| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Intellectual disability syndromic and non-syndromic v2.145 | CBL_FRA11B_CCG |
Zornitza Stark STR: CBL_FRA11B_CCG was added STR: CBL_FRA11B_CCG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature paediatric-onset tags were added to STR: CBL_FRA11B_CCG. Mode of inheritance for STR: CBL_FRA11B_CCG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CBL_FRA11B_CCG were set to 7881408; 7603564; 9508241; 9927483; 10767345; 11076037; 19267933 Phenotypes for STR: CBL_FRA11B_CCG were set to Jacobsen syndrome MIM#147791 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.141 | AFF3_FRA2A_CGG |
Zornitza Stark STR: AFF3_FRA2A_CGG was added STR: AFF3_FRA2A_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature paediatric-onset tags were added to STR: AFF3_FRA2A_CGG. Mode of inheritance for STR: AFF3_FRA2A_CGG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: AFF3_FRA2A_CGG were set to 24763282; 39313615; 33510257 Phenotypes for STR: AFF3_FRA2A_CGG were set to Neurodevelopmental delay |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.139 | CCDC149 |
Zornitza Stark gene: CCDC149 was added gene: CCDC149 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: CCDC149 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC149 were set to 40459248; 42554577 Phenotypes for gene: CCDC149 were set to Cryptorchidism, MONDO:0009047, CCDC149-related; Syndromic disease, MONDO:0002254, CCDC149-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.138 | TTC14 |
Zornitza Stark gene: TTC14 was added gene: TTC14 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: TTC14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC14 were set to 42572047 Phenotypes for gene: TTC14 were set to Neurodevelopmental disorder, MONDO:0700092, TTC14-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.137 | PSMF1 | Zornitza Stark Phenotypes for gene: PSMF1 were changed from Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related to Neurodegeneration, childhood-onset, with movement disorders, cognitive decline, and brain abnormalities, MIM# 621694 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.135 | PSMF1 | Zornitza Stark edited their review of gene: PSMF1: Changed phenotypes: Neurodegeneration, childhood-onset, with movement disorders, cognitive decline, and brain abnormalities, MIM# 621694 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.135 | ZNF536 |
Zornitza Stark gene: ZNF536 was added gene: ZNF536 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: ZNF536 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNF536 were set to 42697193 Phenotypes for gene: ZNF536 were set to Neurodevelopmental disorder, MONDO:0700092, ZNF536-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.134 | TERT | Zornitza Stark Mode of inheritance for gene: TERT was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.133 | ISCA-37447-Loss |
Sarah Milton Region: ISCA-37447-Loss was added Region: ISCA-37447-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen SV/CNV tags were added to Region: ISCA-37447-Loss. Mode of inheritance for Region: ISCA-37447-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Publications for Region: ISCA-37447-Loss were set to 41926606; 39446997 Phenotypes for Region: ISCA-37447-Loss were set to Temple syndrome MIM#616222; Kagami-Ogata syndrome MIM#608149 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.126 | TXNIP |
Zornitza Stark gene: TXNIP was added gene: TXNIP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature,Literature Mode of inheritance for gene: TXNIP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TXNIP were set to 41116060; 30755400 Phenotypes for gene: TXNIP were set to Metabolic disease MONDO:0005066, TXNIP-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.124 | PREX1 |
Lucy Spencer gene: PREX1 was added gene: PREX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PREX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PREX1 were set to 42399407; 26621702 Phenotypes for gene: PREX1 were set to Neurodevelopmental disorder (MONDO:0700092), PREX1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.123 | DCTN4 |
Rylee Peters gene: DCTN4 was added gene: DCTN4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: DCTN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DCTN4 were set to 42378292 Phenotypes for gene: DCTN4 were set to Neurodevelopmental disorder, MONDO:0700092, DCTN4-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.121 | AFF3 | Rylee Peters Mode of inheritance for gene: AFF3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.119 | BCLAF3_FRAXG_CCG |
Bryony Thompson STR: BCLAF3_FRAXG_CCG was added STR: BCLAF3_FRAXG_CCG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for STR: BCLAF3_FRAXG_CCG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: BCLAF3_FRAXG_CCG were set to 42482100 Phenotypes for STR: BCLAF3_FRAXG_CCG were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.116 | PIGB |
Zornitza Stark edited their review of gene: PIGB: Added comment: Association with AFFND1, PMID 34400385: two individuals from two Brazilian families reported with the same homozygous intronic variant c.795-19T>G and a distinctive phenotype comprising severe DD/ID, and marked dysmorphic features, including hypertelorism, broad nose with notched nasal tip, cleft lip/palate, and wide and protruding central upper incisors. Vision is impaired due to coloboma and other ocular anomalies, and hearing loss in later life has been reported. Skeletal abnormalities include mesomelic shortening of limbs, distal digital hypoplasia, fibular hypoplasia, and clubfeet. RED for this association as single, likely founder variant in the Brazilian population.; Changed publications: 34400385; Changed phenotypes: Developmental and epileptic encephalopathy 80, MIM# 618580, Acrofrontofacionasal dysplasia 1, MIM# 201180 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.114 | IRS1 |
chirag patel gene: IRS1 was added gene: IRS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: IRS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IRS1 were set to Syndromic disease, MONDO: 0002254, IRS1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.110 | DDX41 |
chirag patel gene: DDX41 was added gene: DDX41 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature preprint tags were added to gene: DDX41. Mode of inheritance for gene: DDX41 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDX41 were set to 41646732 Phenotypes for gene: DDX41 were set to Inherited retinal dystrophy, MONDO:0019118, DDX41-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.109 | MORF4L1 |
Zornitza Stark gene: MORF4L1 was added gene: MORF4L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: MORF4L1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MORF4L1 were set to 42457791 Phenotypes for gene: MORF4L1 were set to Neurodevelopmental disorder, MONDO:0700092, MORF4L1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.107 | LDB1 |
chirag patel gene: LDB1 was added gene: LDB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: LDB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LDB1 were set to Neurodevelopmental disorder, MONDO:0700092, LDB1-related Review for gene: LDB1 was set to AMBER Added comment: ESHG 2026 16 unrelated individuals with 16 different rare heterozygous de novo variants (missense, nonsense, frameshift, gene deletions) in the LDB1 gene. Eleven variants affect the whole gene or the N-terminal dimerization domain and 5 variants affect only the C-terminus. All individuals presented with developmental delay and behaviour issues, but individuals with C-terminal variants also presented with ventriculomegaly. LDB1 encodes transcriptional regulator protein LIM-domain-binding protein 1, which plays an important role in neurogenesis. In vitro assays showed the N-terminal missense variants disrupted homodimerization of LDB1 (likely leading to a loss of function) but the C-terminal variants impaired interaction with the essential partner LHX2 (in a dominant-negative fashion). Toxicity of overexpressed human LDB1 in Drosophila was not seen for N-terminal missense variants but was exacerbated by C-terminal variants. Phenotypes associated with LDB1/chi loss in Drosophila were a) rescued by overexpression of wild-type LDB1, b) not rescued by N-terminal missense variants, and c) worsened by C-terminal variants. This suggests 2 distinct pathomechanisms of LDB1-related NDDs. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.105 | MACROH2A1 |
chirag patel gene: MACROH2A1 was added gene: MACROH2A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MACROH2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MACROH2A1 were set to Neurodevelopmental disorder, MONDO:0700092, MACROH2A1-related Review for gene: MACROH2A1 was set to AMBER Added comment: ESHG 2026 5 unrelated individuals with 3 different rare heterozygous de novo missense variants in H2A-like domain in MACROH2A1 gene. Two missense variants affected the same amino acid in 4 individuals (p.Arg27Gln and p.Arg27Trp). Individuals presented with global developmental delay (5/5), intellectual disability (5/5), hypotonia (4/4), microcephaly (3/5), seizures (2/5), brain abnormalities (3/4), and dysmorphism (5/5). MACROH2A1 is a distinctive H2A variant involved in transcriptional regulation, chromatin organization, and neuronal differentiation. Structural modeling indicated that variants destabilize the nucleosome and impair MACROH2A1-DNA interactions. Transcriptomic profiling of patient-derived fibroblasts highlighted dysregulation of the actin cytoskeleton organization and cell-matrix interaction dynamics, ER-related trafficking, and neuronal differentiation programs. Patient fibroblasts exhibited disorganized F-actin with defective focal adhesions and ER disorganization with lumen dilation. Patient fibroblasts also showed impaired fibroblast-to-neuronal reprogramming with reduced TuJ1-positive cells, and abnormal neurite morphology. Methylation profiling revealed a distinct episignature discriminating affected individuals from controls, consistent with global epigenetic dysregulation. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.103 | RLF |
chirag patel gene: RLF was added gene: RLF was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: RLF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RLF were set to Neurodevelopmental disorder, MONDO:0700092, RLF-related Review for gene: RLF was set to AMBER Added comment: ESHG 2026 22 unrelated individuals with rare heterozygous de novo variants (14 frameshift, 8 nonsense) located in the last exon of RLF gene. Individuals presented with developmental delay, intellectual disability, autism-type behaviour, and Kabuki syndrome-like facial features. RLF is a poly-ZNF protein which acts as a transcription factor. In vitro assays showed the variants profoundly altered the epigenome, the transcriptome and the DNA secondary structure. ONT whole genome sequencing in patient IPSCs showed hypermethylation and hypo-5-hydroxymethylation at multiple CpG sites. ATAC-seq demonstrated altered chromatin accessibility at promoters and enhancers in patient IPSCs. RNA-seq unveiled several differentially expressed genes enriched for disease-relevant gene ontology terms. RLP variants upregulated neuronal differentiation genes. RLF-ChIP-seq data showed a marked reduction in G4 access signal in patient iPSCs. Methylation arrays revealed a distinct methylation profile overlapping with Kabuki syndrome. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.101 | DHX36 |
chirag patel gene: DHX36 was added gene: DHX36 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: DHX36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DHX36 were set to Neurodevelopmental disorder, MONDO:0700092, DHX36-related Mode of pathogenicity for gene: DHX36 was set to Other Review for gene: DHX36 was set to AMBER Added comment: ESHG 2026 3 unrelated individuals with 3 heterozygous de novo variants (2 missense, 1 in-frame deletion) located in the helicase domain of DHX36 gene. Individuals presented with global developmental delay (3), hypotonia (3), microcephaly (2), cleft palate (2), respiratory defects (3), cardiovascular abnormalities (3), and hearing impairment (2). DHX36 is an ATP-dependent G4 helicase which regulates G-quadruplexes (G4s), which are bulky DNA secondary structures that form naturally in GC-rich regions and can pose threats to genome integrity. Functional studies performed in in vitro, Xenopus egg extract and human cell based assays. DHX36 mutant proteins showed reduced ATPase and G4 unwinding activity, but retained G4 binding affinity. Mutant DHX36 also interfered with wild-type helicase activity, exerting a dominant-negative mechanism. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.99 | THAP12 |
chirag patel gene: THAP12 was added gene: THAP12 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: THAP12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: THAP12 were set to Neurodevelopmental disorder, MONDO:0700092, THAP12-related Review for gene: THAP12 was set to RED Added comment: ESHG 2026 2 siblings from 1 family with compound heterozygous variants in THAP12 (1 missense, 1 frameshift), presenting with refractory early onset epilepsy, severe developmental delay and hypotonia, and microcephaly. ChIP-seq confirmed the role of THAP12 as a transcriptional activator of genes essential for proliferation, apoptosis, and mitochondrial function in HEK293FT cells. In silico predictions (AlphaFold 3) showed that THAP12 forms homodimers, enabling it to bind DNA. The patient variants were shown to lead to a significant reduction in THAP12 protein level, suggesting a loss-of-function mechanism. Mouse models show embryonic lethality in both Thap12-KO and models harbouring patient specific alleles. Zebrafish models showed THAP12 is primarily expressed in cycling neural progenitors, and loss-of-function models phenocopy the clinical presentation with microcephaly, abnormal neural activity, and seizure like-behaviour. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.98 | EHMT2 |
Richard Lin gene: EHMT2 was added gene: EHMT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EHMT2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: EHMT2 were set to 42434347; 42386776; 39674972 Phenotypes for gene: EHMT2 were set to Kleefstra syndrome, MONDO:0012455, EHMT2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.96 | DDX1 |
chirag patel gene: DDX1 was added gene: DDX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: DDX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DDX1 were set to Neurodevelopmental disorder, MONDO:0700092, DDX1-related Review for gene: DDX1 was set to AMBER Added comment: ESHG 2026 9 unrelated individuals with 7 different rare heterozygous de novo variants (6 missense, 1 splice) involving conserved residues in critical domains of DDX1 gene. Individuals presented with developmental delay, hypotonia (9/9), distinctive facial gestalt (9/9), behavioral dysregulation (8/9), hand/foot skeletal anomalies (7/9), seizures (4/9), spasticity (4/9), and ataxia (3/9). DEAD/DExH-box RNA (DDX) helicases are key regulators of RNA metabolism and cellular stress responses, and their dysfunction has been associated with distinct neurodevelopmental syndromes. DDX1 regulates RNA metabolism and genome integrity, and is an essential regulator of cellular responses to genotoxic and environmental stress. In silico analysis predicted all variants decrease protein stability. Patient-derived fibroblasts showed impaired radiation-induced DNA double-strand break repair, defective protection of specific target mRNAs under oxidative stress conditions, increased production of reactive oxygen species, and reduced mitochondrial function. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.94 | XPO7 |
chirag patel gene: XPO7 was added gene: XPO7 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: XPO7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: XPO7 were set to Neurodevelopmental disorder, MONDO:0700092, XPO7-related Review for gene: XPO7 was set to AMBER Added comment: ESHG 2026 25 unrelated individuals with 19 different heterozygous variants in XPO7 (10 missense, 3 splice, 6 truncating). The R756W variant occurred in 6 unrelated individuals. Inheritance of variants was de novo (21), inherited (2), or unknown (1). Individuals presented with mild to severe developmental delay/intellectual disability (24/25), behavioural disturbances (17/24), nonspecific brain abnormalities (9/17), epilepsy (4/25), overweight (7/22), and other variable congenital anomalies. XPO7 encodes a nuclear transport receptor. The R756W knock-in mouse model exhibited reduced XPO7 protein levels, reduced brain volume, decreased dendritic complexity, diminished excitatory synaptic transmission, and altered anxiety-related behaviour. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.93 | TUBB3 | Zornitza Stark Phenotypes for gene: TUBB3 were changed from complex cortical dysplasia with other brain malformations 1 MONDO:0013541; Congenital fibrosis of extraocular muscles 3A, syndromic 1, with anosmia and developmental delay MIM#621655 Congenital fibrosis of extraocular muscles 3A2, syndromic, with joint contractures, developmental delay, and peripheral neuropathy, MIM#621666 to complex cortical dysplasia with other brain malformations 1 MONDO:0013541; Congenital fibrosis of extraocular muscles 3A, syndromic 1, with anosmia and developmental delay; MIM#621655 Congenital fibrosis of extraocular muscles 3A2, syndromic, with joint contractures, developmental delay, and peripheral neuropathy, MIM#621666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.92 | TUBB3 | Zornitza Stark Phenotypes for gene: TUBB3 were changed from complex cortical dysplasia with other brain malformations 1 MONDO:0013541 to complex cortical dysplasia with other brain malformations 1 MONDO:0013541; Congenital fibrosis of extraocular muscles 3A, syndromic 1, with anosmia and developmental delay MIM#621655 Congenital fibrosis of extraocular muscles 3A2, syndromic, with joint contractures, developmental delay, and peripheral neuropathy, MIM#621666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.91 | TUBB3 |
Zornitza Stark commented on gene: TUBB3: CFEOM: multiple families reported, some affected individuals show additional features, including developmental delay or learning disabilities associated with dysgenesis of the corpus callosum. Other variable features include facial weakness and peripheral axonal neuropathy, sometimes associated with wrist and finger contractures. OMIM have split into three disorders. Complex cortical dysplasia with other brain malformations (CDCBM), MIM#614039 is a disorder of aberrant neuronal migration and disturbed axonal guidance. Affected individuals have mild to severe DD/ID, strabismus, axial hypotonia, and spasticity. Brain imaging shows variable malformations of cortical development, including polymicrogyria, gyral disorganization, and fusion of the basal ganglia, as well as thin corpus callosum, hypoplastic brainstem, and dysplastic cerebellar vermis. Unclear if the four disorders are distinct or part of a spectrum of TUBB3-associated abnormalities. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.91 | TUBB3 | Zornitza Stark reviewed gene: TUBB3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital fibrosis of extraocular muscles 3A, syndromic 1, with anosmia and developmental delay MIM#621655 Congenital fibrosis of extraocular muscles 3A2, syndromic, with joint contractures, developmental delay, and peripheral neuropathy, MIM#621666; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.90 | CSMD2 | chirag patel Mode of inheritance for gene: CSMD2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.88 | CSMD2 | chirag patel reviewed gene: CSMD2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CSMD2-related; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.88 | DLGAP1 |
chirag patel gene: DLGAP1 was added gene: DLGAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Other Mode of inheritance for gene: DLGAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DLGAP1 were set to Neurodevelopmental disorder, MONDO:0700092, DLGAP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.86 | UBE2I |
chirag patel gene: UBE2I was added gene: UBE2I was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: UBE2I was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UBE2I were set to Neurodevelopmental disorder, MONDO:0700092, UBE2I-related Review for gene: UBE2I was set to AMBER Added comment: ESHG 2026 10 unrelated individuals with 10 different heterozygous missense variants throughout UBE2I gene (9 confirmed de novo) presenting with developmental delay (10), intellectual disability (4), ASD (5), microcephaly (3), hearing loss (3), and dysmorphism. UBE2I encodes the only human E2 enzyme UBC9. SUMOylation is a critical post-translational modification regulating protein function, localization, and stability through E1, E2, and E3 enzymes. SUMOylation pathway is key regulator of neurodevelopment processes. Structural modeling for all variants suggested possible protein destabilization, disruption of the catalytic core, and altered SUMO binding. LCLs from patient with 2 variants (p.W53L and p.N124I) showed normal UBE2I mRNA levels, whereas protein levels were markedly reduced, and accompanied by decreased global SUMOylation. Yeast-based assays showed reduced protein stability for the p.W53L variant. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.84 | SMC6 |
