Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Intellectual disability syndromic and non-syndromic v1.188 | LONP1 |
Zornitza Stark edited their review of gene: LONP1: Added comment: New reports of autosomal dominant mitochondrial disease due to missense variants at p.Arg301. - PMID: 36353900; Hartley 2023: 1x heterozygous de novo individual with p.(Arg301Gln), with dystonia, hearing loss, seizures. p.(Arg301Gln) has been reported as de novo in a heterozygous individual with dystonia, delayed speech and language development (VCGS/MCRI internal case) - PMID: 31923470; Besse 2020: 1x heterozygous de novo individual with p.(Arg301Trp) with seizures, encephalopathy, pachygyria and microcephaly. - p.(Arg301Trp) has also been reported in a heterozygous individual with recurrent neonatal seizures, suspected mitochondrial disorder, elevated lactate, microcephaly, EEG showing significantly increased seizure susceptibility which was de novo but parentage not tested (ClinVar, personal communication). - p.(Arg301Trp) has also been identified in a heterozygous individual with neonatal intractable epileptic encephalopathy and lactic acidosis. MRI changes in keeping with mitochondrial disorder, a combined Complex I and complex IV defect identified in muscle (but not liver) by RCE (VCGS/MCRI internal case) - p.(Arg301Gly) has been reported de novo in a heterozygous individual with epileptic encephalopathy, microcephaly and dyskinesia (ClinVar, personal communication) LONP1 functions as both a chaperone and an ATP-dependent protease. Functional evidence in Besse shows p.(Arg301Trp) results in loss of chaperone activity but retains proteolytic activity. Expression of WT LONP1 in patient fibroblast cells did not rescue dysfunction (measured via levels of MRPL44, RPL11, PDHE1a, TFAM, PINK1, complex 1 and complex IV) - indicating NOT LoF effect. Overexpression of LONP1 in control fibroblast cells leads to dysfunction (decrease in NDUFB8, COXIV, MRPL44 and TFAM), however, MRPL11, PDHE1a and PINK1 proteins were unchanged compared to controls. Variant p.R721G associated with AR disease showed decreased homo-oligomerisation whilst p.R301W showed increased WT-Mut and WT-WT oligomers. GoF was suggested but no dose-dependent studies so DN cannot be excluded.; Changed publications: 31636596, 36353900 31923470; Changed phenotypes: CODAS syndrome, MIM#600373, mitochondrial disease (MONDO:0044970), LONP1-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.173 | ANKS1B |
Lilian Downie gene: ANKS1B was added gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: ANKS1B. Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKS1B were set to PMID: 31388001; 38129387 Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related Review for gene: ANKS1B was set to GREEN Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model. Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.164 | PTPN1 |
Zornitza Stark gene: PTPN1 was added gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN1 were set to 39986310 Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related Review for gene: PTPN1 was set to GREEN Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.120 | LSM1 |
Sarah Milton changed review comment from: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable.; to: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.115 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.96 | CDKL2 |
Sarah Milton gene: CDKL2 was added gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL2 were set to PMID: 40088891 Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related Penetrance for gene: CDKL2 were set to Complete Mode of pathogenicity for gene: CDKL2 was set to Other Review for gene: CDKL2 was set to AMBER Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion. 2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging. Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5) Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.72 | C14orf80 |
Zornitza Stark gene: C14orf80 was added gene: C14orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: C14orf80. Mode of inheritance for gene: C14orf80 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C14orf80 were set to 39979680; 38252227 Phenotypes for gene: C14orf80 were set to Primary microcephaly, MONDO:0016660 Review for gene: C14orf80 was set to AMBER Added comment: New HGNC approved Gene Name: TEDC1 Only two families reported with biallelic variants in this gene - Reports of a supportive functional assay however rated as Amber given that one of the reported families are consanguineous with hmz missense. PMID: 39979680 - Male sibs from non-consanguineous parents presenting with a range of phenotypes including growth development abnormalities, microcephaly, DD, ID and endocrine insufficiency. The brothers were found to carry chet variants identified in trans [NM_001134877.1 c.[104-5C>G];[787delG] p.[?];[(Ala263LeufsTer29)]. Homozygous zebrafish model recapitulated the human phenotype and is supportive of the loss of function mechanism of disease. PMID: 38252227 - Iranian consanguineous families identified with a rare biallelic missense variant (Gln269Arg). The affected brothers presented with a range of developmental phenotypes including cognitive impairment and microcephaly. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.62 | ARHGEF40 |
Chirag Patel gene: ARHGEF40 was added gene: ARHGEF40 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARHGEF40 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARHGEF40 were set to PMID: 39838643 Phenotypes for gene: ARHGEF40 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: ARHGEF40 was set to RED Added comment: 2 individuals with global developmental delay, hypotonia, short stature, hearing impairment, nystagmus, feeding issues, and dysmorphism (bifid uvula, narrow mouth, high palate, micrognathia). Trio clinical whole exome sequencing identified de novo variants in the ARHGEF40 gene at position p.Arg225, which is fully conserved in mammals and located within the n-terminal keratin binding region (p.Arg225Trp and p.Arg225Gln). Of note, multiple additional probands with rare missense variants at the p.Arg225 residue have been identified by the same laboratory (but there was no consent for publication, providing further evidence of the importance of this residue. The ARHGEF40 gene (aka SOLO) is a member of the Rho guanine nucleotide exchange factor (Rho-GEF) family of proteins, which stimulate Rho signal transduction molecules by converting them from inactive GDP-bound form to the active GTP-bound state. No functional studies to characterise disease-gene relationship or disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v1.59 | HECTD1 |
Chirag Patel gene: HECTD1 was added gene: HECTD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HECTD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HECTD1 were set to PMID: 39879987 Phenotypes for gene: HECTD1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: HECTD1 was set to GREEN Added comment: 14 unrelated individuals (identified through GeneMatcher) with 15 variants of uncertain significance (VUS) in HECTD1 (10 missense, 3 frameshift, 1 nonsense, and 1 splicing variant). Of the 15 different variants in HECTD1, 10 occurred de novo, 3 had unknown inheritance, and 2 were compound heterozygous. All variants were absent in gnomAD, and HECTD1 is highly intolerant to loss-of-function variation (loss-of-function-intolerant score of 1). Clinical presentation was variable developmental delay, intellectual disability, autism spectrum disorder, ADHD, and epilepsy. The one individual with compound heterozygous variants had growth impairment along with NDD. The variants were inherited from apparently healthy parents, suggesting that genetic or environmental modifiers may be required to develop the phenotype. Significant enrichment of de novo variants in HECTD1 was also shown in an independent cohort of 53,305 published trios with NDDs or congenital heart disease. HECT-domain-containing protein 1 (HECTD1) mediates developmental pathways, including cell signalling, gene expression, and embryogenesis. Conditional knockout of Hectd1 in the neural lineage in mice resulted in microcephaly, severe hippocampal malformations, and complete agenesis of the corpus callosum, supporting a role for Hectd1 in embryonic brain development. Functional studies of 2 missense variants and 1 nonsense variant in C. elegans revealed dominant effects, including either change-of-function or loss-of-function/haploinsufficient mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6781 | HOXA1 | Zornitza Stark Phenotypes for gene: HOXA1 were changed from to Bosley-Salih-Alorainy syndrome, MIM#601536 and Athabaskan brainstem dysgenesis syndrome, MIM#601536 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6665 | TSHZ3 |
Bryony Thompson gene: TSHZ3 was added gene: TSHZ3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TSHZ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TSHZ3 were set to 27668656; 34919690; 36553458; 39420202 Phenotypes for gene: TSHZ3 were set to congenital anomaly of kidney and urinary tract MONDO:0019719 Review for gene: TSHZ3 was set to AMBER Added comment: More evidence for the gene-disease association is required PMID: 27668656 - TSHZ3 is included in the region deleted in chromosome 19q13.11 Deletion Syndrome, which includes intellectual disability and behavioural issues, congenital anomalies of the kidney and urinary tract (CAKUT) PMID: 34919690 - haploinsufficient mouse model leads to kidney defects PMID: 36553458 - heterozygous frameshift variant c.119_120dup p.Pro41SerfsTer79 in a case with intellectual disability, behavioural issues, pyelocaliceal dilatation, and mild urethral stenosis. PMID: 39420202 - 12 CAKUT patients from 9/301 (3%) families carried 5 different rare heterozygous TSHZ3 missense variants. However, 1 of the variants (p.Ser58Gly) present in 5 of the families is more common in gnomAD v4.1 than you would expect for a dominant disease including 5 homozygotes (1,408/1,612,114 alleles, 5 hom, AF=0.0008734). The authors state this is not unexpected in a condition, such as CAKUT. However, the different missense variants are inherited from unaffected parents in at least 2/9 families (there was no phenotype information available for an additional 3 parents). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6654 | BHLHE22 |
Zornitza Stark gene: BHLHE22 was added gene: BHLHE22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BHLHE22 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: BHLHE22 were set to 39502664 Phenotypes for gene: BHLHE22 were set to Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related Review for gene: BHLHE22 was set to GREEN Added comment: Four individuals with de novo missense variants within the highly conserved helix-loop-helix domain and seven individuals from five unrelated families with a recurrent homozygous frameshift variant, p.(Gly74Alafs*18). Individuals presented with absent or limited speech, severely impaired motor abilities, intellectual disability (ID), involuntary movements, autistic traits with stereotypies, abnormal muscle tone. The majority of individuals had partial or complete agenesis of the corpus callosum (ACC). Additional symptoms comprised epilepsy, variable dysmorphic features, and eye anomalies. One additional individual had spastic paraplegia without delayed development and ACC, expanding the phenotype to milder and later onset forms. Mice lacking bhlhe22 show nearly complete loss of three brain comminsure, including the corpus callosum. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6652 | MRPL49 |
Zornitza Stark gene: MRPL49 was added gene: MRPL49 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRPL49 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MRPL49 were set to 39417135 Phenotypes for gene: MRPL49 were set to Mitochondrial disease, MONDO:0044970, MRPL49-related Review for gene: MRPL49 was set to GREEN Added comment: Five unrelated families with presentations ranging from Perrault syndrome (primary ovarian insufficiency and sensorineural hearing loss) to severe childhood onset of leukodystrophy, learning disability, microcephaly and retinal dystrophy and bi-allelic variants in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6628 | MARK2 |
Chirag Patel gene: MARK2 was added gene: MARK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MARK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MARK2 were set to PMID: 39419027, 39436150 Phenotypes for gene: MARK2 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: MARK2 was set to GREEN Added comment: 31 individuals with autism spectrum disorder (30/31), intellectual disability/developmental delay (100%), motor delay (62%), speech-language problems (100%), seizure/epilepsy (46%), behaviour disorders (ADHD, aggression, anxiety)(74%), and distinctive facial features (narrow face, abnormal or broad forehead, downslanting palpebral fissures, and large or dysplastic ears). WES/WGS identified 25 LOF and 6 missense variants in MARK2 gene (Microtubule affinity-regulating kinase 2) which contributes to establishing neuronal polarity and developing dendritic spines. LOF variants were de novo (16/25), inherited (4/25), or unk (5/25). All 6 missense variants were de novo and clustered in the kinase or KA1 domains. The mRNA and protein expression of MARK2 in PBMCs were significantly lower in affected individuals with LOF variants than in the control group. In vitro expression assay of missense variants supported the effect of MARK2 loss. Proband-derived and CRISPR-engineered isogenic induced pluripotent stem cells (iPSCs) showed MARK2 loss leads to early neuronal developmental and functional deficits, including anomalous polarity and disorganization in neural rosettes, as well as imbalanced proliferation and differentiation in neural progenitor cells (NPCs). Mark2+/- mice showed abnormal cortical formation and partition and ASD-like behaviour. Through the use of RNA sequencing (RNA-seq) and lithium treatment, they linked MARK2 loss to downregulation of the WNT/β-catenin signaling pathway and identified lithium as a potential drug for treating MARK2-associated ASD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6626 | LINC01578 |
Zornitza Stark gene: LINC01578 was added gene: LINC01578 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: LINC01578. Mode of inheritance for gene: LINC01578 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LINC01578 were set to 39442041 Phenotypes for gene: LINC01578 were set to Neurodevelopmental disorder, MONDO:0700092, CHASERR-related Review for gene: LINC01578 was set to GREEN Added comment: CHASERR encodes a human long noncoding RNA (lncRNA) adjacent to CHD2, a coding gene in which de novo loss-of-function variants cause developmental and epileptic encephalopathy. Three unrelated children reported with a syndromic, early-onset neurodevelopmental disorder, each of whom had a de novo deletion in the CHASERR locus. The children had severe encephalopathy, shared facial dysmorphisms, cortical atrophy, and cerebral hypomyelination - a phenotype that is distinct from the phenotypes of patients with CHD2 haploinsufficiency. CHASERR deletion results in increased CHD2 protein abundance in patient-derived cell lines and increased expression of the CHD2 transcript in cis, indicating bidirectional dosage sensitivity in human disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6620 | KCNJ11 | Zornitza Stark Phenotypes for gene: KCNJ11 were changed from to {Diabetes mellitus, type 2, susceptibility to} 125853; Diabetes mellitus, transient neonatal, 3 610582; Diabetes, permanent neonatal, with or without neurologic features 606176; Hyperinsulinemic hypoglycemia, familial, 2 601820; Maturity-onset diabetes of the young, type 13 616329 AD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6548 | DHRSX |
Zornitza Stark gene: DHRSX was added gene: DHRSX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DHRSX was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DHRSX were set to 38821050 Phenotypes for gene: DHRSX were set to congenital disorder of glycosylation, MONDO:0015286, DHRSX-related Added comment: PMID:38821050 reported the identification of biallelic missense variants in DHRSX gene in four patients from three unrelated families with a congenital disorder of glycosylation. They displayed distinct facial features, severe neurological involvement including hypotonia, scoliosis, contractures, profound intellectual disability, epilepsy, and sensorineural hearing loss. These patients also experienced severe failure to thrive (requiring tube feeding); variable respiratory insufficiency; and involvement of the eyes, the gastrointestinal system, and other organs. Gene located in PAR. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6497 | SLC12A5 |
Zornitza Stark changed review comment from: Note LIMITED by ClinGen. However, note functional evidence including mouse model. Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship.; to: LIMITED by ClinGen. However, note functional evidence including mouse model and additional family in 38660387, again with supportive functional data. Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6306 | SGPL1 | Ain Roesley Phenotypes for gene: SGPL1 were changed from Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575) to Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6305 | SGPL1 | Ain Roesley Phenotypes for gene: SGPL1 were changed from Sphingosine Phosphate Lyase Insufficiency Syndrome; Nephrotic syndrome, type 14, MIM#617575 to Sphingosine Phosphate Lyase Insufficiency Syndrome; RENI syndrome (MIM#617575) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6232 | EP300 | Bryony Thompson Phenotypes for gene: EP300 were changed from to Rubinstein-Taybi syndrome MONDO:0019188 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | EP300 |
Ken Lee Wan changed review comment from: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature, and intellectual disability (https://search.clinicalgenome.org/CCID:004751). Mechanism of disease: loss of function; to: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature and intellectual disability (https://search.clinicalgenome.org/CCID:004751). Mechanism of disease: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6222 | EP300 | Ken Lee Wan reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Rubinstein-Taybi syndrome MONDO:0019188; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6214 | DNMT3B |
Ken Lee Wan changed review comment from: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692). Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860). Mechanism of disease: loss of function; to: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692). Immunodeficiency, centromeric instability and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9 and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860). Mechanism of disease: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6209 | DNMT3B | Zornitza Stark Phenotypes for gene: DNMT3B were changed from to immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6207 | DNMT3B | Ken Lee Wan reviewed gene: DNMT3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6195 | CEP76 |
Mark Cleghorn gene: CEP76 was added gene: CEP76 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038; Joubert syndrome; Bardet-Biedl syndrome; retinitis pigmentosa Penetrance for gene: CEP76 were set to unknown Review for gene: CEP76 was set to GREEN Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago ESHG presentation 4/6/24, unpublished CEP76 associated with syndromic ciliopathy CEP76 localizes to centrioles and basal body primary cilia Role in normal centriolar duplication Index case Bardet Biedl syndrome Compound heterozygous pLoF variants in CEP76 Via Gene matcher 7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum: Obesity Ocular phenotype Structural brain anomalies Renal? 3/7 families clinical Dx Joubert syndrome 1/7 BBS 1/7 GDD/ID NOS 2/7 retinitis pigmentosa (1 of these with learning difficulties) Mixture of biallelic pLOF and missense variant CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | MED16 |
Mark Cleghorn gene: MED16 was added gene: MED16 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED16 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: MED16 were set to unknown Review for gene: MED16 was set to GREEN Added comment: MED16 Charlotte Guillouet, Imagine institute Paris ESHG presentation 4/6/24, unpublished MED16 is part of tail of ‘mediator complex’ Plays a role in enhancer/promotor regions Disruptive variants in other genes encoding proteins within this mediator complex (MED11/12/12/17/20, CDK8) are assoc w neurodevelopmental/neurodegenerative disorders Cases index family Sibs (M/F) to consanguineous parents w NDD/mod ID, tetralogy of Fallot or VSD, bilat deafness, micrognathia, malar hypoplasia, dental AbN, pre auricular tags, hypoplastic nails, brachydactly WES: biallelic MED16 p.Asp217Asn Via genematcher 16 families total, 22 individuals, homozygous or compound het rare MED16 variants Mixture of pLoF and missense variants Motor delay in 16/17 DD or ID in 17/17 Speech delay in 15/15 6/19 ToF 7/19 other septal/aortic defects 6/18 deafness 11/18 microretognathia 6/17 cleft palate 8/19 preauricular tags 9/20 puffy eyelids 12/20 nasal dysplasia (most commonly short columella w bulbous nasal tip) 7/20 corpus callosum anomalies Not clear that functional work recapitulated phenotype as yet? Immunofluroescence on HeLa cells transfected with variants observed ?conclusion MED16 knockout mouse > growth delay, pre weaning lethality MED16 knockout zebrafish > reduced body length, early death, no obvious craniofacial phenotype Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6188 | SLC6A3 | Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6185 | SLC6A3 | Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6134 | GPN2 |
