported, 3 with CNVs (encompassing other genes) and 4 with SNVs (frameshift, nonsense and splice site). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2430 | MCM3AP |
Zornitza Stark gene: MCM3AP was added gene: MCM3AP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: MCM3AP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MCM3AP were set to 24123876; 28633435; 28969388; 29982295 Phenotypes for gene: MCM3AP were set to Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, MIM#618124 Review for gene: MCM3AP was set to GREEN gene: MCM3AP was marked as current diagnostic Added comment: ID is a feature in many of the reported individuals. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2420 | TRIO | Zornitza Stark changed review comment from: The nonsense mutations are spread along the TRIO sequence, and affected individuals show variable neurodevelopmental phenotypes. In contrast, missense variants cluster into two mutational hotspots in the TRIO sequence, one in the seventh spectrin repeat and one in the RAC1-activating GEFD1.; to: The nonsense mutations are spread along the TRIO sequence, and affected individuals show variable neurodevelopmental phenotypes. In contrast, missense variants cluster into two mutational hotspots in the TRIO sequence, one in the seventh spectrin repeat and one in the RAC1-activating GEFD1. Individuals with a pathogenic variant in the seventh spectrin repeat have a more severe ID associated with macrocephaly than do most individuals with GEFD1 variants, who display milder ID and microcephaly. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2413 | NUP188 | Zornitza Stark changed review comment from: Two unrelated individuals with homozygous truncating variants in this gene reported, Sandestin et al 2019, plus another by Strauss et al 2018. Also note two papers reporting mono allelic variants and disparate phenotypes (CDH and mitral valve prolapse, respectively), Yates et al, Haskell et al.; to: Two unrelated individuals with homozygous truncating variants in this gene reported, Sandestig et al 2019 (died in early infancy), plus another by Strauss et al 2018. Also note two papers reporting mono allelic variants and disparate phenotypes (CDH and mitral valve prolapse, respectively), Yates et al, Haskell et al. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2412 | NUDT2 |
Zornitza Stark gene: NUDT2 was added gene: NUDT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: NUDT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NUDT2 were set to 27431290; 30059600 Phenotypes for gene: NUDT2 were set to Muscular hypotonia; Global developmental delay; Intellectual disability Review for gene: NUDT2 was set to AMBER Added comment: 7 affected individuals from 4 Saudi families, with same homozygous truncating variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2395 | NDUFS3 | Zornitza Stark changed review comment from: At least three families reported.; to: At least three families reported. In the original report, the affected individual was phenotypically normal until 9 years of age but had rapidly progressive multi-system disease. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2387 | NDUFB3 | Zornitza Stark changed review comment from: Ten families and functional data.; to: Ten families and functional data. In particular, the 8 families of shared Irish ancestry only had short stature and dysmorphic features, without marked metabolic disturbance. One of the other reported individuals died in infancy, again making it difficult to know whether ID would have been part of the phenotype. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2386 | NDUFAF6 | Zornitza Stark changed review comment from: Multiple unrelated families reported.; to: Multiple unrelated families reported. Presentation in one family was with lactic acidosis in newborn period, and in another with regression in childhood. Limited phenotypic information for others. Unclear if and in what proportion of affected individuals ID is likely to be the main or presenting feature. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2381 | NDUFAF4 | Zornitza Stark changed review comment from: Two unrelated families and functional data.; to: Two unrelated families and functional data. Multiple affected individuals in one family (18179882) presented in newborn period with marked lactic acidosis, one long-term survivor (7yo at assessment) had profound ID. Individual from second family (28853723) presented in infancy with dev delay. Borderline gene-disease association for mitochondrial disease, and unclear what proportion of individuals are likely to present/manifest as ID. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2334 | TRIM8 |
Zornitza Stark changed review comment from: Six unrelated individuals reported. Sources: Expert list; to: Six unrelated individuals reported. All variants reported to date are truncating, affecting the last (sixth exon) and as a result may escape nonsense-mediated decay. Since TRIM8 homodimerizes via its (upstream) coiled-coil domain and its C-terminal domain is required for nuclear localization, a dominant-negative effect is postulated by the authors. Haploinsufficiency appears less likely. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2333 | TRIM8 |
Zornitza Stark gene: TRIM8 was added gene: TRIM8 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TRIM8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRIM8 were set to 30244534; 27346735; 23934111 Phenotypes for gene: TRIM8 were set to Intellectual disability; Seizures Review for gene: TRIM8 was set to GREEN gene: TRIM8 was marked as current diagnostic Added comment: Six unrelated individuals reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2319 | SPOP |
Zornitza Stark gene: SPOP was added gene: SPOP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPOP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SPOP were set to 32109420 Phenotypes for gene: SPOP were set to Intellectual disability; dysmorphism; microcephaly; macrocephaly Mode of pathogenicity for gene: SPOP was set to Other Review for gene: SPOP was set to GREEN Added comment: Seven individuals reported with de novo missense variants in this gene. Gain-of-function variants associated with microcephaly whereas dominant-negative variants associated with macrocephaly. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2309 | TMEM94 |
Zornitza Stark gene: TMEM94 was added gene: TMEM94 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TMEM94 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM94 were set to 30526868 Phenotypes for gene: TMEM94 were set to Intellectual developmental disorder with cardiac defects and dysmorphic facies, MIM#618316 Review for gene: TMEM94 was set to GREEN Added comment: 10 individuals from 6 unrelated families. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2292 | TGFB1 |
Zornitza Stark gene: TGFB1 was added gene: TGFB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TGFB1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TGFB1 were set to 29483653 Phenotypes for gene: TGFB1 were set to Inflammatory bowel disease, immunodeficiency, and encephalopathy, MIM# 618213 Review for gene: TGFB1 was set to AMBER Added comment: Three individuals from two unrelated families reported. DD/ID and seizures in addition to IBD/immunodeficiency. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2209 | PNKP | Zornitza Stark Added comment: Comment when marking as ready: Note 17-bp duplication (1250_1266dup) in exon 14 identified in multiple individuals. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2201 | SLC1A2 |
Zornitza Stark gene: SLC1A2 was added gene: SLC1A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: SLC1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SLC1A2 were set to 27476654; 28777935 Phenotypes for gene: SLC1A2 were set to Epileptic encephalopathy, early infantile, 41, MIM#617105; Intellectual disability Review for gene: SLC1A2 was set to GREEN gene: SLC1A2 was marked as current diagnostic Added comment: Four unrelated individuals reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2177 | PTRHD1 |
Zornitza Stark gene: PTRHD1 was added gene: PTRHD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: PTRHD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTRHD1 were set to 30398675; 27134041; 27753167; 29143421 Phenotypes for gene: PTRHD1 were set to Parkinsonism; Intellectual disability Review for gene: PTRHD1 was set to GREEN Added comment: Three unrelated families reported: two with homozygous missense variants; and one with truncating variant. Affected individuals have juvenile-onset parkinsonism and ID. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2159 | POLR1C |
Zornitza Stark gene: POLR1C was added gene: POLR1C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: POLR1C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLR1C were set to 26151409 Phenotypes for gene: POLR1C were set to Leukodystrophy, hypomyelinating, 11, MIM# 616494 Review for gene: POLR1C was set to GREEN Added comment: 8 unrelated individuals reported, ID is part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2139 | VARS |
chirag patel gene: VARS was added gene: VARS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: VARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VARS were set to PubMed: 30755616, 30755602, 26539891, 29691655, 30275004 Phenotypes for gene: VARS were set to Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy; OMIM #617802 Review for gene: VARS was set to GREEN Added comment: 14 families with 20 affected individuals - homozygous missense or compound heterozygous mutations in VARS - mutations segregated with the disorder in the families - functional studies in some cases Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2117 | ZIC1 |
chirag patel gene: ZIC1 was added gene: ZIC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ZIC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZIC1 were set to PMID: 26340333, 30391508 Phenotypes for gene: ZIC1 were set to Structural brain anomalies with impaired intellectual development and craniosynostosis; OMIM #618736 Review for gene: ZIC1 was set to GREEN Added comment: 5 families with heterozygous mutations located in the final (third) exon of ZIC1 who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5-12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture. 2 sibs with BAIDCS, Vandervore et al. (2018) identified heterozygosity for a frameshift mutation in the ZIC1 gene. Neither parent had evidence of the mutation by whole-exome sequencing, suggesting that gonadal mosaicism for the mutation was present in one of the parents. Expression of the mutated allele was detected in patient fibroblasts by RT-PCR, evidence that the mutant mRNA did not undergo nonsense-mediated decay and probably generates an abnormal protein. Also heterozygous deletions of ZIC1 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum. Loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2108 | GLS | Zornitza Stark edited their review of gene: GLS: Added comment: In addition, single individual also reported with de novo, GoF variant with profound ID, cataract.; Changed mode of pathogenicity: Other; Changed publications: 30970188, 30239721; Changed phenotypes: Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2099 | PHACTR1 |