chirag patel gene: SMC6 was added gene: SMC6 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: SMC6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SMC6 were set to Neurodevelopmental disorder, MONDO:0700092, SMC6-related Review for gene: SMC6 was set to AMBER Added comment: ESHG 2026 17 affected individuals from 2 families (1 consanguineous family with 16 individuals) with biallelic variants in SMC6 (3 missense) which segregated with disease. Phenotype included microcephaly (1 family), short stature, DD/ID (1 family), dysmorphism (Seckel like), haematological anomalies (1 family), and lung disease (1 family). SMC5/6 complex is a highly conserved multi-subunit protein complex essential for repairing DNA damage and preventing replication stress. SMC5 has been associated with a developmental disorder. SMC6 patient-derived cell lines display a shared cellular phenotype (to SMC5) typified by chromosome instability with elevated replication stress and genome instability, exacerbated when exposed to genotoxins that stabilise G-quadruplex structures. Zebrafish models showed microcephaly and reduced length. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.83 | CMIP |
Eleanor Ludington gene: CMIP was added gene: CMIP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: CMIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CMIP were set to 42386996; 28504353; 22689534 Phenotypes for gene: CMIP were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.80 | GTF3C1 |
chirag patel gene: GTF3C1 was added gene: GTF3C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: GTF3C1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GTF3C1 were set to Neurodevelopmental disorder, MONDO:0700092, GTF3C1-related Review for gene: GTF3C1 was set to AMBER Added comment: ESHG 2026 6 individuals from 6 unrelated families (4 consanguineous) with biallelic variants in GTF3C1 which segregated with disease (6 missense, 1 nonsense). Phenotype included developmental delay, intellectual disability, microcephaly, cerebellar atrophy/hypoplasia, abnormal corpus callosum, arthrogryposis, and variable craniofacial features. GTF3C1 encodes a subunit within the general Transcription Factor IIIC (TFIIIC), which is involved general transcription factor activity via recruitment of RNA polymerase III for target gene transcription. Two other TFIIIC subunits, GTF3C3 and GTF3C5, have been implicated in neurodevelopmental disorders. Molecular modelling suggested missense variants disrupt intramolecular interactions, causing instability of the TFIIIC complex. Proteomic analysis using patient cell lines revealed significantly reduced GTF3C1 protein. A relative complex abundance assay demonstrated the five other subunits of the TFIIIC complex were also reduced, and suggests a loss-of-function mechanism. Gtf3c1 knockdown in mouse brain revealed impaired neuronal production and cell cycle exit. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.79 | NUAK1 |
chirag patel changed review comment from: 7 individuals from 5 unrelated consanguineous families with craniofacial dysmorphism (hypertelorism, DSPF, dental anomalies), neurodevelopmental issues, and omphalocele (2 families with LOF variants). WES identified 5 different homozygous variants (3 missense, 1 nonsense, 1 splice) which segregated with disease. NUAK1 has a kinase function and all variants were located in the kinase domain. Patient fibroblast assays showed reduced transcript and loss of NUAK1 protein for LOF variants. The missense variants had increased transcript and protein levels but had reduced kinase activity. Mouse models show abdominal wall defects. Xenopus models showed craniofacial defects and ventral body wall defects. Sources: Other; to: ESHG 2026 7 individuals from 5 unrelated consanguineous families with craniofacial dysmorphism (hypertelorism, DSPF, dental anomalies), neurodevelopmental issues, and omphalocele (2 families with LOF variants). WES identified 5 different homozygous variants (3 missense, 1 nonsense, 1 splice) which segregated with disease. NUAK1 has a kinase function and all variants were located in the kinase domain. Patient fibroblast assays showed reduced transcript and loss of NUAK1 protein for LOF variants. The missense variants had increased transcript and protein levels but had reduced kinase activity. Mouse models show abdominal wall defects. Xenopus models showed craniofacial defects and ventral body wall defects. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.78 | NUAK1 |
chirag patel gene: NUAK1 was added gene: NUAK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: NUAK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NUAK1 were set to Syndromic disease, MONDO: 0002254 Review for gene: NUAK1 was set to AMBER Added comment: 7 individuals from 5 unrelated consanguineous families with craniofacial dysmorphism (hypertelorism, DSPF, dental anomalies), neurodevelopmental issues, and omphalocele (2 families with LOF variants). WES identified 5 different homozygous variants (3 missense, 1 nonsense, 1 splice) which segregated with disease. NUAK1 has a kinase function and all variants were located in the kinase domain. Patient fibroblast assays showed reduced transcript and loss of NUAK1 protein for LOF variants. The missense variants had increased transcript and protein levels but had reduced kinase activity. Mouse models show abdominal wall defects. Xenopus models showed craniofacial defects and ventral body wall defects. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.71 | PDS5B | Zornitza Stark reviewed gene: PDS5B: Rating: GREEN; Mode of pathogenicity: None; Publications: 42431198; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, PDS5B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.69 | PDS5A | Zornitza Stark reviewed gene: PDS5A: Rating: GREEN; Mode of pathogenicity: None; Publications: 42431198; Phenotypes: Complex neurodevelopmental disorder, MONDO:0100038, PDS5A-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.68 | SYTL4 |
Zornitza Stark gene: SYTL4 was added gene: SYTL4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: SYTL4 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SYTL4 were set to 42531028 Phenotypes for gene: SYTL4 were set to Neurodevelopmental disorder, MONDO:0700092, SYTL4-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.67 | DMRTA2 |
Zornitza Stark gene: DMRTA2 was added gene: DMRTA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: DMRTA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DMRTA2 were set to 40541527; 26757254 Phenotypes for gene: DMRTA2 were set to Microcephaly, MONDO:0001149, DMRTA2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.66 | ELAVL2 |
Zornitza Stark gene: ELAVL2 was added gene: ELAVL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: ELAVL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ELAVL2 were set to 42556336 Phenotypes for gene: ELAVL2 were set to Neurodevelopmental disorder, MONDO:0700092, ELAVL2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.65 | ZIC1 |
chirag patel changed review comment from: 5 families with heterozygous mutations located in the final (third) exon of ZIC1 who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5-12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture. 2 sibs with BAIDCS, Vandervore et al. (2018) identified heterozygosity for a frameshift mutation in the ZIC1 gene. Neither parent had evidence of the mutation by whole-exome sequencing, suggesting that gonadal mosaicism for the mutation was present in one of the parents. Expression of the mutated allele was detected in patient fibroblasts by RT-PCR, evidence that the mutant mRNA did not undergo nonsense-mediated decay and probably generates an abnormal protein. Also heterozygous deletions of ZIC1 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum. Loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects. Sources: Expert list; to: Individuals with BAIDCS have microcephaly, brain anomalies (esp corpus callosum), intellectual disability (moderate to severe), and bicoronal synostosis. 5 families with heterozygous mutations located in the final (third) exon of ZIC1 who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5-12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture. 2 sibs with BAIDCS, Vandervore et al. (2018) identified heterozygosity for a frameshift mutation in the ZIC1 gene. Neither parent had evidence of the mutation by whole-exome sequencing, suggesting that gonadal mosaicism for the mutation was present in one of the parents. Expression of the mutated allele was detected in patient fibroblasts by RT-PCR, evidence that the mutant mRNA did not undergo nonsense-mediated decay and probably generates an abnormal protein. Also heterozygous deletions of ZIC1 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum. Loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.64 | PRKACB | chirag patel Phenotypes for gene: PRKACB were changed from Cardioacrofacial dysplasia 2, MIM# 619143; Postaxial hand polydactyly; Postaxial foot polydactyly; Common atrium; Atrioventricular canal defect; Narrow chest; Abnormality of the teeth; Intellectual disability to Cardioacrofacial dysplasia 2, MONDO:0030877 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.62 | HSPA9 | chirag patel Phenotypes for gene: HSPA9 were changed from Even-plus syndrome, OMIM 616854; skeletal anomalies; congenital cardiac and renal anom to Even-plus syndrome, MONDO:0014801 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.61 | PTPRG |
Bryony Thompson gene: PTPRG was added gene: PTPRG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: PTPRG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPRG were set to 37056996 Phenotypes for gene: PTPRG were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.60 | NPTN |
Zornitza Stark gene: NPTN was added gene: NPTN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NPTN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NPTN were set to 42387534 Phenotypes for gene: NPTN were set to neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.59 | KLC1 | Zornitza Stark reviewed gene: KLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.59 | NDUFA5 | Zornitza Stark reviewed gene: NDUFA5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Inborn mitochondrial metabolism disorder MONDO:0004069, NDUFA5-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.59 | ATP8B2 |
Zornitza Stark gene: ATP8B2 was added gene: ATP8B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: ATP8B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP8B2 were set to 39219493 Phenotypes for gene: ATP8B2 were set to Neurodevelopmental disorder MONDO:0700092, ATP8B2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.58 | YBX3 |
Zornitza Stark gene: YBX3 was added gene: YBX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: YBX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: YBX3 were set to 39423228; 38260399 Phenotypes for gene: YBX3 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.56 | GAK | Zornitza Stark reviewed gene: GAK: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder MONDO:0700092, GAK-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.56 | GRIPAP1 | Zornitza Stark Mode of inheritance for gene: GRIPAP1 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.54 | GRIPAP1 | Zornitza Stark reviewed gene: GRIPAP1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: GRIPAP1-related neurodevelopmental disorder MONDO:0001071; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.54 | NFIC |
Zornitza Stark gene: NFIC was added gene: NFIC was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature SV/CNV tags were added to gene: NFIC. Mode of inheritance for gene: NFIC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NFIC were set to 42498698 Phenotypes for gene: NFIC were set to Neurodevelopmental disorder, MONDO:0700092, NFIC-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.53 | GRIPAP1 |
Sangavi Sivagnanasundram gene: GRIPAP1 was added gene: GRIPAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: GRIPAP1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: GRIPAP1 were set to 28285821 Phenotypes for gene: GRIPAP1 were set to GRIPAP1-related neurodevelopmental disorder MONDO:0001071 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.52 | GAK |
Lucy Spencer gene: GAK was added gene: GAK was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: GAK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GAK were set to 37056996 Phenotypes for gene: GAK were set to neurodevelopmental disorder MONDO:0700092, GAK-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.51 | FIBCD1 |
Lucy Spencer gene: FIBCD1 was added gene: FIBCD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: FIBCD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FIBCD1 were set to 35916241 Phenotypes for gene: FIBCD1 were set to neurodevelopmental disorder MONDO:0700092, FIBCD1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.50 | CAMK4 | Zornitza Stark Phenotypes for gene: CAMK4 were changed from Global developmental delay; Intellectual disability; Autism; Behavioral abnormality; Abnormality of movement; Dystonia; Ataxia; Chorea; Myoclonus to Neurodevelopmental disorder, MONDO:0700092, CAMK4-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.48 | CAMK4 | Zornitza Stark reviewed gene: CAMK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 37070062, 37644014; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CAMK4-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.48 | LGALS3BP |
Bryony Thompson gene: LGALS3BP was added gene: LGALS3BP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: LGALS3BP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LGALS3BP were set to 37205765; 34728600 Phenotypes for gene: LGALS3BP were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.47 | KDM8 |
Bryony Thompson gene: KDM8 was added gene: KDM8 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: KDM8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KDM8 were set to 36795492 Phenotypes for gene: KDM8 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.44 | ASTN1 | Zornitza Stark edited their review of gene: ASTN1: Added comment: PMID 41544630 reports 18 individuals with NDDs from 12 unrelated families with bi-allelic, ultra-rare, predicted damaging variants in ASTN1. Clinical features ranged from mild to profound developmental delay or intellectual disability +/- autism, ADHD, and epilepsy. Other recurrent abnormalities included dysmorphic facial features, hypotonia, spasticity, and ataxia. The neuroradiographic phenotype ranged from normal to mild (a thin corpus callosum and cerebellar dysgenesis), to severe (polymicrogyria and lissencephaly).; Changed publications: 41544630, 29706646, 27431290, 26539891; Changed phenotypes: Neurodevelopmental disorder (MONDO:0700092), ASTN1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.44 | KIF6 |
Rylee Peters gene: KIF6 was added gene: KIF6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIF6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF6 were set to 30475797 Phenotypes for gene: KIF6 were set to Neurodevelopmental disorder, MONDO:0700092, KIF6-related Review for gene: KIF6 was set to RED Added comment: PMID: 30475797 describes a consanguineous family homozygous for a frameshift KIF6 variant (p.L398fsX2) presenting with macrocephaly, intellectual disability and developmental delay. Knock-in homozygous mouse model with analogous variant displayed severe, postnatal-onset hydrocephalus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.43 | ESRRG | Zornitza Stark Phenotypes for gene: ESRRG were changed from Movement disorder, MONDO:0005395, ESRRG-related to Movement disorder, congenital nonprogressive, with ataxia and eye movement abnormalities, MIM# 621639 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.42 | ESRRG | Zornitza Stark edited their review of gene: ESRRG: Changed phenotypes: Movement disorder, congenital nonprogressive, with ataxia and eye movement abnormalities, MIM# 621639 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.41 | NDUFA5 |
Sarah Milton gene: NDUFA5 was added gene: NDUFA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NDUFA5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA5 were set to 41916321 Phenotypes for gene: NDUFA5 were set to Mitochondrial disease, MONDO:0044970, NDUFA5-related Penetrance for gene: NDUFA5 were set to Complete |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.40 | GIGYF2 |
Zornitza Stark gene: GIGYF2 was added gene: GIGYF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: GIGYF2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: GIGYF2 were set to 42297935; 18358451; 33239198; 25279164; 20060621; 19250854; 26152800; 19449032 Phenotypes for gene: GIGYF2 were set to Neurodevelopmental disorder, MONDO:0700092, GIGYF2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.39 | LAMC3 | Zornitza Stark Phenotypes for gene: LAMC3 were changed from complex neurodevelopmental disorder MONDO:0100038; Cortical malformations, occipital, MIM# 614115 to Cortical malformations, occipital, MIM# 614115 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.38 | LAMC3 | Zornitza Stark Mode of inheritance for gene: LAMC3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.34 | SEMA6A |
chirag patel gene: SEMA6A was added gene: SEMA6A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SEMA6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SEMA6A were set to 38062045,22132072 Phenotypes for gene: SEMA6A were set to Neurodevelopmental disorder, MONDO:0700092; SEMA6A-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.33 | PREP |
chirag patel gene: PREP was added gene: PREP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: PREP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PREP were set to 42362369 Phenotypes for gene: PREP were set to Neurodevelopmental disorder (MONDO:0700092), PREP-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.32 | EIF1AX |
Rylee Peters gene: EIF1AX was added gene: EIF1AX was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: EIF1AX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: EIF1AX were set to 42337333 Phenotypes for gene: EIF1AX were set to Neurodevelopmental disorder, MONDO:0700092, EIF1AX-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.31 | GSK3B |
Rylee Peters gene: GSK3B was added gene: GSK3B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: GSK3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GSK3B were set to 39472663 Phenotypes for gene: GSK3B were set to Neurodevelopmental disorder, MONDO:0700092, GSK3B-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.30 | USP34 |
Sarah Milton gene: USP34 was added gene: USP34 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: USP34 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: USP34 were set to 42315110; 39117575 Phenotypes for gene: USP34 were set to Neurodevelopmental disorder, MONDO:0700092-USP34 related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.29 | MED20 |
Sarah Milton gene: MED20 was added gene: MED20 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: MED20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MED20 were set to 25446406; 10.21203/rs.3.rs-9516499/v1 Phenotypes for gene: MED20 were set to Neurodevelopmental disorder, MONDO:0700092, MED20-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.27 | KLC1 |
Sangavi Sivagnanasundram gene: KLC1 was added gene: KLC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KLC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KLC1 were set to 42372486 Phenotypes for gene: KLC1 were set to KLC1-related neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.26 | GIT1 |
Sarah Milton gene: GIT1 was added gene: GIT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: GIT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GIT1 were set to 42360756 Phenotypes for gene: GIT1 were set to Neurodevelopmental disorder, MONDO:0700092, GIT1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.23 | FSD1L | Zornitza Stark reviewed gene: FSD1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 41720098; Phenotypes: Neurodevelopmental disorder with seizures, spastic tetraparesis, and vision impairment, MIM# 621643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.23 | ZRANB1 |