Mark Cleghorn gene: GPN2 was added gene: GPN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: GPN2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPN2 were set to complex neurodevelopmental disorder MONDO:0100038; Perrault syndrome Review for gene: GPN2 was set to AMBER Added comment: GPN2 ESHG talk 2/6/24, unpublished Thomas Smith, University of Manchester Biallelic GPN2 proposed to cause Perrault syndrome (SNHL, ovarian dysfunction, NDD) RNA polymerase assembly factor 4 families (14 affected individuals) w biallalic GPN2 rare missense variants Segregated w phenotype Fam 2 and 3 may be distantly related (leaving 3 distinct kindreds) Clinical features 13/14 SNHL 3/4 families all females of adolescent age or older had primary ovarian insufficiency 4/4 GDD, ataxia (no data on family w 10 affected indiv.) Some functional work, not conclusive Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6134 | ATP6V1C1 |
Zornitza Stark gene: ATP6V1C1 was added gene: ATP6V1C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP6V1C1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V1C1 were set to 39210597 Phenotypes for gene: ATP6V1C1 were set to neurodevelopmental disorder MONDO:0700092, ATP6V1C1-related Review for gene: ATP6V1C1 was set to RED Added comment: 1x de novo missense p.Glu289Lys (absent in v4 gnomad). Manual inspection of IGV found the dad was mosaic 7% VAF and he shared some of the clinical features (minor digit anomalies). Some functional studies using patient fibroblasts were performed, demonstrating similar effects as known pathogenic variants in ATP6V1B2. - lysosomal morphology - autophagic flux dysregulation - increased acidification of lysosome borderline red/amber Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6127 | RFC4 |
Chirag Patel gene: RFC4 was added gene: RFC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RFC4 were set to PMID: 39106866 Phenotypes for gene: RFC4 were set to RFC4-related multisystem disorder Review for gene: RFC4 was set to GREEN gene: RFC4 was marked as current diagnostic Added comment: 9 affected individuals (aged birth to 47yrs) from 8 unrelated families with a multisystem disorder. Clinical features included: muscle weakness/myopathy (9/9), motor incoordination/gait disturbance (8/8), delayed gross motor development (6/9), dysarthria (5/5), peripheral neuropathy (3/3 adults), bilateral sensorineural hearing impairment (6/9), decreased body weight (8/9), short stature (5/9), microcephaly (4/9), respiratory issues/insufficiency (6/9), cerebellar atrophy (4/9), pituitary hypoplasia (3/9). WES or WGS identified biallelic loss-of-function variants in RFC4 (3 frameshift, 2 splice site, 1 single AA duplication, 2 single AA deletions, 2 missense), and almost all are likely to disrupt the C-terminal domain indispensable for Replication factor C (RFC) complex formation. All variants segregated with the disease. The RFC complex (with 5 subunits) is central to process of regulation of DNA replication, and it loads proliferating cell nuclear antigen onto DNA to facilitate the recruitment of replication and repair proteins and enhance DNA polymerase processivity. RFC1 is associated with CANVAS but the contributions of RFC2-5 subunits on human Mendelian disorders is unknown. Analysis of a previously determined cryo-EM structure of RFC bound to proliferating cell nuclear antigen suggested that the variants disrupt interactions within RFC4 and/or destabilize the RFC complex. Cellular studies using RFC4-deficient HeLa cells and primary fibroblasts demonstrated decreased RFC4 protein, compromised stability of the other RFC complex subunits, and perturbed RFC complex formation. Additionally, functional studies of the RFC4 variants affirmed diminished RFC complex formation, and cell cycle studies suggested perturbation of DNA replication and cell cycle progression. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6126 | LARP1 |
Sangavi Sivagnanasundram gene: LARP1 was added gene: LARP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: LARP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LARP1 were set to 39182167 Phenotypes for gene: LARP1 were set to Neurodevelopmental disorder; MONDO:0700092 Review for gene: LARP1 was set to GREEN Added comment: Seven unrelated probands (6 males and 1 female) with ASD or another variable NDD phenotype (ID, hypotonia, motor delay and/or ASD). Variants were showed to be de novo null variants or missense variants that resulted in haploinsufficiency. Ex vivo (knockout CRISPR-Cas9) functional assay using lymphoblasts that was collected and immortilised from one proband was conducted to assess the functional impact of the LARP1 variant. The results showed a reduction in protein compared to WT causing reduced rates of aerobic respiration and glycolysis Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6123 | TTL |
Mark Cleghorn gene: TTL was added gene: TTL was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: TTL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTL were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: TTL was set to AMBER Added comment: TTL Valentina Serpieri, University of Pavia ESHG talk 1/6/24 FAM1 (Italy) 2 affected sisters born to consanguineous Pakistani parents GDD, spastic tetraparesis, optic atrophy, brain anomalies resembling tubulinopathies (dysplasia of corpus callosum, basal ganglia, brainstem) WES: homozygous TTL:c.1013G>A; p.Cys338Tyr in both affected sisters Via genematcher 5 more families (9 individuals) w similar phenotypes and biallelic variants in TTL FAM2 (Egypt): homozygous p.Arg46Pro FAM3 (Egypt): homozygous p.Arg46Pro FAM4 (Australia): homozygous p.Gln183Arg FAM5 (France): homozygous p.Trp147* FAM6 (Saudi Arabia): homozygous p.His243Tyr TTL KO mice: death soon after birth, no overt malformations, but defects in organisation of cerebral layers Functional work on patient fibroblasts FAM1 – reduced quantity of TTL protein compared to control on Western blot, decreased function of TTL protein (increase in detyrosinated tubulin) compared to controls – infer LoF as mechanism FAM3 – mentioned but no details FAM4– mentioned but no details Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6121 | CSMD1 |
Krithika Murali gene: CSMD1 was added gene: CSMD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD1 were set to PMID 38816421 Phenotypes for gene: CSMD1 were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: CSMD1 was set to GREEN Added comment: PMID 38816421 Werren et al 2024 report 8 individuals from 6 families with biallelic missense CSMD1 variants identified through exome sequencing and subsequent gene-sharing efforts. Shared phenotypic features included: GDD, ID, microcephaly and polymicrogyria. Other features included dysmorphism, IUGR, hypotonia, arthrogryposis, seizures, opthalmological anomalies and other brain white matter anomalies Heterozygous parents were unaffected. Loss of function is the postulated mechanism based on experimental data involving early-stage forebrain organoids differentiated from CSMD1 knockout human embryonic stem cells. ClinGen haploinsufficiency score of 1, however, this curation was last reviewed in 2018. This gene is within the scope of review for the ClinGen Autisim and ID GCEP. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6051 | PSMF1 |
Zornitza Stark gene: PSMF1 was added gene: PSMF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMF1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSMF1 were set to https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 Phenotypes for gene: PSMF1 were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related Review for gene: PSMF1 was set to GREEN Added comment: 22 individuals from 15 families reported with a range of neurological phenotypes ranging from early-onset Parkinson's disease; childhood conditions typified by ID and a range of movement disorders; through to perinatal lethal presentations with arthrogryposis multiplex. Genotype-phenotype correlation: biallelic missense variants resulted in the milder phenotypes, while bi-allelic LoF variants in the more severe phenotypes. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.6033 | SLC6A1 | Zornitza Stark edited their review of gene: SLC6A1: Added comment: Haploinsufficiency established as the mechanism.; Changed publications: 29315614, 38781976 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5881 | SOX10 | David Fairbairn changed review comment from: Main mutation mechanism: truncated proteins, potent dominant-negative activity and more severe phenotype only when escapes NMD. Decipher: SOX 10 copy number losses and gains associated with intellectual disability. PCWH Gene2Phenotype: monoallelic-altered gene product structure, DD definitive. Waardenburg syndrome, type 2E Gene2Phenotype: monoallelic-absent gene product, DD definitive. GenCC definitive. OMIM #609136: dominant-negative heterozygous SOX 10 variants in multiple (>3) unrelated cases resulting in neurologic features.; to: Main mutation mechanism: truncated proteins, potent dominant-negative activity and more severe phenotype only when escapes NMD. Decipher: SOX 10 copy number losses and gains associated with intellectual disability. PCWH Gene2Phenotype: monoallelic-altered gene product structure, DD definitive. Waardenburg syndrome, type 2E Gene2Phenotype: monoallelic-absent gene product, DD definitive. GenCC definitive. OMIM #609136: dominant-negative heterozygous SOX 10 variants in multiple (>3) unrelated cases resulting in neurologic features. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5768 | PURA | Ain Roesley Phenotypes for gene: PURA were changed from Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) to Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5768 | PURA | Ain Roesley Phenotypes for gene: PURA were changed from Mental retardation, autosomal dominant 31, MIM# 616158 to Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5746 | DOCK4 |
Sangavi Sivagnanasundram changed review comment from: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).; to: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Two of the individuals are reportedly compound heterozygous. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5746 | DOCK4 |
Sangavi Sivagnanasundram changed review comment from: Well-established gene-disease association 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).; to: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5722 | PTRHD1 | Zornitza Stark Phenotypes for gene: PTRHD1 were changed from Parkinsonism; Intellectual disability to Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5721 | PTRHD1 | Zornitza Stark edited their review of gene: PTRHD1: Changed phenotypes: Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5666 | PPFIA3 |
Zornitza Stark gene: PPFIA3 was added gene: PPFIA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPFIA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPFIA3 were set to 37034625 Phenotypes for gene: PPFIA3 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA3-related Review for gene: PPFIA3 was set to GREEN Added comment: 19 individuals with mono-allelic variants presenting with features including developmental delay, intellectual disability, hypotonia, micro/macrocephaly, autism, and epilepsy. One individual with compound het variants: insufficient evidence for bi-allelic variants causing disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5628 | PLA2G16 |
Lauren Rogers gene: PLA2G16 was added gene: PLA2G16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLA2G16 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PLA2G16 were set to PMID: 37919452 Phenotypes for gene: PLA2G16 were set to Lipodystrophy (MONDO:0006573) Added comment: 7 patients from 4 unrelated consanguineous families with homozygous loss of function PTC variants. Features: 4/7 metabolic features, 6/7 neurological/skeletal features, 3/7 Psychomotor retardation/intellectual disability, 5/7 demyelinating peripheral neuropathy. Null mouse and patient derived white adipose tissue showed enrichment of arachidonic acid-containing membrane phospholipids and a strong decrease in PPARγ. CRISPR–Cas9-mediated PLAAT3 inactivation in human adipose stem cells induced insulin resistance, altered adipocyte differentiation with decreased lipid droplet formation and reduced the expression of adipogenic and mature adipocyte markers, including PPARγ. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5595 | PTPN4 |
Bryony Thompson changed review comment from: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature; to: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines PMID: 34527963 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5591 | ZFHX3 | Chirag Patel edited their review of gene: ZFHX3: Added comment: 41 patients with protein truncating variants (PTVs) or (partial) deletions of ZFHX3. Presentations included (mild) ID and/or behavioural problems, postnatal growth retardation, feeding difficulties, dysmorphism (rarely cleft palate). Nuclear abundance of ZFHX3 increases during human brain development and neuronal differentiation in neural stem cells and SH-SY5Y cells, ZFHX3 interacts with the chromatin remodelling BRG1/Brm-associated factor complex and the cleavage and polyadenylation complex. ZFHX3 haploinsufficiency associates with a specific DNA methylation profile in leukocyte-derived DNA, and participates in chromatin remodelling and mRNA processing.; Changed rating: GREEN; Changed publications: PMID: 37292950; Changed phenotypes: Neurodevelopmental disorder; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Set current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5531 | TCF4 | Zornitza Stark Phenotypes for gene: TCF4 were changed from to Pitt-Hopkins syndrome MONDO:0012589 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5508 | TCF4 | Kaitlyn Dianna Weldon reviewed gene: TCF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22934316; Phenotypes: Pitt-Hopkins syndrome MONDO:0012589; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5390 | RAB5C |
Rylee Peters changed review comment from: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature; to: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All have mild to severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5387 | RAB5C |
Rylee Peters gene: RAB5C was added gene: RAB5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB5C were set to PMID: 37552066 Phenotypes for gene: RAB5C were set to Neurodevelopmental disorder MONDO:0700092, RAB5C-related Penetrance for gene: RAB5C were set to Complete Review for gene: RAB5C was set to GREEN gene: RAB5C was marked as current diagnostic Added comment: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5333 | HNRNPC |
Zornitza Stark gene: HNRNPC was added gene: HNRNPC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HNRNPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HNRNPC were set to 37541189 Phenotypes for gene: HNRNPC were set to Neurodevelopmental disorder (MONDO:0700092), HNRNPC-related Review for gene: HNRNPC was set to GREEN Added comment: 13 individuals with global developmental delay, intellectual disability, behavioral abnormalities, and subtle facial dysmorphology with heterozygous HNRNPC germline variants. Five had an identical in-frame deletion of nine amino acids in the extreme C terminus. Supportive functional data; haploinsufficiency is the mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5273 | DCAF15 |
Chirag Patel gene: DCAF15 was added gene: DCAF15 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: DCAF15 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DCAF15 were set to Cornelia de Lange syndrome Review for gene: DCAF15 was set to AMBER Added comment: ESHG 2023: 3 unrelated cases with CdLS (1 x TOP with MCA, 1 x death @20mths, 1 x living child) Features suggestive of CdLS - DD, microcephaly, CHD, dysmorphism, visual/hearing impairment. WES identified recurrent de novo variant (p.Ser470Phe) in DCAF15 gene. This mediates ubiquitination and degradation of target proteins, and interacts with cohesin complex members (SMC1/SMC3). Protein analysis from individuals showed increased accumulation of ubiquitination-modified proteins and SM3 (GOF mechanism). EpiSign analysis showed same DNA methylation pattern as other CdLS cases/genes. Zebrafish model showed reduced body length, reduced head size, reduced oligodendrocytes, heart defect, aberrant motor neurons, and abnormal response to visual/auditory stimuli. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5271 | CYHR1 |
Chirag Patel gene: CYHR1 was added gene: CYHR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CYHR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYHR1 were set to Neurodevelopmental disorder and microcephaly Review for gene: CYHR1 was set to AMBER gene: CYHR1 was marked as current diagnostic Added comment: ESHG 2023: 5 individuals from 3 families with biallelic LOF variants in CYHR1 (aka ZTRAF1). Presentation with microcephaly, hypotonia, DD, and ID. Expression studies showed mislocalisation of CYHR1. Mutant fibroblasts showed increased lysosomal markers and upregulated lysosomal proteins, leading to impaired autophagy. Zebrafish KO however did not show a phenotype. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5263 | DENND5B |
Chirag Patel gene: DENND5B was added gene: DENND5B was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: DENND5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DENND5B were set to Neurodevelopmental disorder with white matter anomalies Review for gene: DENND5B was set to GREEN gene: DENND5B was marked as current diagnostic Added comment: ESHG 2023: 7 patients/7 families with de novo DENND5B variants (6 missense, 1 splice) DD/ID (mod/profound)(7/7), white matter anomalies (6/7) hypotonia, epilepsy (3/7) DENND5B acts as: -GEF for activation of RAB proteins which are involved in membrane trafficking and neurotransmitter release -regulator of lipid absorption and homeostasis Functional studies showed loss of expression of DENND5B in fibroblasts, abnormal vesicle trafficking, and impaired lipid uptake and intracellular distribution Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5251 | ERI1 |
Elena Savva gene: ERI1 was added gene: ERI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ERI1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERI1 were set to 37352860 Phenotypes for gene: ERI1 were set to Intellectual disability (MONDO#0001071), ERI1-related Review for gene: ERI1 was set to GREEN Added comment: PMID: 37352860 - 8 individuals from 7 unrelated families - Patients with biallelic missense show a MORE severe spondyloepimetaphyseal dysplasia, syndactyly, brachydactyly/clinodactyly/camptodactyly - Patients with biallelic null/whole gene deletion had mild ID and digit anomalies including brachydactyly/clinodactyly/camptodactyly - Patient chet for a missense and PTC variant has a blended phenotype with short stature, syndactyly, brachydactyly/clinodactyly/camptodactyly, mild ID and failure to thrive - Missense variants were functionally shown to not be able to rescue 5.8S rRNA processing in KO HeLa cells - K/O mice had neonatal lethality with growth defects, brachydactyly. Skeletal-specific K/O had mild platyspondyly, had more in keeping with patients with null variants than missense More severe phenotype hypothesised due to "exonuclease-dead proteins may compete for the target RNA molecules with other exonucleases that have functional redundancy with ERI1, staying bound to those RNA molecules" Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5239 | UNC79 |
Krithika Murali gene: UNC79 was added gene: UNC79 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UNC79 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UNC79 were set to PMID:37183800 Phenotypes for gene: UNC79 were set to Complex neurodevelopmental disorder - MONDO:0100038 Review for gene: UNC79 was set to AMBER Added comment: PMID:37183800 Bayat et al 2023 report 6 unrelated patients with heterozygous NMD-predicted LoF variants in UNC79 - x1 canonical splice site variant, x5 nonsense/frameshift. 5 were confirmed de novo, 1 not identified in mother - father unavailable for testing. All variants absent in gnomAD and v2 pLI score for UNC79 is 1. Patients with UNC79 variants were identified through GeneMatcher or an international network of Epilepsy and Genetics departments. x1 patient underwent duo exome sequencing, remaining had trio exome sequencing - no other causative variants identified. Phenotypic features included: - 4/6 autistic features - 5/6 patients mild-moderate ID - 4/6 behavioural issues (aggression, stereotypies) - 4/6 epilepsy (focal to bilateral tonic-clonic seizures) - 5/6 hypotonia unc79 knockdown drosophila flies exhibited significantly higher rate of seizure-like behaviour than controls. unc79 haploinsufficiency shown to lead to significant reduction in protein levels of both unc79 and unc80 in mouse brains. Unc79 haploinsufficiency associated with deficiency in hippocampal-dependent learning and memory in mice. Authors have reviewed their own evidence in relation to the gene-disease criteria detailed by Strande et al 2017 and note that their clinical and experimental data provides moderate-level evidence supporting the association between UNC79 and a neurodevelopment disorder including ASD. Amber association favoured due to clinical phenotypic range reported between affected individuals and their lack of specificity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5234 | POU3F2 |