Zornitza Stark gene: PHACTR1 was added gene: PHACTR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: PHACTR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHACTR1 were set to 30256902; 28135719; 23033978; 27457812 Phenotypes for gene: PHACTR1 were set to Seizures:Epileptic encephalopathy, early infantile, 70, MIM# 618298; PHACTR1-associated neurodevelopment disorder Penetrance for gene: PHACTR1 were set to Incomplete Mode of pathogenicity for gene: PHACTR1 was set to Other Review for gene: PHACTR1 was set to GREEN gene: PHACTR1 was marked as current diagnostic Added comment: 6 unrelated individuals reported altogether with variants in this gene. Several as part of large cohorts, so limited variant and patient characterisation. One variant reported by de Ligt et al is present in the population (4 individuals) suggesting reduced penetrance. However, functional data (including mouse model) for this and other variants exerting a dominant negative effect. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2070 | LIPT2 |
Zornitza Stark gene: LIPT2 was added gene: LIPT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: LIPT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LIPT2 were set to 28757203 Phenotypes for gene: LIPT2 were set to Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM#617668 Review for gene: LIPT2 was set to AMBER Added comment: Three individuals from two unrelated families; profound ID. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2063 | KIF2A |
Zornitza Stark gene: KIF2A was added gene: KIF2A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: KIF2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KIF2A were set to 23603762; 21594994; 27747449; 27896282 Phenotypes for gene: KIF2A were set to Cortical dysplasia, complex, with other brain malformations 3, 615411 Review for gene: KIF2A was set to GREEN gene: KIF2A was marked as current diagnostic Added comment: Five unrelated individuals reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2061 | KCNT2 |
Zornitza Stark gene: KCNT2 was added gene: KCNT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: KCNT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNT2 were set to 29069600; 29740868 Phenotypes for gene: KCNT2 were set to Epileptic encephalopathy, early infantile 57, 617771 Mode of pathogenicity for gene: KCNT2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: KCNT2 was set to GREEN gene: KCNT2 was marked as current diagnostic Added comment: Three unrelated individuals reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2059 | KCNK4 |
Zornitza Stark gene: KCNK4 was added gene: KCNK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: KCNK4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNK4 were set to 30290154 Phenotypes for gene: KCNK4 were set to Facial dysmorphism, hypertrichosis, epilepsy, intellectual/developmental delay, and gingival overgrowth syndrome 618381 Mode of pathogenicity for gene: KCNK4 was set to Other Review for gene: KCNK4 was set to GREEN Added comment: Three unrelated individuals reported with a distinctive syndromic ID condition and de novo variants (two of the individuals had the same variant). Likely GoF as KO mice do not share the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2007 | GRIN2D |
Zornitza Stark gene: GRIN2D was added gene: GRIN2D was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: GRIN2D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GRIN2D were set to 27616483; 30280376 Phenotypes for gene: GRIN2D were set to Epileptic encephalopathy, early infantile, 46, MIM# 617162; intellectual disability Mode of pathogenicity for gene: GRIN2D was set to Other Review for gene: GRIN2D was set to GREEN gene: GRIN2D was marked as current diagnostic Added comment: Five unrelated individuals reported, two with recurrent variant (NM_000836.2:c.1999G>A or p.Val667Ile). GoF postulated as mechanism. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2005 | GRIA1 |
Zornitza Stark gene: GRIA1 was added gene: GRIA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: GRIA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GRIA1 were set to 28628100; 23033978; 26350204; 24896178 Phenotypes for gene: GRIA1 were set to Intellectual disability; autism Review for gene: GRIA1 was set to GREEN Added comment: Multiple affected individuals reported but in large ID cohorts reporting multiple candidate genes. Recurrent (p.A636T) variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1991 | GMNN |
Zornitza Stark gene: GMNN was added gene: GMNN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: GMNN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GMNN were set to 26637980 Phenotypes for gene: GMNN were set to Meier-Gorlin syndrome 6, MIM# 616835 Review for gene: GMNN was set to AMBER Added comment: Two of the three reported individuals had ID. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1989 | TRAPPC4 |
Zornitza Stark gene: TRAPPC4 was added gene: TRAPPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: TRAPPC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC4 were set to 31794024 Phenotypes for gene: TRAPPC4 were set to intellectual disability; epilepsy; spasticity; microcephaly Review for gene: TRAPPC4 was set to GREEN Added comment: Seven individuals from three unrelated families reported; recurrent splice site variant (hg19:chr11:g.118890966A>G; TRAPPC4: NM_016146.5; c.454+3A>G), not a founder variant. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1985 | PMPCB |
Zornitza Stark gene: PMPCB was added gene: PMPCB was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: PMPCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PMPCB were set to 29576218 Phenotypes for gene: PMPCB were set to Multiple mitochondrial dysfunctions syndrome 6, MIM# 617954 Review for gene: PMPCB was set to GREEN Added comment: Five individuals from four families; seizures in 4/5 individuals reported, onset in infancy. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1983 | NSF |
Zornitza Stark gene: NSF was added gene: NSF was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NSF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NSF were set to 31675180 Phenotypes for gene: NSF were set to Seizures; EEG with burst suppression; Global developmental delay; Intellectual disability Review for gene: NSF was set to AMBER Added comment: Two individuals reported with de novo missense variants in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1981 | KAT8 |
Zornitza Stark gene: KAT8 was added gene: KAT8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KAT8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KAT8 were set to 31794431 Phenotypes for gene: KAT8 were set to Intellectual disability; seizures; autism; dysmorphic features Review for gene: KAT8 was set to GREEN Added comment: Eight unrelated individuals reported with de novo variants in this gene and a mouse model. All variants missense, in the chromobarrel domain or the acetyltransferase domain; three individuals had the same variant p.Tyr90Cys . One more individual reported with bi-allelic variants: one missense and one frameshift; carrier parents were normal suggesting that may be haploinsuffiency is not the mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1966 | GABBR2 |
Zornitza Stark gene: GABBR2 was added gene: GABBR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: GABBR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABBR2 were set to 29100083; 28061363; 28135719; 28856709; 29369404; 29377213 Phenotypes for gene: GABBR2 were set to Neurodevelopmental disorder with poor language and loss of hand skills, 617903 Review for gene: GABBR2 was set to GREEN gene: GABBR2 was marked as current diagnostic Added comment: At least 7 unrelated individuals reported, missense variants only, A707T and A567T (recurrent). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1949 | FRRS1L |
Zornitza Stark gene: FRRS1L was added gene: FRRS1L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: FRRS1L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FRRS1L were set to 27236917; 27239025 Phenotypes for gene: FRRS1L were set to Epileptic encephalopathy, early infantile, 37, MIM#616981 Review for gene: FRRS1L was set to GREEN Added comment: Five unrelated individuals reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1939 | TKFC |
Zornitza Stark gene: TKFC was added gene: TKFC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TKFC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TKFC were set to 32004446 Phenotypes for gene: TKFC were set to Developmental delay; cataracts; liver dysfunction Review for gene: TKFC was set to AMBER Added comment: Two unrelated individuals reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1937 | RALGAPA1 |
Zornitza Stark gene: RALGAPA1 was added gene: RALGAPA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RALGAPA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RALGAPA1 were set to 32004447 Phenotypes for gene: RALGAPA1 were set to Intellectual disability; hypotonia; infantile spasms. Review for gene: RALGAPA1 was set to GREEN Added comment: Four unrelated individuals reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1920 | EMC1 |
Zornitza Stark gene: EMC1 was added gene: EMC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: EMC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EMC1 were set to 26942288; 29271071 Phenotypes for gene: EMC1 were set to Cerebellar atrophy, visual impairment, and psychomotor retardation, MIM# 616875 Review for gene: EMC1 was set to GREEN gene: EMC1 was marked as current diagnostic Added comment: Four unrelated families with bi-allelic variants in this gene reported. Single individual with heterozygous variant: insufficient evidence at present for mono allelic variants causing disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1896 | DLG4 | Zornitza Stark edited their review of gene: DLG4: Added comment: Four unrelated individuals reported.; Changed rating: GREEN; Changed publications: 27479843, 25123844, 19617690, 29460436, 23020937, 28135719; Changed phenotypes: Intellectual disability, Marfanoid habitus; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Set current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1895 | DLAT | Zornitza Stark edited their review of gene: DLAT: Added comment: Only two families with ID reported; third individual had paroxysmal dyskinesia.; Changed rating: AMBER; Changed publications: 16049940, 29093066 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1886 | DCPS |
Zornitza Stark gene: DCPS was added gene: DCPS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: DCPS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DCPS were set to 25701870; 30289615; 25712129 Phenotypes for gene: DCPS were set to Al-Raqad syndrome, MIM#616459 Review for gene: DCPS was set to GREEN gene: DCPS was marked as current diagnostic Added comment: 7 individuals from 3 families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1882 | CUX1 |
Zornitza Stark gene: CUX1 was added gene: CUX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CUX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CUX1 were set to 25059644; 20510857; 30014507 Phenotypes for gene: CUX1 were set to Global developmental delay with or without impaired intellectual development, MIM#618330 Review for gene: CUX1 was set to GREEN gene: CUX1 was marked as current diagnostic Added comment: Nine individuals from 7 families reported. Three individuals had normal intelligence at school age despite significant early developmental delay. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1856 | CHD1 | Zornitza Stark edited their review of gene: CHD1: Added comment: Possible dominant negative mechanism: reported variants are missense, an individual with a deletion did not have a neurological phenotype.; Changed mode of pathogenicity: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1855 | CEP104 |