chirag patel gene: ZRANB1 was added gene: ZRANB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: ZRANB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZRANB1 were set to 38099646 Phenotypes for gene: ZRANB1 were set to Neurodevelopmental disorder, MONDO:0700092, ZRANB1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.20 | TMEM63B | Zornitza Stark Mode of inheritance for gene: TMEM63B was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.19 | TMEM63B | Zornitza Stark edited their review of gene: TMEM63B: Added comment: PMID: 42259295 Chan et al 2026 report five individuals from four unrelated families with childhood interstitial lung disease and biallelic predicted loss-of-function variants in TMEM63B. Other phenotypic characteristics include moderate/severe developmental delay (5/5), white matter changes, (1/5), mild global atrophy on brain imaging (1/5) and severe short stature (2/5). None of the individuals had epilepsy or hearing loss. Individuals were from Saudi Arabian, Malay, European and Native American ethnicities. 5 different variants were reported including nonsense, frameshift and splice donor variants. The authors report that while there are 53 TMEM63B pLoF variants in gnomAD v.4.1.0 database none are in the homozygous state. Histopathological examination of lung tissue also showed a pattern consistent with surfactant dysfunction. The authors conclude that biallelic loss of function variants result in a distinct pulmonary-predominant phenotype characterized by hypoxaemia, early-onset respiratory failure, histological features of surfactant dysfunction, and chest imaging consistent with chILD.; Changed publications: 37421948, 42259295; Changed phenotypes: Developmental and epileptic encephalopathy 118, MIM# 621250, Hereditary pulmonary alveolar proteinosis, MONDO:0012580, TMEM63B-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.17 | NRXN1 |
Sarah Milton Source Genetic Health Queensland was removed from NRXN1. Source Literature was added to NRXN1. Mode of inheritance for gene NRXN1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Phenotypes for gene: NRXN1 were changed from Pitt-Hopkins-like syndrome 2 - MIM#614325 to Pitt-Hopkins-like syndrome 2 - MIM#614325; Complex neurodevelopmental disorder, MONDO:0100038, NRXN1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.14 | SMG5 |
Zornitza Stark gene: SMG5 was added gene: SMG5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: SMG5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SMG5 were set to 41758221 Phenotypes for gene: SMG5 were set to Neurodevelopmental disorder, MONDO:0700092, SMG5-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.13 | SF3B3 |
Zornitza Stark gene: SF3B3 was added gene: SF3B3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SF3B3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SF3B3 were set to 41709284 Phenotypes for gene: SF3B3 were set to Neurodevelopmental disorder, MONDO:0700092, SF3B3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.12 | INTS6 | Zornitza Stark Phenotypes for gene: INTS6 were changed from Neurodevelopmental disorder, MONDO:0700092, INTS6-related to Intellectual developmental disorder, autosomal dominant 78, MIM# 621627 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.11 | INTS6 | Zornitza Stark reviewed gene: INTS6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 78, MIM# 621627; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.11 | NLGN2 |
Zornitza Stark gene: NLGN2 was added gene: NLGN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: NLGN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NLGN2 were set to 37506563; 32405903; 27865048; 22820233 Phenotypes for gene: NLGN2 were set to Neurodevelopmental disorder, MONDO:0700092, NLGN2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.10 | HDAC2 |
Lucy Spencer gene: HDAC2 was added gene: HDAC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: HDAC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HDAC2 were set to 30806031; 27620904; 38753158 Phenotypes for gene: HDAC2 were set to Neurodevelopmental disorder (MONDO:0700092), HDAC2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.9 | DOP1A |
Zornitza Stark gene: DOP1A was added gene: DOP1A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: DOP1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: DOP1A were set to 42164854; 38818041 Phenotypes for gene: DOP1A were set to Neurodevelopmental disorder, MONDO:0700092, DOP1A-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.7 | MAGED1 |
Sarah Milton gene: MAGED1 was added gene: MAGED1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAGED1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: MAGED1 were set to 42162770 Phenotypes for gene: MAGED1 were set to Neurodevelopmental disorder, MONDO:0700092, MAGED1-related Review for gene: MAGED1 was set to AMBER Added comment: MAGED1 encodes Melanoma-Associated Antigen D1. It is expressed in the developing brain and is involved in controlling cell cycle progression and neuronal apoptosis. PMID 42162770 reports two unrelated male probands with de novo variants in MAGED1 presenting with epileptic spasms and severe intellectual disability. One frameshift and one missense variant we observed. It should be noted the missense variant was present in gnomAD v4 with 3 heterozygotes. Functional studies were performed demonstrating altered protein interactions and changes to cell cycle progression. Proposed mechanism of disease (GOF vs LOF) remains unclear. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.834 | MAGED1 |
Sarah Milton gene: MAGED1 was added gene: MAGED1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: MAGED1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: MAGED1 were set to 42162770 Phenotypes for gene: MAGED1 were set to Neurodevelopmental disorder, MONDO:0700092, MAGED1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.6 | DSCAM | chirag patel reviewed gene: DSCAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 42063257, 28600779, 33170561; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), DSCAM-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.4 | DSCAM | chirag patel Mode of inheritance for gene: DSCAM was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.2 | SPEN | chirag patel Phenotypes for gene: SPEN were changed from Radio-Tartaglia syndrome, MIM# 619312; Intellectual disability; autism; congenital anomalies to Radio-Tartaglia syndrome, MIM# 619312 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.1 | SNORD116-1 |
Boris Keren gene: SNORD116-1 was added gene: SNORD116-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNORD116-1 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Publications for gene: SNORD116-1 were set to PMID: 24916642 Phenotypes for gene: SNORD116-1 were set to Intellectual disability, obesity, hypotonia Penetrance for gene: SNORD116-1 were set to Complete Mode of pathogenicity for gene: SNORD116-1 was set to Other Review for gene: SNORD116-1 was set to GREEN gene: SNORD116-1 was marked as current diagnostic Added comment: The paternal deletion of the SNORD166 cluster is the critical region of Prader Willi syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.832 | HDAC2 |
Lucy Spencer gene: HDAC2 was added gene: HDAC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: HDAC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HDAC2 were set to 30806031; 27620904; 38753158 Phenotypes for gene: HDAC2 were set to Neurodevelopmental disorder (MONDO:0700092), HDAC2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAL | Gene migrated from ENSG00000172005 to ENSG00000172005 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BMAL1 | Gene symbol changed from ARNTL to BMAL1 during gene set migration (ENSG00000133794 -> ENSG00000133794) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.831 | CLUAP1 |
Sarah Milton gene: CLUAP1 was added gene: CLUAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature,Literature Mode of inheritance for gene: CLUAP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CLUAP1 were set to 34209753; 28679688; 26820066 Phenotypes for gene: CLUAP1 were set to Leber congenital amaurosis, MONDO:0018998, CLUAP1-related; Ciliopathy, MONDO:0005308, CLUAP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.830 | PTPRD |
Sarah Milton gene: PTPRD was added gene: PTPRD was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: PTPRD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPRD were set to 37056996; 31088393; 38890753 Phenotypes for gene: PTPRD were set to Neurodevelopmental disorder, MONDO:0700092, PTPRD related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.829 | TMEM161B |
Zornitza Stark gene: TMEM161B was added gene: TMEM161B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: TMEM161B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM161B were set to 37486637; 36669109; 36669111 Phenotypes for gene: TMEM161B were set to Neurodevelopmental disorder, MONDO:0700092, TMEM161B-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.827 | IRF2BP1 |
Zornitza Stark gene: IRF2BP1 was added gene: IRF2BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: IRF2BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: IRF2BP1 were set to 38091987; 37501076 Phenotypes for gene: IRF2BP1 were set to Neurodevelopmental disorder, MONDO:0700092, IRF2BP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.826 | DENR |
Zornitza Stark gene: DENR was added gene: DENR was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: DENR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DENR were set to 27239039 Phenotypes for gene: DENR were set to Neurodevelopmental disorder, MONDO:0700092, DENR-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.824 | NCOR1 |
Bryony Thompson gene: NCOR1 was added gene: NCOR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NCOR1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: NCOR1 were set to 32034166; 31849593; 30664766; 30289594; 29483668 Phenotypes for gene: NCOR1 were set to complex neurodevelopmental disorder, MONDO:0100038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.820 | PLAT |
Zornitza Stark gene: PLAT was added gene: PLAT was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen,ClinGen disputed tags were added to gene: PLAT. Mode of inheritance for gene: PLAT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLAT were set to 39574431; 37808270; 27417437 Phenotypes for gene: PLAT were set to Syndromic disease, MONDO:0002254, PLAT-related; Thrombophilia, familial, due to decreased release of tissue plasminogen activator MONDO:0012872 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.817 | NLGN1 | Zornitza Stark Mode of inheritance for gene: NLGN1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.813 | FEM1C | Zornitza Stark reviewed gene: FEM1C: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, FEM1C-related MONDO:0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.806 | UBA7 |
Bryony Thompson gene: UBA7 was added gene: UBA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: UBA7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UBA7 were set to 42023152; 33710394; 28397838 Phenotypes for gene: UBA7 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.805 | MELK |
Zornitza Stark gene: MELK was added gene: MELK was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: MELK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MELK were set to 41973119 Phenotypes for gene: MELK were set to Neurodevelopmental disorder, MONDO:0700092, MELK-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.804 | CECR2 |
Lucy Spencer gene: CECR2 was added gene: CECR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: CECR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CECR2 were set to 41964217; 37424722 Phenotypes for gene: CECR2 were set to Neurodevelopmental disorder, MONDO:0700092, CECR2-related; neural tube defects, susceptibility to MONDO:0020705, CECR2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.803 | MACF1 | Lucy Spencer Phenotypes for gene: MACF1 were changed from Lissencephaly 9 with complex brainstem malformation, MIM# 618325 to Lissencephaly 9 with complex brainstem malformation, MIM#618325; Neurodevelopmental disorder (MONDO:0700092), MACF1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.802 | MACF1 | Lucy Spencer Mode of inheritance for gene: MACF1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.800 | SRRM4 |
chirag patel gene: SRRM4 was added gene: SRRM4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SRRM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SRRM4 were set to 41958152 Phenotypes for gene: SRRM4 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM4-related Mode of pathogenicity for gene: SRRM4 was set to Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.799 | RPS4X |
chirag patel gene: RPS4X was added gene: RPS4X was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: RPS4X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: RPS4X were set to 42031741 Phenotypes for gene: RPS4X were set to Neurodevelopmental disorder, MONDO:0700092, RPS4X-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.798 | DRD1 |
chirag patel gene: DRD1 was added gene: DRD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: DRD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DRD1 were set to 41966088; 37048120 Phenotypes for gene: DRD1 were set to Neurodevelopmental disorder, MONDO:0700092, DRD1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.797 | CDK6 | chirag patel Phenotypes for gene: CDK6 were changed from Microcephaly 12, primary, autosomal recessive, MONDO:0014484 to Microcephaly 12, primary, autosomal recessive, MONDO:0014484 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.799 | CDK6 | chirag patel Phenotypes for gene: CDK6 were changed from Microcephaly 12, primary, autosomal recessive, MONDO:0014484 to Microcephaly 12, primary, autosomal recessive, MONDO:0014484 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.799 | CDK6 | chirag patel Phenotypes for gene: CDK6 were changed from Microcephaly 12, primary, autosomal recessive, MONDO:0014484 to Microcephaly 12, primary, autosomal recessive, MONDO:0014484 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.798 | CDK6 | chirag patel Phenotypes for gene: CDK6 were changed from Microcephaly 12, primary, autosomal recessive, MIM#616080 to Microcephaly 12, primary, autosomal recessive, MONDO:0014484 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.787 | MDGA1 |
chirag patel gene: MDGA1 was added gene: MDGA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: MDGA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MDGA1 were set to 41862769; 40585099 Phenotypes for gene: MDGA1 were set to Neurodevelopmental disorder, MONDO:0700092, MDGA1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.780 | SUPT4H1 | Freeman A reviewed gene: SUPT4H1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 41842694; Phenotypes: intellectual disability, motor disability, speech impairment, dystonia, craniofacial dysmorphism, skeletal anomalies, enamel hypoplasia.; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.777 | SUPT6H |
Lucy Spencer gene: SUPT6H was added gene: SUPT6H was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: SUPT6H was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SUPT6H were set to 41864309 Phenotypes for gene: SUPT6H were set to Neurodevelopmental disorder, MONDO:0700092, SUPT6H-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.776 | WWP1 |
Zornitza Stark gene: WWP1 was added gene: WWP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: WWP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WWP1 were set to 41786693; 32699206 Phenotypes for gene: WWP1 were set to Neurodevelopmental disorder, MONDO:0700092, WWP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.772 | KLHL15 |
Zornitza Stark edited their review of gene: KLHL15: Added comment: Additional male individual presenting with impaired intelligence, short stature, frequent hypoglycaemia and periodic fever. Hemizygous variant was identified in the proband c.736 C>T p.(Arg246*) - absent from gnomAD v4.1; Changed rating: GREEN; Changed publications: 25644381, 24817631, 37452054; Changed phenotypes: intellectual disability, X-linked 103 MONDO:0010508 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.768 | OLA1 |
Zornitza Stark gene: OLA1 was added gene: OLA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: OLA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OLA1 were set to 41887223 Phenotypes for gene: OLA1 were set to Neurodevelopmental disorder, MONDO:0700092, OLA1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.766 | NPRL2 |
Lucy Spencer changed review comment from: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy; PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2 PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2 PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad Borderline amber/green for this panel Sources: Literature; to: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy; PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2 PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2 PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.766 | SUPT4H1 |
Sarah Milton gene: SUPT4H1 was added gene: SUPT4H1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SUPT4H1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SUPT4H1 were set to 41842694 Phenotypes for gene: SUPT4H1 were set to Syndromic disease, MONDO:0002254, SUPT4H1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.763 | ATG12 |
Sangavi Sivagnanasundram gene: ATG12 was added gene: ATG12 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: ATG12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATG12 were set to 41895291 Phenotypes for gene: ATG12 were set to ATG12-related neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.761 | NDUFA5 |
Zornitza Stark gene: NDUFA5 was added gene: NDUFA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NDUFA5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA5 were set to 41916321 Phenotypes for gene: NDUFA5 were set to Complex I deficiency Penetrance for gene: NDUFA5 were set to Complete |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.759 | SLC20A2 | Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.757 | SLC20A2 |
Zornitza Stark edited their review of gene: SLC20A2: Added comment: PMID 41458256: Reports a single individual a homozygous nonsense SLC20A2 variant presenting with infantile primary familial brain calcification, cerebral arterial vasculopathy and ischaemic stroke. Individual exhibited seizures, hypotonia, poor feeding, and extensive ischaemic changes. PMID 35881308: reports two siblings from a consanguineous Turkish family with a homozygous splice‑site loss‑of‑function variant NM_006749.5:c.1794+1G>A. The affected children presented with severe paediatric‑onset features resembling congenital CMV infection: growth retardation, bilateral cataracts, microcephaly, seizures, cerebral atrophy, corpus callosum hypoplasia and brain microcalcifications. Gene is classically associated with a milder mono-allelic disorder, which typically does not involve ID.; Changed rating: AMBER; Changed publications: 41458256, 35881308; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.756 | MAU2 | Zornitza Stark reviewed gene: MAU2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cornelia de Lange syndrome 7, MIM# 621570; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.752 | NPRL2 |
Lucy Spencer gene: NPRL2 was added gene: NPRL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NPRL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NPRL2 were set to 26505888; 34376795; 40804712; 30093711 Phenotypes for gene: NPRL2 were set to epilepsy, familial focal, with variable foci 2 (MIM#617116) Review for gene: NPRL2 was set to AMBER Added comment: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy; PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2 PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2 PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad Borderline amber/green for this panel Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.751 | IQSEC2 | Zornitza Stark Phenotypes for gene: IQSEC2 were changed from Intellectual developmental disorder, X-linked 1 MIM#309530, MONDO:0010656; Severe intellectual disability-progressive postnatal microcephaly- midline stereotypic hand movements syndrome MONDO:0018347 to Intellectual developmental disorder, X-linked 1, MIM# 309530; Neurodevelopmental disorder, X-linked, with poor or absent speech and behavioral abnormalities, MIM# 301164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.750 | IQSEC2 | Zornitza Stark edited their review of gene: IQSEC2: Changed phenotypes: Intellectual developmental disorder, X-linked 1, MIM# 309530, Neurodevelopmental disorder, X-linked, with poor or absent speech and behavioral abnormalities, MIM# 301164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.749 | EMX2 |