Sarah Pantaleo gene: POU3F2 was added gene: POU3F2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POU3F2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: POU3F2 were set to PMID: 37207645 Phenotypes for gene: POU3F2 were set to Autism spectrum disorder, NDD, and adolescent-onset obesity Penetrance for gene: POU3F2 were set to unknown Mode of pathogenicity for gene: POU3F2 was set to Other Review for gene: POU3F2 was set to GREEN Added comment: We associate ultra-rare variants in POU3F2, encoding a central nervous system transcription factor, with syndromic obesity and neurodevelopment delay in 12 individuals. Demonstrate variant pathogenicity through in vitro analysis. Used exome sequencing, GeneMatcher and Genomics England 100,000 Genomes Project rare disease database. Both truncating and missense variants in over 10 individuals sharing autism spectrum disorder, NDD, and adolescent-onset obesity (may have had other features eg. CAKUT in 2 individuals, diabetes in two) . Affected individuals presented with low-to-normal birth weight and infantile feeding difficulties but developed insulin resistance and hyperplasia during childhood. With the exception of an early truncating variant, the variants showed adequate nuclear translocation but overall disturbed DNA-binding ability and promoter activation. Variants absent from population and clinical databases. Almost all constituted putatively non-inherited de novo variants (8/10). Functional studies provide evidence for loss of function in eight and gain of function in one obesity-associated POU3F2 variant. One variant did not impact POU3F2-promoter activation, leaving the possibility for further path-mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5198 | CRIPT |
Karina Sandoval commented on gene: CRIPT: PMID: 37013901 identified 6 individuals with Rothmund-Thomson syndrome characterised by poikiloderma, sparse hair, small stature, skeletal defects, cancer, cataracts, resembling features of premature aging. Two new variants identified and 4 were already published. 5 were hom, 1 was chet, all with different variants. All CRIPT individuals fulfilled the diagnostic criteria for RTS, and additionally had neurodevelopmental delay and seizures. CRIPT-deficient fibroblasts showed an unremarkable mitotic progression and unremarkable number of mitotic errors, c.132del p.(Ala45Glyfs*82), hom c.227G>A, p.(Cys76Tyr), hom c.133_134insGG,p.(Ala45Glyfs*82),hom c.141del p.(Phe47Leufs*84), hom c.8G>A p.(Cys3Tyr), 1,331 bp del exon 1, chet c.7_8del; p.(Cys3Argfs*4), hom |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5158 | CCDC84 |
Lucy Spencer gene: CCDC84 was added gene: CCDC84 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC84 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC84 were set to 34009673 Phenotypes for gene: CCDC84 were set to Mosaic variegated aneuploidy syndrome 4 (MIM#620153) Review for gene: CCDC84 was set to AMBER Added comment: PMID: 34009673- patients with constitutional mosaic aneuploidy were found to have biallelic mutations in CENATAC(CCDC84). 2 adult siblings with mosaic aneuploidies, microcephaly, dev delay, and maculopathy. Both chet for a missense and a splice site deletion- but the paper days these both result in the creation of a novel splice site that leads to frameshifts and loss of the c-terminal 64 amino acids. Gene is shown to be part of a spliceosome. CENATAC depletion or expression of disease mutants resulted in retention of introns in ~100 genes enriched for nucleocytoplasmic transport and cell cycle regulation, and caused chromosome segregation errors. Functional analysis in CENATAC-depleted HeLa cells demonstrated chromosome congression defects and subsequent mitotic arrest, which could be fully rescued by wildtype but not mutant CENATAC. Expression of the MVA-associated mutants exacerbated the phenotype, suggesting that the mutant proteins dominantly repress the function of any residual wildtype protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5079 | ALMS1 | Christa Whelan reviewed gene: ALMS1: Rating: RED; Mode of pathogenicity: None; Publications: MIM # 203800, 27142762, 25846608, 18154657, 25296579, 17146208, 17940554, 22043170, 31889847, 2231654, 8418611, 8181924, 8556827, 9663233, 25864795, 8556827, 11941369.; Phenotypes: Alström Syndrome (multisystemic), characterized by progressive cone-rod dystrophy leading to blindness, sensorineural hearing loss, childhood obesity associated with hyperinsulinemia, and type 2 diabetes mellitus, Dilated cardiomyopathy occurs in approximately 70% of patients during infancy or adolescence, Renal failure, pulmonary, hepatic, and urologic dysfunction are often observed, and systemic fibrosis develops with age MIM# 203800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5079 | AP1S1 |
Gemma O'Farrell changed review comment from: Publications support gene-disease association. AP1S1 associated with MENDIK syndrome of which intellectual disability and global developmental delay are part of the phenotype. Functional data available. OMIM: 603531 AP1S1 variant described in French-Canadian (Quebec) families with MENDIK (founder variant; splice variant, leading to PTC) different AS1P1 variant (insertion) described in Sephardic-Jewish child with mental retardation and a Turkish child with intellectual disability and MENDIK.; to: Publications support gene-disease association. AP1S1 associated with MENDIK syndrome of which intellectual disability and global developmental delay are part of the phenotype. Functional data available. OMIM: 603531 AP1S1 variant described in French-Canadian (Quebec) families with MENDIK (founder variant; splice variant, leading to PTC) different AS1P1 variant (insertion) described in Sephardic-Jewish child with mental retardation and a Turkish child with intellectual disability and MENDIK. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4987 | HECW2 |
Zornitza Stark changed review comment from: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease) PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease. PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head.; to: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease) PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease. PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head. Association with bi-allelic variants is AMBER. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4987 | HECW2 |
Zornitza Stark edited their review of gene: HECW2: Added comment: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease) PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease. PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head.; Changed publications: 29807643, 29395664, 27334371, 27389779, 35753050, 35487419; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4939 | PTPA |
Konstantinos Varvagiannis changed review comment from: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature; to: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp UK or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4939 | PTPA |
Konstantinos Varvagiannis gene: PTPA was added gene: PTPA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTPA were set to 36073231 Phenotypes for gene: PTPA were set to Intellectual disability; Parkinsonism Penetrance for gene: PTPA were set to Complete Review for gene: PTPA was set to AMBER Added comment: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4928 | UBAP2L |
Konstantinos Varvagiannis gene: UBAP2L was added gene: UBAP2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBAP2L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: UBAP2L were set to 35977029 Phenotypes for gene: UBAP2L were set to Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system Penetrance for gene: UBAP2L were set to unknown Review for gene: UBAP2L was set to GREEN Added comment: Based on Jia et al (2022 - PMID: 35977029) speech, motor delay as well as ID are observed in individuals harboring de novo pLoF variants in UBAP2L. The gene encodes a regulator of the stress granule (SG) assembly. Extensive evidence is provided on the effect of variants as well as the role of UBAP2L and other genes for components and/or regulation of SG in pathogenesis of NDDs. Among others a Ubap2l htz deletion mouse model (behavioral and cognitive impairment, abnormal cortical development due to impaired SG assembly, etc). Data from 26 previous studies, aggregating 40,853 probands with NDDs (mostly DD/ID, also ASD) suggest enrichment for DNMs in UBAP2L or other genes previously known and further shown to be important for SG formation (incl. G3BP1/G3BP2, CAPRIN1). Details provided below. Not associated with any phenotype in OMIM, G2P or SysNDD. -------- Jia et al (2022 - PMID: 35977029) describe 12 affected individuals with heterozygous de novo pLoF variants in UBAP2L. Phenotype: Features included hypotonia, speech (11/11) and motor delay (8/12), ID (8/10 with formal evaluation), variable behavioral concerns (ADHD 5/11, ASD in 4/10, etc). Seizures were reported in 7/12 with 3/10 having a formal diagnosis of epilepsy. Few had microcephaly (3/10). Facial dysmorphisms were common (9/9) and included abnormal palpebral fissures, deep prominent concha, high broad forehead, hypertelorism, thin upper lip and mild synophrys (each in 4 or less individuals). Short stature or skeletal alterations were described in some (4/10 each). Role of the gene: UBAP2L encodes an essential regulator of stress granule assembly. Stress granules are membraneless cytoplasmic compartments in eukaryotic cells, induced upon a variety of stressors and playing a role in regulation of gene expression. Variants identified : 9 nonsense/frameshift UBAP2L variants and 3 splicing ones were reported, in all cases as de novo events, upon trio/quad exome sequencing. All were absent from gnomAD. There were no other causative variants. Variant effect/studies (NM_014847.4 / NP_055662.3) : - Minigene assays revealed that the 3 splice variants all resulted in out-of-frame exon skipping. - In patient fibroblasts one of these splice variants was demonstrated to result to reduced protein levels. - 8 of the 9 nonsense/frameshift variants were predicted to result to NMD. - 1 nonsense variant (c.88C>T/p.Q30*) was shown to result to decreased protein expression in patient fibroblasts, with detection of the protein using an antibody for the C terminus but not the N terminus. Protein N-terminal sequencing confirmed that the protein lacked the N terminus, with utilization of an alternative start site (11 codons downstream). - Generation of HeLa UBAP2L KO cell lines resulted in significant reduction of SG numbers which was also the case for 4 variants studied, under stress conditions. - The protein has a DUF domain (aa 495-526) known to mediate interaction of UBAP2L with G3BP1 (a stress granule marker) with deletions of this domain leading to shuttling of UBAP2L from the cytoplasm to the nucleus. Truncating variants upstream of the DUF domain were shown to result in nuclear localization. Mouse model : - The authors generated Ubap2l KO model with hmz deletion of Ubap2l resulting in a lethal phenotype (2.6% survived) and htz deletion leading to behavioral issues (low preference for social novelty, anxious-like behaviors) and cognitive impairment. - Ubap2l haploinsufficiency resulted in abnormal cortical development and lamination with reduction of neural progenitor proliferation. - Ubap2l deficiency was shown to impair SG assembly during cortical development both under physiological stress conditions or upon utilization of an oxidative stress inducer. Additional evidence of UBAP2L and SG overall in pathogenesis of NDDs: - Based on DNMs from 40,853 individuals with NDDs from 26 studies (9,228 with ASD, 31,625 with DD/ID) the authors demonstrate significant excess of DNM in 31 genes encoding SG components, regulators or both, the latter being the case for UBAP2L and 2 further genes (G3BP1 and G3BP2 - both with crucial roles in SG assembly). - Excess dn splice-site (N=3) and missense (N=5) variants in G3BP1 were observed in the above cohort [c.95+1G>A, c.353+1G>T, c.539+1G>A / p.S208C, R320C, V366M]. - Excess dn missense (N=7) variants in G3BP2 were observed in the above cohort [p.R13W, D151N, E158K, L209P, E399D, K408E, R438C]. - Generation of G3BP1 or G3BP2 KO HeLa cell lines and immunofluorescence upon use of oxidative stress inducer revealed significant reduction of stress granules. - Generation of HeLa cell lines for 5 G3BP1 mutants (R78C*, R132I*, S208C*, R320C*, V366M) and 7 G3BP2 mutants (p.R13W*, D151N*, E158K, L209P*, E399D, K408E, R438C) revealed that several (those in asterisk) resulted in significantly fewer SG formation under oxidative stress compared to WT while the subcellular distribution of the proteins under stress was identical to WT. - Among the identified genes for SG enriched for DNMs, CAPRIN1 was implicated in previous publications as a NDD risk gene with 3 dn missense SNVs reported (p.I373K, p.Q446H, p.L484P). CAPRIN1 binding to G3BP1/2 has been shown to promote SG formation. Significant reduction of SG was observed in CAPRIN1 KO HeLa lines. p.I373K abolished interaction with G3BP1/2 and disrupted SG formation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4924 | SLC31A1 |
Daniel Flanagan gene: SLC31A1 was added gene: SLC31A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: SLC31A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC31A1 were set to PMID: 35913762 Phenotypes for gene: SLC31A1 were set to Neurodevelopmental disorder, SLC31A1-related (MONDO#0700092) Review for gene: SLC31A1 was set to RED Added comment: SLC31A1 is also referred to as CTR1. Monozygotic twins with hypotonia, global developmental delay, seizures, and rapid brain atrophy, consistent with profound central nervous system copper deficiency. Homozygous for a novel missense variant (p.(Arg95His)) in copper transporter CTR1, both parents heterozygous. A mouse knock-out model of CTR1 deficiency resulted in prenatal lethality. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4912 | NOTCH1 |
Chern Lim changed review comment from: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Missense and small inframe insertion variants in the negative regulatory region. Sources: Literature; to: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Other clinical features include intellectual disability, spasticity and etc. Childhood onset in most individuals however 15y and 40y reported in two individuals. - Missense and small inframe insertion variants in the negative regulatory region. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4912 | NOTCH1 |
Chern Lim gene: NOTCH1 was added gene: NOTCH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NOTCH1 were set to 35947102 Phenotypes for gene: NOTCH1 were set to Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related Mode of pathogenicity for gene: NOTCH1 was set to Other Review for gene: NOTCH1 was set to GREEN gene: NOTCH1 was marked as current diagnostic Added comment: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Missense and small inframe insertion variants in the negative regulatory region. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4849 | PABPC1 |
Elena Savva gene: PABPC1 was added gene: PABPC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PABPC1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PABPC1 were set to PMID: 35511136 Phenotypes for gene: PABPC1 were set to Neurodevelopmental disorder, PABPC1-related (MONDO#0700092) Review for gene: PABPC1 was set to GREEN Added comment: PMID: 35511136 - 4 probands with an overlapping phenotype of DD, expressive speech delay, and autistic features and heterozygous de novo variants that cluster in the PABP domain of PABPC1. Electroporation of mouse embryo brains showed that Pabpc1 knockdown decreases the proliferation of neural progenitor cells. Wild-type Pabpc1 could rescue this disturbance, whereas 3 of the 4 variants did not. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4828 | NR4A2 | Zornitza Stark Phenotypes for gene: NR4A2 were changed from Intellectual disability; rolandic epilepsy; autism to Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4776 | ADD1 |
Chirag Patel gene: ADD1 was added gene: ADD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADD1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: ADD1 were set to PMID: 34906466 Phenotypes for gene: ADD1 were set to Intellectual disability, corpus callosum dysgenesis, and ventriculomegaly; no OMIM # Review for gene: ADD1 was set to GREEN Added comment: 4 unrelated individuals affected by ID and/or complete or partial agenesis of corpus callosum, and enlarged lateral ventricles. WES found loss-of-function variants - 1 recessive missense variant and 3 de novo variants. The recessive variant is associated with ACC and enlarged lateral ventricles, and the de novo variants were associated with complete or partial agenesis of corpus callosum, mild ID and attention deficit. Human variants impair ADD1 protein expression and/or dimerization with ADD2. Add1 knockout mice recapitulate corpus callosum dysgenesis and ventriculomegaly phenotypes. Three adducin genes (ADD1, ADD2, and ADD3) encode cytoskeleton proteins that are critical for osmotic rigidity and cell shape. ADD1, ADD2, and ADD3 form heterodimers (ADD1/ADD2, ADD1/ADD3), which further form heterotetramers. Adducins interconnect spectrin and actin filaments to form polygonal scaffolds beneath the cell membranes and form ring-like structures in neuronal axons. Adducins regulate mouse neural development, but their function in the human brain is unknown. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4717 | LINS1 | Alison Yeung Phenotypes for gene: LINS1 were changed from Intellectual developmental disorder, autosomal recessive 27, MIM# 614340 to Intellectual developmental disorder, autosomal recessive 27, MIM# 614340 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4716 | LINS1 | Alison Yeung Phenotypes for gene: LINS1 were changed from to Intellectual developmental disorder, autosomal recessive 27, MIM# 614340 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4715 | LINS1 | Alison Yeung Marked gene: LINS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4715 | LINS1 | Alison Yeung Gene: lins1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4715 | LINS1 | Alison Yeung Publications for gene: LINS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4714 | LINS1 | Alison Yeung Mode of inheritance for gene: LINS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4713 | LINS1 | Alison Yeung reviewed gene: LINS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32802957, 34450347, 32499722, 31922598; Phenotypes: ntellectual developmental disorder, autosomal recessive 27, MIM# 614340; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4662 | PIGA | Zornitza Stark edited their review of gene: PIGA: Added comment: PMID 34875027: variants in PIGA causing a neurodevelopment disorder and a juvenile form of hereditary hemochromatosis reported in > three unrelated patients. All patients had increased serum iron, ferritin and transferrin saturation levels, high ALP and low hepcidin. All patients had generalised seizures and intellectual disability. A subpopulation of patient blood cells showed a slight reduction of GPI-anchored proteins, suggesting that the mutations were hypomorphic and retained some residual activity. CRISPR/Cas12a-mediated knockdown of PIGA in Hep3B liver cells eliminated the cell surface expression of GPI-anchored proteins CD59 and hemojuvelin (HJV; 608374), as well as caused decreased expression of hepcidin (606464) compared to controls. These hypomorphic alleles could explain the milder neurologic phenotype, which allowed for sufficiently long survival for the iron overload phenotype to manifest.; Changed publications: 22305531, 24357517, 24706016, 26545172, 33333793, 32694024, 34875027; Changed phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466, Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4631 | NTRK1 | Zornitza Stark Phenotypes for gene: NTRK1 were changed from to Insensitivity to pain, congenital, with anhidrosis - MIM#256800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4624 | NRXN1 | Zornitza Stark Phenotypes for gene: NRXN1 were changed from to Pitt-Hopkins-like syndrome 2 - MIM#614325 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4621 | NTRK1 | Krithika Murali reviewed gene: NTRK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10233776, 19250380, 10861667, 10982191, 20301726, 20089052; Phenotypes: Insensitivity to pain, congenital, with anhidrosis - MIM#256800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4621 | NRXN1 | Krithika Murali reviewed gene: NRXN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25486015, 19896112, 21964664, 30873608, 35101781, 22337556, 22670139; Phenotypes: Pitt-Hopkins-like syndrome 2 - MIM#614325; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4615 | SMS | Zornitza Stark Phenotypes for gene: SMS were changed from to Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583; Syndromic X-linked intellectual disability Snyder type, MONDO:0010664 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4612 | SMS | Zornitza Stark reviewed gene: SMS: Rating: GREEN; Mode of pathogenicity: None; Publications: 30237987, 34177437, 32838743, 23805436; Phenotypes: Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583, Syndromic X-linked intellectual disability Snyder type, MONDO:0010664; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4550 | KIAA1109 | Zornitza Stark Phenotypes for gene: KIAA1109 were changed from Alkuraya-Kucinskas syndrome, MIM# 617822 to Alkuraya-Kucinskas syndrome, MIM# 617822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4550 | KIAA1109 | Zornitza Stark Phenotypes for gene: KIAA1109 were changed from Alkuraya-Kucinskas syndrome, MIM# 617822 to Alkuraya-Kucinskas syndrome, MIM# 617822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4550 | KIAA1109 | Zornitza Stark Phenotypes for gene: KIAA1109 were changed from to Alkuraya-Kucinskas syndrome, MIM# 617822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4547 | KIAA1109 | Zornitza Stark reviewed gene: KIAA1109: Rating: GREEN; Mode of pathogenicity: None; Publications: 29290337, 30906834; Phenotypes: Alkuraya-Kucinskas syndrome, MIM# 617822; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4535 | IRX5 | Zornitza Stark edited their review of gene: IRX5: Added comment: Third family with Hamamy syndrome and homozygous missense variant reported, p.Arg168His. Two cousins, >4 meioses, good segregation data. Intellectual disability.; Changed rating: GREEN; Changed publications: 22581230, 27453922, 34899143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4520 | CPSF3 |