Zornitza Stark gene: CEP104 was added gene: CEP104 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CEP104 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CEP104 were set to 26477546 Phenotypes for gene: CEP104 were set to Joubert syndrome 25, MIM# 616781 Review for gene: CEP104 was set to GREEN Added comment: Three unrelated individuals reported, ID is part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1843 | CARS2 |
Zornitza Stark gene: CARS2 was added gene: CARS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CARS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CARS2 were set to 30139652; 25787132 Phenotypes for gene: CARS2 were set to Combined oxidative phosphorylation deficiency 27, MIM#616672 Review for gene: CARS2 was set to GREEN Added comment: Three unrelated individuals described with this mitochondrial disorder, ID is part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1833 | ACSL4 | Zornitza Stark Added comment: Comment when marking as ready: At least three unrelated individuals reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1779 | CACNA2D2 |
Zornitza Stark gene: CACNA2D2 was added gene: CACNA2D2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CACNA2D2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CACNA2D2 were set to 23339110; 24358150; 30410802; 29997391; 31402629; 11487633; 11756448; 4177347; 14660671; 15331424 Phenotypes for gene: CACNA2D2 were set to Cerebellar atrophy with seizures and variable developmental delay, MIM#618501 Review for gene: CACNA2D2 was set to GREEN Added comment: Multiple affected individuals reported; DD/ID is variable but present in most. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1775 | C8orf37 |
Zornitza Stark gene: C8orf37 was added gene: C8orf37 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: C8orf37 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C8orf37 were set to 26854863; 27008867 Phenotypes for gene: C8orf37 were set to Bardet-Biedl syndrome 21, MIM#617406 Review for gene: C8orf37 was set to AMBER Added comment: Two unrelated individuals reported with BBS; note gene has an association with retinal ciliopathies. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1759 | FBXW11 |
Alison Yeung gene: FBXW11 was added gene: FBXW11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXW11 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FBXW11 were set to PMID: 31402090 Phenotypes for gene: FBXW11 were set to Intellectual disability; developmental eye anomalies; digital anomalies Review for gene: FBXW11 was set to GREEN gene: FBXW11 was marked as current diagnostic Added comment: Reported in >3 unrelated individuals Functional studies in Zebrafish Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1728 | ALDOB | Zornitza Stark edited their review of gene: ALDOB: Added comment: ID is not an intrinsic feature of this condition; most reported individuals have had normal cognition; Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1727 | CTBP1 |
Sebastian Lunke gene: CTBP1 was added gene: CTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CTBP1 were set to 27094857; 28955726; 31041561 Phenotypes for gene: CTBP1 were set to Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, 617915 gene: CTBP1 was marked as current diagnostic Added comment: From GEL: There are 12 individuals reported from 3 papers (2 papers from the same group). All 12 individuals have the same heterozygous missense variant (R331W in NM_001012614.1; R342W in NM_001328.2). It is a de novo variant in all cases except one where it's inherited from a somatic parent. The phenotype of all 12 is summarised in Table 1 of PMID:31041561. Global DD is a consistent feature (varying severity). ID is recorded in several patients. Developmental motor regression recorded in 4 patients (2 of which also had cognitive regression). Authors note that healthy individuals with heterozygous LOF alleles have been reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1727 | CTBP1 |
Sebastian Lunke gene: CTBP1 was added gene: CTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CTBP1 were set to 27094857; 28955726; 31041561 Phenotypes for gene: CTBP1 were set to Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, 617915 gene: CTBP1 was marked as current diagnostic Added comment: From GEL: There are 12 individuals reported from 3 papers (2 papers from the same group). All 12 individuals have the same heterozygous missense variant (R331W in NM_001012614.1; R342W in NM_001328.2). It is a de novo variant in all cases except one where it's inherited from a somatic parent. The phenotype of all 12 is summarised in Table 1 of PMID:31041561. Global DD is a consistent feature (varying severity). ID is recorded in several patients. Developmental motor regression recorded in 4 patients (2 of which also had cognitive regression). Authors note that healthy individuals with heterozygous LOF alleles have been reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1724 | AGO1 |
Zornitza Stark gene: AGO1 was added gene: AGO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: AGO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AGO1 were set to 30213762; 22495306; 23020937; 25363768; 25356899; 27620904; 29346770; 28135719 Phenotypes for gene: AGO1 were set to Intellectual disability; autism Review for gene: AGO1 was set to GREEN Added comment: Multiple individuals reported with de novo variants in this gene, most as part of large ID cohorts so phenotypic information is scarce; however, given large number I have rated as Green. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1712 | CCDC47 |
Sebastian Lunke gene: CCDC47 was added gene: CCDC47 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CCDC47 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC47 were set to 30401460 Phenotypes for gene: CCDC47 were set to Trichohepatoneurodevelopmental syndrome, 618268 Review for gene: CCDC47 was set to GREEN gene: CCDC47 was marked as current diagnostic Added comment: From GEL: Morimoto el al. (PMID: 30401460) report on 4 individuals from 4 unrelated families with biallelic LoF variants in CCDC47. The phenotype consisted of abnormal (woolly) hair, liver dysfunction, common facial features as well as DD/ID. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1708 | ACAT1 | Zornitza Stark commented on gene: ACAT1: Primarily manifests as metabolic decompensation, DD/ID reported in a few individuals, mostly normal cognition. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1690 | FUK |
Zornitza Stark gene: FUK was added gene: FUK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FUK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FUK were set to 30503518 Phenotypes for gene: FUK were set to Congenital disorder of glycosylation with defective fucosylation 2, MIM# 618324 Review for gene: FUK was set to AMBER Added comment: Two unrelated individuals reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1688 | ZNF142 |
Zornitza Stark gene: ZNF142 was added gene: ZNF142 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ZNF142 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF142 were set to 31036918 Phenotypes for gene: ZNF142 were set to Neurodevelopmental disorder with impaired speech and hyperkinetic movements, MIM#618425 Review for gene: ZNF142 was set to GREEN gene: ZNF142 was marked as current diagnostic Added comment: 7 individuals from 4 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1684 | VPS11 |
Zornitza Stark gene: VPS11 was added gene: VPS11 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: VPS11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS11 were set to 27120463; 26307567; 27473128 Phenotypes for gene: VPS11 were set to Leukodystrophy, hypomyelinating, 12, MIM#616683 Review for gene: VPS11 was set to GREEN Added comment: ID, (variable) acquired microcephaly with hypomyelination; seizures in several reported individuals. 13 individuals from 7 Ashkenazi Jewish families, homozygous for a founder mutation (NM_021729.5:c.2536T>G or p.Cys846Gly); a different variant (p.Leu387_Gly395del) reported in a consanguineous family. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1677 | SLC1A4 |
Zornitza Stark gene: SLC1A4 was added gene: SLC1A4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: SLC1A4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC1A4 were set to 29989513; 27193218; 26138499; 26041762; 25930971 Phenotypes for gene: SLC1A4 were set to Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657 Review for gene: SLC1A4 was set to GREEN gene: SLC1A4 was marked as current diagnostic Added comment: Multiple affected individuals reported in the literature, seizures/EE are part of the phenotype. While initial reports identified a recurrent missense variant in individuals of Ashkenazi Jewish ancestry, there have been more recent reports of individuals from other ethnic backgrounds with different variants Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1675 | NBEA |
Zornitza Stark gene: NBEA was added gene: NBEA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: NBEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NBEA were set to 30269351; 28554332; 12746398; 12826745; 11450821; 3377648; 23277425; 22109531; 23153818 Phenotypes for gene: NBEA were set to Intellectual disability; Seizures Review for gene: NBEA was set to GREEN gene: NBEA was marked as current diagnostic Added comment: 24 de novo variants reported in individuals with a neurodevelopmental disorder. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1673 | MACF1 |
Zornitza Stark gene: MACF1 was added gene: MACF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: MACF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MACF1 were set to 30471716 Phenotypes for gene: MACF1 were set to Lissencephaly 9 with complex brainstem malformation, MIM# 618325 Mode of pathogenicity for gene: MACF1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: MACF1 was set to GREEN Added comment: Nine individuals (including a pair of twins) reported with de novo, likely GoF variants in this gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1664 | GNB5 |
Zornitza Stark gene: GNB5 was added gene: GNB5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: GNB5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GNB5 were set to 27523599; 27677260; 28697420; 29368331 Phenotypes for gene: GNB5 were set to Intellectual developmental disorder with cardiac arrhythmia, 617173; Language delay and ADHD/cognitive impairment with or without cardiac arrhythmia, 617182; Early infantile epileptic encephalopathy (EIEE) Review for gene: GNB5 was set to GREEN gene: GNB5 was marked as current diagnostic Added comment: Multiple affected individuals reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1658 | GOT2 |