Krithika Murali changed review comment from: PMID: 25577462 Lin et al 2014 - novel, heterozygous EMX2 PTC variant (p.E142X) identified in an XX female with didelphic uterus, variant inheritance unknown. Western blot and functional studies indicated formation of a truncated protein with dominant-negative effect. Variant was identified through direct sequencing of EMX2 in a cohort of 517 patients with incomplete Mullerian fusion. PMID: 33434492 Chen et al 2021 AJHG, identified a novel, heterozygous EMX2 PTC variant (p.Tyr120ter) in a female with type I MKHS (inheritance unknown). Identified through exome-sequencing in an MKHS cohort. PMID: 34829455 Miclea et al 2021 (Diagnostic) - large panel sequencing performed in a DSD cohort. Novel missense (inheritance unknown) - p.Arg205Gln - identified in a 4 yo XY male with hypospadius, GDD/ID, Pierre-robin sequence, hydrocephalus. Variant located in the DNA binding domain, classified as VUS. PMID: 41765865 Stamou et al 2026 (Genetics in Medicine) performed trio WES on an idiopathic hypogonadotrophic hypogonadism cohort. 3 de novo CNVs that included 18 genes in the minimal critical region including EMX2 in individuals with DSD and developmental delay. In addition, x2 unrelated individuals with DSD, dev delay, hearing loss had a heterozygous de novo p.Lys199Gln missense variant located in the DNA binding domain. x1 individual identified with crytorchidism and a heterozygous Ser111Ter variant (inheritance unknown). Based on the current evidence: - Green for hypogonadotrophic hypogonadism and DSD - Amber for ID - based on 3 unrelated individuals with dev delay and variants in the DNA binding domain (p.Arg205Gln, p.Lys199Gln) - Red for Pierre-Robin sequence; to: PMID: 25577462 Lin et al 2014 - novel, heterozygous EMX2 PTC variant (p.E142X) identified in an XX female with didelphic uterus, variant inheritance unknown. Western blot and functional studies indicated formation of a truncated protein with dominant-negative effect. Variant was identified through direct sequencing of EMX2 in a cohort of 517 patients with incomplete Mullerian fusion. PMID: 33434492 Chen et al 2021 AJHG, identified a novel, heterozygous EMX2 PTC variant (p.Tyr120ter) in a female with type I MKHS (inheritance unknown). Identified through exome-sequencing in an MKHS cohort. PMID: 34829455 Miclea et al 2021 (Diagnostic) - large panel sequencing performed in a DSD cohort. Novel missense (inheritance unknown) - p.Arg205Gln - identified in a 4 yo XY male with hypospadius, GDD/ID, Pierre-robin sequence, hydrocephalus. Variant located in the DNA binding domain, classified as VUS. PMID: 41765865 Stamou et al 2026 (Genetics in Medicine) performed trio WES on an idiopathic hypogonadotrophic hypogonadism cohort. 3 de novo CNVs detected in individuals with DSD and developmental delay - 18 genes including EMX2 in the minimal critical region. In addition, x2 unrelated individuals with DSD, dev delay, hearing loss had a heterozygous de novo p.Lys199Gln missense variant located in the DNA binding domain. x1 individual identified with crytorchidism and a heterozygous Ser111Ter variant (inheritance unknown). Based on the current evidence: - Green for hypogonadotrophic hypogonadism and DSD - Amber for ID - based on 3 unrelated individuals with dev delay and variants in the DNA binding domain (p.Arg205Gln, p.Lys199Gln) - Red for Pierre-Robin sequence |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.743 | DIP2B | Bryony Thompson edited their review of gene: DIP2B: Added comment: PMID 33688487 reports two siblings from one family with a heterozygous splice‑site loss‑of‑function DIP2B variant causing moderate intellectual disability.; Changed rating: RED; Changed publications: 33688487; Changed phenotypes: intellectual disability MONDO:0001071; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.742 | WSB2 | Zornitza Stark reviewed gene: WSB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Luo-Agrawal neurodevelopmental syndrome, MIM# 621552; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.742 | KCNJ4 |
chirag patel gene: KCNJ4 was added gene: KCNJ4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: KCNJ4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNJ4 were set to 41830586 Phenotypes for gene: KCNJ4 were set to Neurodevelopmental disorder, MONDO:0700092, KCNJ4-related Mode of pathogenicity for gene: KCNJ4 was set to Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.741 | WDTC1 |
Lucy Spencer gene: WDTC1 was added gene: WDTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: WDTC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WDTC1 were set to 41793087 Phenotypes for gene: WDTC1 were set to Neurodevelopmental disorder MONDO:0700092, WDTC1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.729 | ASAH2 |
Zornitza Stark gene: ASAH2 was added gene: ASAH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: ASAH2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ASAH2 were set to 41808410 Phenotypes for gene: ASAH2 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.726 | ABCB7 |
Lucy Spencer gene: ABCB7 was added gene: ABCB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABCB7 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: ABCB7 were set to 11050011; 26242992 Phenotypes for gene: ABCB7 were set to Anaemia, sideroblastic, with ataxia, MIM# 301310 Review for gene: ABCB7 was set to AMBER Added comment: Some limited reports of developmental delay/ID in the literature and mentioned in the ClinGen review Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.713 | POC1A | chirag patel reviewed gene: POC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 39662966; Phenotypes: Short stature-onychodysplasia-facial dysmorphism-hypotrichosis syndrome, MONDO:0013894; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.711 | TRIM71 | Zornitza Stark edited their review of gene: TRIM71: Added comment: PMID 38833623 reports 20 individuals from 13 unrelated families with heterozygous de novo or rare inherited TRIM71 variants (missense, nonsense, splice‑site, frameshift) presenting with congenital hydrocephalus/ventriculomegaly, developmental delay, dysmorphic features, corpus callosum dysgenesis, white‑matter hypoplasia, limb and craniofacial anomalies, hearing and cardiac defects. Functional studies in HEK293T cells show NHL‑domain missense variants impair binding to CDKN1A/EGR1 and disrupt P‑body localization, supporting loss‑of‑function/altered‑function mechanisms.; Changed publications: 40892928, 38833623 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.711 | TRIM71 |
Zornitza Stark gene: TRIM71 was added gene: TRIM71 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: TRIM71 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TRIM71 were set to 29983323; 32168371; 30975633; 40892928 Phenotypes for gene: TRIM71 were set to Congenital hydrocephalus 4 (MIM#618667) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.709 | TNK2 |
Sarah Milton gene: TNK2 was added gene: TNK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: TNK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: TNK2 were set to 27977884; 23686771; 31517310 Phenotypes for gene: TNK2 were set to late onset infantile epilepsy; Mayer-Rokitansky-Küster-Hauser syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.705 | PDS5B |
chirag patel gene: PDS5B was added gene: PDS5B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: PDS5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PDS5B were set to 10.64898/2026.02.23.26346364 Phenotypes for gene: PDS5B were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.705 | PDS5A |
chirag patel gene: PDS5A was added gene: PDS5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: PDS5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PDS5A were set to 10.64898/2026.02.23.26346364; 30158690 Phenotypes for gene: PDS5A were set to Complex neurodevelopmental disorder, MONDO:0100038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.704 | FMO4 |
chirag patel gene: FMO4 was added gene: FMO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: FMO4 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: FMO4 were set to 41714691, 28940097 Phenotypes for gene: FMO4 were set to Neurodevelopmental disorder, MONDO:0700092; FMO4 related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.701 | NRDC | Zornitza Stark reviewed gene: NRDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 41734767, 41449824, 28017472; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, NRDC-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.701 | VWA3B |
Zornitza Stark gene: VWA3B was added gene: VWA3B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for gene: VWA3B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VWA3B were set to 26157035; 41673450; 37772257 Phenotypes for gene: VWA3B were set to Spinocerebellar ataxia, autosomal recessive 22 MIM#616948 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.700 | XPOT |
Zornitza Stark gene: XPOT was added gene: XPOT was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature preprint tags were added to gene: XPOT. Mode of inheritance for gene: XPOT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: XPOT were set to 10.64898/2026.01.28.26344748 Phenotypes for gene: XPOT were set to Syndromic disease, MONDO:0002254 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.699 | WDR59 |
Zornitza Stark gene: WDR59 was added gene: WDR59 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature founder tags were added to gene: WDR59. Mode of inheritance for gene: WDR59 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR59 were set to 41715954 Phenotypes for gene: WDR59 were set to Syndromic disease, MONDO:0002254 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.698 | WAPL |
Zornitza Stark gene: WAPL was added gene: WAPL was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature preprint tags were added to gene: WAPL. Mode of inheritance for gene: WAPL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WAPL were set to 10.64898/2026.02.23.26346364; 30158690 Phenotypes for gene: WAPL were set to complex neurodevelopmental disorder, MONDO:0100038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.697 | C17orf80 |
Zornitza Stark gene: C17orf80 was added gene: C17orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature new gene name tags were added to gene: C17orf80. Mode of inheritance for gene: C17orf80 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C17orf80 were set to 41720819 Phenotypes for gene: C17orf80 were set to Mitochondrial disease, MONDO:0044970 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.696 | RDH11 |
Lucy Spencer changed review comment from: PMID: 41459630 proband with oligodontia and malocclusion, dysmorphic hands and feet, microcephaly, ASD but otherwise normal development, homozygous for Cys72*. following the genetic findings the proband had an ophthalmological examination which showed a mild retinopathy consisting of yellow deposits and hyperpigmentation within the RPE, but the patient was visually asymptomatic at age 7. However in the original family PMID: 24916380 progressive visual acuity decrease did not occur until ages 10 or 8 in the 3 affected siblings. This family also had widely spaced oligodontia and malocclusion.; to: PMID: 41459630 proband with oligodontia and malocclusion, dysmorphic hands and feet, microcephaly, ASD but otherwise normal development, homozygous for Cys72*. following the genetic findings the proband had an ophthalmological examination which showed a mild retinopathy consisting of yellow deposits and hyperpigmentation within the RPE, but the patient was visually asymptomatic at age 7. However in the original family PMID: 24916380 progressive visual acuity decrease did not occur until ages 10 or 8 in the 3 affected siblings. This family also had widely spaced oligodontia and malocclusion. ID also reported in PMID: 24916380 and PMID 34988992 families |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.695 | RDH11 |
Lucy Spencer gene: RDH11 was added gene: RDH11 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list Mode of inheritance for gene: RDH11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RDH11 were set to 24916380; 15634683; 30731079; 18326732 Phenotypes for gene: RDH11 were set to Retinal dystrophy, juvenile cataracts, and short stature syndrome, MIM# 616108 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.690 | JKAMP |
Zornitza Stark gene: JKAMP was added gene: JKAMP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: JKAMP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: JKAMP were set to 41643666 Phenotypes for gene: JKAMP were set to Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM# 621533 Review for gene: JKAMP was set to GREEN Added comment: 14 individuals from 10 families reported. All had moderate to profound neurodevelopmental delay, intellectual disability, and infantile-onset epilepsy. Six were nonverbal, and the remaining individuals spoke only a few words. Five individuals had neurodevelopmental regression. Three individuals died suddenly; death was associated with seizures or status epilepticus in two. Thirteen individuals had hypotonia, 5 had visual impairment, 5 had microcephaly, and 1 had hearing loss. Brain MRIs showed cortical or cerebral atrophy in 11, delayed myelination in 6, and diffuse demyelinating disease in 1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.688 | RBFOX3 |
Lucy Spencer gene: RBFOX3 was added gene: RBFOX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: RBFOX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RBFOX3 were set to 35951651; 36117209; 24039908; 40011789 Phenotypes for gene: RBFOX3 were set to Neurodevelopmental disorder (MONDO:0700092), RBFOX3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.678 | PPP1R12A | Zornitza Stark Phenotypes for gene: PPP1R12A were changed from Intellectual disability; holoprosencephaly; disorder of sex development to Genitourinary and/or/brain malformation syndrome MIM#618820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.677 | PPP1R12A | Zornitza Stark edited their review of gene: PPP1R12A: Changed phenotypes: Genitourinary and/or/brain malformation syndrome MIM#618820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.676 | NAV2 |
Zornitza Stark gene: NAV2 was added gene: NAV2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: NAV2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAV2 were set to PMID:35218524 Phenotypes for gene: NAV2 were set to Developmental delay; cerebellar hypoplasia; cerebellar dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.674 | RSF1 |
Rylee Peters gene: RSF1 was added gene: RSF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: RSF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RSF1 were set to 41606215 Phenotypes for gene: RSF1 were set to Neurodevelopmental disorder, MONDO:0700092, RSF1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.673 | EXOC8 |
Bryony Thompson gene: EXOC8 was added gene: EXOC8 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: EXOC8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOC8 were set to 32103185; 22700954; 36344539; 35460391 Phenotypes for gene: EXOC8 were set to neurodevelopmental disorder with microcephaly, seizures, and brain atrophy MONDO:0033662 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.672 | ARHGEF2 |
Bryony Thompson gene: ARHGEF2 was added gene: ARHGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARHGEF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ARHGEF2 were set to 28453519 Phenotypes for gene: ARHGEF2 were set to neurodevelopmental disorder with midbrain and hindbrain malformations MONDO:0056797 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.671 | CDK4 | Zornitza Stark Phenotypes for gene: CDK4 were changed from Neurodevelopmental disorder, MONDO:0700092, CDK4-related to Microcephaly 31, primary, autosomal recessive, MIM# 621507 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.670 | CDK4 | Zornitza Stark edited their review of gene: CDK4: Changed phenotypes: Microcephaly 31, primary, autosomal recessive, MIM# 621507 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.669 | EPG5 | Zornitza Stark edited their review of gene: EPG5: Added comment: Neurodevelopmental disorder with parkinsonism or other movement abnormalities (NEDPAM) is an autosomal recessive disorder characterized by mild to severe developmental delay or intellectual disability and movement abnormalities including spasticity, early onset-parkinsonism with dystonia, myoclonus, or a combination of these. Movement abnormalities may have onset from birth to adulthood in the sixth decade of life. Adolescent-onset dystonia and parkinsonism on the background of neurodevelopmental delay may be rapidly progressive, with cognitive decline. Patients may have additional features such as seizures and optic nerve atrophy. PMIDs 41053928, 36410285 and 40192014 report over 100 affected individuals.; Changed publications: 23222957, 26917586, 41053928, 36410285, 40192014; Changed phenotypes: Vici syndrome, MIM# 242840, Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.668 | FSCN1 | Lilian Rudd reviewed gene: FSCN1: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 40874942; Phenotypes: neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.668 | RAPGEF2 |
Bryony Thompson gene: RAPGEF2 was added gene: RAPGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature STR tags were added to gene: RAPGEF2. Mode of inheritance for gene: RAPGEF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAPGEF2 were set to 41556274; 30636905 Phenotypes for gene: RAPGEF2 were set to Neurodevelopmental disorder, MONDO:0700092; amyotrophic lateral sclerosis MONDO:0004976 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.666 | PTBP1 | Zornitza Stark reviewed gene: PTBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: STAD syndrome, MIM# 621495; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.665 | PRODH | Krithika Murali reviewed gene: PRODH: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID 34285201, 17412540, 18197084, 12525555; Phenotypes: hyperprolinemia type 1 - MONDO:0009400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.665 | CELSR1 |
Rylee Peters changed review comment from: GREEN rating for biallelic neurodevelopmental disorder association PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature; to: GREEN rating for biallelic neurodevelopmental disorder association PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants associated with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.664 | CELSR1 |
Rylee Peters changed review comment from: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature; to: GREEN rating for biallelic neurodevelopmental disorder association PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.663 | CELSR1 |
Rylee Peters gene: CELSR1 was added gene: CELSR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELSR1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CELSR1 were set to 41530147; 36453712 Review for gene: CELSR1 was set to GREEN Added comment: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.662 | TTBK1 |
Zornitza Stark gene: TTBK1 was added gene: TTBK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: TTBK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTBK1 were set to 41545183 Phenotypes for gene: TTBK1 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.661 | TMEM189 |
chirag patel gene: TMEM189 was added gene: TMEM189 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: TMEM189 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM189 were set to 41491239 Phenotypes for gene: TMEM189 were set to Neurodevelopmental disorder, MONDO:0700092, PEDS1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.659 | MAP2K4 |
Sangavi Sivagnanasundram gene: MAP2K4 was added gene: MAP2K4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAP2K4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAP2K4 were set to 41480045 Phenotypes for gene: MAP2K4 were set to Neurodevelopmental disorder, MONDO:0700092 Mode of pathogenicity for gene: MAP2K4 was set to Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.656 | CTNND2 |
Zornitza Stark edited their review of gene: CTNND2: Added comment: PMID 41502569 (preprint) reports phenotypic and molecular information for 57 individuals, 42 previously unpublished, with heterozygous CTNND2 variants. The 41 CTNND2 variants included 12 previously reported loss-of-function- and one missense variant, and 28 novel variants comprising 10 missense and 18 predicted loss-of-function changes. Eight of the novel variants occurred de novo, and 12 were inherited from a parent with a neurodevelopmental phenotype. The most common clinical features were developmental delay (90%), intellectual disability (74%), and behavioral abnormalities (79%). Functional studies revealed impaired early neurogenesis in one patient-derived line, characterized by aberrant neural rosette formation. Transcriptome analysis showed dysregulated WNT signaling, and partial rescue of these defects was achieved by modulating the WNT pathway, highlighting δ-catenin's role in early neural development. Note several of the reported missense variants in this gene have high gnomAD counts so these should be interpreted with caution. Nevertheless, large number of individuals reported now with LoF variants and NDD phenotype.; Changed rating: GREEN; Changed publications: 25839933, 29127138, 25807484, 41502569; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CTNND2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.655 | PGBD5 |