Belinda Chong gene: CPSF3 was added gene: CPSF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CPSF3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CPSF3 were set to 35121750 Phenotypes for gene: CPSF3 were set to Intellectual disability syndrome Review for gene: CPSF3 was set to GREEN gene: CPSF3 was marked as current diagnostic Added comment: Study of a deficit of observed homozygous carriers of missense variants, versus an expected number in a set of 153,054 chip-genotyped Icelanders, to identify potentially pathogenic genotypes Six homozygous carriers of missense variants in CPSF3 show severe intellectual disability, seizures, microcephaly, and abnormal muscle tone. - Four identified through Icelandic geneology (p.Gly468Glu), three carrier couples total of four children who had died prematurely. Tested archival samples for two of these children, and confirm a homozygous genotype. - Two of Mexican descent (p.Ile354Thr), first-degree cousins Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4519 | CRLS1 |
Michelle Torres gene: CRLS1 was added gene: CRLS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CRLS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRLS1 were set to 35147173 Phenotypes for gene: CRLS1 were set to Mitochondrial disease MONDO:0044970 CRLS1-related Added comment: - Three families (4 individuals) with cardiolipin deficiency. - Two families (one consanguineous with 2 affected siblings) with homozygous the p.(Ile109Asn) had infantile progressive encephalopathy, bull’s eye maculopathy, auditory neuropathy, diabetes insipidus, autonomic instability, cardiac defects and early death. - The fourth individual cHet p.(Ala172Asp) and p.(Leu217Phe) presented with chronic encephalopathy with neurodevelopmental regression, congenital nystagmus with decreased vision, sensorineural hearing loss, failure to thrive and acquired microcephaly. - Functional studies on patient cells showed increased levels of the substrate of CRLS1 and impaired mitochondrial morphology and biogenesis Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4494 | PAX5 |
Bryony Thompson gene: PAX5 was added gene: PAX5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PAX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PAX5 were set to 35094443; 31452935; 28263302; 25418537; 8001127; 27626380 Phenotypes for gene: PAX5 were set to neurodevelopmental disorder MONDO:0700092 Review for gene: PAX5 was set to GREEN Added comment: 5 individuals from 4 families with large deletions involving PAX5 and 11 individuals from 9 families with frameshift/stopgain/missense variants and neurodevelopmental phenotypes that included delayed developmental milestones (DD), intellectual disability (ID), and/or ASD. 6 of the variants are de novo. Null mouse have retarded growth and altered patterning of the posterior midbrain. Pax5+/− mice of both sexes are hyperactive and have abnormal auditory brainstem responses. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4484 | SOD1 |
Naomi Baker gene: SOD1 was added gene: SOD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SOD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SOD1 were set to PMID: 31314961; 31332433; 34788402 Phenotypes for gene: SOD1 were set to Spastic tetraplegia and axial hypotonia, progressive, MIM#618598 Review for gene: SOD1 was set to GREEN Added comment: Phenotypes include one individual with axial hypotonia and loss of gross and fine motor function beginning at 6 months of age, after which severe, progressive spastic tetraparesis developed and Babinski’s sign was present in both feet. MRI of brain detected mild frontoparietal atrophy. The second individual had severe and marked by progressive loss of motor abilities from 9 months of age, tetraspasticity with predominance in the lower extremities, mild cerebellar atrophy, and hyperekplexia-like symptoms. Dysmorphic features such as low set, posteriorly rotated ears, and overlapping toes The third individual is an infant with severe global developmental delay, axial hypotonia and limb spasticity. No dysmorphic facial features were noted, but she had a high arched palate, bilateral 5th finger clinodactyly, partial toe syndactyly of the second and third toes, and a single hyperpigmented macule tongue fasciculations, axial hypotonia with limb spasticity (more pronounced in the lower limbs), ankle clonus, and brisk patellar deep tendon reflexes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4482 | MAN2C1 |
Michelle Torres gene: MAN2C1 was added gene: MAN2C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAN2C1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAN2C1 were set to 35045343 Phenotypes for gene: MAN2C1 were set to neurodevelopmental disorder MONDO:0700092 MAN2C1-related Review for gene: MAN2C1 was set to GREEN Added comment: Six individuals from four different families, including two fetuses, exhibiting dysmorphic facial features, congenital anomalies such as tongue hamartoma, variable degrees of intellectual disability, and brain anomalies including polymicrogyria, interhemispheric cysts, hypothalamic hamartoma, callosal anomalies, and hypoplasia of brainstem and cerebellar vermis. Variants include PTC and missense. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4408 | NAA20 |
Chirag Patel gene: NAA20 was added gene: NAA20 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAA20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAA20 were set to PMID: 34230638 Phenotypes for gene: NAA20 were set to Autosomal recessive developmental delay, intellectual disability, and microcephaly Added comment: 2 consanguineous families with 5 affected individuals with developmental delay, intellectual disability, and microcephaly (-2-4SD). Exome and genome sequencing identified 2 different homozygous variants in NAA20 gene (p.Met54Val and p.Ala80Val), and segregated with affected individuals. N-terminal acetyltransferases modify proteins by adding an acetyl moiety to the first amino acid and are vital for protein and cell function. The NatB complex acetylates 20% of the human proteome and is composed of the catalytic subunit NAA20 and the auxiliary subunit NAA25. Both NAA20-M54V and NAA20-A80V were impaired in their capacity to form a NatB complex with NAA25, and in vitro acetylation assays revealed reduced catalytic activities toward different NatB substrates. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4403 | SGPL1 | Seb Lunke Phenotypes for gene: SGPL1 were changed from to Sphingosine Phosphate Lyase Insufficiency Syndrome; Nephrotic syndrome, type 14, MIM#617575 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4401 | SGPL1 | Seb Lunke reviewed gene: SGPL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33074640; Phenotypes: Sphingosine Phosphate Lyase Insufficiency Syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4322 | FOXR2 |
Paul De Fazio changed review comment from: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype. In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation). A mouse knockout has comparable phenotypes, and a severe survival deficit. Rated amber (1 patient, functional evidence, mouse model). Sources: Literature; to: Geme added incorrectly. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4322 | FOXR1 |
Paul De Fazio gene: FOXR1 was added gene: FOXR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FOXR1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FOXR1 were set to 34723967 Phenotypes for gene: FOXR1 were set to Postnatal microcephaly, progressive brain atrophy and global developmental delay Mode of pathogenicity for gene: FOXR1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: FOXR1 was set to AMBER gene: FOXR1 was marked as current diagnostic Added comment: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype. In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation). A mouse knockout has comparable phenotypes, and a severe survival deficit. Rated amber (1 patient, functional evidence, mouse model). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4322 | FOXR2 |
Paul De Fazio gene: FOXR2 was added gene: FOXR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FOXR2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FOXR2 were set to 34723967 Phenotypes for gene: FOXR2 were set to Postnatal microcephaly, progressive brain atrophy and global developmental delay Review for gene: FOXR2 was set to AMBER gene: FOXR2 was marked as current diagnostic Added comment: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype. In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation). A mouse knockout has comparable phenotypes, and a severe survival deficit. Rated amber (1 patient, functional evidence, mouse model). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4214 | ZNHIT3 |
Zornitza Stark gene: ZNHIT3 was added gene: ZNHIT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNHIT3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNHIT3 were set to 28335020; 28335020; 31048081 Phenotypes for gene: ZNHIT3 were set to PEHO syndrome, MIM# 260565 Review for gene: ZNHIT3 was set to GREEN Added comment: PEHO is a severe autosomal recessive neurodevelopmental disorder characterized by extreme cerebellar atrophy due to almost total loss of granule neurons. Affected individuals present in early infancy with hypotonia, profoundly delayed psychomotor development, optic atrophy, progressive atrophy of the cerebellum and brainstem, and dysmyelination. Most patients also develop infantile seizures that are often associated with hypsarrhythmia on EEG, and many have peripheral oedema. More than 20 affected individuals reported of Finnish origin, p.Ser31Leu is a founder variant. One compound het reported and supportive animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4184 | PLXNA1 |
Chirag Patel gene: PLXNA1 was added gene: PLXNA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLXNA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: PLXNA1 were set to PMID: 34054129 Phenotypes for gene: PLXNA1 were set to Neurodevelopmental disorder with cerebral and eye anomalies Review for gene: PLXNA1 was set to GREEN Added comment: Dworschak et al. (2021) via WES reported 10 patients from 7 families with biallelic (n=7) or de novo (n=3) PLXNA1 variants. Shared phenotypic features include global developmental delay (9/10), brain anomalies (6/10), and eye anomalies (7/10). Seizures were predominantly reported in patients with monoallelic variants. Zebrafish studies showed an embryonic role of plxna1a in the development of the central nervous system and the eye. Biallelic variants in the extracellular Plexin-A1 domains lead to impaired dimerization or lack of receptor molecules, whereas monoallelic variants in the intracellular Plexin-A1 domains might impair downstream signaling through a dominant-negative effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4119 | HMGB1 |
Chirag Patel gene: HMGB1 was added gene: HMGB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HMGB1 were set to PMID: 34164801 Phenotypes for gene: HMGB1 were set to Developmental delay and microcephaly, no OMIM # Review for gene: HMGB1 was set to GREEN Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4059 | RNF220 |
Konstantinos Varvagiannis changed review comment from: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Sources: Literature, Other; to: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Consider inclusion in panels for leukodystrophies, childhood onset ataxia, sensorineural hearing loss, corpus callosum anomalies, cardiomyopathies, hepatopathies, etc in all cases with green rating. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4059 | RNF220 |
Konstantinos Varvagiannis gene: RNF220 was added gene: RNF220 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNF220 were set to 33964137; 10881263 Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum Penetrance for gene: RNF220 were set to Complete Review for gene: RNF220 was set to GREEN Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4058 | ARF3 |
Konstantinos Varvagiannis gene: ARF3 was added gene: ARF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ARF3 were set to 34346499 Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system Penetrance for gene: ARF3 were set to unknown Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality. Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu. Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both. ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively. Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons. There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185). In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val). This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia. Evidence to support the effect of each variant include: Arg99Leu: Had identical Golgi localization to that of wt Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF) In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF). In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu) Asp67Val: Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant) Displayed decreased protein stability In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF) In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye. There is no associated phenotype in OMIM, G2P or SysID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4053 | PLXNA2 |
Konstantinos Varvagiannis gene: PLXNA2 was added gene: PLXNA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLXNA2 were set to 34327814 Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology Penetrance for gene: PLXNA2 were set to Incomplete Review for gene: PLXNA2 was set to AMBER Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants. The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members. Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)). Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed). The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed). Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved. Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele. As the authors discuss: *PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration. *Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch. *Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD. *Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus. Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg: - Cyanotic heart disease explaining discordance in cognitive outcome among sibs - Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or - Additional pathogenic variants possibly explaining the CHD in the first subject. There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4052 | HNMT | Zornitza Stark edited their review of gene: HNMT: Added comment: Verhoeven et al. 2020 (PMID: 33310825) report an adult male patient with severe intellectual disability and autism, born to second cousins, with a homozygous nonsense variant (c.88C>T; p.Gln30*). Treatment with antihistaminergic medication and a histamine-restricted diet resulted in significant general improvement, supporting an etiological role for HNMT deficiency. Taskiran et al. 2021 (PMID: 33739554) report an adult male patient with severe intellectual disability, pervasive developmental disorder and ADHD, born to consanguineous parents, with a homozygous nonsense variant (c.100G>T; p.Glu34*).; Changed publications: 26206890, 30744146, 33310825, 33739554 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4051 | VPS50 |
Konstantinos Varvagiannis gene: VPS50 was added gene: VPS50 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS50 were set to 34037727 Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum Penetrance for gene: VPS50 were set to Complete Review for gene: VPS50 was set to AMBER Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants. Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging. Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)). VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor. As discussed by Schneeberger et al (refs provided in text): - VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development. - Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality. Studies performed by Schneeberger et al included: - Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del). - Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels. - Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts. - Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function. As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders". There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes. Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4040 | PIDD1 |
Konstantinos Varvagiannis gene: PIDD1 was added gene: PIDD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010 Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum Penetrance for gene: PIDD1 were set to Complete Review for gene: PIDD1 was set to GREEN Added comment: There is enough evidence to include this gene in the current panel with green rating. Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested. The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families]. Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants. Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder. PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage. There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation. Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants. Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26 Evidence so far provided includes: - Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern. - Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability. - Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp] - Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain. - Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD. Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects. There is currently no associated phenotype in OMIM, PanelApp Australia. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes. Overall the gene appears to be relevant for the epilepsy panel, panels for gyration and/or corpus callosum anomalies etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4033 | UBR1 | Zornitza Stark changed review comment from: >50 unrelated families reported, reviewed in PMID: 24599544. Common clinical features include poor growth, mental retardation, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency.; to: >50 unrelated families reported, reviewed in PMID: 24599544. Common clinical features include poor growth, intellectual disability, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4023 | AP1G1 |
Zornitza Stark changed review comment from: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. Sources: Literature; to: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. GREEN for mono-allelic, AMBER for bi-allelic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4023 | AP1G1 |
Zornitza Stark gene: AP1G1 was added gene: AP1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AP1G1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: AP1G1 were set to 34102099 Phenotypes for gene: AP1G1 were set to Neurodevelopmental disorder (NDD); Intellectual Disability; Epilepsy Review for gene: AP1G1 was set to GREEN Added comment: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4016 | SPTBN1 |
Belinda Chong changed review comment from: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature; to: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures (9/29); behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4015 | SPTBN1 |
Belinda Chong gene: SPTBN1 was added gene: SPTBN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPTBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPTBN1 were set to PMID: 34211179 PMID: 33847457 Phenotypes for gene: SPTBN1 were set to Neurodevelopmental Syndrome Review for gene: SPTBN1 was set to GREEN Added comment: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.4002 | SYNCRIP |
Konstantinos Varvagiannis gene: SYNCRIP was added gene: SYNCRIP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SYNCRIP were set to 34157790; 30504930; 27479843; 23020937 Phenotypes for gene: SYNCRIP were set to Global developmental delay; Intellectual disability; Autism; Myoclonic atonic seizures; Abnormality of nervous system morphology Review for gene: SYNCRIP was set to AMBER Added comment: Semino et al (2021 - PMID: 34157790) provide clinical details on 3 unrelated individuals with de novo SYNCRIP variants and provide a review of 5 additional subjects previously identified within large cohorts in the literature and databases. Features included DD, ID (7/7 for whom this information was available), ASD or autistic features (4/7). MRI abnormalities were observed in 3 (widening of CSF spaces, periventricular nodular heterotopia, prominent lat. ventricles). Epilepsy (myoclonic-astatic epilepsy / Doose syndrome) was reported for 2(/8) individuals. The 3 patients here reported were identified following trio/singleton exome with Sanger confirmation of the variants and their de novo occurrence. Variants are in almost all cases de novo (7/7 for whom this was known) and in 5/8 cases were pLoF, in 2/8 missense SNVs while a case from DECIPHER had a 77.92 kb whole gene deletion not involving other genes with unknown inheritance. Overall the variants reported to date include [NM_006372.5]: 1 - c.858_859del p.(Gly287Leufs*5) 2 - c.854dupA p.(Asn285Lysfs*8) 3 - c.734T>C p.(Leu245Pro) 4 - chr6:85605276-85683190 deletion (GRCh38) 5 - c.629T>C p.(Phe210Ser) 6 - c.1573_1574delinsTT p.(Gln525Leu) 7 - c.1247_1250del p.(Arg416Lysfs*145) 8 - c.1518_1519insC p.(Ala507Argfs*14) [P1-3: this report, P4: DECIPHER 254774, P5-6: Guo et al 2019 - PMID: 30504930, P7: Lelieveld et al 2016 - PMID: 27479843, P8: Rauch et al 2012 - PMID: 23020937 / all other Refs not here reviewed, clinical details summarized by Semino et al in table 1] SYNCRIP (also known as HNRNPQ) encodes synaptotagmin‐binding cytoplasmic RNA‐interacting protein. As the authors note, this RNA-binding protein is involved in multiple pathways associated with neuronal/muscular developmental disorders. Several references are provided for its involvement in regulation of RNA metabolism, among others sequence recognition, pre-mRNA splicing, translation, transport and degradation. Mutations in other RNA-interacting proteins and hnRNP members (e.g. HNRNPU, HNRNPD) are associated with NDD. The missense variant (p.Leu245Pro) is within RRM2 one of the 3 RNA recognition motif (RRM) domains of the protein. These 3 domains, corresponding to the central part of the protein (aa 150-400), are relatively intolerant to variation (based on in silico predictions and/or variation in gnomAD). Leu245 localizes within an RNA binding pocket and in silico modeling suggests alteration of the tertiary structure and RNA-binding capacity of RRM2. There are no additional studies performed. Overall haploinsufficiency appears to be the underlying disease mechanism based on the truncating variants and the gene deletion. [pLI in gnomAD : 1, %HI : 2.48%] Animal models are not discussed. There is no associated phenotype in OMIM. This gene is included in the DD panel of G2P (monoallelic LoF variants / SYNCRIP-related developmental disorder). SysID also lists SYNCRIP within the current primary ID genes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3985 | SUFU |