Zornitza Stark gene: GOT2 was added gene: GOT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GOT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GOT2 were set to 31422819 Phenotypes for gene: GOT2 were set to Epileptic encephalopathy, early infantile, 82, MIM# 618721 Review for gene: GOT2 was set to GREEN Added comment: Four individuals from three unrelated families reported, EE/DD. Treatment with pyridoxine and serine ameliorated the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1656 | RAB11A |
Zornitza Stark gene: RAB11A was added gene: RAB11A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB11A were set to 29100083 Phenotypes for gene: RAB11A were set to Intellectual disability; seizures Review for gene: RAB11A was set to AMBER Added comment: Five individuals reported with DNMs and neurodevelopmental phenotypes as part of this paper; however, clinical details are sparse. Emerging gene, phenotype not yet clearly delineated. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1654 | DHPS |
Zornitza Stark gene: DHPS was added gene: DHPS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: DHPS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DHPS were set to 30661771 Phenotypes for gene: DHPS were set to Neurodevelopmental disorder with seizures and speech and walking impairment, MIM#618480 Review for gene: DHPS was set to GREEN gene: DHPS was marked as current diagnostic Added comment: 5 individuals from 4 unrelated families with biallelic pathogenic variants in DHPS, note one variant is recurrent (c.518A>G or p.Asn173Ser). The phenotype consisted of DD/ID (5/5), tone abnormalities (hypotonia/hypertonia/spasticity - 5/5), seizures (5/5 - in one case though unclear staring spells) with EEG abnormalities (5/5). Additionally most individuals displayed behavioral issues, or some common facial features Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1652 | DHDDS |
Zornitza Stark gene: DHDDS was added gene: DHDDS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: DHDDS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DHDDS were set to 29100083 Phenotypes for gene: DHDDS were set to Developmental delay and seizures with or without movement abnormalities, MIM#617836 Review for gene: DHDDS was set to GREEN gene: DHDDS was marked as current diagnostic Added comment: Five unrelated individuals reported with mono-allelic variants and a neurodevelopmental phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1641 | MTHFS |
Zornitza Stark gene: MTHFS was added gene: MTHFS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MTHFS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MTHFS were set to 30031689; 31844630; 22303332 Phenotypes for gene: MTHFS were set to Neurodevelopmental disorder with microcephaly, epilepsy, and hypomyelination, 618367 Review for gene: MTHFS was set to GREEN Added comment: Three unrelated individuals reported with supporting biochemical evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1637 | CDH2 |
Zornitza Stark gene: CDH2 was added gene: CDH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDH2 were set to 31585109 Phenotypes for gene: CDH2 were set to Intellectual disability; corpus callosum abnormalities; congenital abnormalities Review for gene: CDH2 was set to GREEN Added comment: Nine unrelated individuals reported with de novo variants in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1634 | NTNG2 |
Zornitza Stark gene: NTNG2 was added gene: NTNG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NTNG2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NTNG2 were set to 31668703 Phenotypes for gene: NTNG2 were set to Intellectual disability; autism; dysmorphic features Review for gene: NTNG2 was set to GREEN Added comment: 16 individuals from 7 unrelated families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1619 | KCNN3 |
Alison Yeung gene: KCNN3 was added gene: KCNN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNN3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KCNN3 were set to PMID: 31155282 Phenotypes for gene: KCNN3 were set to Zimmermann-Laband syndrome 3; OMIM# 618658 Review for gene: KCNN3 was set to GREEN gene: KCNN3 was marked as current diagnostic Added comment: Reported in three unrelated individuals Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1614 | IQSEC1 |
Zornitza Stark gene: IQSEC1 was added gene: IQSEC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IQSEC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IQSEC1 were set to 31607425 Phenotypes for gene: IQSEC1 were set to Intellectual developmental disorder with short stature and behavioral abnormalities, MIM# 618687 Review for gene: IQSEC1 was set to GREEN Added comment: Five individuals from two unrelated families reported, animal model data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1609 | GPC4 |
Alison Yeung gene: GPC4 was added gene: GPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GPC4 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: GPC4 were set to PMID: 30982611 Phenotypes for gene: GPC4 were set to Keipert syndrome OMIM# 301026 Review for gene: GPC4 was set to GREEN gene: GPC4 was marked as current diagnostic Added comment: >3 unrelated individuals reported, functional studies in mice Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1605 | MAPK8IP3 |
Alison Yeung gene: MAPK8IP3 was added gene: MAPK8IP3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAPK8IP3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAPK8IP3 were set to 30612693 Phenotypes for gene: MAPK8IP3 were set to Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431 Review for gene: MAPK8IP3 was set to GREEN gene: MAPK8IP3 was marked as current diagnostic Added comment: >3 reported individuals and functional evidence in Caenorhabditis elegans Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1598 | TET3 |
Zornitza Stark gene: TET3 was added gene: TET3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TET3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: TET3 were set to 31928709 Phenotypes for gene: TET3 were set to Intellectual disability; dysmorphic features; abnormal growth; movement disorders Review for gene: TET3 was set to GREEN Added comment: Eleven individuals from 8 families described. Mono-allelic frameshift and nonsense variants occur throughout the coding region. Mono-allelic and bi-allelic missense variants localize to conserved residues; all but one such variant occur within the catalytic domain, and most display hypomorphic function in an assay of catalytic activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1522 | AP2M1 |
Zornitza Stark gene: AP2M1 was added gene: AP2M1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: AP2M1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AP2M1 were set to 31104773 Phenotypes for gene: AP2M1 were set to Intellectual developmental disorder 60 with seizures, MIM# 618587 Review for gene: AP2M1 was set to GREEN Added comment: Four unrelated individuals reported, recurrent variant, NM_004068.3:c.508C>T or p.Arg170Trp. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1501 | PUS3 |
Zornitza Stark gene: PUS3 was added gene: PUS3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: PUS3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PUS3 were set to 30308082; 28454995; 27055666; 30697592; 31444731 Phenotypes for gene: PUS3 were set to Mental retardation, autosomal recessive 55, MIM# 617051 Review for gene: PUS3 was set to GREEN Added comment: Seven individuals from five families reported; two of the families had the same homozygous truncating variant. Variable features reported in addition to ID, including leukoencephalopathy, EE, and nephropathy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1499 | EIF3F |
Zornitza Stark gene: EIF3F was added gene: EIF3F was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: EIF3F was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3F were set to 30409806 Phenotypes for gene: EIF3F were set to Mental retardation, autosomal recessive 67, MIM# 618295 Review for gene: EIF3F was set to GREEN Added comment: Nine individuals from 7 families reported, all homozygous for the same missense variant, p.(Phe232Val). This variant is present at 0.12% frequency in non-Finnish Europeans in gnomad (no homozygotes). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1495 | RSRC1 |
Zornitza Stark gene: RSRC1 was added gene: RSRC1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: RSRC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RSRC1 were set to 28640246; 29522154 Phenotypes for gene: RSRC1 were set to Intellectual developmental disorder, autosomal recessive 70, MIM# 618402 Review for gene: RSRC1 was set to AMBER Added comment: Two unrelated families reported, 8 affected individuals. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1490 | USP27X |
Zornitza Stark gene: USP27X was added gene: USP27X was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: USP27X was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: USP27X were set to 25644381 Phenotypes for gene: USP27X were set to Mental retardation, X-linked 105, MIM#300984 Review for gene: USP27X was set to AMBER Added comment: Four individuals from two unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1486 | ODC1 |
Zornitza Stark gene: ODC1 was added gene: ODC1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: ODC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ODC1 were set to 30475435 Phenotypes for gene: ODC1 were set to Intellectual disability; macrocephaly; dysmorphism Mode of pathogenicity for gene: ODC1 was set to Other Review for gene: ODC1 was set to GREEN Added comment: Four individuals with de novo GoF variants in this gene reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1484 | RALA |
Zornitza Stark gene: RALA was added gene: RALA was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: RALA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RALA were set to 30500825 Phenotypes for gene: RALA were set to Intellectual disability; short stature; dysmorphism Review for gene: RALA was set to GREEN Added comment: Ten individuals with de novo variants in this gene, six of these at two codons only: Val25 and Lys128. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1481 | TRPM3 |
Zornitza Stark gene: TRPM3 was added gene: TRPM3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: TRPM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRPM3 were set to 31278393 Phenotypes for gene: TRPM3 were set to Intellectual disability; epilepsy Review for gene: TRPM3 was set to GREEN Added comment: 8 unrelated individuals with de novo variants in this gene. Recurrent variant p.(Val837Met) identified in 7/8. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1478 | NUS1 |
Zornitza Stark gene: NUS1 was added gene: NUS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: NUS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NUS1 were set to 31656175; 29100083 Phenotypes for gene: NUS1 were set to Epilepsy; intellectual disability Review for gene: NUS1 was set to GREEN Added comment: Five individuals reported with de novo variants in this gene and epilepsy/ID phenotype (4 truncating variants and a small deletion). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1476 | UGP2 |
Zornitza Stark gene: UGP2 was added gene: UGP2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: UGP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGP2 were set to 31820119 Phenotypes for gene: UGP2 were set to Epileptic encephalopathy; intellectual disability; microcephaly Review for gene: UGP2 was set to GREEN Added comment: 22 individuals from 15 families reported with the same homozygous missense variant in this gene, chr2:64083454A > G, which causes a disruption of the start codon in the shorter isoform, which is expressed in brain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1465 | NTRK2 |