Zornitza Stark gene: PGBD5 was added gene: PGBD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PGBD5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PGBD5 were set to 41533792 Phenotypes for gene: PGBD5 were set to Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482 Review for gene: PGBD5 was set to GREEN Added comment: 10 individuals reported from 5 consanguineous families with bi-allelic variants in this gene and global developmental delay with impaired intellectual development, delayed motor skills, and motor abnormalities. Affected individuals were unable to speak or walk due to peripheral spasticity, ataxia, or hypotonia, and developed early-onset seizures. Additional features included dysmorphic facies, short stature, and brain imaging abnormalities, such as thin corpus callosum and cerebellar atrophy. Pgbd5-null mice were runted and had significantly smaller brains compared to wildtype. Mutant mice showed increased locomotor activity, reduced anxiety-like behavior, impaired motor coordination, increased susceptibility to seizures, and decreased cortical volume on brain MRI. Analysis of neurons derived from Pgbd5-null mouse brains showed reduced DNA breakage and repair in postmitotic neuronal precursors during cortical development compared to controls. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.651 | KDM2B | Zornitza Stark Phenotypes for gene: KDM2B were changed from neurodevelopmental disorder MONDO#0700092, KDM2B-related to Neurodevelopmental disorder with congenital cardiac defects and variable renal and ocular abnormalities, MIM# 621474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.650 | KDM2B | Zornitza Stark edited their review of gene: KDM2B: Changed phenotypes: Neurodevelopmental disorder with congenital cardiac defects and variable renal and ocular abnormalities, MIM# 621474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.650 | ISCA-37448-Loss |
Sarah Milton Region: ISCA-37448-Loss was added Region: ISCA-37448-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-37448-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37448-Loss were set to Chromosome 15q11.2 deletion syndrome, MIM#615656 Penetrance for Region: ISCA-37448-Loss were set to Incomplete |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.645 | ISCA-46743-Gain |
Sarah Milton Region: ISCA-46743-Gain was added Region: ISCA-46743-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-46743-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for Region: ISCA-46743-Gain were set to Xq25 duplication syndrome, MIM#300979 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.644 | ISCA-46304-Gain |
Sarah Milton Region: ISCA-46304-Gain was added Region: ISCA-46304-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-46304-Gain was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for Region: ISCA-46304-Gain were set to PMID: 29141583, 22679399 Phenotypes for Region: ISCA-46304-Gain were set to Syndromic X-linked intellectual disability Lubs type, MONDO:0010283 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.643 | ISCA-46300-Loss |
Sarah Milton Region: ISCA-46300-Loss was added Region: ISCA-46300-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-46300-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-46300-Loss were set to Chromosome 15q24 deletion syndrome, MONDO:0013256 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.642 | ISCA-46299-Gain |
Sarah Milton Region: ISCA-46299-Gain was added Region: ISCA-46299-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-46299-Gain. Mode of inheritance for Region: ISCA-46299-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for Region: ISCA-46299-Gain were set to PMID: 22840365 Phenotypes for Region: ISCA-46299-Gain were set to Xp11.22 microduplication syndrome MIM#300705 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.638 | TMPRSS7 |
Zornitza Stark changed review comment from: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature; to: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder, presenting with fetal agenesis of the corpus callosum and ventriculomegaly. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.638 | NRDC |
Rylee Peters gene: NRDC was added gene: NRDC was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: NRDC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NRDC were set to 41449824; 28017472; 34582790; 19935654 Phenotypes for gene: NRDC were set to Neurodevelopmental disorder, MONDO:0700092, NRDC-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.637 | ARCN1 | Zornitza Stark Mode of inheritance for gene: ARCN1 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.636 | ARCN1 | Zornitza Stark changed review comment from: PMID 35300924 reports 14 individuals (9 post‑natal, 5 fetuses) from 3 unrelated families with biallelic loss‑of‑function ARCN1 variants. Core phenotype includes intrauterine growth restriction, micrognathia, short stature, rhizomelic shortening, microcephaly, variable developmental delay/intellectual disability, genitourinary anomalies in males, cataracts, transient liver dysfunction/glycosylation abnormalities, and rare complications such as hepatoblastoma. Functional assays show defective type I collagen transport and abnormal N‑glycan profiles.; to: At least 14 individuals reported, summarised in PMID 35300924. Intrauterine growth restriction, micrognathia, and short stature were present in all patients. Other common features included prematurity (11/15, 73.3%), developmental delay (10/14, 71.4%), genitourinary malformations in males (6/8, 75%), and microcephaly (12/15, 80%). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.636 | ARCN1 | Zornitza Stark edited their review of gene: ARCN1: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.635 | ARCN1 | Zornitza Stark Mode of inheritance for gene: ARCN1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.634 | ARCN1 | Zornitza Stark edited their review of gene: ARCN1: Added comment: PMID 35300924 reports 14 individuals (9 post‑natal, 5 fetuses) from 3 unrelated families with biallelic loss‑of‑function ARCN1 variants. Core phenotype includes intrauterine growth restriction, micrognathia, short stature, rhizomelic shortening, microcephaly, variable developmental delay/intellectual disability, genitourinary anomalies in males, cataracts, transient liver dysfunction/glycosylation abnormalities, and rare complications such as hepatoblastoma. Functional assays show defective type I collagen transport and abnormal N‑glycan profiles.; Changed publications: 27476655, 33154040, 35300924; Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.633 | MED14 |
Zornitza Stark gene: MED14 was added gene: MED14 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: MED14 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: MED14 were set to PMID: 40597352 Phenotypes for gene: MED14 were set to Neurodevelopmental disorder (MONDO:0700092), MED14-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.632 | Zornitza Stark Copied gene SPNS1 from panel Lysosomal Storage Disorder | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.632 | SPNS1 |
Zornitza Stark gene: SPNS1 was added gene: SPNS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SPNS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPNS1 were set to 40608416; 38451736 Phenotypes for gene: SPNS1 were set to Lysosomal disorder, SPNS1-related, MONDO:0002561 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.630 | MTSS1L | Zornitza Stark reviewed gene: MTSS1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 39890443, 40698928; Phenotypes: Intellectual developmental disorder with ocular anomalies and distinctive facial features, MIM# 620086; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.628 | SF3B1 | Zornitza Stark reviewed gene: SF3B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 41577671; Phenotypes: complex neurodevelopmental disorder MONDO:0100038, SF3B1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.626 | VPS51 |
Zornitza Stark edited their review of gene: VPS51: Added comment: PMID 40176246 Reports another individual with autosomal recessive homozygous in-frame duplication in VPS51 (p.Lys126_Met132dup) presenting with severe global developmental delay, microcephaly, hypotonia, hypomyelination, and cerebral and cerebellar atrophy. No functional studies performed; variant absent from gnomAD. PMID 40565173 reports 2 affected individuals another family with a homozygous missense variant NM_013265.4:c.1511C>T (p.Thr504Met) in VPS51. The siblings presented with developmental delay, severe intellectual disability, microcephaly, thin corpus callosum, epilepsy, hearing loss and dysphagia. Biparental inheritance demonstrated. Functional assays in patient fibroblasts showed reduced VPS51 mRNA and protein levels, altered autophagy marker expression (LC3B, p62), and increased mitochondria‑lysosome contacts, supporting a loss‑of‑function mechanism.; Changed rating: GREEN; Changed publications: 30624672, 31207318, 40176246, 40565173; Changed phenotypes: Pontocerebellar hypoplasia, type 13, MIM# 618606 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.624 | SEC31A |
Zornitza Stark edited their review of gene: SEC31A: Added comment: PMID 39725565: Reports another individual from unrelated family with a homozygous splice‑acceptor loss‑of‑function variant (c.14351G>A) presenting with lethal neurodevelopmental disorder, dysmorphic facial features, brain anomalies, and severe skeletal defects. RT‑PCR on patient and carrier parents blood samples shows exon 12 skipping and markedly reduced SEC31A transcript, supporting loss‑of‑function. Functional data from PMID 30464055: knockdown SEC31A Drosophila had defective brains and early lethality. In line with SEC31A encoding one of the two coating layers comprising the Coat protein complex II (COP-II) complex, trafficking newly synthesised proteins from the endoplasmic reticulum (ER) to the Golgi, CRISPR/Cas9-mediated SEC31A null mutant cells demonstrated reduced viability through upregulation of ER-stress pathways.; Changed rating: GREEN; Changed publications: 30464055, 40508110, 39725565; Changed phenotypes: Halperin-Birk syndrome, MIM# 618651 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.623 | LGI1 | Zornitza Stark reviewed gene: LGI1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 121, MIM# 621475; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.623 | ISCA-46296-Loss |
Sarah Milton Region: ISCA-46296-Loss was added Region: ISCA-46296-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-46296-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-46296-Loss were set to PMID: 25217958 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.622 | LAGE3 |
Sarah Milton gene: LAGE3 was added gene: LAGE3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: LAGE3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: LAGE3 were set to 28805828 Phenotypes for gene: LAGE3 were set to Galloway-Mowat syndrome 2, X-linked, MIM# 301006 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.621 | ZNF185 |
Lucy Spencer gene: ZNF185 was added gene: ZNF185 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF185 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: ZNF185 were set to 41404552 Phenotypes for gene: ZNF185 were set to Cerebrooculonasal syndrome MONDO:0011575, ZNF185-related Review for gene: ZNF185 was set to RED Added comment: PMID 41404552 describes a single female individual with cerebro oculo nasal syndrome and a de novo heterozygous X linked frameshift ZNF185. The proband presented with developmental delay, moderate ID, dysmorphic facial features, cleft lip/palate, nasal anomaly, CHD and anopthalmia. She was shown to have skewed X-inactivation 19:81, however it is not stated if the skewing was towards the allele with the variant. The variant in this individual (p.Gln102SerfsTer18) is NMD predicted and absent from gnomad, however there are at least 6 NMD variants present in gnomad as hemizygous (4 with over 4 hemis) all of which also have over 5 heterozygotes Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.615 | GSPT2 | Zornitza Stark edited their review of gene: GSPT2: Added comment: PMID 41420488: Six unrelated males reported with hemizygosity for variants in GSTP2 and neurodevelopmental disorder including intellectual disability, language impairment, autism, motor impairment, epilepsy, or abnormal fetal brain development. Variants were reported to be inherited from unaffected mothers. Functional evidence did support deleterious effects of the variants and gene knock-out.; Changed rating: GREEN; Changed publications: 28414775, 41420488; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, GSPT2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.615 | UNC13C |
Sangavi Sivagnanasundram gene: UNC13C was added gene: UNC13C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UNC13C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UNC13C were set to 41399760 Phenotypes for gene: UNC13C were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.614 | SEPT2 |
chirag patel gene: SEPT2 was added gene: SEPT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SEPT2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SEPT2 were set to 41408595 Phenotypes for gene: SEPT2 were set to Neurodevelopmental disorder, MONDO:0700092, SEPTIN2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.613 | PCBP1 |
Sarah Milton gene: PCBP1 was added gene: PCBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PCBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PCBP1 were set to 41415500 Phenotypes for gene: PCBP1 were set to Neurodevelopmental disorder, MONDO:0700092, PCBP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.610 | NDUFA3 |
Zornitza Stark gene: NDUFA3 was added gene: NDUFA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NDUFA3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA3 were set to 41038977; 39661167 Phenotypes for gene: NDUFA3 were set to Mitochondrial disease, MONDO:0044970,NDUFA3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.606 | BAIAP2 | Zornitza Stark reviewed gene: BAIAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 120, MIM# 621468; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.602 | CNP |
Zornitza Stark gene: CNP was added gene: CNP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: CNP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CNP were set to 32128616; 12590258; 40396300 Phenotypes for gene: CNP were set to Leukodystrophy, hypomyelinating, 20, MIM# 619071 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.601 | PFAS |
Zornitza Stark gene: PFAS was added gene: PFAS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: PFAS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PFAS were set to 40421664 Phenotypes for gene: PFAS were set to Inborn error of metabolism, MONDO:0019052, PFAS-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.600 | ISCA-46295-Loss |
Sarah Milton Region: ISCA-46295-Loss was added Region: ISCA-46295-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-46295-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for Region: ISCA-46295-Loss were set to PMID: 19289393 Phenotypes for Region: ISCA-46295-Loss were set to Chromosome 15q13.3 microdeletion syndrome MIM#612001; intellectual disability; seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.599 | ISCA-46290-Gain |
Sarah Milton Region: ISCA-46290-Gain was added Region: ISCA-46290-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-46290-Gain was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for Region: ISCA-46290-Gain were set to 19716111; 27605428; 29707408; 16900295 Phenotypes for Region: ISCA-46290-Gain were set to Chromosome Xp11.23-p11.22 duplication syndrome MIM#300801; intellectual disability; seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.598 | ISCA-37500-Loss |
Sarah Milton Region: ISCA-37500-Loss was added Region: ISCA-37500-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37500-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37500-Loss were set to 20921022; 24352913 Phenotypes for Region: ISCA-37500-Loss were set to Chromosome 15q25 deletion syndrome MIM#614294; intellectual disability; congenital abnormalities; haematological abnormalities |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.597 | ISCA-37498-Loss |
Sarah Milton Region: ISCA-37498-Loss was added Region: ISCA-37498-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-37498-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37498-Loss were set to 11q13.2q13.4 deletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.593 | RNU4-2 | Zornitza Stark Mode of inheritance for gene: RNU4-2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.592 | RNU4-2 | Zornitza Stark edited their review of gene: RNU4-2: Added comment: PMID 40297424: preprint reporting 16 individuals from 10 families with balletic variants and presenting with global developmental delay, intellectual disability, speech delay or absence, hypotonia, spasticity, microcephaly, ophthalmologic and visual impairment, seizures, and variable genital, skin, hair and limb anomalies; brain MRI shows distinctive white‑matter abnormalities and cerebellar atrophy.; Changed publications: 38991538, 40297424; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.591 | ATP9A | Zornitza Stark Mode of inheritance for gene: ATP9A was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.590 | ATP9A | Zornitza Stark edited their review of gene: ATP9A: Added comment: PMIDs 34379057, 34764295, 36604604 and 40226306 report 12 unrelated families with ATP9A variants. Six families carry biallelic loss‑of‑function variants causing an autosomal recessive neurodevelopmental disorder with post‑natal microcephaly, failure‑to‑thrive and behavioural abnormalities; five families carry de novo heterozygous missense variants causing autosomal dominant nonsyndromic intellectual disability with seizures and autism‑like features. Multiple functional studies in patient cells, mouse knock‑out models and rescue assays provide strong loss‑of‑function evidence.; Changed publications: 34379057, 34764295, 36604604, 40226306; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.590 | DLAT | Chris Ciotta reviewed gene: DLAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 39007626, 29093066, 16049940; Phenotypes: Pyruvate dehydrogenase E2 deficiency, MIM#245348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.590 | ISCA-37494-Gain |
Sarah Milton Region: ISCA-37494-Gain was added Region: ISCA-37494-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37494-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for Region: ISCA-37494-Gain were set to 25927380; 20301461; 32043567; 32112660 Phenotypes for Region: ISCA-37494-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815; intellectual disability; hypotonia; seizures; spasticity; recurrent respiratory infections |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.590 | ISCA-37493-Loss |
Sarah Milton Region: ISCA-37493-Loss was added Region: ISCA-37493-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37493-Loss. Mode of inheritance for Region: ISCA-37493-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37493-Loss were set to 28283832; 31929334; 31830750; 30853971 Phenotypes for Region: ISCA-37493-Loss were set to 1q43q44 microdeletion syndrome; intellectual disability; seizures; microcephaly; corpus callosum abnormalities |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.589 | ISCA-37486-Loss |
Sarah Milton Region: ISCA-37486-Loss was added Region: ISCA-37486-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37486-Loss. Mode of inheritance for Region: ISCA-37486-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37486-Loss were set to 19914906; 32993859; 32732550; 32597026; 32537635 Phenotypes for Region: ISCA-37486-Loss were set to Chromosome 16p11.2 deletion syndrome, MIM#611913, distal BP2-BP3; intellectual disability; autism; obesity |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.588 | ISCA-37478-Loss |
Sarah Milton Region: ISCA-37478-Loss was added Region: ISCA-37478-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37478-Loss. Mode of inheritance for Region: ISCA-37478-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37478-Loss were set to 22045295 Phenotypes for Region: ISCA-37478-Loss were set to Angelman syndrome, MIM# 105830; Prader-Willi syndrome, MIM# 176270 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.587 | ISCA-37478-Gain |