Zornitza Stark edited their review of gene: SUFU: Added comment: Heterozygous truncating variants in SUFU in 15 subjects from 6 unrelated families of various ethnic backgrounds (familial and de novo cases). Clinical features of early-onset (congenital) ocular ataxia and developmental delay, with some phenotypic variability. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign of Joubert syndrome. Paper reports that condition reported here and SUFU-associated Basal cell nevus syndrome (Gorlin) are likely allelic disorders, as there is currently no convincing evidence for a clinical overlap. Functional studies showed no differences in cilia occurrence, morphology, or localization of ciliary proteins, such as smoothened. However, analysis of expression of HH signaling target genes detected a significant increase in the general signaling activity in COMA patient–derived fibroblasts compared with control cells. We observed higher basal HH signaling activity resulting in increased basal expression levels of GLI1, GLI2, GLI3, and Patched1. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign. Knockout mice with SuFu deficiency demonstrated that SuFu is required for proper midhindbrain patterning and controls cerebellar patterning.; Changed rating: GREEN; Changed publications: 28965847, 33024317; Changed phenotypes: Joubert syndrome 32, MIM#617757, SUFU-related neurodevelopmental syndrome; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3937 | EPHA7 |
Zornitza Stark gene: EPHA7 was added gene: EPHA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: EPHA7. Mode of inheritance for gene: EPHA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPHA7 were set to 34176129 Phenotypes for gene: EPHA7 were set to Intellectual disability Review for gene: EPHA7 was set to AMBER Added comment: Lévy et al (2021 - PMID: 34176129) provide evidence that haploinssuficiency of EPHA7 results in a neurodevelopmental disorder. The authors report on 12 individuals belonging to 9 unrelated families, all harboring with 6q microdeletions spanning EPHA7. Overlapping features included DD (13/13), ID (10/10 - mild in most cases, individuals with larger CNVs/additional variants had more severe phenotype), speech delay and behavioral disorders. Variable other features incl. hypotonia (70%), non specific facial features, eye abnormalities (40%) and cardiac defects (25%). The CNVs ranged from 152 kb to few Mb in size but in 4 subjects (P5-8) were only minimal, involving only EPHA7. 9 out of 12 individuals had inherited the deletion (5 subjects paternal, 4 maternal), in 1 subject (P12) this occured de novo, while for 2 others inheritance was not specified. Most deletions were inherited from an unaffected parent (in 6/7 families), with unclear contribution in a further one. The authors discuss on previous studies suggesting an important role for EphA7 in brain development (modulation of cell-cell adhesion and repulsion, regulation of dendrite morphogenesis in early corticogenesis, role in dendritic spine formation later in development. EphA7 has also been proposed to drive neuronal maturation and synaptic function). Haploinsufficiency for other ephrins or ephrin receptors has been implicated in other NDDs. Overall Lévy et al promote incomplete penetrance and variable expressivity with haploinsufficiency of this gene being a risk factor for NDD. [The gene has also an %HI of 2.76% and a pLI of 1]. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3875 | IFT74 |
Zornitza Stark gene: IFT74 was added gene: IFT74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IFT74 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT74 were set to 27486776; 32144365; 33531668 Phenotypes for gene: IFT74 were set to Bardet-Biedl syndrome 20, MIM# 617119; Joubert syndrome Review for gene: IFT74 was set to GREEN Added comment: Two individuals reported with BBS phenotype. PMID 33531668: Identified IFT74 as a JBTS-associated gene in 3 unrelated families through WES. All the affected individuals carried truncated variants and shared one missense variant (p.Q179E) found only in East Asians. The expression of the human p.Q179E-IFT74 variant displayed compromised rescue effects in zebrafish ift74 morphants. Attenuated ciliogenesis; altered distribution of IFT proteins and ciliary membrane proteins, including ARL13B, INPP5E, and GPR161; and disrupted hedgehog signaling were observed in patient fibroblasts with IFT74 variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3786 | UFSP2 |
Konstantinos Varvagiannis changed review comment from: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature; to: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. **Monoallelic** (correction to previous review) UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3785 | UFSP2 |
Konstantinos Varvagiannis gene: UFSP2 was added gene: UFSP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UFSP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UFSP2 were set to 33473208 Phenotypes for gene: UFSP2 were set to Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus Penetrance for gene: UFSP2 were set to Complete Review for gene: UFSP2 was set to AMBER Added comment: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3761 | AFF3 | Zornitza Stark Phenotypes for gene: AFF3 were changed from to KINSSHIP syndrome, MIM# 619297 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3758 | AFF3 | Zornitza Stark reviewed gene: AFF3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31388108, 33961779; Phenotypes: KINSSHIP syndrome, MIM# 619297; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3753 | TMEM222 |
Konstantinos Varvagiannis gene: TMEM222 was added gene: TMEM222 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM222 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM222 were set to 33824500 Phenotypes for gene: TMEM222 were set to Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality Penetrance for gene: TMEM222 were set to Complete Review for gene: TMEM222 was set to GREEN Added comment: Polla et al (2021 - PMID: 33824500) report 17 individuals from 9 unrelated families, with biallelic TMEM222 pathogenic variants. The phenotype included motor, speech delay and moderate to severe ID (as universal features). Other manifestations included hypotonia (10/15), broad gait (5/12), seizures (7/17 - belonging to 6/9 families), MRI abnormalities (5/8). Variable behavioral abnormalities were observed (aggressive behavior, shy character, stereotypic movements etc). Abnormal OFC was a feature in several with microcephaly in 7 subjects from 4 families (measurements not available for all 17). Nonspecific facial features were reported in 10/17. Rare features incl. body tremors, decreased lower extremity muscle mass or disorder of motor neurons. TMEM222 variants were identified following exome sequencing. Previous investigations incl. metabolic studies, FMR1, chromosomes by standard karyotype or CMA, SMA, CMT1A were reported to be normal (available for some individuals). TMEM222 variants missense and pLoF ones mostly found in homozygosity (7/9 families were consanguineous, compound heterozygosity reported in a single case from the 9 families). Sanger sequencing was used for confirmation of variants, parental carrier state as well as testing of sibs (unaffected sibs tested in 4 families). Few individuals had additional genetic findings in other genes, though classified as VUS (3 families). The gene encodes transmembrane protein 222 (208 residues) which however has unknown function. The protein comprises 3 transmembrane domains and a domain of unknown function. TMEMs are a group of transmembrane proteins spanning membranes with - most commonly - unclear function. The authors measured expression by qPCR mRNA analysis, demonstrating highest fetal and adult brain expression (incl. parietal and occipital cortex). Expression levels from GTEx data also support a role in neurodevelopment. Immunocytochemistry revealed highest levels in mature human iPSC-derived glutaminergic cortical neurons and moderate in immature ones. Additional studies supported that the gene is highly expressed in dendrites and might play a role in postsynaptic vesicles (colocalization with postsynaptic and early endosomal markers). A previous study by Riazuddin et al (2017 - PMID: 27457812) had identified TMEM222 as a candidate gene for ID. This family (PKMR213) however appears to be included as family 2 in the aforementioned publication (same pedigree, variant and phenotype in both articles). In OMIM there is currently no associated phenotype. The gene is listed among the primary ID genes in SysID. Please consider inclusion in the ID panel with green (or amber) rating. This gene may also be included in other panels e.g. for epilepsy, microcephaly, etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3738 | PTPN4 |
Bryony Thompson gene: PTPN4 was added gene: PTPN4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN4 were set to 17953619; 25424712; 30238967; DOI: https://doi.org/10.1016/j.xhgg.2021.100033 Phenotypes for gene: PTPN4 were set to Intellectual disability; developmental delay Review for gene: PTPN4 was set to GREEN Added comment: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3717 | KCNJ6 |
Zornitza Stark changed review comment from: Keppen-Lubinsky syndrome characterised by severely delayed psychomotor development, hypertonia, hyperreflexia, generalized lipodystrophy giving an aged appearance, and distinctive dysmorphic features, including microcephaly, prominent eyes, narrow nasal bridge, and open mouth. Three unrelated individuals reported with de novo variants in this gene (one recurred in 2), mouse model.; to: Keppen-Lubinsky syndrome characterised by severely delayed psychomotor development, hypertonia, hyperreflexia, generalized lipodystrophy giving an aged appearance, and distinctive dysmorphic features, including microcephaly, prominent eyes, narrow nasal bridge, and open mouth. Four unrelated individuals reported with de novo variants in this gene (one recurred in 2), mouse model. One of the individuals did not have lipodystrophy but had a prominent hyperkinetic movement disorder. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3717 | KCNJ6 | Zornitza Stark Phenotypes for gene: KCNJ6 were changed from to Keppen-Lubinsky syndrome, MIM# 614098; MONDO:0013572 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3714 | KCNJ6 | Zornitza Stark reviewed gene: KCNJ6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25620207; Phenotypes: Keppen-Lubinsky syndrome, MIM# 614098, MONDO:0013572; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3509 | KIDINS220 | Zornitza Stark Marked gene: KIDINS220 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3509 | KIDINS220 | Zornitza Stark Gene: kidins220 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3509 | KIDINS220 | Zornitza Stark Phenotypes for gene: KIDINS220 were changed from to Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; MONDO:0015007 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3508 | KIDINS220 | Zornitza Stark Publications for gene: KIDINS220 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3507 | KIDINS220 | Zornitza Stark Mode of inheritance for gene: KIDINS220 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3506 | KIDINS220 | Zornitza Stark reviewed gene: KIDINS220: Rating: GREEN; Mode of pathogenicity: None; Publications: 27005418, 29667355; Phenotypes: Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296, MONDO:0015007; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3440 | CLCN6 | Zornitza Stark Phenotypes for gene: CLCN6 were changed from Developmental delay; neurodegeneration to Neurodegeneration, childhood-onset, hypotonia, respiratory insufficiency and brain imaging abnormalities, MIM# 619173; Developmental delay; neurodegeneration | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3439 | CLCN6 | Zornitza Stark edited their review of gene: CLCN6: Changed phenotypes: Neurodegeneration, childhood-onset, hypotonia, respiratory insufficiency and brain imaging abnormalities, MIM# 619173, Developmental delay, neurodegeneration | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3378 | FGF13 |
Zornitza Stark gene: FGF13 was added gene: FGF13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FGF13 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: FGF13 were set to 33245860 Phenotypes for gene: FGF13 were set to Intellectual disability; epilepsy Mode of pathogenicity for gene: FGF13 was set to Other Review for gene: FGF13 was set to GREEN Added comment: Two sibling pairs and three unrelated males reported who presented in infancy with intractable focal seizures and severe developmental delay. The variants were located in the N-terminal domain of the A isoform of FGF13/FHF2 (FHF2A). The X-linked FHF2 gene (also known as FGF13) has alternative first exons which produce multiple protein isoforms that differ in their N-terminal sequence. The variants were located at highly conserved residues in the FHF2A inactivation particle that competes with the intrinsic fast inactivation mechanism of Nav channels. Functional characterization of mutant FHF2A co-expressed with wild-type Nav1.6 (SCN8A) revealed that mutant FHF2A proteins lost the ability to induce rapid-onset, long-term blockade of the channel while retaining pro-excitatory properties. These gain-of-function effects are likely to increase neuronal excitability consistent with the epileptic potential of FHF2 variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3367 | FBRSL1 |
Elena Savva gene: FBRSL1 was added gene: FBRSL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBRSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FBRSL1 were set to PMID: 32424618 Phenotypes for gene: FBRSL1 were set to Malformation and intellectual disability syndrome Review for gene: FBRSL1 was set to GREEN Added comment: Three children with de novo PTCs that escape NMD, and an overlapping syndromic phenotype with respiratory insufficiency, postnatal growth restriction, microcephaly, global developmental delay and other malformations. 2/3 had heart defects, cleft palate and hearing impairement. Supported by Xenopus oocyte functional studies Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3264 | RAP1B |
Chirag Patel gene: RAP1B was added gene: RAP1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAP1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAP1B were set to PMID: 32627184 Phenotypes for gene: RAP1B were set to RAP1B‐associated phenotype, no OMIM # Review for gene: RAP1B was set to RED Added comment: De novo variants in the RAP1B gene (c.35G>T p.(Gly12Val) and c.178G>C p.(Gly60Arg)) in two unrelated patients with thrombocytopenia, microcephaly, learning difficulties, renal malformations, structural anomalies of the brain and other features (not Kabuki like). RAP1B is a member of the RAS superfamily of small GTPases. There is strong evidence that the p.Gly12Val and p.Gly60Arg variants in the RAP1B gene lead into a dysregulation of the downstream pathway. Both substitutions have been described previously as dominant constitutively active in RAS‐related proteins (gain of function variants). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3257 | CLCN6 |
Zornitza Stark gene: CLCN6 was added gene: CLCN6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLCN6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CLCN6 were set to 33217309 Phenotypes for gene: CLCN6 were set to Developmental delay; neurodegeneration Review for gene: CLCN6 was set to GREEN Added comment: Three unrelated families reported with recurrent GOF de novo c.1658A>G (p.Tyr553Cys) and severe developmental delay with pronounced generalized hypotonia, respiratory insufficiency, and variable neurodegeneration and diffusion restriction in cerebral peduncles, midbrain, and/or brainstem in MRI scans. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3128 | PRKAR1B |
Konstantinos Varvagiannis gene: PRKAR1B was added gene: PRKAR1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRKAR1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PRKAR1B were set to https://doi.org/10.1101/2020.09.10.20190314; 33057194 Phenotypes for gene: PRKAR1B were set to Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Aggressive behavior; Abnormality of movement; Upslanted palpebral fissure Penetrance for gene: PRKAR1B were set to unknown Review for gene: PRKAR1B was set to AMBER Added comment: Please consider inclusion of this gene with amber rating pending publication of the preprint and/or additional evidence. Marbach et al. (2020 - medRxiv : https://doi.org/10.1101/2020.09.10.20190314 - last author : C. Schaaf) report 6 unrelated individuals with heterozygous missense PRKAR1B variants. All presented formal ASD diagnosis (6/6), global developmental delay (6/6) and intellectual disability (all - formal evaluations were lacking though). Additional features included neurologic anomalies (movement disorders : dyspraxia, apraxia, clumsiness in all, with tremor/dystonia or involuntary movements as single occurrences). Three displayed high pain tolerance. Regression in speech was a feature in two. Additional behavior anomalies included ADHD (4-5/6) or aggression (3/6). There was no consistent pattern of malformations, physical anomalies or facial features (with the exception of uplsanted palpebral fissures reported in 4). 3 different missense variants were identified (NM_00116470:c.1003C>T - p.Arg335Trp, c.586G>A - p.Glu196Lys, c.500_501delAAinsTT - p.Gln167Leu) with Arg355Trp being a recurrent one within this cohort (4/6 subjects). A possible splicing effect may apply for the MNV. All variants are absent from gnomAD and the SNVs had CADD scores > 24. In all cases were parental samples were available (5/6), the variant had occurred as a de novo event. Protein kinase A (PKA) is a tetrameric holoenzyme formed by the association of 2 catalytic (C) subunits with a regulatory (R) subunit dimer. Activation of PKA is achieved through binding of 2 cAMP molecules to each R-subunit, and unleashing(/dissociation) of C-subunits to engage substrates. PRKACA/B genes encode the Cα- and Cβ-subunits while the 4 functionally non-redundant regulatory subunits are encoded by PRKAR1A/1B/2A/2B genes. As the authors comment, the RIβ subunit is primarily expressed in brain with higher expression in cortex and hypothalamus. The functional consequences of the variants at cellular level were not studied. Previous studies have demonstrated that downregulation of RIβ in murine hippocampal cultures, reduced phosphorylation of CREB, a transcription factor involved in long-term memory formation. The authors speculate that a similar effect on cAMP/PKA/CREB cascade may mediate the cognitive effects in humans. RIβ deficient mice also display diminished nociceptive pain, similar to the human phenotype. [Several refs provided]. The authors cite the study by Kaplanis et al (2020 - PMID: 33057194), where in a large sample of 31,058 trio exomes of children with developmental disorders, PRKAR1B was among the genes with significant enrichment for de novo missense variants. [The gene has a pLI score of 0.18 in gnomAD / o/e = 0.26 - so pLoF variants may not be deleterious]. Please note that a specific PRKAR1B variant (NM_002735.2:c.149T>G - p.Leu50Arg) has been previous reported to segregate with a late-onset neurodegenerative disorder characterized by dementia and/or parkinsonism within a large pedigree with 12 affected individuals [Wong et al 2014 - PMID: 25414040]. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3127 | MPP5 |