Zornitza Stark gene: NTRK2 was added gene: NTRK2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: NTRK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NTRK2 were set to 15494731; 27884935; 29100083 Phenotypes for gene: NTRK2 were set to Obesity, hyperphagia, and developmental delay, MIM# 613886 Review for gene: NTRK2 was set to GREEN Added comment: Three unrelated individuals reported with this phenotype. Note recurrent missense in this gene also causes EE. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1463 | GLS |
Zornitza Stark gene: GLS was added gene: GLS was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: GLS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GLS were set to 30970188 Phenotypes for gene: GLS were set to Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412 Review for gene: GLS was set to AMBER Added comment: Three unrelated individuals described with compound het variants, however, note one of these is a triplet expansion in the 5' UTR, this may not be tractable depending on sequencing modality. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1462 | PPP1R12A | Zornitza Stark Added comment: Comment when marking as ready: Now published, 12 individuals, upgraded to Green. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1435 | MN1 |
Zornitza Stark gene: MN1 was added gene: MN1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: MN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MN1 were set to 31834374; 31839203 Phenotypes for gene: MN1 were set to Intellectual disability; dysmophic features; rhombencephalosynapsis Mode of pathogenicity for gene: MN1 was set to Other Review for gene: MN1 was set to GREEN Added comment: Over 20 individuals described with de novo truncating variants in this gene; these cluster in the C-terminal and the authors postulate that that syndrome is not due to MN1 haploinsufficiency but rather is the result of dominantly acting C-terminally truncated MN1 protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1433 | EEF1B2 |
Zornitza Stark gene: EEF1B2 was added gene: EEF1B2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: EEF1B2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EEF1B2 were set to 31845318; 21937992 Phenotypes for gene: EEF1B2 were set to Intellectual disability Review for gene: EEF1B2 was set to AMBER Added comment: 5 individuals from two unrelated families described in the literature so far, no functional data but gene belongs to a family implicated in neurodevelopmental disorders. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1422 | DSCAM | Natasha Brown Added comment: Comment when marking as ready: Large cohort studies mean that individual phenotype data currently lacking in particular in relation to ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1414 | ZFHX3 |
Zornitza Stark changed review comment from: Personal communication: Over 20 individuals with mostly de novo variants in this gene and mild ID/DD Sources: Research; to: Emerging evidence. Sources: Research |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1412 | ZFHX3 |
Zornitza Stark gene: ZFHX3 was added gene: ZFHX3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Research Mode of inheritance for gene: ZFHX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ZFHX3 were set to Intellectual disability Review for gene: ZFHX3 was set to GREEN Added comment: Personal communication: Over 20 individuals with mostly de novo variants in this gene and mild ID/DD Sources: Research |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1410 | USP7 |
Natasha Brown gene: USP7 was added gene: USP7 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: USP7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: USP7 were set to 30679821 Phenotypes for gene: USP7 were set to ID; Autism Review for gene: USP7 was set to GREEN Added comment: at least 16 individuals identified and 7 previous cases Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1406 | SLC12A2 |
Zornitza Stark gene: SLC12A2 was added gene: SLC12A2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: SLC12A2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC12A2 were set to 30740830 Phenotypes for gene: SLC12A2 were set to Kilquist syndrome; deafness; intellectual disability; dysmorphic features; absent salivation Review for gene: SLC12A2 was set to AMBER Added comment: Single individual with bi-alllelic deletion described; mouse model recapitulated the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1395 | SCAMP5 | Zornitza Stark Added comment: Comment when marking as ready: Two unrelated individuals and functional data, upgraded to Green. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1392 | POLR2A |
Sue White gene: POLR2A was added gene: POLR2A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: POLR2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: POLR2A were set to 31353023 Phenotypes for gene: POLR2A were set to Neurodevelopmental disorder with hypotonia and variable intellectual and behavioral abnormalities, MIM# 618603 Mode of pathogenicity for gene: POLR2A was set to Other Review for gene: POLR2A was set to GREEN Added comment: 11 unrelated individuals reported with de novo variants in this gene. Missense variants postulated to exert a dominant-negative effect; LoF variants by contrast resulted in milder phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1379 | ETS1 |
Zornitza Stark gene: ETS1 was added gene: ETS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: ETS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ETS1 were set to 31160359 Phenotypes for gene: ETS1 were set to Intellectual disability Review for gene: ETS1 was set to RED Added comment: Single individual with de novo truncating variant in this gene; gene is Jacobsen syndrome critical region. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1374 | DYNC1I2 |
Zornitza Stark gene: DYNC1I2 was added gene: DYNC1I2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: DYNC1I2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DYNC1I2 were set to 31079899 Phenotypes for gene: DYNC1I2 were set to Neurodevelopmental disorder with microcephaly and structural brain anomalies , MIM#618492 Review for gene: DYNC1I2 was set to GREEN Added comment: Five individuals from three unrelated families reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1372 | DNAJA1 |
Zornitza Stark gene: DNAJA1 was added gene: DNAJA1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: DNAJA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAJA1 were set to 30972502 Phenotypes for gene: DNAJA1 were set to Intellectual disability; seizures Review for gene: DNAJA1 was set to RED Added comment: Single family with multiple affected individuals reported with bi-allelic truncating variant in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1370 | DLL1 |
Zornitza Stark gene: DLL1 was added gene: DLL1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: DLL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DLL1 were set to 31353024 Phenotypes for gene: DLL1 were set to Intellectual disability; autism; seizures; variable brain abnormalities; scoliosis Review for gene: DLL1 was set to GREEN Added comment: Fifteen individuals from 12 unrelated families reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1368 | DDX6 |
Zornitza Stark gene: DDX6 was added gene: DDX6 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: DDX6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DDX6 were set to 31422817, Phenotypes for gene: DDX6 were set to Intellectual developmental disorder with impaired language and dysmorphic facies, MIM#618653 Review for gene: DDX6 was set to GREEN Added comment: Five unrelated individuals reported with 5 different de novo heterozygous missense mutations in exon 11 of the DDX6 gene. All variants occurred at conserved residues in either the QxxR or V motifs within the second RecA-2 domain of the helicase core; this region is involved in RNA and/or ATP binding, suggesting functional consequences. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1366 | CYFIP2 |
Zornitza Stark gene: CYFIP2 was added gene: CYFIP2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: CYFIP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CYFIP2 were set to 29534297 Phenotypes for gene: CYFIP2 were set to Epileptic encephalopathy, early infantile, 65, MIM#618008 Review for gene: CYFIP2 was set to GREEN Added comment: Four unrelated individuals with de novo variants in this gene. All variants affected the same highly conserved residue (arg87) in the DUF1394 domain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1361 | FBXL3 |
chirag patel gene: FBXL3 was added gene: FBXL3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: FBXL3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXL3 were set to PubMed: 30481285 Phenotypes for gene: FBXL3 were set to Intellectual developmental disorder with short stature, facial anomalies, and speech defects; OMIM #606220 Review for gene: FBXL3 was set to AMBER Added comment: 3 unrelated families with 8 affected individuals with ID, DD, short stature and mild facial dysmorphism, and with homozygous mutations in FBXL3. Segregated with the disorder in all 3 families. Functional studies of the variants and studies of patient cells were not performed. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1358 | FRY |
chirag patel gene: FRY was added gene: FRY was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: FRY was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FRY were set to PMID: 31487712; 27457812; 21937992 Phenotypes for gene: FRY were set to no OMIM number yet Review for gene: FRY was set to AMBER Added comment: 1 patient with ID/DD and a novel homozygous deletion involving FRY gene identified by genomic SNP microarray. No functional evidence. 2 consanguineous families with 6 affected individuals with ID, and homozygous mutations of FRY. No functional evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1352 | CDK8 |
Zornitza Stark gene: CDK8 was added gene: CDK8 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: CDK8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDK8 were set to 30905399 Phenotypes for gene: CDK8 were set to Intellectual disability; dysmorphism; congenital abnormalities; seizures Review for gene: CDK8 was set to GREEN Added comment: 12 unrelated individuals, missense variants demonstrated as de novo in 10. All variants localize to the ATP-binding pocket of the kinase domain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1346 | KDM3B |
chirag patel gene: KDM3B was added gene: KDM3B was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: KDM3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KDM3B were set to PMID: 30929739 Phenotypes for gene: KDM3B were set to no OMIM number yet Review for gene: KDM3B was set to GREEN Added comment: 14 unrelated individuals and 3 affected parents with varying degrees of ID, DD, short stature, dysmorphism, and de novo or inherited pathogenic variants in KDM3B. No functional studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1344 | LMAN2L |