Sarah Milton Region: ISCA-37478-Gain was added Region: ISCA-37478-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37478-Gain. Mode of inheritance for Region: ISCA-37478-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37478-Gain were set to Chromosome 15q11q13 duplication syndrome, MIM#608636; autism; intellectual disability; ataxia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.584 | ISCA-37468-Loss |
Sarah Milton Region: ISCA-37468-Loss was added Region: ISCA-37468-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen,Expert Review Green SV/CNV tags were added to Region: ISCA-37468-Loss. Mode of inheritance for Region: ISCA-37468-Loss was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for Region: ISCA-37468-Loss were set to PMID: 22126752; 16385466; 20186789 Phenotypes for Region: ISCA-37468-Loss were set to Chromosome Xp11.3 deletion syndrome MIM#300578; intellectual disability; retinal dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.583 | ISCA-37446-Loss |
Sarah Milton Region: ISCA-37446-Loss was added Region: ISCA-37446-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37446-Loss. Mode of inheritance for Region: ISCA-37446-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37446-Loss were set to 18179902; 23765049; 21671380 Phenotypes for Region: ISCA-37446-Loss were set to Chromosome 22q11.2 deletion syndrome, distal MIM#611867; intellectual disability; autism; multiple congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.582 | ISCA-37446-Gain |
Sarah Milton Region: ISCA-37446-Gain was added Region: ISCA-37446-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37446-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37446-Gain were set to PMID: 18707033 Phenotypes for Region: ISCA-37446-Gain were set to Chromosome 22q11.2 microduplication syndrome MIM#608363, proximal A-D |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.582 | ISCA-37443-Loss |
Sarah Milton Region: ISCA-37443-Loss was added Region: ISCA-37443-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37443-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37443-Loss were set to PMID: 20830797; 19460468; 19610115 Phenotypes for Region: ISCA-37443-Loss were set to Chromosome 3q29 microdeletion syndrome MIM#609425; intellectual disability; autism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.581 | ISCA-37441-Loss |
Sarah Milton Region: ISCA-37441-Loss was added Region: ISCA-37441-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37441-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37441-Loss were set to PMID: 20140962 Phenotypes for Region: ISCA-37441-Loss were set to Potocki-Shaffer syndrome MIM#601224; intellectual disability; multiple exostoses; biparietal foramina |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.580 | ISCA-37440-Loss |
Sarah Milton Region: ISCA-37440-Loss was added Region: ISCA-37440-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37440-Loss was set to BIALLELIC, autosomal or pseudoautosomal Publications for Region: ISCA-37440-Loss were set to PMID: 18234729; 23794250 Phenotypes for Region: ISCA-37440-Loss were set to 2p21 deletion syndrome; Hypotonia-cystinuria syndrome, MIM# 606407 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.577 | SCYL2 |
Zornitza Stark gene: SCYL2 was added gene: SCYL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SCYL2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SCYL2 were set to 31960134; 26203146 Phenotypes for gene: SCYL2 were set to Arthrogryposis multiplex congenita (AMC); Zain syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.575 | PPP5C | Zornitza Stark reviewed gene: PPP5C: Rating: AMBER; Mode of pathogenicity: None; Publications: 40172746; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, PPP5C-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.574 | ISCA-37439-Gain |
Sarah Milton Region: ISCA-37439-Gain was added Region: ISCA-37439-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37439-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for Region: ISCA-37439-Gain were set to PMID: 20004760 Phenotypes for Region: ISCA-37439-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.573 | ISCA-37434-Loss |
Sarah Milton Region: ISCA-37434-Loss was added Region: ISCA-37434-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37434-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37434-Loss were set to PMID: 12974736; 18245432 Phenotypes for Region: ISCA-37434-Loss were set to Chromosome 1p36 deletion syndrome MIM#607872; intellectual disability; hypotonia; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.571 | RPS6KC1 | Zornitza Stark reviewed gene: RPS6KC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.571 | ISCA-37433-Loss |
Sarah Milton Region: ISCA-37433-Loss was added Region: ISCA-37433-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37433-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for Region: ISCA-37433-Loss were set to DiGeorge syndrome MIM#188400 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.570 | ISCA-37433-Gain |
Sarah Milton Region: ISCA-37433-Gain was added Region: ISCA-37433-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37433-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37433-Gain were set to PMID: 18707033 Phenotypes for Region: ISCA-37433-Gain were set to Chromosome 22q11.2 microduplication syndrome MIM#608363 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.569 | ISCA-37432-Loss |
Sarah Milton Region: ISCA-37432-Loss was added Region: ISCA-37432-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37432-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37432-Loss were set to PMID: 19844256 Phenotypes for Region: ISCA-37432-Loss were set to Chromosome 17q12 deletion syndrome MIM#614527; Renal cysts and diabetes (RCAD) syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.568 | ISCA-37432-Gain |
Sarah Milton Region: ISCA-37432-Gain was added Region: ISCA-37432-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37432-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37432-Gain were set to PMID: 19844256 Phenotypes for Region: ISCA-37432-Gain were set to Chromosome 17q12 duplication syndrome 614526; intellectual disability; seizures; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.567 | ISCA-37431-Loss |
Sarah Milton Region: ISCA-37431-Loss was added Region: ISCA-37431-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37431-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37431-Loss were set to 12660952; 14729829 Phenotypes for Region: ISCA-37431-Loss were set to Chromosome 17q11.2 deletion syndrome, MIM#613675; NF1 deletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.566 | ISCA-37430-Loss |
Sarah Milton Region: ISCA-37430-Loss was added Region: ISCA-37430-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37430-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37430-Loss were set to Miller-Dieker lissencephaly syndrome, MIM# 247200 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.565 | CDK4 | Zornitza Stark Phenotypes for gene: CDK4 were changed from Neurodevelopmental disorder, MONDO:0700092; {Melanoma, cutaneous malignant, 3} MIM#609048 to Neurodevelopmental disorder, MONDO:0700092, CDK4-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.564 | CDK4 |
Zornitza Stark gene: CDK4 was added gene: CDK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: CDK4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CDK4 were set to 40210435 Phenotypes for gene: CDK4 were set to Neurodevelopmental disorder, MONDO:0700092; {Melanoma, cutaneous malignant, 3} MIM#609048 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.563 | MAU2 |
Lucy Spencer gene: MAU2 was added gene: MAU2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: MAU2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAU2 were set to 41332805; 37962004; 32433956 Phenotypes for gene: MAU2 were set to Cornelia de Lange syndrome MONDO:0016033, MAU2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.561 | TMEM251 |
Zornitza Stark gene: TMEM251 was added gene: TMEM251 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM251 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM251 were set to 40171858; 33252156 Phenotypes for gene: TMEM251 were set to Dysostosis multiplex, Ain-Naz type MIM@619345 Review for gene: TMEM251 was set to GREEN Added comment: PMID 40171858: reports 2 siblings from an Iranian consanguineous family and six previously reported families (8 patients, 7 unrelated families) with biallelic loss‑of‑function LYSET variants presenting with MLII‑like mucolipidosis; core features include dysostosis multiplex, coarse facial features, hepatomegaly, joint contractures, developmental delay; mouse knockout recapitulates the phenotype, supporting gene‑disease causality. HGNC approved name is LYSET. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.560 | LMAN2L | Lucy Spencer Phenotypes for gene: LMAN2L were changed from Mental retardation, autosomal recessive, 52 OMIM #616887; Intellectual developmental disorder, autosomal dominant 69 , MIM# 617863 to Intellectual developmental disorder, autosomal dominant 69 MIM#617863; Intellectual developmental disorder, autosomal recessive 52 MIM#616887 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.559 | KMT5B | Lucy Spencer Phenotypes for gene: KMT5B were changed from Mental retardation, autosomal dominant 51, MIM#617788 to Intellectual developmental disorder, autosomal dominant 51 MIM# 617788 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.557 | ZFHX4 | Boris Keren reviewed gene: ZFHX4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40367947; Phenotypes: intellectual disability, short stature, cleft; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.557 | NOP58 |
Zornitza Stark gene: NOP58 was added gene: NOP58 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: NOP58 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NOP58 were set to 41383020 Phenotypes for gene: NOP58 were set to Neurodevelopmental disorder, MONDO:0700092, NOP58-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.555 | UNC13A | Zornitza Stark Phenotypes for gene: UNC13A were changed from neurodevelopmental disorder MONDO#0700092, UNC13A-related; Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455 to Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456; Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.554 | UNC13A | Zornitza Stark edited their review of gene: UNC13A: Changed phenotypes: Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456, Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.552 | WDR83 |
chirag patel gene: WDR83 was added gene: WDR83 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR83 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: WDR83 were set to 41381792 Phenotypes for gene: WDR83 were set to Neurodevelopmental disorder, MONDO:0700092, WDR83-related Mode of pathogenicity for gene: WDR83 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.551 | NDUFB7 |
Zornitza Stark gene: NDUFB7 was added gene: NDUFB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NDUFB7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFB7 were set to 33502047; 27626371; 40025060 Phenotypes for gene: NDUFB7 were set to Mitochondrial complex I deficiency nuclear type 39 (MC1DN39), MIM#620135 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.548 | FIBP | Zornitza Stark edited their review of gene: FIBP: Added comment: Beyond the two families previously reviewed (PMIDs 26660953; 27183861), four additional studies (PMIDs 36919607, 37218527, 37876348, 40099975) contribute four new unrelated families (total six unrelated families, nine patients) with a consistent autosomal‑recessive overgrowth syndrome. All six families have biallelic loss‑of‑function FIBP variants (nonsense or frameshift leading to NMD). Detailed clinical descriptions include overgrowth, macrocephaly, facial dysmorphism, developmental delay/intellectual disability, renal dysplasia and, in two families, early‑onset tumor predisposition. Segregation analyses confirm recessive inheritance in every case. Functional work (RT‑qPCR, fibroblast proliferation assays, mouse embryonic expression) demonstrates reduced FIBP expression and increased cell proliferation, supporting pathogenicity.; Changed publications: 40099975, 37876348, 36919607, 27183861, 26660953 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.546 | DPH2 | Zornitza Stark edited their review of gene: DPH2: Added comment: Third family reported with biallelic LoF variant c.1429C>T (p.Arg477*) presenting with developmental delay, proportionate short stature, sparse hair, dysmorphic facial features, hypotonia, seizures, neuroimaging abnormalities, and behavioral issues.; Changed rating: GREEN; Changed publications: 40130534 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.545 | SEC24C |
Zornitza Stark gene: SEC24C was added gene: SEC24C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: SEC24C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SEC24C were set to 40131364 Phenotypes for gene: SEC24C were set to Neurodevelopmental disorder, MONDO:0700092, SEC24C-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.544 | CAMK2G | Elena Savva Phenotypes for gene: CAMK2G were changed from Mental retardation, autosomal dominant 59, MIM# 618522 to Intellectual developmental disorder, autosomal dominant 59 MIM# 618522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.543 | ZIC2_HPE5_GCN |
Bryony Thompson STR: ZIC2_HPE5_GCN was added STR: ZIC2_HPE5_GCN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list paediatric-onset tags were added to STR: ZIC2_HPE5_GCN. Mode of inheritance for STR: ZIC2_HPE5_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ZIC2_HPE5_GCN were set to 11285244; 33811808 Phenotypes for STR: ZIC2_HPE5_GCN were set to Holoprosencephaly 5 MIM#609637 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.540 | RSPRY1 | Zornitza Stark edited their review of gene: RSPRY1: Added comment: PMIDs 30063090, 38562122 and 39940902 add three additional unrelated families (total 5 families, 12 patients) with autosomal recessive loss‑of‑function RSPRY1 variants causing spondyloepimetaphyseal dysplasia, Faden‑Alkuraya type.; Changed rating: GREEN; Changed publications: 26365341, 30063090, 38562122, 39940902 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.540 | USMG5 |
Zornitza Stark gene: USMG5 was added gene: USMG5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: USMG5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: USMG5 were set to 29917077; 30240627; 40014158 Phenotypes for gene: USMG5 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 6 MIM#618683 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.538 | PRMT1 |
Zornitza Stark gene: PRMT1 was added gene: PRMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: PRMT1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PRMT1 were set to 39937650 Phenotypes for gene: PRMT1 were set to Neurodevelopmental disorder, MONDO:0700092, PRMT1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.537 | EXOSC4 |
Zornitza Stark gene: EXOSC4 was added gene: EXOSC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: EXOSC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOSC4 were set to 39009343; 37961665; 36344539 Phenotypes for gene: EXOSC4 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.534 | SELENOI | Zornitza Stark Phenotypes for gene: SELENOI were changed from developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals; microcephaly to Spastic paraplegia 81, autosomal recessive, MIM# 618768 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.531 | SELENOI | Zornitza Stark edited their review of gene: SELENOI: Added comment: Four families reported now, upgrade to Green. Although spasticity and motor delay are prominent, intellectual impairment and speech delay are also a feature.; Changed rating: GREEN; Changed publications: 28052917, 39806532, 29500230, 33454747; Changed phenotypes: Spastic paraplegia 81, autosomal recessive, MIM# 618768 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.531 | TRMT1L |
Zornitza Stark gene: TRMT1L was added gene: TRMT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: TRMT1L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRMT1L were set to 39786990 Phenotypes for gene: TRMT1L were set to Neurodevelopmental disorder, MONDO:0700092, TRMT1L-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.530 | SPAG9 |
Zornitza Stark gene: SPAG9 was added gene: SPAG9 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: SPAG9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPAG9 were set to 39846792 Phenotypes for gene: SPAG9 were set to Neurodevelopmental disorder, MONDO:0700092, SPAG9-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.529 | NUBP2 |
Zornitza Stark gene: NUBP2 was added gene: NUBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: NUBP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NUBP2 were set to 39867373 Phenotypes for gene: NUBP2 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.526 | HCN2 | Zornitza Stark reviewed gene: HCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Generalized epilepsy with febrile seizures plus, type 11, MIM# 602477; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.525 | PPP1R3F | Paul De Fazio reviewed gene: PPP1R3F: Rating: AMBER; Mode of pathogenicity: None; Publications: 37531237; Phenotypes: Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.522 | ISCA-37431-Gain |
Sarah Milton Region: ISCA-37431-Gain was added Region: ISCA-37431-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37431-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37431-Gain were set to 22241097 Phenotypes for Region: ISCA-37431-Gain were set to Chromosome 17q11.2 duplication syndrome, 1.4-Mb MIM#618874; NF1 microduplication; intellectual disability; micro- and macrocephaly; seizures; dysmorphic features |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.521 | ISCA-37430-Gain |
Sarah Milton Region: ISCA-37430-Gain was added Region: ISCA-37430-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37430-Gain. Mode of inheritance for Region: ISCA-37430-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37430-Gain were set to Chromosome 17p13.3 duplication syndrome, centromeric, MIM#613215; intellectual disability |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.520 | ISCA-37429-Loss |
Sarah Milton Region: ISCA-37429-Loss was added Region: ISCA-37429-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37429-Loss. Mode of inheritance for Region: ISCA-37429-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37429-Loss were set to Wolf-Hirschhorn syndrome, MIM# 194190; intellectual disability; growth retardation; seizures; dysmorphic features |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.519 | ISCA-37425-Loss |
Sarah Milton Region: ISCA-37425-Loss was added Region: ISCA-37425-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37425-Loss. Mode of inheritance for Region: ISCA-37425-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37425-Loss were set to 23190751; 19596467 Phenotypes for Region: ISCA-37425-Loss were set to Sotos syndrome, chromosome 5q35 deletion; intellectual disability; overgrowth |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.518 | ISCA-37425-Gain |
Sarah Milton Region: ISCA-37425-Gain was added Region: ISCA-37425-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37425-Gain. Mode of inheritance for Region: ISCA-37425-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37425-Gain were set to 24819041 Phenotypes for Region: ISCA-37425-Gain were set to Chromosome 5q35 duplication syndrome; microcephaly; failure to thrive; seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.517 | ISCA-37424-Loss |
Sarah Milton Region: ISCA-37424-Loss was added Region: ISCA-37424-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37424-Loss. Mode of inheritance for Region: ISCA-37424-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37424-Loss were set to 20345475; 25846706 Phenotypes for Region: ISCA-37424-Loss were set to Chromosome 10q22.3q23.2 deletion syndrome (LCR-3/4-flanked); intellectual disability; autism; macrocephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.517 | ISCA-37423-Loss |