Konstantinos Varvagiannis gene: MPP5 was added gene: MPP5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MPP5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MPP5 were set to 33073849 Phenotypes for gene: MPP5 were set to Global developmental delay; Intellectual disability; Delayed speech and language development; Developmental regression; Behavioral abnormality Penetrance for gene: MPP5 were set to unknown Review for gene: MPP5 was set to GREEN Added comment: Sterling et al (2020 - PMID: 33073849) provide information on the phenotype of 3 individuals with de novo MPP5 variants. Common features included global developmental delay, intellectual disability (3/3 - severe in 2/3), speech delay/regression (the latter in at least 2) and behavioral abnormalities. Variable other features were reported, among others microcephaly (1/3), abnormal vision (1/3 : CVI, retinal dystrophy, nystagmus), brain MRI abnormalities (2/3), late-onset seizures (1/3). These subjects displayed variable and non-specific dysmorphic features. All were investigated by exome sequencing (previous investigations not mentioned). One subject was found to harbor a de novo mosaic (5/25 reads) stopgain variant, further confirmed by Sanger sequencing [NM_022474.4:c.1555C>T - p.(Arg519Ter). The specific variant is reported once in gnomAD (1/251338). Two de novo missense variants were identified in the remaining individuals [c.1289A>G - p.Glu430Gly / c.974A>C - p.His325Pro). All variants had in silico predictions in favor of a deleterious effect (CADD score >24). The authors comment that MPP5 encodes an apical complex protein with asymmetric localization to the apical side of polarized cells. It is expressed in brain, peripheral nervous system and other tissues. MPP5 is a member of the membrane-associated guanylate kinase family of proteins (MAGUK p55 subfamily), determining cell polarity at tight junctions. Previous animal models suggest that complete Mpp5(Pals1) KO in mice leads to near absence of cerebral cortical neurons. Htz KO display reduction in size of cerebral cortex and hippocampus. The gene is expressed in proliferating cell populations of cerebellum and important for establishment cerebellar architecture. Conditional KO of Mpp5(Pals1) in retinal progenitor cells mimics the retinal pathology observed in LCA. [Several refs. provided] The authors studied a heterozygous CNS-specific Mpp5 KO mouse model. These mice presented microcephaly, decreased cerebellar volume and cortical thickness, decreased ependymal cells and Mpp5 at the apical surface of cortical vertrical zone. The proportion of cortical cells undergoing apoptotic cell death was increased. Mice displayed behavioral abnormalities (hyperactivity) and visual deficits, with ERG traces further suggesting retinal blindness. Overall the mouse model was thought to recapitulate the behavioral abnormalities observed in affected subjects as well as individual rare features such as microcephaly and abnormal vision. Haploinsufficiency (rather than a dominant negative effect) is favored as the underlying disease mechanism. This is also in line with a dose dependent effect observed in mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3079 | LMNB1 | Zornitza Stark changed review comment from: Adult-onset neurodegenerative condition, not truly ID.; to: Adult-onset neurodegenerative condition, not truly ID. Associated with CNV of this gene, suggestive of haploinsufficiency. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3078 | LMNB2 |
Konstantinos Varvagiannis changed review comment from: Please consider inclusion of LMNB2 in the ID panel with amber/green rating. Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6). LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event. LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His. LMNB1/2 common phenotypes : All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) appart from one individual, without history of IUGR or postnatally abnormal height (the latter in most). Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2. LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13). LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occured at the age of 6y in 1/6). Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some). Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some). Animal model: Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different. Variant effect : variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments. Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency. [Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed] Sources: Literature; to: Please consider inclusion of LMNB2 in the ID panel with amber/green rating. Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6). LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event. LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His. LMNB1/2 common phenotypes : All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) apart from one individual, without history of IUGR or postnatally abnormal height (the latter in most). Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2. LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13). LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occurred at the age of 6y in 1/6). Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some). Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some). Animal model: Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different. Variant effect : variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments. Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency. [Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed] Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3078 | LMNB2 |
Konstantinos Varvagiannis gene: LMNB2 was added gene: LMNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LMNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LMNB2 were set to 33033404 Phenotypes for gene: LMNB2 were set to Congenital microcephaly; Global developmental delay; Intellectual disability Penetrance for gene: LMNB2 were set to Complete Mode of pathogenicity for gene: LMNB2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: LMNB2 was set to GREEN Added comment: Please consider inclusion of LMNB2 in the ID panel with amber/green rating. Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6). LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event. LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His. LMNB1/2 common phenotypes : All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) appart from one individual, without history of IUGR or postnatally abnormal height (the latter in most). Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2. LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13). LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occured at the age of 6y in 1/6). Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some). Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some). Animal model: Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different. Variant effect : variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments. Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency. [Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed] Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3078 | LMNB1 |
Konstantinos Varvagiannis commented on gene: LMNB1: There is an additional report on LMBN1/2-associated phenotypes supporting green rating of the gene in the current panel. Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6). LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event. LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His. LMNB1/2 common phenotypes : All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) appart from one individual, without history of IUGR or postnatally abnormal height (the latter in most). Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2. LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13). LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occured at the age of 6y in 1/6). Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some). Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some). Animal model: Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different. Variant effect : variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments. Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency. [Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed] -------- |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides produced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration in mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could be ruled out that the de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.3026 | SECISBP2 |
Anna Le Fevre gene: SECISBP2 was added gene: SECISBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SECISBP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SECISBP2 were set to 16228000; 19602558; 21084748; 22247018 Phenotypes for gene: SECISBP2 were set to #609698 THYROID HORMONE METABOLISM, ABNORMAL Penetrance for gene: SECISBP2 were set to unknown Review for gene: SECISBP2 was set to RED Added comment: Multiple families with biallelic loss of function variants have been reported with a disorder of thyroid hormone metabolism involving synthesis of selenoproteins. Features include short stature with delayed bone age, muscle weakness with fatty infiltration of skeletal muscle, azoospermia, and mild developmental delay. Photosensitivity and high frequency SNHL have been reported. Thyroid function tests show elevated FT4 and rT3, low FT3 and normal or mildly elevated TSH. Incomplete loss of SECISBP2 function has been hypothesized to cause a milder phenotype. At least two reports of children with delayed milestones. One report of an affected adult with mild ID. Further reports may clarify if this phenotype typically includes ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2928 | CREBBP | Zornitza Stark Phenotypes for gene: CREBBP were changed from to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2925 | CREBBP | Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2849 | LMBRD2 |
Konstantinos Varvagiannis gene: LMBRD2 was added gene: LMBRD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LMBRD2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LMBRD2 were set to 32820033; https://doi.org/10.1101/797787 Phenotypes for gene: LMBRD2 were set to Global developmental delay; Intellectual disability; Microcephaly; Seizures; Abnormality of nervous system morphology; Abnormality of the eye Penetrance for gene: LMBRD2 were set to unknown Mode of pathogenicity for gene: LMBRD2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: LMBRD2 was set to AMBER Added comment: You may consider inclusion with green (13 individuals with dn missense SNVs overall, overlapping features for 10 with available phenotype / a recurring variant has been identified in 2 different studies) or amber rating (role of the gene not known, no variant studies, animal model probably not available). ► Malhotra et al (2020 - PMID: 32820033) report on 10 unrelated individuals with de novo missense LMBRD2 variants. Features included DD (9/10), ID (6/8 of relevant age), microcephaly (7/10), seizures (5/10 - >=3 different variants), structural brain abnormalities (e.g. thin CC in 6/9), highly variable ocular abnormalities (5/10) and dysmorphic features in some (7/10 - nonspecific). All had variable prior non-diagnostic genetic tests (CMA, gene panel, mendeliome, karyotype). WES/WGS revealed LMBRD2 missense variants, in all cases de novo. A single individual had additional variants with weaker evidence of pathogenicity. 5 unique missense SNVs and 2 recurrent ones (NM_001007527:c.367T>C - p.Trp123Arg / c.1448G>A - p.Arg483His) were identified. These occurred in different exons. Variants were not present in gnomAD and all had several in silico predictions in favor of a deleterious effect. There was phenotypic variability among individuals with the same variant (e.g. seizures in 1/3 and microchephaly in 2/3 of those harboring R483H). The gene has a pLI of 0 (although o/e ranges from 0.23 to 0.55), %HI of 15.13 and z-score of 2.27. The authors presume that haploinsufficiency may not apply, and consider a gain-of-function/dominant-negative effect more likely. As the authors comment LMBRD2 (LMBR1 domain containing 2) encodes a membrane bound protein with poorly described function. It is widely expressed across tissues with notable expression in human brain (also in Drosophila, or Xenopus laevis). It displays high interspecies conservation. It has been suggested (Paek et al - PMID: 28388415) that LMBRD2 is a potential regulator of β2 adrenoreceptor signalling through involvement in GPCR signalling. ► Kaplanis et al (2020 - https://doi.org/10.1101/797787) in a dataset of 31058 parent-offspring trios (WES) previously identified 3 individuals with developmental disorder, harboring c.1448G>A - p.Arg483His. These individuals (1 from the DDD study, and 2 GeneDx patients) appear in Decipher. [ https://decipher.sanger.ac.uk/ddd/research-variant/40e17c78cc9655a6721006fc1e0c98db/overview ]. The preprint by Kaplanis et al is cited by Malhotra et al, with Arg483His reported in 6 patients overall in both studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2835 | MADD | Konstantinos Varvagiannis reviewed gene: MADD: Rating: GREEN; Mode of pathogenicity: None; Publications: 28940097, 29302074, 32761064; Phenotypes: Global developmental delay / Intellectual disability / Seizures, Global developmental delay / Intellectual disability / Seizures / Abnormality of the endocrine system / Exocrine pancreatic insufficiency / Constipation / Diarrhea / Anemia / Thrombocytopenia / Abnormality of the autonomic nervous system; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2833 | FAM50A |
Konstantinos Varvagiannis gene: FAM50A was added gene: FAM50A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FAM50A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: FAM50A were set to 32703943 Phenotypes for gene: FAM50A were set to Mental retardation syndrome, X-linked, Armfield type (MIM #300261) Penetrance for gene: FAM50A were set to unknown Review for gene: FAM50A was set to GREEN Added comment: Lee et al (2020 - PMID: 32703943) provide evidence that Armfield X-Linked intellectual disability syndrome is caused by monoallelic FAM50A pathogenic variants. The current review is based only on this reference. The authors provide clinical details on 6 affected individuals from 5 families. Features included postnatal growth delay, DD and ID (6/6 - also evident for those without formal IQ assesment), seizures (3/6 from 2 families), prominent forehead with presence of other facial features and variable head circumference (5th to >97th %le), ocular anomalies (5/6 - strabismus/nystagmus/Axenfeld-Rieger), cardiac (3/6 - ASD/Fallot) and genitourinary anomalies (3/6). In the first of these families (Armfield et al 1999 - PMID: 10398235), linkage analysis followed by additional studies (Sanger, NGS of 718 genes on chrX, X-exome NGS - several refs provided) allowed the identification of a FAM50A variant. Variants in other families were identified by singleton (1 fam) or trio-ES (3 fam). In affected individuals from 3 families, the variant had occurred de novo. Carrier females in the other families were unaffected (based on pedigrees and/or the original publication). XCI was rather biased in most obligate carrier females from the 1st family (although this ranged from 95:5 to 60:40). Missense variants were reported in all affected subjects incl. Trp206Gly, Asp255Gly, Asp255Asn (dn), Glu254Gly (dn), Arg273Trp (dn) (NM_004699.3). Previous studies have demonstrated that FAM50A has ubiquitous expression in human fetal and adult tissues (incl. brain in fetal ones). Immunostaining suggests a nuclear localization for the protein (NIH/3T3 cells). Comparison of protein levels in LCLs from affected males and controls did not demonstrate significant differences. Protein localization for 3 variants (transfection of COS-7 cells) was shown to be similar to wt. Complementation studies in zebrafish provided evidence that the identified variants confer partial loss of function (rescue of the morpholino phenotype with co-injection of wt but not mt mRNA). The zebrafish ko model seemed to recapitulate the abnormal development of cephalic structures and was indicative of diminished/defective neurogenesis. Transcriptional dysregulation was demonstrated in zebrafish (altered levels and mis-splicing). Upregulation of spliceosome effectors was demonstrated in ko zebrafish. Similarly, mRNA expression and splicing defects were demonstrated in LCLs from affected individuals. FAM50A pulldown followed by mass spectrometry in transfected HEK293T cells demonstrated enrichment of binding proteins involved in RNA processing and co-immunoprecipitation assays (transfected U-87 cells) suggested that FAM50A interacts with spliceosome U5 and C-complex proteins. Overall aberrant spliceosome C-complex function is suggested as the underlying pathogenetic mechanism. Several other neurodevelopmental syndromes are caused by variants in genes encoding C-complex affiliated proteins (incl. EFTUD2, EIF4A3, THOC2, etc.). Please consider inclusion in the ID panel with green rating and epilepsy panel with amber (seizures in individuals from 2 families). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2804 | ZNF407 |
Konstantinos Varvagiannis gene: ZNF407 was added gene: ZNF407 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF407 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ZNF407 were set to 24907849; 32737394; 23195952 Phenotypes for gene: ZNF407 were set to Global developmental delay; Intellectual disability Penetrance for gene: ZNF407 were set to unknown Review for gene: ZNF407 was set to AMBER Added comment: You may consider inclusion of this gene probably with amber rating (or green if the evidence for biallelic variants is considered sufficient). Biallelic variants: - Kambouris et al. (2014 - PMID: 24907849) described 2 brothers with severe DD and ID, born to first cousin parents. Homozygosity mapping, following other non-diagnostic investigations (incl. aCGH), revealed 4 major homozygosity intervals. Exome sequencing in one identified 5 variants within these intervals, ZNF407 (c.5054C>G, p.Ser1685Trp) being the best candidate, supported also by segregation studies. The authors commented that zinc finger proteins act as transcriptional regulators, with mutations in genes encoding for other zinc finger proteins interfering with normal brain development. - Zahra et al. (2020 - PMID: 32737394) report on 7 affected individuals (from 3 families) homozygous or compound heterozygous for ZNF407 variants. Features included hypotonia, DD and ID (in all) and variable occurrence of short stature (6/6), microcephaly (in at least 5), behavioural, visual problems and deafness. Linkage analysis in the first family revealed a 4.4 Mb shared homozygosity region and exome (30x) revealed a 3-bp duplication, confirmed by Sanger sequencing and segregating with the disease (NM_001146189:c.2814_2816dup, p.Val939dup). Affected subjects from the 2 other families were each found to be homozygous (c.2405G>T) or compound heterozygous (c.2884C>G, c.3642G>C) for other variants. Segregation was compatible in all families. Other studies were not performed. The authors comment than only the 3-bp duplication fullfilled ACMG criteria for classification as LP, the other variants being all formally classified as VUS (also due to in silico predictions predicting a LB effect). In addition, while several features such as DD/ID and short stature appeared to be frequent among all patients reported, Zahra et all comment that there was partial clinical overlap with the sibs described by Kambouris et al (additional variants?). Monoallelic disruption of ZNF407: - Ren et al (2013 - PMID: 23195952) described an 8 y.o. boy with ID and ASD. The boy was found to harbor a de novo translocation between chromosomes 3 and 18 [46,XY,t(3;18)(p13;q22.3)]. Array CGH did not reveal any P/LP CNV. Delineation of the breakpoints (FISH, long-range PCR) revealed that the chr18 breakpoint disrupted intron 3 of ZNF407 (isoform 1) with the other breakpoint within a gene-free region of exon 3. There was a loss of 4-8 nt in chr18 and 2-6 in chr3. Sequencing of ZNF407 did not reveal additional variants. RNA isolation in blood followed by RT-PCR studied expression of all 3 ZNF407 isoforms (the intronic region being shared by isoforms 1 and 2). Expression of isoform 1 was shown to be significantly reduced compared to controls. Isoform 2 was undetectable (in blood) while isoform 3 expression was similar to controls. Sequencing of 105 additional patients with similar clinical presentation (ID & ASD) revealed 2 further individuals with de novo missense variants. - Based on the discussion by Kambouris et al (PMID: 24907849 - cited literature not here reviewed) ZNF407 may be deleted in patients with congenital aural atresia due to deletion of a critical region of 18q22.3 (though TSHZ1 is responsible for this phenotype) or 18q- although such deletions span several other genes (cited PMID: 16639285). In one case the breakpoint was shown to be disrupting ZNF407 (cited PMID: 24092497). - The denovo db and Decipher (research variant tab) list few individuals with de novo ZNF407 SNVs although these do not seem to allow conclusions. https://denovo-db.gs.washington.edu/denovo-db/QueryVariantServlet?searchBy=Gene&target=ZNF407 https://decipher.sanger.ac.uk/search/ddd-research-variants/results?q=znf407 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2803 | MAPK1 |
Konstantinos Varvagiannis gene: MAPK1 was added gene: MAPK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAPK1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAPK1 were set to 32721402 Phenotypes for gene: MAPK1 were set to Global developmental delay; Intellectual disability; Behavioral abnormality; Growth delay; Abnormality of the face; Abnormality of the neck; Abnormality of the cardiovascular system; Abnormality of the skin Penetrance for gene: MAPK1 were set to unknown Mode of pathogenicity for gene: MAPK1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: MAPK1 was set to GREEN Added comment: Motta et al (2020 - PMID: 32721402) report on 7 unrelated individuals harboring de novo missense MAPK1 pathogenic variants. The phenotype corresponded to a neurodevelopmental disorder and - as the authors comment - consistently included DD, ID , behavioral problems. Postnatal growth delay was observed in approximately half. Hypertelorism, ptosis, downslant of palpebral fissures, wide nasal bridge as low-set/posteriorly rotated ears were among the facial features observed (each in 3 or more subjects within this cohort). Together with short/webbed neck and abnormalities of skin (lentigines / CAL spots) and growth delay these led to clinical suspicion of Noonan s. or disorder of the same pathway in some. Congenital heart defects (ASD, mitral valve insufficiency, though not cardiomyopathy) occurred in 4/7. Bleeding diathesis and lymphedema were reported only once. MAPK1 encodes the mitogen-activated protein kinase 1 (also known as ERK2) a serine/threonine kinase of the RAS-RAF-MEK-(MAPK/)ERK pathway. MAPK1 de novo variants were identified in all individuals following trio exome sequencing (and extensive previous genetic investigations which were non-diagnostic). The distribution of variants, as well as in silico/vitro/vivo studies suggest a GoF effect (boosted signal through the MAPK cascade. MAPK signaling also upregulated in Noonan syndrome). The authors comment that screening of 267 additional individuals with suspected RASopathy (without mutations in previously implicated genes) did not reveal other MAPK1 variants. Overall this gene can be considered for inclusion in the ID panel with green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2750 | KIF21B |