chirag patel gene: LMAN2L was added gene: LMAN2L was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: LMAN2L was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: LMAN2L were set to PMID: 31020005; 26566883 Phenotypes for gene: LMAN2L were set to ?Mental retardation, autosomal recessive, 52; OMIM #616887 Review for gene: LMAN2L was set to AMBER Added comment: 1 consanguineous family with 7 individuals with ID and epilepsy, with homozygous LMAN2L missense mutation. Segregated with disease in family, and unaffected family members were heterozygous variant carriers. No functional studies. 1 non-consanguineous family with 4 affected with heterozygous frameshift LMAN2L mutation. Segregates in family. Mutation eliminates LMAN2L's endoplasmic reticulum retention signal and mislocalizes the protein from that compartment to the plasma membrane. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1343 | LSM1 |
chirag patel gene: LSM1 was added gene: LSM1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: LSM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LSM1 were set to PMID: 31010896 Phenotypes for gene: LSM1 were set to no OMIM number yet Review for gene: LSM1 was set to RED Added comment: 1 family with 2 siblings with global DD, multiple congenital anomalies, and abnormal eye movements, with homozygous splice variant in LSM1. Segregated with the phenotype in the family. Expression studies revealed absence of expression of the canonical isoform in the affected individuals. The Lsm1 knockout mice have a partially overlapping phenotype that affects the brain, heart, and eye. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1341 | LSS |
chirag patel gene: LSS was added gene: LSS was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: LSS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LSS were set to PMID: 30723320 Phenotypes for gene: LSS were set to Cataract 44, OMIM #616509; Hypotrichosis 14, OMIM #618275 Review for gene: LSS was set to GREEN Added comment: Expanded the phenotypic spectrum of LSS to a recessive neuroectodermal syndrome formerly named alopecia with mental retardation (APMR) syndrome. Ten APMR individuals from 6 unrelated families with biallelic variants in LSS. Quantification of cholesterol and its precursors did not reveal noticeable imbalance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1340 | MACROD2 |
chirag patel gene: MACROD2 was added gene: MACROD2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: MACROD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MACROD2 were set to PMID: 31055587 Phenotypes for gene: MACROD2 were set to no OMIM number yet Review for gene: MACROD2 was set to RED Added comment: 1 family with a few affected with microcephaly, ID, dysmorphic features, and polydactyly. Deletion of chromosome 20p12.1 involving the MACROD2 gene was found in several members of the family. qRT-PCR showed higher levels of a MACROD2 mRNA isoform in the individuals carrying the deletion. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1328 | PAK1 |
chirag patel gene: PAK1 was added gene: PAK1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PAK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PAK1 were set to PMID: 31504246; 30290153 Phenotypes for gene: PAK1 were set to Intellectual developmental disorder with macrocephaly, seizures, and speech delay; OMIM #618158 Review for gene: PAK1 was set to GREEN Added comment: 2 unrelated individuals with de novo PAK1 mutations, with developmental delay, secondary macrocephaly, seizures, and ataxic gait. Enhanced phosphorylation of the PAK1 targets JNK and AKT shown in fibroblasts of one subject and of c-JUN in those of both subjects compared with control subjects. In fibroblasts of the 2 affected individuals, they observed a trend toward enhanced PAK1 kinase activity. By using co-immunoprecipitation and size-exclusion chromatography, they observed a significantly reduced dimerization for both PAK1 mutants compared with wild-type PAK1. 4 unrelated individuals with intellectual disability, macrocephaly and seizures, with de novo heterozygous missense variants in PAK1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1326 | PHF21A |
chirag patel gene: PHF21A was added gene: PHF21A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PHF21A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHF21A were set to PMID: 31649809; 30487643; 22770980 Phenotypes for gene: PHF21A were set to no OMIM number yet. Review for gene: PHF21A was set to GREEN Added comment: 9 cases with intellectual disability and craniofacial anomalies (Potocki-Shaffer syndrome), with de novo truncating variants in PHF21A. No functional evidence of variants, but PHF21A is highly expressed in the human fetal brain, which is consistent with the neurodevelopmental phenotype. 2 other unrelated individuals with translocations disrupting PHF21A. Lymphoblastoid cell lines from translocation subjects showed derepression of the neuronal gene SCN3A and reduced LSD1 occupancy at the SCN3A promoter, supporting a direct functional consequence of PHF21A haploinsufficiency on transcriptional regulation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1324 | PIBF1 |
chirag patel gene: PIBF1 was added gene: PIBF1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PIBF1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIBF1 were set to PubMed: 26167768; 30858804; 29695797 Phenotypes for gene: PIBF1 were set to Joubert syndrome 33; OMIM #617767 Review for gene: PIBF1 was set to GREEN Added comment: 1 family of Schmiedeleut Hutterite descent with 2 affected brothers with Joubert syndrome had homozygous missense mutation in PIBF1 gene. Parents were heterozygous. 2 other Hutterite families with 3 affected children and same homozygous missense mutation in PIBF1 gene, suggesting a founder effect. 2 other unrelated individuals with compound heterozygous mutations in PIBF1 gene. 1 unrelated individual with compound heterozygous variants in PIBF1 gene, and functional evidence in the frog Xenopus. 1 unrelated individual with another homozygous missense mutation in PIBF1 gene, but no and functional evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1320 | PIGU |
chirag patel gene: PIGU was added gene: PIGU was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PIGU was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGU were set to PMID: 31353022 Phenotypes for gene: PIGU were set to Glycosylphosphatidylinositol biosynthesis defect 21; OMIM #618590 Review for gene: PIGU was set to GREEN Added comment: 5 patients from 3 unrelated families, with homozygous missense mutations in the PIGU gene. All individuals presented with global DD, severe-to-profound ID, muscular hypotonia, seizures, brain anomalies, scoliosis, and mild facial dysmorphism. Flow cytometric analysis of patient granulocytes showed a characteristic pattern, with reduced cell surface expression of CD16 and CD24. In addition, patient B cells showed increased expression of free GPI anchors determined by a specific antibody, T5. The findings suggested that PIGU mutations reduce the function of the GPI transamidase complex, leading to accumulation of free GPI anchors on the cell surface. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1317 | PISD |
chirag patel changed review comment from: 4 individuals in 2 unrelated but consanguineous families from Portugal and Brazil affected by early-onset retinal degeneration, sensorineural hearing loss, microcephaly, intellectual disability, and skeletal dysplasia with scoliosis and short stature (Liberfarb syndrome). Affected individuals shared a homozygous 10-bp deletion immediately upstream of the last exon of the PISD gene. In HEK293T cells, this variant led to aberrant splicing of PISD transcripts. Sources: Literature; to: 4 individuals in 2 unrelated but consanguineous families from Portugal and Brazil affected by early-onset retinal degeneration, sensorineural hearing loss, microcephaly, intellectual disability, and skeletal dysplasia with scoliosis and short stature (Liberfarb syndrome). Affected individuals shared a homozygous 10-bp deletion immediately upstream of the last exon of the PISD gene. In HEK293T cells, this variant led to aberrant splicing of PISD transcripts. 1 family with 2 sisters with congenital cataracts, short stature, and white matter changes identified compound heterozygous variants in the PISD gene. Decreased conversion of phosphatidylserine to PE in patient fibroblasts is consistent with impaired phosphatidylserine decarboxylase (PISD) enzyme activity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1317 | PISD |
chirag patel gene: PISD was added gene: PISD was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PISD was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PISD were set to PMID: 31263216 Phenotypes for gene: PISD were set to no OMIM number yet. Review for gene: PISD was set to AMBER Added comment: 4 individuals in 2 unrelated but consanguineous families from Portugal and Brazil affected by early-onset retinal degeneration, sensorineural hearing loss, microcephaly, intellectual disability, and skeletal dysplasia with scoliosis and short stature (Liberfarb syndrome). Affected individuals shared a homozygous 10-bp deletion immediately upstream of the last exon of the PISD gene. In HEK293T cells, this variant led to aberrant splicing of PISD transcripts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1315 | POU3F3 |
chirag patel gene: POU3F3 was added gene: POU3F3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: POU3F3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: POU3F3 were set to PMID: 24550763; 31303265 Phenotypes for gene: POU3F3 were set to no OMIM number yet. Review for gene: POU3F3 was set to GREEN Added comment: 19 individuals with DD/ID/speech issues and heterozygous POU3F3 disruptions, most of which were de novo variants. Positive functional cell-based analyses of pathogenic variants. 1 patient reported with whole gene deletion and ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1313 | PPP2CA |
chirag patel gene: PPP2CA was added gene: PPP2CA was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PPP2CA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2CA were set to PMID: 30595372 Phenotypes for gene: PPP2CA were set to Neurodevelopmental disorder and language delay with or without structural brain abnormalities; OMIM #618354 Review for gene: PPP2CA was set to GREEN Added comment: 15 unrelated patients with a neurodevelopmental disorder with de novo heterozygous PPP2CA mutations, and 1 with partial deletion of PPP2CA. Functional studies showed complete PP2A dysfunction in 4 individuals with seemingly milder ID, hinting at haploinsufficiency. Ten other individuals showed mutation-specific biochemical distortions, including poor expression, altered binding to the A subunit and specific B-type subunits, and impaired phosphatase activity and C-terminal methylation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1309 | RNF113A |