Sarah Milton Region: ISCA-37423-Loss was added Region: ISCA-37423-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37423-Loss. Mode of inheritance for Region: ISCA-37423-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37423-Loss were set to 23696316; 23011633; 20969981 Phenotypes for Region: ISCA-37423-Loss were set to 8p23.1 deletion syndrome; congenital heart disease; developmental delay |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.514 | KIF21A | Rylee Peters reviewed gene: KIF21A: Rating: AMBER; Mode of pathogenicity: None; Publications: 37921537, 39643435, 41282472, 32141982, 24715754, 36494820, 22699964; Phenotypes: Fibrosis of extraocular muscles, congenital, 1/3B, MIM#135700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.514 | KIF21B | Lucy Spencer Phenotypes for gene: KIF21B were changed from Global developmental delay; Intellectual disability; Abnormality of brain morphology; Microcephaly to Neurodevelopmental disorder MONDO:0700092, KIF21B-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.513 | KCTD3 | Lucy Spencer Phenotypes for gene: KCTD3 were changed from Epilepsy; Intellectual disability; Posterior fossa abnormalities to Neurodevelopmental disorder MONDO:0700092, KCTD3-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.510 | CRNKL1 | Zornitza Stark reviewed gene: CRNKL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Microcephaly, progressive, with simplified gyral pattern and cerebellar hypoplasia, MIM# 621436; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.510 | ISCA-37423-Gain |
Sarah Milton Region: ISCA-37423-Gain was added Region: ISCA-37423-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37423-Gain. Mode of inheritance for Region: ISCA-37423-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37423-Gain were set to 26097203; 25520754 Phenotypes for Region: ISCA-37423-Gain were set to 8p23.1 duplication syndrome; intellectual disability; congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.509 | ISCA-37421-Loss |
Sarah Milton Region: ISCA-37421-Loss was added Region: ISCA-37421-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37421-Loss. Mode of inheritance for Region: ISCA-37421-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37421-Loss were set to 32655619 Phenotypes for Region: ISCA-37421-Loss were set to Chromosome 1q21.1 deletion syndrome, MIM# 612474; intellectual disability; microcephaly; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.508 | THG1L | Zornitza Stark reviewed gene: THG1L: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.508 | DNAJA3 |
Zornitza Stark gene: DNAJA3 was added gene: DNAJA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: DNAJA3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAJA3 were set to 34750646; 30770860 Phenotypes for gene: DNAJA3 were set to Mitochondrial disease, MONDO:0044970, DNAJA3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.507 | ISCA-37418-Gain | Zornitza Stark Phenotypes for Region: ISCA-37418-Gain were changed from Potocki-Lupski syndrome, MIM# 610883; intellectual disability; hypotonia; congenital anomalies to Potocki-Lupski syndrome, MIM# 610883 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.506 | ISCA-37418-Loss | Zornitza Stark Phenotypes for Region: ISCA-37418-Loss were changed from Potocki-Lupski syndrome; Smith-Magenis syndrome; moderate intellectual disability, delayed speech and language skills, distinctive facial features, sleep disturbances, and behavioral problems; 182290; Structural cardiovascular anomalies (dilated aortic root, bicommissural aortic valve, atrial/ventricular and septal defects) and sleep disturbance; hypotonia, failure to thrive, mental retardation, pervasive developmental disorders, congenital anomalies; Dental abnormalities; hypotonia, poor feeding, failure to thrive, developmental delay particularly cognitive and language deficity, mild-moderate intellectual deficit, and neuropsychiatric disorders to Smith-Magenis syndrome, MIM#182290 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.504 | ISCA-37421-Gain |
Sarah Milton Region: ISCA-37421-Gain was added Region: ISCA-37421-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37421-Gain. Mode of inheritance for Region: ISCA-37421-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37421-Gain were set to 32655619 Phenotypes for Region: ISCA-37421-Gain were set to Chromosome 1q21.1 duplication syndrome, MIM# 612475; intellectual disability; autism; macrocephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.503 | ISCA-37418-Loss |
Sarah Milton Region: ISCA-37418-Loss was added Region: ISCA-37418-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen,NHS GMS Mode of inheritance for Region: ISCA-37418-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for Region: ISCA-37418-Loss were set to Potocki-Lupski syndrome; Smith-Magenis syndrome; moderate intellectual disability, delayed speech and language skills, distinctive facial features, sleep disturbances, and behavioral problems; 182290; Structural cardiovascular anomalies (dilated aortic root, bicommissural aortic valve, atrial/ventricular and septal defects) and sleep disturbance; hypotonia, failure to thrive, mental retardation, pervasive developmental disorders, congenital anomalies; Dental abnormalities; hypotonia, poor feeding, failure to thrive, developmental delay particularly cognitive and language deficity, mild-moderate intellectual deficit, and neuropsychiatric disorders |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.502 | ISCA-37418-Gain |
Sarah Milton Region: ISCA-37418-Gain was added Region: ISCA-37418-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37418-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37418-Gain were set to Potocki-Lupski syndrome, MIM# 610883; intellectual disability; hypotonia; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.501 | ISCA-37415-Gain |
Sarah Milton Region: ISCA-37415-Gain was added Region: ISCA-37415-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37415-Gain. Mode of inheritance for Region: ISCA-37415-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37415-Gain were set to 30287593 Phenotypes for Region: ISCA-37415-Gain were set to 16p13.11 microduplication syndrome; intellectual disability; autism; aortopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.500 | ISCA-37411-Loss |
Sarah Milton Region: ISCA-37411-Loss was added Region: ISCA-37411-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37411-Loss. Mode of inheritance for Region: ISCA-37411-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for Region: ISCA-37411-Loss were set to 19372089; 20979196 Phenotypes for Region: ISCA-37411-Loss were set to Chromosome 15q13.3 microdeletion syndrome, MIM# 612001; intellectual disability; epilepsy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.499 | ISCA-37406-Loss |
Sarah Milton Region: ISCA-37406-Loss was added Region: ISCA-37406-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37406-Loss. Mode of inheritance for Region: ISCA-37406-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37406-Loss were set to 20101707; 17473832; 16783566 Phenotypes for Region: ISCA-37406-Loss were set to Chromosome 16p13.3 deletion syndrome, Rubinstein-Taybi deletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.499 | ISCA-37405-Loss |
Sarah Milton Region: ISCA-37405-Loss was added Region: ISCA-37405-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37405-Loss. Mode of inheritance for Region: ISCA-37405-Loss was set to BIALLELIC, autosomal or pseudoautosomal Publications for Region: ISCA-37405-Loss were set to 29146700 Phenotypes for Region: ISCA-37405-Loss were set to Nephronophthisis 1, juvenile, MIM# 256100; Joubert syndrome 4, MIM# 609583; Senior-Loken syndrome 1, MIM# 266900 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.498 | ISCA-37404-Loss |
Sarah Milton Region: ISCA-37404-Loss was added Region: ISCA-37404-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37404-Loss. Mode of inheritance for Region: ISCA-37404-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37404-Loss were set to 20301323; 20301505 Phenotypes for Region: ISCA-37404-Loss were set to Angelman syndrome, MIM# 105830; Prader-Willi syndrome, MIM# 176270 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 | Monica Petica reviewed gene: CTNND2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38604781, PMID: 25473103, PMID: 31814264,; Phenotypes: Neurodevelopmental disorders (NDDs), intellectual disability (ID), autism, behavioural issues; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | ESRRG |
Zornitza Stark gene: ESRRG was added gene: ESRRG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: ESRRG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ESRRG were set to 41265451 Phenotypes for gene: ESRRG were set to Movement disorder, MONDO:0005395, ESRRG-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.490 | ELMSAN1 |
Zornitza Stark gene: ELMSAN1 was added gene: ELMSAN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature new gene name tags were added to gene: ELMSAN1. Mode of inheritance for gene: ELMSAN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ELMSAN1 were set to Neurodevelopmental disorder, MONDO:0700092, ELMSAN1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.489 | SUCO |
Zornitza Stark gene: SUCO was added gene: SUCO was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SUCO were set to 29620724; 20440000; 41282771 Phenotypes for gene: SUCO were set to Syndromic disease (MONDO:0002254), SUCO-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.488 | GTF2H4 |
Zornitza Stark gene: GTF2H4 was added gene: GTF2H4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: GTF2H4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTF2H4 were set to 40924495; 40924475 Phenotypes for gene: GTF2H4 were set to Xeroderma pigmentosum, complementation group J, MIM# 621435 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.486 | ISCA-37404-Gain |
Sarah Milton Region: ISCA-37404-Gain was added Region: ISCA-37404-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37404-Gain. Mode of inheritance for Region: ISCA-37404-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37404-Gain were set to 24239951; 24075935 Phenotypes for Region: ISCA-37404-Gain were set to Chromosome 15q11q13 duplication syndrome; {Autism susceptibility 4} 608636; intellectual disability; seizures; ataxia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.485 | ISCA-37400-Loss |
Sarah Milton Region: ISCA-37400-Loss was added Region: ISCA-37400-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37400-Loss. Mode of inheritance for Region: ISCA-37400-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37400-Loss were set to Chromosome 16p11.2 deletion syndrome, proximal, MIM# 611913; autism; intellectual disability; seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.484 | ISCA-37400-Gain |
Sarah Milton Region: ISCA-37400-Gain was added Region: ISCA-37400-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37400-Gain. Mode of inheritance for Region: ISCA-37400-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37400-Gain were set to 21841781; 18184952; 21731881 Phenotypes for Region: ISCA-37400-Gain were set to Chromosome 16p11.2 duplication syndrome, MIM# 614671; intellectual disability; autism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.484 | ISCA-37397-Loss |
Sarah Milton Region: ISCA-37397-Loss was added Region: ISCA-37397-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37397-Loss. Mode of inheritance for Region: ISCA-37397-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37397-Loss were set to 21671380; 23765049; 18179902 Phenotypes for Region: ISCA-37397-Loss were set to Chromosome 22q11.2 deletion syndrome, distal, MIM#611867; intellectual disability; seizures; growth retardation; multiple congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.483 | ISCA-37397-Gain |
Sarah Milton Region: ISCA-37397-Gain was added Region: ISCA-37397-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37397-Gain. Mode of inheritance for Region: ISCA-37397-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37397-Gain were set to 21671380; 31479204 Phenotypes for Region: ISCA-37397-Gain were set to Chromosome 22q11.2 microduplication syndrome, MIM#608363, distal; intellectual disability; dysmorphic features; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.482 | ISCA-37396-Loss |
Sarah Milton Region: ISCA-37396-Loss was added Region: ISCA-37396-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37396-Loss. Mode of inheritance for Region: ISCA-37396-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37396-Loss were set to 22180641; 19557438; 19233321; 22359776 Phenotypes for Region: ISCA-37396-Loss were set to Chromosome 15q24 deletion syndrome, MIM#613406; intellectual disability; facial dysmorphisms; congenital malformations of the hands and feet, eye, and genitalia; joint laxity; and growth retardation and failure to thrive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.481 | ISCA-37394-Loss |
Sarah Milton Region: ISCA-37394-Loss was added Region: ISCA-37394-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37394-Loss. Mode of inheritance for Region: ISCA-37394-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37394-Loss were set to 20691407 Phenotypes for Region: ISCA-37394-Loss were set to Chromosome 2q37 deletion syndrome, MIM# 600430; brachydactyly; intellectual disability |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.480 | ISCA-37393-Gain |
Sarah Milton Region: ISCA-37393-Gain was added Region: ISCA-37393-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37393-Gain. Mode of inheritance for Region: ISCA-37393-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37393-Gain were set to Cat eye syndrome, MIM# 115470; coloboma; anal atresia; heart and renal malformations |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.479 | ISCA-37392-Loss |
Sarah Milton Region: ISCA-37392-Loss was added Region: ISCA-37392-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37392-Loss. Mode of inheritance for Region: ISCA-37392-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37392-Loss were set to 20301427 Phenotypes for Region: ISCA-37392-Loss were set to Williams-Beuren syndrome, MIM# 194050; intellectual disability; growth retardation; cardiovascular disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.478 | ISCA-37392-Gain |
Sarah Milton Region: ISCA-37392-Gain was added Region: ISCA-37392-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37392-Gain. Mode of inheritance for Region: ISCA-37392-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37392-Gain were set to 33187326; 27615053; 26610320 Phenotypes for Region: ISCA-37392-Gain were set to Chromosome 7q11.23 duplication syndrome, MIM# 609757; intellectual disability; hypotonia; macrocephaly; seizures; aortic dilatation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.478 | ISCA-37390-Loss |
Sarah Milton Region: ISCA-37390-Loss was added Region: ISCA-37390-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37390-Loss. Mode of inheritance for Region: ISCA-37390-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37390-Loss were set to 16953888 Phenotypes for Region: ISCA-37390-Loss were set to Cri-du-chat syndrome MIM#123450; intellectual disability; microcephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.473 | FASTKD5 | Zornitza Stark reviewed gene: FASTKD5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 24, MIM# 621431; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.470 | ABI2 |
Zornitza Stark changed review comment from: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Sources: Literature; to: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Amber as still a preprint. Additional individual with recurrent variant identified internally. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.470 | ABI2 |
Zornitza Stark gene: ABI2 was added gene: ABI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ABI2 were set to 40475134 Phenotypes for gene: ABI2 were set to Neurodevelopmental disorder, MONDO:0700092, ABI2-related Review for gene: ABI2 was set to AMBER Added comment: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.468 | NUDT2 | Zornitza Stark edited their review of gene: NUDT2: Added comment: PMID 38141063 reports 18 individuals from 10 unrelated families with biallelic loss‑of‑function NUDT2 variants presenting with early‑onset neurodevelopmental disorder characterized by hypotonia, motor delay, gait disturbance, mild intellectual disability, peripheral neuropathy, corpus callosum abnormalities and progressive basal ganglia signal abnormalities.; Changed publications: 27431290, 30059600, 33058507, 38141063 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.468 | KARS |
Zornitza Stark changed review comment from: Sources: Expert list; to: Infantile-onset progressive leukoencephalopathy with or without deafness (LEPID) is a complex neurodegenerative disorder with onset of symptoms in infancy or early childhood. Most individuals present with sensorineural deafness or hypoacousia and global developmental delay. Affected individuals show episodic regression with progressive motor deterioration resulting in spastic tetraplegia and loss of ambulation, as well as impaired intellectual development with poor or absent speech. Additional more variable features may include poor overall growth with microcephaly, seizures, visual loss, microcytic anaemia, and hepatic enlargement or abnormal liver enzymes. Brain imaging shows deep white matter abnormalities consistent with a progressive leukoencephalopathy. Calcifications of the brain and spinal cord are a feature. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.461 | GSPT2 | Lucy Spencer Mode of inheritance for gene: GSPT2 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.460 | GSPT2 | Lucy Spencer Mode of inheritance for gene: GSPT2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.459 | GRIN2B | Lucy Spencer Phenotypes for gene: GRIN2B were changed from Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 to GRIN2B-related complex neurodevelopmental disorder MONDO:0700350; Developmental and epileptic encephalopathy 27 MIM#616139; Intellectual developmental disorder, autosomal dominant 6, with or without seizures MIM#613970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.458 | GRIK2 | Lucy Spencer Phenotypes for gene: GRIK2 were changed from Mental retardation, autosomal recessive, 6 MIM# 611092; Neurodevelopmental disorder with impaired language and ataxia and with or without seizures, MIM# 619580 to Intellectual developmental disorder, autosomal recessive 6 MIM#611092; Neurodevelopmental disorder with impaired language and ataxia and with or without seizures MIM#619580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.455 | TRA2B | Zornitza Stark reviewed gene: TRA2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ramond-Elliott neurodevelopmental syndrome, MIM# 621421; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.454 | MET | chirag patel Phenotypes for gene: MET were changed from ?Deafness, autosomal recessive 97, OMIM #616705; {Osteofibrous dysplasia, susceptibility to}, OMIM #607278 to complex neurodevelopmental disorder, MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.454 | MET | chirag patel Mode of inheritance for gene: MET was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.453 | MET | chirag patel edited their review of gene: MET: Added comment: ClinGen DISPUTED - Jan 2021; Changed phenotypes: complex neurodevelopmental disorder, MONDO:0100038; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.452 | EN2 |
chirag patel gene: EN2 was added gene: EN2 was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen disputed tags were added to gene: EN2. Mode of inheritance for gene: EN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EN2 were set to Complex neurodevelopmental disorder, MONDO:0100038 Review for gene: EN2 was set to RED Added comment: ClinGen DISPUTED - Feb 2021 https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_91eb2fc6-864c-4a4a-9b2d-0b2bdd695999-2021-02-16T170000.000Z?page=1&size=25&search= Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.450 | CNTN4 | chirag patel reviewed gene: CNTN4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: complex neurodevelopmental disorder, MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.450 | CNTNAP5 | chirag patel reviewed gene: CNTNAP5: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Complex neurodevelopmental disorder, MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.450 | SLC9A9 |
chirag patel Source Genetic Health Queensland was removed from SLC9A9. Source ClinGen was added to SLC9A9. Mode of inheritance for gene SLC9A9 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tag disputed tag was added to SLC9A9. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.449 | SLC9A9 | chirag patel reviewed gene: SLC9A9: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.449 | AVPR1A | chirag patel Mode of inheritance for gene: AVPR1A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.449 | AVPR1A | chirag patel Mode of inheritance for gene: AVPR1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.446 | COX4I1 |
Lucy Spencer gene: COX4I1 was added gene: COX4I1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list Mode of inheritance for gene: COX4I1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COX4I1 were set to 28766551; 22592081; 31290619; 40095452; 41203052 Phenotypes for gene: COX4I1 were set to Mitochondrial complex IV deficiency, nuclear type 16, MIM#619060 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.441 | CUL1 |