Konstantinos Varvagiannis gene: KIF21B was added gene: KIF21B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIF21B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KIF21B were set to 32415109 Phenotypes for gene: KIF21B were set to Global developmental delay; Intellectual disability; Abnormality of brain morphology; Microcephaly Penetrance for gene: KIF21B were set to unknown Mode of pathogenicity for gene: KIF21B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: KIF21B was set to GREEN Added comment: Asselin et al (2020 - PMID: 32415109) report on 4 individuals with KIF21B pathogenic variants. DD/ID (borderline intellectual functioning to severe ID) was a feature in all. Variable other findings included brain malformations (CCA) and microcephaly. 3 missense variants and a 4-bp insertion were identified, in 3 cases as de novo events while in a single subject the variant was inherited from the father who was also affected. The authors provide evidence for a role of KIF21B in the regulation of processes involved in cortical development and deleterious effect of the missense variants impeding neuronal migration and kinesin autoinhibition. Phenotypes specific to variants (e.g. CCA or microcephaly) were recapitulated in animal models. Missense variants are thought to exert a gain-of-function effect. As commented on, the 4-bp duplication (/frameshift) variant might not be pathogenic. In blood sample from the respective individual, RT-qPCR analysis suggested that haploinsufficiency (NMD) applies. Although Kif21b haploinsufficiency in mice was shown to lead to impaired neuronal positioning, the gene might partially tolerate LoF variants as also suggested by 28 such variants in gnomAD. Homozygous Kif21b ko mice display severe morphological abnormalities, partial loss of commissural fibers, cognitive deficits and altered synaptic transmission (several refs to previous studies provided by the authors). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2750 | PAX1 |
Konstantinos Varvagiannis gene: PAX1 was added gene: PAX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: PAX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PAX1 were set to 29681087; 23851939; 28657137 Phenotypes for gene: PAX1 were set to Otofaciocervical syndrome 2, 615560 Penetrance for gene: PAX1 were set to Complete Review for gene: PAX1 was set to AMBER Added comment: Biallelic PAX1 pathogenic variants cause Otofaciocervical syndrome 2 (OMIM 615560). Brief review of the literature suggests 3 relevant publications to date (04-07-2020). 2 individuals with DD and ID have been reported (Patil et al, 2018 - PMID: 29681087 and Pohl et al, 2013 - PMID: 23851939). Other subjects reported were only evaluated as newborns(mostly)/infants [Paganini et al, 2017 - PMID: 28657137, Patil et al, 2018 - PMID: 29681087]. While the first report by Pohl et al identified a homozygous missense variant supported by functional studies [NM_006192.5:c.497G>T - p.(Gly166Val)] subsequent ones identified homozygosity for pLoF mutations [Patil et al: NM_006192.4:c.1173_1174insGCCCG / Paganini et al: NM_006192:c.1104C>A - p.(Cys368*)]. As discussed by Pohl et al: PAX1 encodes a transcription factor with critical role in pattern formation during embryogenesis. Study of the mouse Gly157Val (equivalent to human Gly166Val) Pax1 variant suggested reduced binding affinity (reduced transactivation of a regulatory sequence of the Nkx3-2 promoter) and hypofunctional nature of this variant. Mouse models seem to recapitulate features of the disorder (skeletal, immunodeficiency) while the role of Pax1 in hearing process was thought to be supported by early expression (P6) in mouse cochlea. Overall this gene can be considered for inclusion in the ID panel with amber/green rating. Sources: Literature, Radboud University Medical Center, Nijmegen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2750 | TBC1D2B |
Konstantinos Varvagiannis gene: TBC1D2B was added gene: TBC1D2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TBC1D2B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBC1D2B were set to 32623794 Phenotypes for gene: TBC1D2B were set to Global developmental delay; Intellectual disability; Seizures; Gingival overgrowth; Behavioral abnormality; Abnormality of the mandible; Abnormality of brain morphology; Abnormality of the eye; Hearing abnormality Penetrance for gene: TBC1D2B were set to Complete Review for gene: TBC1D2B was set to AMBER Added comment: Harms et al (2020 - PMID: 32623794) report on 3 unrelated individuals with biallelic pLoF TBC1D2B variants. Features included cognitive impairment (mild ID in one case, regression at the age of 12y in another, hypotonia and delayed milestones in a third aged 8m), seizures (3/3 - variable age of onset) and/or gingival overgrowth (2/3 - prior to initiation of AEDs). Other findings included behavioral abnormalities, mandibular anomalies, abnormal brain imaging and ophthalmologic or (rarely) audiometric evaluations. All were born to non-consanguineous couples and additional investigations were performed in some. Variants were identified by WES or trio WGS, with Sanger confirmation/compatible segregation analyses. In line with the pLoF variants, mRNA studies in fibroblasts from 2 unrelated affected individuals demonstrated significantly reduced (~80-90%) TBC1C2D mRNA levels compared to controls, restored following cycloheximide treatment. Protein was absent in patient fibroblasts. TBC-domain containing GTPase activating proteins are known as key regulators of RAB GTPase activity. TBC1D2B was shown to colocalize with RAB5-positive endocytic vesicles. CRISPR/Cas9-mediated ko of TBC1D2B in HeLa cells suggested a role in EGF receptor endocytosis and decreased cell viability of TBC1D2B-deficient HeLa cells upon serum deprivation. Genes encoding other TBC domain-containg GTPase-activating proteins, e.g. TBC1D7 and TBC1D20, TBC1D24 are associated with recessive neurodevelopmental disorders (with ID and/or seizures) and the pathophysiological defect in TBC1D2B-related disorder (deficit in vesicle trafficking and/or cell survival) is proposed to be similar to that of TBC1D24. Overall this gene can be considered for inclusion with amber/green rating in the ID panel and green in epilepsy panel. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2665 | DSCR3 |
Chirag Patel gene: DSCR3 was added gene: DSCR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DSCR3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DSCR3 were set to PMID: 31845315 Phenotypes for gene: DSCR3 were set to Intellectual disability, no OMIM # yet Review for gene: DSCR3 was set to RED Added comment: 1 family/2 cousins with cognitive impairment, growth failure, skeletal abnormalities, and distinctive facial features. Both shared the homozygous nonsense variant c.178G>T (p.Glu60*) in the VPS26C gene. This gene encodes VPS26C, a member of the retriever integral membrane protein recycling pathway. The nature of the variant which is predicted to result in loss‐of‐function, expression studies revealing significant reduction in the mutant transcript, and the co‐segregation of the homozygous variant with the phenotype in two affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2659 | TTC5 |
Konstantinos Varvagiannis gene: TTC5 was added gene: TTC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TTC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC5 were set to 29302074; 32439809 Phenotypes for gene: TTC5 were set to Central hypotonia; Global developmental delay; Intellectual disability; Abnormality of nervous system morphology; Microcephaly; Abnormality of the face; Behavioral abnormality; Abnormality of the genitourinary system Penetrance for gene: TTC5 were set to Complete Review for gene: TTC5 was set to GREEN Added comment: Hu et al (2019 - PMID: 29302074) reported briefly on 3 individuals from 2 consanguineous families (from Turkey and Iran) with biallelic TTC5 variants. Features included DD (3/3), ID (severe in 2/2 with relevant age), microcephaly (3/3), brain abnormalities, etc. A nonsense and a variant affecting splice site were identified by WES/WGS. --- In a recent report, Rasheed et al (2020 - PMID: 32439809) report on the phenotype of 8 individuals - belonging to 5 consanguineous families - all 8 harboring homozygous TTC5 mutations. Frequent features included hypotonia (6/8), motor and speech delay, moderate to severe ID (10/10 of relevant age - inclusion of less severely affected subjects was not considered by study design), brain MRI abnormalities (8/8). Other findings included microcephaly in some (6/11), behavioral abnormalities in few (autistic behavior in 2/8, aggression in 2/8), genitourinary anomalies (2/8), seizures (1/11). Facial phenotype incl. thin V-shaped upper lip, low-set ears (in most) and/or additional features. TTC5 encodes a 440 aa protein, functioning as a scaffold to stabilise p300-JMY interactions. Apart from this role in nucleus, it has functions in the cytoplasm (inhibiting actin nucleataion, autophagosome formation, etc). The gene has ubiquitous expression, highest in brain. All variants were identified following WES - as the best candidates - in affected individuals with compatible Sanger studies in all affected family members and carrier parents. 2 missense and 2 nonsense variants were identified with the 2 missense SNVs localizing within TPR domains. qRT-PCR studies for a nonsense variant localizing 19 nt before the last exon, revealed fourfold decreased expression in affected individuals compared to carriers. Families from Egypt shared a homozygous ~6.3 Mb haplotype block spanning TTC5, suggesting that p.(Arg263Ter) is likely a founder mutation. The authors underscore some phenotypic (though not facial) similarities with Rubinstein-Taybi syndrome 2 due to EP300 mutations (in line with the role of TTC5). Biallelic variants in genes encoding other members of the TTC family (containing a TPR motif), e.g. TTC8 or TTC15 cause disorders with neurologic manifestations (and DD/ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2629 | CUL3 |
Konstantinos Varvagiannis gene: CUL3 was added gene: CUL3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CUL3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CUL3 were set to 32341456 Phenotypes for gene: CUL3 were set to Global developmental delay; Intellectual disability; Seizures; Abnormality of cardiovascular system morphology; Abnormality of the palate; Pseudohypoaldosteronism, type IIE - MIM #614496 Penetrance for gene: CUL3 were set to unknown Review for gene: CUL3 was set to GREEN Added comment: Please consider inclusion with amber / green rating. -- Nakashima et al (2020 - PMID:32341456) provide clinical details on 3 unrelated individuals with de novo CUL3 variants. Features included DD, variable degrees of ID (P1: severe, P3: mild, P2: NA although he displayed motor and severe speech and language delay and had severe learning difficulties). Two out of three had intractable seizures (onset 2 - 6 months). One presented with congenital heart defects (ASD, PV stenosis) and another submucosal palatoschisis/bifid uvula. There were no facial dysmorphisms reported. CUL3 encodes Cullin-3, a core piece of the E3 ubiquitin ligase complex, thus playing a role in the ubiquitin-proteasome system. [ https://ghr.nlm.nih.gov/gene/CUL3 ]. Germline variants in some other Cullin family genes (eg. CUL4B, CUL7) cause disorders with ID as a feature. The 3 individuals reported by Nakashima had variable previous investigations (karyotype, CMA, metabolic testing) which were non-diagnostic. Singleton or trio exome sequencing identified 2 frameshift and 1 missense variant (NM_003590.4:c.854T>C / p.Val285Ala), further confirmed with Sanger sequencing. De novo occurrence was confirmed by analysis of microsatellite markers in an individual with singleton ES. While the frameshift variants were presumed to lead to NMD (not studied), studies in HEK293T cells suggested that the Val285Ala reduced binding ability with KEAP1, possibly leading to instability of the Cullin-RING ligase (CRL) complex and impairment of the ubiquitin-proteasome system. In OMIM, the phenotype associated with heterozygous CUL3 mutations is Pseudohypoaldosteronism type IIE (PHA2E - # 614496). As OMIM and Nakashima et al comment, PHA2E-associated variants are clustered around exon 9, most lead to skipping of exon 9 and produce an in-frame deletion of 57 aa in the cullin homology domain. Few (probably 3) missense variants in exon 9 have also been reported. Individuals with PHA2E do not display DD/ID and conversely individuals with NDD did not display features of PHA2E. Nakashima et al summarize the phenotypes associated with 12 further de novo CUL3 variants in the literature with most pLOF ones detected in individuals with autism and/or developmental disorders and in few cases with congenital heart disease. Few additional missense variants and a stoploss one have been reported in individuals with NDD and one in SCZ. Heterozygous Cul3 (/tissue-specific) deletion in mice resulted in autism-like behavior. Cul3 deficient mice also demonstrated NMDAR hypofunction and decreased spine density. [PMIDs cited : 31455858, 31780330] Overall haploinsufficiency is favored as the underlying mechanism of variants associated with NDD. Nakashima et al comment that the pathogenesis of missense variants remains unknown and/or that a dominant-negative effect on CRL may be possible. Studies on larger cohorts reporting on individuals with relevant phenotypes due to de novo CUL3 variants (eg. DDD study - PMID: 28135719, Lelieveld et al - PMID: 27479843), are summarized in denovo-db (after filtering for coding variants): http://denovo-db.gs.washington.edu/denovo-db/QueryVariantServlet?searchBy=Gene&target=cul3 Overall, this gene can be considered for inclusion in the ID (amber/green), epilepsy (amber) and/or ASD panels. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2625 | YIF1B |
Konstantinos Varvagiannis gene: YIF1B was added gene: YIF1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YIF1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YIF1B were set to 32006098 Phenotypes for gene: YIF1B were set to Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement Penetrance for gene: YIF1B were set to Complete Review for gene: YIF1B was set to GREEN Added comment: AlMuhaizea et al (2020 - PMID: 32006098) report on the phenotype of 6 individuals (from 5 families) with biallelic YIF1B truncating variants. Affected subjects presented hypotonia, failure to thrive, microcephaly (5/6), severe global DD and ID (as evident from best motor/language milestones achieved - Table S1) as well as features suggestive of a motor disorder (dystonia/spasticity/dyskinesia). Seizures were reported in 2 unrelated individuals (2/6). MRI abnormalities were observed in some with thin CC being a feature in 3. Variable initial investigations were performed including SNP CMA, MECP2, microcephaly / neurotransmitter disorders gene panel testing did not reveal P/LP variants. YIF1B variants were identified in 3 families within ROH. Following exome sequencing, affected individuals were found to be homozygous for truncating variants (4/5 families being consanguineous). The following 3 variants were identified (NM_001039672.2) : c.186dupT or p.Ala64fs / c.360_361insACAT or p.Gly121fs / c.598G>T or p.Glu200*. YIF1B encodes an intracellular transmembrane protein. It has been previously demonstrated that - similarly to other proteins of the Yip family being implicated in intracellular traffic between the Golgi - Yif1B is involved in the anterograde traffic pathway. Yif1B KO mice demonstrate a disorganized Golgi architecture in pyramidal hippocampal neurons (Alterio et al 2015 - PMID: 26077767). The rat ortholog interacts with serotonin receptor 1 (5-HT1AR) with colocalization of Yif1BB and 5-HT1AR in intermediate compartment vesicles and involvement of the former in intracellular trafficing/modulation of 5-HT1AR transport to dendrites (PMID cited: 18685031). Available mRNA and protein expression data (Protein Atlas) suggest that the gene is widely expressed in all tissues incl. neuronal cells. Immunochemistry data from the Human Brain Atlas also suggest that YIF1B is found in vesicles and localized to the Golgi apparatus. Immunohistochemistry in normal human brain tissue (cerebral cortex) demonstrated labeling of neuronal cells (Human Protein Atlas). Functional/network analysis of genes co-regulated with YIF1B based on available RNAseq data, suggest enrichement in in genes important for nervous system development and function. Please consider inclusion in other panels that may be relevant (e.g. microcephaly, etc). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2615 | DARS | Zornitza Stark Phenotypes for gene: DARS were changed from to Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2612 | DARS | Zornitza Stark reviewed gene: DARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 25527264, 23643384; Phenotypes: Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2605 | ATAD3A | Zornitza Stark Phenotypes for gene: ATAD3A were changed from Harel-Yoon syndrome, MIM# 617183 to Harel-Yoon syndrome, MIM# 617183; Pontocerebellar hypoplasia, hypotonia, and respiratory insufficiency syndrome, neonatal lethal (PHRINL SYNDROME) 618810 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2602 | ATAD3A |
Zornitza Stark edited their review of gene: ATAD3A: Added comment: Note mode of pathogenicity includes: i) bi-allelic missense and nonsense variants and bi-allelic deletions that create an ATAD3B/ATAD3A fusion gene under the lowly expressed ATAD3B promoter ii) monoallelic dominant-negative missense variants (either de novo or inherited) and de novo monoallelic duplications creating a dominant negative ATAD3A/ATAD3C fusion gene; Changed publications: 27640307, 32004445, 28549128; Changed phenotypes: Harel-Yoon syndrome, MIM# 617183, Pontocerebellar hypoplasia, hypotonia, and respiratory insufficiency syndrome, neonatal lethal (PHRINL SYNDROME) 618810 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2599 | VPS51 |
Zornitza Stark gene: VPS51 was added gene: VPS51 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: VPS51 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS51 were set to 30624672; 31207318 Phenotypes for gene: VPS51 were set to Pontocerebellar hypoplasia, type 13, MIM# 618606 Review for gene: VPS51 was set to AMBER Added comment: Two families reported with bi-allelic variants in this gene and global developmental delay, impaired intellectual development with absent speech, microcephaly, and progressive atrophy of the cerebellar vermis and brainstem. Additional features, including seizures and visual impairment, are variable. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2574 | GALNT2 |
Zornitza Stark gene: GALNT2 was added gene: GALNT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GALNT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GALNT2 were set to 32293671 Phenotypes for gene: GALNT2 were set to Congenital disorder of glycosylation Review for gene: GALNT2 was set to GREEN Added comment: Seven individuals from four families reported with bi-allelic LOF variants and global developmental delay, intellectual disability with language deficit, autistic features, behavioural abnormalities, epilepsy, chronic insomnia, white matter changes on brain MRI, dysmorphic features, decreased stature, and decreased high density lipoprotein cholesterol levels. Rodent (mouse and rat) models of GALNT2-CDG recapitulated much of the human phenotype, including poor growth and neurodevelopmental abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2542 | IGF1R | Zornitza Stark Phenotypes for gene: IGF1R were changed from to Insulin-like growth factor I, resistance to, MIM# 270450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2536 | IGF1R | Zornitza Stark reviewed gene: IGF1R: Rating: GREEN; Mode of pathogenicity: None; Publications: 31586944; Phenotypes: Insulin-like growth factor I, resistance to, MIM# 270450; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2523 | SLC18A2 |
Zornitza Stark gene: SLC18A2 was added gene: SLC18A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: SLC18A2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC18A2 were set to 23363473; 31240161; 26497564 Phenotypes for gene: SLC18A2 were set to Parkinsonism-dystonia, infantile, 2, MIM# 618049 Review for gene: SLC18A2 was set to GREEN Added comment: At least three unrelated families reported, potential treatment implications. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2509 | TOP2B |
Zornitza Stark gene: TOP2B was added gene: TOP2B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: TOP2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TOP2B were set to 31953910; 28343847; 12773624 Phenotypes for gene: TOP2B were set to Intellectual disability Review for gene: TOP2B was set to AMBER Added comment: Two unrelated individuals reported with the same de novo variant, c.187C > T, p.(His63Tyr) and also mouse model data supports role in brain development. Gene has also been associated independently with deafness and with immunodeficiency and the variant-disease relationship remains to be fully elucidated. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2371 | ZBTB24 | Zornitza Stark Phenotypes for gene: ZBTB24 were changed from to Immunodeficiency-centromeric instability-facial anomalies syndrome 2; OMIM # 614069 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2334 | TRIM8 |