chirag patel gene: RNF113A was added gene: RNF113A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: RNF113A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: RNF113A were set to PMID: 25612912; 31793730 Phenotypes for gene: RNF113A were set to ?Trichothiodystrophy 5, nonphotosensitive; OMIM #300953 Review for gene: RNF113A was set to AMBER Added comment: 1 family of 2 male cousins with IUGR, progressive microcephaly, profound ID, genital anomalies, and severe linear growth failure, and nonsense Q301X mutation in RNF113A gene. Segregated with disease in the family. The mutation markedly reduced RNF113A protein expression in extracts from lymphoblastoid cell lines derived from the affected individuals. 2 fetuses affected with abnormalities similar to previous report, with the same nonsense Q301X mutation in RNF113A gene (can not access paper to see if from same family or functional evidence). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1307 | SCAMP5 |
chirag patel gene: SCAMP5 was added gene: SCAMP5 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: SCAMP5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SCAMP5 were set to PMID: 31439720 Phenotypes for gene: SCAMP5 were set to no OMIM number yet Review for gene: SCAMP5 was set to AMBER Added comment: 2 unrelated individuals with ASD, ID and seizures, with the same heterozygous de novo variant in SCAMP5 (p.Gly302Trp). Western blot analysis of proteins overexpressed in the Drosophila fat body showed strongly reduced levels of the SCAMP p.Gly302Trp protein compared with the wild-type protein, indicating that the mutant either reduced expression or increased turnover of the protein. The expression of the fly homologue of the human SCAMP5 p.Gly180Trp mutation caused similar eye and neuronal phenotypes as the expression of SCAMP RNAi, suggesting a dominant-negative effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1303 | BRSK2 |
Zornitza Stark gene: BRSK2 was added gene: BRSK2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: BRSK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BRSK2 were set to 30879638 Phenotypes for gene: BRSK2 were set to Intellectual disability; autism Review for gene: BRSK2 was set to GREEN Added comment: Nine unrelated individuals with heterozygous variants in this gene; six confirmed de novo (parents available). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1298 | SMARCC2 |
chirag patel gene: SMARCC2 was added gene: SMARCC2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: SMARCC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMARCC2 were set to PMID: 30580808 Phenotypes for gene: SMARCC2 were set to Coffin-Siris syndrome 8; OMIM #618362 Review for gene: SMARCC2 was set to GREEN Added comment: 15 individuals with variable degrees of neurodevelopmental delay, growth retardation, prominent speech impairment, hypotonia, feeding difficulties, behavioral abnormalities, and dysmorphic features. They found heterozygous de novo SMARCC2 variants, but no functional evidence of specific variants. Transcriptomic analysis of fibroblasts from affected individuals highlighted a group of differentially expressed genes with possible roles in regulation of neuronal development and function, namely H19, SCRG1, RELN, and CACNB4. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1296 | SMARCD1 |
chirag patel gene: SMARCD1 was added gene: SMARCD1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: SMARCD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMARCD1 were set to PMID: 30879640 Phenotypes for gene: SMARCD1 were set to no OMIM number yet Review for gene: SMARCD1 was set to GREEN Added comment: 5 individuals with heterozygous SMARCD1 variants (4 de novo, 1 unk), and developmental delay, intellectual disability, hypotonia, feeding difficulties, dysmorphisms, and small hands and feet. No functional evidence of some variants was not conclusive with immunoblot or co-immunoprecipitation studies. Targeted knockdown of Drosophila ortholog Bap60 in the mushroom body of adult flies causes defects in long-term memory. Mushroom-body-specific transcriptome analysis revealed that Bap60 is required for context-dependent expression of genes involved in neuron function and development in juvenile flies when synaptic connections are actively being formed in response to experience. T Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1294 | BCL11B |
Zornitza Stark gene: BCL11B was added gene: BCL11B was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: BCL11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BCL11B were set to 29985992 Phenotypes for gene: BCL11B were set to Intellectual developmental disorder with dysmorphic facies, speech delay, and T-cell abnormalities, MIM# 618092 Review for gene: BCL11B was set to GREEN Added comment: Nine unrelated individuals, all but one with de novo variants in this gene and syndromic ID/immunodeficiency. Most variants located in the last exon (exon 4) and are predicted to escape nonsense-mediated mRNA decay. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1285 | ATN1 |
Zornitza Stark gene: ATN1 was added gene: ATN1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: ATN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATN1 were set to 30827498 Phenotypes for gene: ATN1 were set to Congenital hypotonia, epilepsy, developmental delay, and digital anomalies, MIM#618494 Review for gene: ATN1 was set to GREEN Added comment: Eight unrelated individuals with de novo heterozygous variants in this gene and syndromic ID; all variants result in substitutions within the highly conserved 16-amino acid histidine-rich 'HX repeat' motif near the C terminus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1279 | APC2 |
Zornitza Stark gene: APC2 was added gene: APC2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: APC2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: APC2 were set to 31585108 Phenotypes for gene: APC2 were set to Cortical dysplasia, complex, with other brain malformations 10, MIM#618677 Review for gene: APC2 was set to GREEN Added comment: 12 individuals from 8 unrelated families; intellectual disability, seizures, cortical dysplasia including posterior to anterior predominant pattern of lissencephaly, heterotopias, paucity of white matter, thin corpus callosum. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1277 | VAMP2 |
chirag patel gene: VAMP2 was added gene: VAMP2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: VAMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: VAMP2 were set to PMID: 30929742 Phenotypes for gene: VAMP2 were set to no OMIM number yet Review for gene: VAMP2 was set to GREEN Added comment: 5 unrelated patients with heterozygous de novo mutations in VAMP2, presenting with a neurodevelopmental disorder characterized by axial hypotonia, intellectual disability, and autistic features. Affected individuals carrying de novo non-synonymous variants involving the C-terminal region presented a more severe phenotype with additional neurological features, including central visual impairment, hyperkinetic movement disorder, and epilepsy or electroencephalography abnormalities. Reconstituted fusion involving a lipid-mixing assay indicated impairment in vesicle fusion as one of the possible associated disease mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1268 | ACTL6B |
Zornitza Stark gene: ACTL6B was added gene: ACTL6B was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: ACTL6B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ACTL6B were set to 31134736; 31031012; 30656450; 30237576 Phenotypes for gene: ACTL6B were set to Epileptic encephalopathy, early infantile, 76, MIM# 618468; Intellectual developmental disorder with severe speech and ambulation defects, MIM# 618470 Review for gene: ACTL6B was set to GREEN Added comment: Multiple affected individuals reported, main phenotype is ID/EE. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1158 | SELENOI |
Zornitza Stark gene: SELENOI was added gene: SELENOI was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: SELENOI was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SELENOI were set to 28052917 Phenotypes for gene: SELENOI were set to developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals; microcephaly Review for gene: SELENOI was set to RED Added comment: Single family only, four sibs, supportive biochemical evidence. Borderline amber/red gene, only mild ID described, seems to be more of a progressive neurometabolic condition based on limited evidence. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1093 | RORA |
Zornitza Stark gene: RORA was added gene: RORA was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: RORA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RORA were set to 29656859 Phenotypes for gene: RORA were set to Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, MIM#618060 Mode of pathogenicity for gene: RORA was set to Other Review for gene: RORA was set to GREEN Added comment: Eleven unrelated individuals with de novo variants in this gene; postulated that some variants exert dominant-negative effect resulting in a more severe phenotype than the LoF variants. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1083 | RHOBTB2 |
Zornitza Stark gene: RHOBTB2 was added gene: RHOBTB2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: RHOBTB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RHOBTB2 were set to 29768694; 29276004 Phenotypes for gene: RHOBTB2 were set to Epileptic encephalopathy, early infantile, 64, MIM#618004 Review for gene: RHOBTB2 was set to GREEN Added comment: 13 individuals from unrelated families reported in the literature in 2018 with de novo variants in this gene and ID/EE. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1022 | PRR12 |
Zornitza Stark gene: PRR12 was added gene: PRR12 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PRR12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRR12 were set to 29556724 Review for gene: PRR12 was set to GREEN Added comment: Three unrelated individuals reported with de novo LoF variants; in addition, another individual with translocation disrupting gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.953 | PHIP |
Zornitza Stark gene: PHIP was added gene: PHIP was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: PHIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHIP were set to 29209020; 27900362; 23033978 Phenotypes for gene: PHIP were set to Chung-Jansen syndrome, MIM#617991 Review for gene: PHIP was set to GREEN Added comment: Recent large case series describing 20 individuals; variable expressivity, some inherited from mildly affected parents, most de novo. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.933 | OXR1 |
Zornitza Stark gene: OXR1 was added gene: OXR1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: OXR1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OXR1 were set to 31785787 Phenotypes for gene: OXR1 were set to Intellectual disability; seizures; cerebellar atrophy Review for gene: OXR1 was set to GREEN Added comment: Five individuals from three families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.931 | TMX2 |
Zornitza Stark gene: TMX2 was added gene: TMX2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: TMX2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMX2 were set to 31735293; 31586943 Phenotypes for gene: TMX2 were set to Microcephaly; ID; brain malformations Review for gene: TMX2 was set to GREEN Added comment: 14 individuals from 10 unrelated families with bi-allelic variants in this gene (31735293) and another four families with recurrent variant (31586943). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.926 | PCYT2 |