Zornitza Stark changed review comment from: Six unrelated individuals reported. Sources: Expert list; to: Six unrelated individuals reported. All variants reported to date are truncating, affecting the last (sixth exon) and as a result may escape nonsense-mediated decay. Since TRIM8 homodimerizes via its (upstream) coiled-coil domain and its C-terminal domain is required for nuclear localization, a dominant-negative effect is postulated by the authors. Haploinsufficiency appears less likely. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2281 | TASP1 |
Zornitza Stark changed review comment from: Four unrelated families reported; two with founder mutation. Protein interacts with KMT2A and KMT2D. Another infant with a de novo missense variant reported in a single infant with multiple congenital abnormalities, insufficient evidence for mono allelic disease at present. Sources: Literature; to: Four unrelated families reported; two with founder mutation. Protein interacts with KMT2A and KMT2D. Another de novo missense variant reported in a single infant with multiple congenital abnormalities, insufficient evidence for mono allelic disease at present. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2177 | PTRHD1 |
Zornitza Stark gene: PTRHD1 was added gene: PTRHD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: PTRHD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTRHD1 were set to 30398675; 27134041; 27753167; 29143421 Phenotypes for gene: PTRHD1 were set to Parkinsonism; Intellectual disability Review for gene: PTRHD1 was set to GREEN Added comment: Three unrelated families reported: two with homozygous missense variants; and one with truncating variant. Affected individuals have juvenile-onset parkinsonism and ID. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2121 | ZBTB24 | Chirag Patel reviewed gene: ZBTB24: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 21906047, 21596365, 23486536; Phenotypes: Immunodeficiency-centromeric instability-facial anomalies syndrome 2, OMIM # 614069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2043 | INSR | Zornitza Stark Marked gene: INSR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2043 | INSR | Zornitza Stark Gene: insr has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2043 | INSR | Zornitza Stark Phenotypes for gene: INSR were changed from to Leprechaunism, MIM# 246200; Rabson-Mendenhall syndrome, MIM# 262190 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2042 | INSR | Zornitza Stark Mode of inheritance for gene: INSR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2041 | INSR | Zornitza Stark Classified gene: INSR as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2041 | INSR | Zornitza Stark Gene: insr has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2040 | INSR | Zornitza Stark reviewed gene: INSR: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Leprechaunism, MIM# 246200, Rabson-Mendenhall syndrome, MIM# 262190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.2001 | GORAB | Zornitza Stark edited their review of gene: GORAB: Added comment: Reviewed against assessment by GEL curation team: agree ID is not a predominant feature of this condition.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1981 | KAT8 |
Zornitza Stark gene: KAT8 was added gene: KAT8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KAT8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KAT8 were set to 31794431 Phenotypes for gene: KAT8 were set to Intellectual disability; seizures; autism; dysmorphic features Review for gene: KAT8 was set to GREEN Added comment: Eight unrelated individuals reported with de novo variants in this gene and a mouse model. All variants missense, in the chromobarrel domain or the acetyltransferase domain; three individuals had the same variant p.Tyr90Cys . One more individual reported with bi-allelic variants: one missense and one frameshift; carrier parents were normal suggesting that may be haploinsuffiency is not the mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1920 | EMC1 |
Zornitza Stark gene: EMC1 was added gene: EMC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: EMC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EMC1 were set to 26942288; 29271071 Phenotypes for gene: EMC1 were set to Cerebellar atrophy, visual impairment, and psychomotor retardation, MIM# 616875 Review for gene: EMC1 was set to GREEN gene: EMC1 was marked as current diagnostic Added comment: Four unrelated families with bi-allelic variants in this gene reported. Single individual with heterozygous variant: insufficient evidence at present for mono allelic variants causing disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1771 | BSND | Zornitza Stark edited their review of gene: BSND: Added comment: Downgrade to Amber after review against GEL panel; ID not a consistent/predominant feature of Bartter syndrome.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1728 | ALDOB | Zornitza Stark edited their review of gene: ALDOB: Added comment: ID is not an intrinsic feature of this condition; most reported individuals have had normal cognition; Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1673 | MACF1 |
Zornitza Stark gene: MACF1 was added gene: MACF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: MACF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MACF1 were set to 30471716 Phenotypes for gene: MACF1 were set to Lissencephaly 9 with complex brainstem malformation, MIM# 618325 Mode of pathogenicity for gene: MACF1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: MACF1 was set to GREEN Added comment: Nine individuals (including a pair of twins) reported with de novo, likely GoF variants in this gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1435 | MN1 |
Zornitza Stark gene: MN1 was added gene: MN1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: MN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MN1 were set to 31834374; 31839203 Phenotypes for gene: MN1 were set to Intellectual disability; dysmophic features; rhombencephalosynapsis Mode of pathogenicity for gene: MN1 was set to Other Review for gene: MN1 was set to GREEN Added comment: Over 20 individuals described with de novo truncating variants in this gene; these cluster in the C-terminal and the authors postulate that that syndrome is not due to MN1 haploinsufficiency but rather is the result of dominantly acting C-terminally truncated MN1 protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1426 | TASP1 |
Zornitza Stark gene: TASP1 was added gene: TASP1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: TASP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TASP1 were set to 31209944; 31350873 Phenotypes for gene: TASP1 were set to Developmental delay; microcephaly; dysmorphic features; congenital abnormalities Review for gene: TASP1 was set to GREEN Added comment: Four unrelated families reported; two with founder mutation. Protein interacts with KMT2A and KMT2D. Another infant with a de novo missense variant reported in a single infant with multiple congenital abnormalities, insufficient evidence for mono allelic disease at present. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1326 | PHF21A |
Chirag Patel gene: PHF21A was added gene: PHF21A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PHF21A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHF21A were set to PMID: 31649809; 30487643; 22770980 Phenotypes for gene: PHF21A were set to no OMIM number yet. Review for gene: PHF21A was set to GREEN Added comment: 9 cases with intellectual disability and craniofacial anomalies (Potocki-Shaffer syndrome), with de novo truncating variants in PHF21A. No functional evidence of variants, but PHF21A is highly expressed in the human fetal brain, which is consistent with the neurodevelopmental phenotype. 2 other unrelated individuals with translocations disrupting PHF21A. Lymphoblastoid cell lines from translocation subjects showed derepression of the neuronal gene SCN3A and reduced LSD1 occupancy at the SCN3A promoter, supporting a direct functional consequence of PHF21A haploinsufficiency on transcriptional regulation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1322 | PIGB |
Chirag Patel gene: PIGB was added gene: PIGB was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PIGB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGB were set to PubMed: 31256876 Phenotypes for gene: PIGB were set to Epileptic encephalopathy, early infantile, 80; OMIM #618580 Review for gene: PIGB was set to GREEN Added comment: 10 unrelated families with biallelic mutations in PIGB, with global DD and/or ID, and seizures. Two had polymicrogyria, 4 had a peripheral neuropathy, and 2 had a clinical diagnosis of DOORS syndrome. Patient lymphocytes and fibroblasts showed variably decreased levels of cell surface GPI-anchored proteins, including CD16 and CD59. In vitro functional expression studies performed with some of the mutations in PIGB-null CHO cells showed that the mutant proteins were unable to fully restore expression of GPI-anchored surface proteins, consistent with a loss of function, although the mutations had variable effects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1313 | PPP2CA |
Chirag Patel gene: PPP2CA was added gene: PPP2CA was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: PPP2CA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2CA were set to PMID: 30595372 Phenotypes for gene: PPP2CA were set to Neurodevelopmental disorder and language delay with or without structural brain abnormalities; OMIM #618354 Review for gene: PPP2CA was set to GREEN Added comment: 15 unrelated patients with a neurodevelopmental disorder with de novo heterozygous PPP2CA mutations, and 1 with partial deletion of PPP2CA. Functional studies showed complete PP2A dysfunction in 4 individuals with seemingly milder ID, hinting at haploinsufficiency. Ten other individuals showed mutation-specific biochemical distortions, including poor expression, altered binding to the A subunit and specific B-type subunits, and impaired phosphatase activity and C-terminal methylation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1309 | RNF113A |
Chirag Patel gene: RNF113A was added gene: RNF113A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: RNF113A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: RNF113A were set to PMID: 25612912; 31793730 Phenotypes for gene: RNF113A were set to ?Trichothiodystrophy 5, nonphotosensitive; OMIM #300953 Review for gene: RNF113A was set to AMBER Added comment: 1 family of 2 male cousins with IUGR, progressive microcephaly, profound ID, genital anomalies, and severe linear growth failure, and nonsense Q301X mutation in RNF113A gene. Segregated with disease in the family. The mutation markedly reduced RNF113A protein expression in extracts from lymphoblastoid cell lines derived from the affected individuals. 2 fetuses affected with abnormalities similar to previous report, with the same nonsense Q301X mutation in RNF113A gene (can not access paper to see if from same family or functional evidence). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1307 | SCAMP5 |
Chirag Patel gene: SCAMP5 was added gene: SCAMP5 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: SCAMP5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SCAMP5 were set to PMID: 31439720 Phenotypes for gene: SCAMP5 were set to no OMIM number yet Review for gene: SCAMP5 was set to AMBER Added comment: 2 unrelated individuals with ASD, ID and seizures, with the same heterozygous de novo variant in SCAMP5 (p.Gly302Trp). Western blot analysis of proteins overexpressed in the Drosophila fat body showed strongly reduced levels of the SCAMP p.Gly302Trp protein compared with the wild-type protein, indicating that the mutant either reduced expression or increased turnover of the protein. The expression of the fly homologue of the human SCAMP5 p.Gly180Trp mutation caused similar eye and neuronal phenotypes as the expression of SCAMP RNAi, suggesting a dominant-negative effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1291 | SOX4 |
Chirag Patel gene: SOX4 was added gene: SOX4 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: SOX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SOX4 were set to PMID: 30661772 Phenotypes for gene: SOX4 were set to Coffin-Siris syndrome 10; OMIM #618506 Review for gene: SOX4 was set to GREEN Added comment: 4 patients with syndromic DD/ID and de novo mutations in SOX4 gene. Functional assays demonstrated that the SOX4 proteins carrying these variants were unable to bind DNA in vitro and transactivate SOX reporter genes in cultured cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1289 | SVBP |
Chirag Patel gene: SVBP was added gene: SVBP was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: SVBP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SVBP were set to PMID: 31363758; 30607023 Phenotypes for gene: SVBP were set to Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly; OMIM #618569 Review for gene: SVBP was set to GREEN Added comment: 5 unrelated families with homozygous mutations in SVBP. The mutations segregated with the disorder in all families. In vitro functional cellular expression studies showed that protein levels of the SVBP mutants were barely detectable, suggesting instability, and that the mutant proteins had lost VASH/SVBP catalytic detyrosination activity toward tubulin. Knockdown of about 50% Svbp expression using shRNA in rat hippocampal neurons impaired the formation of excitatory synapses compared to controls. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1275 | ZMIZ1 |
Chirag Patel gene: ZMIZ1 was added gene: ZMIZ1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: ZMIZ1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZMIZ1 were set to PubMed: 30639322 Phenotypes for gene: ZMIZ1 were set to Neurodevelopmental disorder with dysmorphic facies and distal skeletal anomalies; OMIM #618659 Review for gene: ZMIZ1 was set to GREEN Added comment: 28 families with spectrum of neurodevelopmental features (including ID, ASD, and ADHD) due to de novo ZNF292 variants (1 family inherited). No functional evidence of specific variants, but ZNF292 is highly expressed in the developing human brain. 14 unrelated patients with neurodevelopmental disorder with dysmorphic facies and distal skeletal anomalies, and de novo heterozygous mutations in the ZMIZ1 gene. Transfection of 3 variants (T300M, c.3112dupA, and K91R) into HEK293T cells resulted in decreased induction of luciferase activity compared to wildtype (although the change for K91R was not statistically significant), suggesting impaired coactivation activity of the mutant proteins. Electroporation of these 3 mutants into progenitor cells in the ventricular zone of embryonic mice cortices resulted in defective neuronal migration to the cortex, as well as morphologic abnormalities of the neurons manifest as rounded cells with aberrantly oriented processes. These findings suggested that the ZMIZ1 mutations disrupted proper neuronal polarization and neuronal migration in the developing cortex. Functional studies of the other variants and additional studies of patient cells were not performed. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1184 | STAT5B |
Chirag Patel Source Genetic Health Queensland was removed from STAT5B. Source Expert list was added to STAT5B. Mode of inheritance for gene STAT5B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STAT5B were changed from to Growth hormone insensitivity with immunodeficiency; OMIM #245590 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1183 | STAT5B | Chirag Patel edited their review of gene: STAT5B: Changed phenotypes: Growth hormone insensitivity with immunodeficiency, OMIM #245590; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1153 | TBC1D20 | Chirag Patel edited their review of gene: TBC1D20: Added comment: Liegel et al. (2013) analyzed the candidate gene TBC1D20 and identified homozygous mutations in 7 patients diagnosed with Warburg Micro syndrome from 5 families of different ethnic origins. Evaluation of human fibroblasts deficient in TBC1D20 function identified aberrant lipid droplet formation.; Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1018 | PRKN | Zornitza Stark Phenotypes for gene: PRKN were changed from to Parkinson disease, juvenile, type 2, MIM#600116 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.1015 | PRKN | Zornitza Stark reviewed gene: PRKN: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease, juvenile, type 2, MIM#600116; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.968 | PINK1 | Zornitza Stark Phenotypes for gene: PINK1 were changed from to Parkinson disease 6, early onset, MIM#605909 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.965 | PINK1 | Zornitza Stark reviewed gene: PINK1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 6, early onset, MIM#605909; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.683 | AVPR2 | Zornitza Stark Phenotypes for gene: AVPR2 were changed from to Diabetes insipidus, nephrogenic, MIM#304800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.679 | AVP | Zornitza Stark Phenotypes for gene: AVP were changed from to Diabetes insipidus, neurohypophyseal, MIM#125700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.490 | INS | Zornitza Stark Marked gene: INS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.490 | INS | Zornitza Stark Gene: ins has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.490 | INS | Zornitza Stark Phenotypes for gene: INS were changed from to Diabetes mellitus, permanent neonatal, MIM#606176 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.489 | INS | Zornitza Stark Mode of inheritance for gene: INS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.488 | INS | Zornitza Stark Classified gene: INS as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.488 | INS | Zornitza Stark Gene: ins has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.487 | INS | Zornitza Stark reviewed gene: INS: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Diabetes mellitus, permanent neonatal, MIM#606176; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.341 | HADH | Zornitza Stark Phenotypes for gene: HADH were changed from to 3-hydroxyacyl-CoA dehydrogenase deficiency, MIM#231530; Hyperinsulinemic hypoglycemia, familial, 4, MIM#609975 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.338 | HADH | Zornitza Stark reviewed gene: HADH: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-hydroxyacyl-CoA dehydrogenase deficiency, MIM#231530, Hyperinsulinemic hypoglycemia, familial, 4, MIM#609975; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.290 | GLUD1 | Zornitza Stark Phenotypes for gene: GLUD1 were changed from to Hyperinsulinism-hyperammonemia syndrome, MIM#606762 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.287 | GLUD1 | Zornitza Stark reviewed gene: GLUD1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperinsulinism-hyperammonemia syndrome, MIM#606762; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.279 | GHR | Zornitza Stark Phenotypes for gene: GHR were changed from to Growth hormone insensitivity, partial, MIM#604271; Laron dwarfism, MIM#262500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.276 | GHR | Zornitza Stark reviewed gene: GHR: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Growth hormone insensitivity, partial, MIM#604271, Laron dwarfism, MIM#262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.106 | DNAJC6 | Zornitza Stark Phenotypes for gene: DNAJC6 were changed from to Parkinson disease 19a, juvenile-onset, MIM#615528 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.103 | DNAJC6 | Zornitza Stark reviewed gene: DNAJC6: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 19a, juvenile-onset, MIM#615528; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.102 | DNAJC12 |
Zornitza Stark gene: DNAJC12 was added gene: DNAJC12 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: DNAJC12 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAJC12 were set to Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384 Review for gene: DNAJC12 was set to GREEN Added comment: Highly variable neurological phenotype, including ID, dystonia, parkinsonism. Treatable. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.44 | COX4I2 | Zornitza Stark Phenotypes for gene: COX4I2 were changed from to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.41 | COX4I2 | Zornitza Stark reviewed gene: COX4I2: Rating: RED; Mode of pathogenicity: None; Publications: 19268275, 22730437; Phenotypes: Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5 | AVPR2 | Zornitza Stark reviewed gene: AVPR2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Diabetes insipidus, nephrogenic, MIM#304800; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.5 | AVP | Zornitza Stark reviewed gene: AVP: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Diabetes insipidus, neurohypophyseal, MIM#125700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | LINS1 |
Zornitza Stark gene: LINS1 was added gene: LINS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: LINS1 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | KIDINS220 |
Zornitza Stark gene: KIDINS220 was added gene: KIDINS220 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: KIDINS220 was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | INSR |
Zornitza Stark gene: INSR was added gene: INSR was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: INSR was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Intellectual disability syndromic and non-syndromic v0.0 | INS |
Zornitza Stark gene: INS was added gene: INS was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: INS was set to Unknown |