Zornitza Stark gene: PCYT2 was added gene: PCYT2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert Review Mode of inheritance for gene: PCYT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCYT2 were set to 31637422 Phenotypes for gene: PCYT2 were set to Global developmental delay with regression; spastic para- or tetra paresis; epilepsy; progressive cerebral and cerebellar atrophy Review for gene: PCYT2 was set to GREEN Added comment: Five unrelated individuals. Variants are hypomorphic. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.893 | NUP62 | Zornitza Stark Added comment: Comment when marking as ready: Multiple affected individuals, age of onset variable, may be after viral trigger. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.866 | NFIB |
Zornitza Stark gene: NFIB was added gene: NFIB was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: NFIB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NFIB were set to 30388402 Phenotypes for gene: NFIB were set to Macrocephaly, acquired, with impaired intellectual development, MIM#618286 Review for gene: NFIB was set to GREEN Added comment: 18 individuals reported, of whom 11 had deletions of this gene and the rest had SNVs. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.798 | ADRA2B |
Zornitza Stark gene: ADRA2B was added gene: ADRA2B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: ADRA2B was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ADRA2B were set to 24114805; 21937992 Phenotypes for gene: ADRA2B were set to Cortical myoclonus and epilepsy; Intellectual disability Review for gene: ADRA2B was set to RED Added comment: Two families reported but same mutation, ?founder effect. Most affected individuals had normal intellect. Another paper linking to AR intellectual disability but as part of manuscript reporting multiple novel candidates. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.589 | LINGO1 |
Zornitza Stark gene: LINGO1 was added gene: LINGO1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: LINGO1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LINGO1 were set to 28837161 Phenotypes for gene: LINGO1 were set to Mental retardation, autosomal recessive 64, MIM#618103 Review for gene: LINGO1 was set to GREEN Added comment: Five individuals from two unrelated families, no functional evidence. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.575 | KMT5B |
Zornitza Stark gene: KMT5B was added gene: KMT5B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: KMT5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KMT5B were set to 25363768; 28191889; 29276005 Phenotypes for gene: KMT5B were set to Mental retardation, autosomal dominant 51, MIM#617788 Review for gene: KMT5B was set to GREEN Added comment: Multiple affected individuals from unrelated families. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.553 | KDM6B |
Zornitza Stark gene: KDM6B was added gene: KDM6B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: KDM6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KDM6B were set to 31124279 Phenotypes for gene: KDM6B were set to Intellectual disability Review for gene: KDM6B was set to GREEN Added comment: 12 unrelated individuals with de novo variants in this gene, no functional evidence reported but KDM6B involved in histone methylation. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.524 | TRMT1 |
chirag patel edited their review of gene: TRMT1: Added comment: 4 families reported: -1 consanguineous Iranian family with 5 individuals with nonsyndromic moderate to severe impaired intellectual development. -1 consanguineous Iranian family with 3 adult brothers with global developmental delay and moderately delayed intellectual development -2 unrelated Pakistani families with 4 patients with impaired intellectual development. All with homozygous mutations in the TRMT1 gene which segregated with the disorder in the families, but functional studies of the variants were not performed.; Changed publications: PMID: 30289604, 26308914, 21937992 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.491 | IREB2 |
Zornitza Stark gene: IREB2 was added gene: IREB2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Literature Mode of inheritance for gene: IREB2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IREB2 were set to 30915432; 31243445; 11175792 Phenotypes for gene: IREB2 were set to Neurodegeneration, early-onset, with choreoathetoid movements and microcytic anemia, MIM#618451 Review for gene: IREB2 was set to GREEN Added comment: Two affected individuals from unrelated families with functional evidence including concordant phenotype in mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.394 | VPS37A |
chirag patel changed review comment from: ID reported in this type of HSP in 2 families. Zivony-Elboum et al. (2012) reported 9 patients from 2 Arab Moslem families with early-onset spastic paraplegia. Affected individuals showed developmental and motor delay during the first 2 years of life. They had unsteadiness in standing and difficulty walking. All affected children presented with spasticity in the lower limbs that progressed to the upper extremities. All had mild to moderate cognitive and speech delay.; to: ID reported in this type of HSP in 2 families. Zivony-Elboum et al. (2012) reported 9 patients from 2 Arab Moslem families with early-onset spastic paraplegia. Affected individuals showed developmental and motor delay during the first 2 years of life. They had unsteadiness in standing and difficulty walking. All affected children presented with spasticity in the lower limbs that progressed to the upper extremities. All had mild to moderate cognitive and speech delay. Functional studied performed. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.362 | WASF1 | chirag patel edited their review of gene: WASF1: Added comment: 5 unrelated individuals with moderate to profound intellectual disability with autistic features and seizures. Functional studies using fibroblast cells from two affected individuals showed a truncated WASF1 and a defect in actin remodeling.; Changed phenotypes: No OMIM phenotype # yet. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.302 | ZNF41 | chirag patel changed review comment from: Shoichet et al. (2003) described a female patient with severe nonsyndromic mental retardation and a de novo balanced translocation t(X;7)(p11.3;q11.21) in whom they cloned the DNA fragment that contained the X chromosomal and the autosomal breakpoint. In silico sequence analysis demonstrated that the ZNF41 gene was disrupted. Expression studies indicated that ZNF41 transcripts were absent in the patient cell line, suggesting that the mental disorder in this patient resulted from loss of functional ZNF41. Moreover, screening of a panel of patients with MRX led to the identification of 2 other ZNF41 mutations (314995.0001-314995.0002) that were not found in healthy control individuals. Based on their finding of the mutations in ZNF41 identified by Shoichet et al. (2003) in a total of 7 males in the NHLBI Exome Variant Server, and the additional finding of truncating ZNF41 variants in 1 male and 1 female in that database, Piton et al. (2013) classified the involvement of ZNF41 in mental retardation as highly questionable.; to: Shoichet et al. (2003) described a female patient with severe nonsyndromic mental retardation and a de novo balanced translocation t(X;7)(p11.3;q11.21) in whom they cloned the DNA fragment that contained the X chromosomal and the autosomal breakpoint. In silico sequence analysis demonstrated that the ZNF41 gene was disrupted. Expression studies indicated that ZNF41 transcripts were absent in the patient cell line, suggesting that the mental disorder in this patient resulted from loss of functional ZNF41. Screening of patients with mental retardation led to the identification of 2 other ZNF41 mutations that were not found in healthy control individuals. Based on their finding of the mutations in ZNF41 identified by Shoichet et al. (2003) in a total of 7 males in the NHLBI Exome Variant Server, and the additional finding of truncating ZNF41 variants in 1 male and 1 female in that database, Piton et al. (2013) classified the involvement of ZNF41 in mental retardation as highly questionable. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.250 | FUT8 |
Zornitza Stark gene: FUT8 was added gene: FUT8 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: FUT8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FUT8 were set to 29304374 Phenotypes for gene: FUT8 were set to Congenital disorder of glycosylation with defective fucosylation 1, MIM#618005 Review for gene: FUT8 was set to GREEN Added comment: Three unrelated individuals reported with bi-allelic variants in this gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.231 | FDFT1 |
Zornitza Stark gene: FDFT1 was added gene: FDFT1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: FDFT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FDFT1 were set to 29909962 Phenotypes for gene: FDFT1 were set to Squalene synthase deficiency, MIM#618156 Review for gene: FDFT1 was set to GREEN Added comment: Three individuals from two unrelated families reported; metabolic disorder with good level of biochemical evidence to support gene-disease association.. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.195 | EXOSC2 |
Zornitza Stark gene: EXOSC2 was added gene: EXOSC2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: EXOSC2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOSC2 were set to 26843489; 31628467 Phenotypes for gene: EXOSC2 were set to Short stature, hearing loss, retinitis pigmentosa, and distinctive facies, MIM# 617763 Review for gene: EXOSC2 was set to GREEN Added comment: Three individuals from two families, but founder mutation, some functional data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.89 | DDX59 | Zornitza Stark commented on gene: DDX59: Some affected individuals are reported as having ID. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.10 | CHD3 |
Zornitza Stark gene: CHD3 was added gene: CHD3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: CHD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHD3 were set to 30397230 Phenotypes for gene: CHD3 were set to Snijders Blok-Campeau syndrome, MIM#618205 Review for gene: CHD3 was set to GREEN gene: CHD3 was marked as current diagnostic Added comment: 35 individuals from 33 unrelated families reported with heterozygous variants in this gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.9 | CHD1 |
Zornitza Stark gene: CHD1 was added gene: CHD1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Literature Mode of inheritance for gene: CHD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHD1 were set to 28866611 Phenotypes for gene: CHD1 were set to Pilarowski-Bjornsson syndrome, MIM#617682 Review for gene: CHD1 was set to GREEN Added comment: Six unrelated individuals with heterozygous variants reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.0 | ALG14 | Zornitza Stark edited their review of gene: ALG14: Added comment: 5 individuals from unrelated families described in the literature: one with myasthenic syndrome, no report of ID; second with predominantly ID phenotype; and three more with a neurodegenerative phenotype.; Changed rating: GREEN; Changed publications: 30221345, 23404334, 28733338 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.0 | IDUA |
Zornitza Stark gene: IDUA was added gene: IDUA was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: IDUA was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||