Zornitza Stark gene: CUL1 was added gene: CUL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: CUL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CUL1 were set to PMID: 41189326 Phenotypes for gene: CUL1 were set to Neurodevelopmental disorder, MONDO:0700092, CUL1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.440 | SEC31A | Zornitza Stark Phenotypes for gene: SEC31A were changed from ?Neurodevelopmental disorder with spastic quadriplegia, optic atrophy, seizures, and structural brain anomalies, OMIM #618651 to Halperin-Birk syndrome, MIM# 618651 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.432 | CACNA1A | Zornitza Stark Mode of inheritance for gene: CACNA1A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.430 | EXOSC10 |
Zornitza Stark gene: EXOSC10 was added gene: EXOSC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: EXOSC10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EXOSC10 were set to 41132091 Phenotypes for gene: EXOSC10 were set to Microcephaly, MONDO:0001149, EXOSC10-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.429 | ARHGEF6 | chirag patel reviewed gene: ARHGEF6: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Non-syndromic X-linked intellectual disability, MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.429 | RPS6KC1 |
Rylee Peters gene: RPS6KC1 was added gene: RPS6KC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: RPS6KC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RPS6KC1 were set to 41130203 Phenotypes for gene: RPS6KC1 were set to Complex neurodevelopmental disorder, MONDO:0100038, RPS6KC1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.427 | LRRC7 | Zornitza Stark Phenotypes for gene: LRRC7 were changed from neurodevelopmental disorder (MONDO:0700092), LRRC7-related to Intellectual developmental disorder, autosomal dominant 77, MIM# 621415 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.426 | LRRC7 | Zornitza Stark edited their review of gene: LRRC7: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 77, MIM# 621415 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.425 | KLHL13 |
Krithika Murali gene: KLHL13 was added gene: KLHL13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KLHL13 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: KLHL13 were set to PMID: 41159445 Phenotypes for gene: KLHL13 were set to Neurodevelopmental disorder, MONDO:0700092, KLHL13-related Review for gene: KLHL13 was set to GREEN Added comment: PMID: 41159445 Akhther et al 2025 (pre-print) report 8 affected individuals from 4 unrelated famlies with hemizygous/heterozygous KLHL13 variants and an X-linked neurodevelopmental disorder with the following phenotypic features including mild-severe ID, developmental delay, macrocephaly, hypotonia, unsteady gait, facial dysmrophism and behavioural issues. Functional studies support LoF disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.420 | BAIAP2 |
Bryony Thompson gene: BAIAP2 was added gene: BAIAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: BAIAP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BAIAP2 were set to 41133935; 38149472 Phenotypes for gene: BAIAP2 were set to BAIAP2-related complex neurodevelopmental disorder MONDO:0100038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.418 | Zornitza Stark Copied gene QSER1 from panel Fetal anomalies | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.418 | QSER1 |
Zornitza Stark gene: QSER1 was added gene: QSER1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature,Literature Mode of inheritance for gene: QSER1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: QSER1 were set to PMID: 41139957 Phenotypes for gene: QSER1 were set to Neurodevelopmental disorder, MONDO:0700092, QSER1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.416 | CCNK |
Sangavi Sivagnanasundram gene: CCNK was added gene: CCNK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCNK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CCNK were set to 41101726; 37597256; 30122539 Phenotypes for gene: CCNK were set to CCNK-related neurodevelopmental disorder-severe intellectual disability-facial dysmorphism syndrome MONDO:0035775 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.414 | SRRM1 |
Zornitza Stark gene: SRRM1 was added gene: SRRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SRRM1 were set to 41145827 Phenotypes for gene: SRRM1 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM1-related Review for gene: SRRM1 was set to GREEN Added comment: PMID 41145827 reports three individuals from three unrelated families with heterozygous truncating SRRM1 variants presenting with a neurodevelopmental disorder characterised by developmental delay, intellectual disability, short stature, behavioural and skeletal anomalies, and facial dysmorphism. Two variants are confirmed de novo and functional assays in neuronal‑like cells and Drosophila support haploinsufficiency as a disease mechanism. Serine/arginine repetitive matrix protein 1 (SRRM1) is a key component of spliceosomes and plays various roles in messenger RNA processing. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.413 | SGSM3 | Zornitza Stark Phenotypes for gene: SGSM3 were changed from Neurodevelopmental disorder (MONDO:0700092), SGSM3-related to Intellectual developmental disorder, autosomal recessive 84, MIM# 620401 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.412 | SGSM3 | Zornitza Stark reviewed gene: SGSM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 84, MIM# 620401; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.412 | PAN2 | Zornitza Stark Phenotypes for gene: PAN2 were changed from Syndromic disease MONDO:0002254 to Developmental delay with variable cardiac and renal congenital anomalies and dysmoprhic facies, MIM# 621384 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.411 | PAN2 | Zornitza Stark reviewed gene: PAN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay with variable cardiac and renal congenital anomalies and dysmoprhic facies, MIM# 621384; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.411 | TAF2 | Zornitza Stark Phenotypes for gene: TAF2 were changed from Mental retardation, autosomal recessive 40, MIM# 615599 to Intellectual development disorder, autosomal recessive 40, MIM# 615599 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.410 | TAF2 | Zornitza Stark edited their review of gene: TAF2: Changed phenotypes: Intellectual development disorder, autosomal recessive 40, MIM# 615599 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.399 | SLC27A3 |
Sarah Milton gene: SLC27A3 was added gene: SLC27A3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC27A3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC27A3 were set to PMID: 41054338 Phenotypes for gene: SLC27A3 were set to Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.398 | OTUD7A | Rylee Peters reviewed gene: OTUD7A: Rating: GREEN; Mode of pathogenicity: None; Publications: 29395075, 31997314, 33381903, 36180924, 41028987; Phenotypes: Neurodevelopmental disorder with hypotonia and seizures (MIM#620790), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.398 | AUTS2 | Fahaz Nazer reviewed gene: AUTS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 39953909; Phenotypes: Intellectual developmental disorder, autosomal dominant 26, MIM# 615834; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.398 | SLC31A1 | Rylee Peters reviewed gene: SLC31A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 41040850; Phenotypes: Neurodegeneration and seizures due to copper transport defect MIM#620306; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.396 | SSPO |
Sarah Milton gene: SSPO was added gene: SSPO was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: SSPO. Mode of inheritance for gene: SSPO was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SSPO were set to PMID: 41077560 Phenotypes for gene: SSPO were set to Neurodevelopmental disorder, MONDO:0700092, SSPOP-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.395 | PPFIA2 |
Zornitza Stark gene: PPFIA2 was added gene: PPFIA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: PPFIA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPFIA2 were set to 41044885 Phenotypes for gene: PPFIA2 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA2 related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.394 | EIPR1 |
Zornitza Stark gene: EIPR1 was added gene: EIPR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: EIPR1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIPR1 were set to 41058046 Phenotypes for gene: EIPR1 were set to Mendelian neurodevelopmental disorder MONDO:0100500, EIPR1-related Penetrance for gene: EIPR1 were set to unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.393 | BRSK1 |
Zornitza Stark gene: BRSK1 was added gene: BRSK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: BRSK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BRSK1 were set to 41035394 Phenotypes for gene: BRSK1 were set to Neurodevelopmental disorder, MONDO:0700092, BRSK1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.392 | KLHL20 | Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.391 | KLHL20 | Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder (MONDO:0700092), KLHL20-related to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.390 | KLHL20 | Zornitza Stark reviewed gene: KLHL20: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.390 | SNAPIN | Zornitza Stark Phenotypes for gene: SNAPIN were changed from Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393 to Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.389 | SNAPIN | Zornitza Stark Phenotypes for gene: SNAPIN were changed from Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related to Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.388 | SNAPIN | Zornitza Stark reviewed gene: SNAPIN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.382 | TBCB | Zornitza Stark Phenotypes for gene: TBCB were changed from Neurodevelopmental disorder, MONDO:0700092, TBCB-related to Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.381 | TBCB | Zornitza Stark reviewed gene: TBCB: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.380 | TBX2 |
Krithika Murali gene: TBX2 was added gene: TBX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TBX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TBX2 were set to PMID: 36733940 Phenotypes for gene: TBX2 were set to Vertebral anomalies and variable endocrine and T-cell dysfunction - MIM#618223 Review for gene: TBX2 was set to AMBER Added comment: PMID: 36733940 Rafeeq et al 2022 report a novel de novo nonsense variant (c.529A>T; p.Lys177*; NM_005994.4) in a child with chondrodysplasia. Skeletal features included spinal deformities, short limbs, metaphyseal and epiphyseal dysplasia, and bilateral developmental dislocation of the hip (DDH). Global developmental delay was also noted in this child. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.378 | EIF3B |
Zornitza Stark gene: EIF3B was added gene: EIF3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF3B were set to 41033306 Phenotypes for gene: EIF3B were set to Syndromic disease (MONDO:0002254), EIF3B-related Review for gene: EIF3B was set to GREEN Added comment: Fourteen individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.376 | EIF3A |
Zornitza Stark changed review comment from: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature; to: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.376 | EIF3A |
Zornitza Stark gene: EIF3A was added gene: EIF3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF3A were set to 41033306 Phenotypes for gene: EIF3A were set to Syndromic disease (MONDO:0002254), EIF3A-related Added comment: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.373 | MDGA2 |
Zornitza Stark gene: MDGA2 was added gene: MDGA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MDGA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MDGA2 were set to https://doi.org/10.1101/2025.08.28.25330873; 40168357; 27608760 Phenotypes for gene: MDGA2 were set to MDGA2-related neurodevelopmental disorder MONDO:0700092 Review for gene: MDGA2 was set to GREEN Added comment: Affected individuals present with a broad neurodevelopmental impairment-like phenotype. Pre-print - https://doi.org/10.1101/2025.08.28.25330873 Individuals with developmental and epileptic encephalopathy (DEE) 8 individuals from 6 consanguineous families exhibiting infantile hypotonia, severe neurodevelopmental delay, intractable seizures, progressive brain atrophy, and consistent dysmorphic features. 7 different biallelic LoF variants were identified p.Tyr913Ter, p.Arg404Ter, p.Leu920Ter, c.421-1G>A, p.Lys391SerfsTer7 and c.421-96_595+99del - all variants are rare or absent in gnomAD v4.1 In vitro functional studies of three nonsense variants in mammalian expression systems and hippocampal cultured neurons that resulted in impaired MDGA2 membrane trafficking are supportive of a loss-of-function mechanism. PMID: 40168357, 27608760 A knockout mouse model showed that MGAD2-deficient mice presented with autism-like behaviours (social deficits, repetitive behaviour, and cognitive impairment). The mice also showed abnormalities in excitatory synapses. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.371 | DBX1 |
Zornitza Stark gene: DBX1 was added gene: DBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DBX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DBX1 were set to 40995053 Phenotypes for gene: DBX1 were set to central hypoventilation syndrome, congenital MONDO:0800031 Review for gene: DBX1 was set to RED Added comment: Single individual reported with congenital central hypoventilation syndrome (atypical CCHS) with central hypotonia, global developmental delay, seizures, autoaggressive behaviour. Consanguineous parents, hmz frameshift variant c.340_341delGC, absent from gnomAD. Mouse Dbx1 knockout is lethal indicating essential role in respiration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.369 | NFXL1 |
Zornitza Stark gene: NFXL1 was added gene: NFXL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NFXL1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NFXL1 were set to 40430072; 41024252 Phenotypes for gene: NFXL1 were set to Syndromic disease (MONDO:0002254), NFXL1-related Review for gene: NFXL1 was set to AMBER Added comment: PMID: 40430072 2 siblings with psychosis and schizophrenia, homozygous for Cys441Tyr. Some modelling suggested a deleterious affect but no functional studies performed. PMID: 41024252 8 patients from 7 families with joint hyperlaxity, with or without short stature and renal disease. 6 families were homozygous for p.(Cys539Trpfs*64) while the other two were homozygous for p.(Lys681*). Paper described both as founder variants but they are rare/absent in gnomad. Joint hyperlaxity (7), chronic kidney disease/FSGS (2) small echogenic kidneys (3), acute kidney injury (1), dysmorphic features (6), short stature (6), speech delay (3). One patient also had epilepsy, developmental delay and spasticity however c.728+1G>A in WDR45 explained this part of her phenotype. Other patients also had more severe outlying symptoms with no other explanation mentioned: 1 with developmental delay, hearing loss, brain malformations, skeletal abnormalities, and another a 3 year old who passed away following a complex medical course including blue sclera, proximal tibial fracture, severe respiratory distress due to a chest infection, and acute kidney injury. Amber given the variable phenotype findings of the reported patients and only 2 homozygous variants identified so far. Extent of associated DD/ID currently unclear but adding on this panel as it is often ordered in children with multi-system features suggestive of an underlying syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.366 | CDK9 |
Zornitza Stark gene: CDK9 was added gene: CDK9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDK9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CDK9 were set to 33640901; 30237576; 26633546 Phenotypes for gene: CDK9 were set to multiple congenital anomalies/dysmorphic syndrome-variable intellectual disability syndrome MONDO:0015160; CHARGE-like syndrome with retinal dystrophy Review for gene: CDK9 was set to AMBER Added comment: Two independent reports: 1) A boy with a phenotype resembling CHARGE syndrome (multiple anomalies involving the eyes, ears, cleft lip, and palate, and intellectual disability) with retinal dystrophy (p.A288T/p.R303C), 2) 4 consanguineous families homozygous for p.R225C, including a set of cousins. CDK9 variants demonstrated decreased kinase activity. One of the studies suggested the extent the kinase activity is reduced may account for the absence/presence of the CHARGE-like phenotype with retinal dystrophy One additional family with retinal dystrophy only. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.358 | NAA20 | Chern Lim reviewed gene: NAA20: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37191084; Phenotypes: Intellectual developmental disorder, autosomal recessive 73, MIM# 619717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.354 | DDOST | Bryony Thompson reviewed gene: DDOST: Rating: ; Mode of pathogenicity: None; Publications: 22305527, 34462534, 36214423, 37848450, 33413482, 36631682; Phenotypes: DDOST-congenital disorder of glycosylation MONDO:0013789; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.354 | TM2D3 | Zornitza Stark Phenotypes for gene: TM2D3 were changed from Neurodevelopmental disorder, MONDO:0700092, TM2D3-related to Neurocardiorenal malformation syndrome, MIM# 621379 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.353 | TM2D3 | Zornitza Stark edited their review of gene: TM2D3: Changed phenotypes: Neurocardiorenal malformation syndrome, MIM# 621379 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.352 | ATXN7L3 | Zornitza Stark reviewed gene: ATXN7L3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Harel-Tora neurodevelopmental syndrome, MIM# 621377; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | BCAT1 |
Lucy Spencer gene: BCAT1 was added gene: BCAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BCAT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BCAT1 were set to 41029903 Phenotypes for gene: BCAT1 were set to Neurodevelopmental disorder (MONDO:0700092), BCAT1-related Review for gene: BCAT1 was set to RED Added comment: PMID: 41029903 One patient with a suspected neurometabolic disorder; congenital blindness and suspected Leber Congenital Amaurosis, microcephaly, failure to thrive, profound global developmental delay and extensive delayed myelination on MRI. AT 10 he was non-verbal and non-ambulatory with regression of motor skills and -3SD for height and weight. Compound heterozygous for Phe264Leu (539 hets but no homs in gnomad v4) and Glu348Lys (over 8000 hets and 24 homs in gnomad v4). in compound heterozygous iPSCs a severe 75% reduction in BCAT1 protein levels was seen, but mRNA levels were normal suggesting the variants affect protein stability or increased degradation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | RNU6ATAC |
Lucy Spencer gene: RNU6ATAC was added gene: RNU6ATAC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU6ATAC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNU6ATAC were set to 40975062 Phenotypes for gene: RNU6ATAC were set to Neurodevelopmental disorder (MONDO:0700092), RNU6ATAC-related Review for gene: RNU6ATAC was set to RED Added comment: PMID: 40975062 1 patient compound heterozygous for n.36T>G and n.28C>T. Has short stature, microcephaly, hypotonia, neurodevelopmental delay, ID, seizures, ataxia, ventriculomegaly, syndactyly, nystagmus and oculomotor apraxia. Identified in a cohort of individuals with an excess of significant intron retention outliers in minor intron containing genes which are usually removed by the minor spliceosome of which RNU6ATAC is a part (as is RNU4ATAC). Proband had no candidate variants in RNU4ATAC or RNU12. Both RNU6ATAC variants are in a highly conserved 39bp region, and affect nucleotides predicted to be important for binding to U4ATAC. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | PTBP1 |
Lucy Spencer gene: PTBP1 was added gene: PTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTBP1 were set to 40965981 Phenotypes for gene: PTBP1 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP1-related Review for gene: PTBP1 was set to GREEN Added comment: PMID: 40965981 27 individuals with abnormal prenatal ultrasound in thirteen (48%) including short femora, IUGR, hydramnios, increased nuchal translucency, asymmetry of heart cavities, and bilateral hydronephrosis. Skeletal anomalies were seen in 24 (89%), short stature/limbs in 63%, facial dysmorphism 25 (93%), developmental delay in 78%, behavioral problems in 30% and ID in 26% generally mild/moderate, 43% had variable brain MRI abnormalities. additional features included skin, nail, and hair anomalies (52%), dental anomalies (37%), ophthalmological findings (44%), and cardiovascular defects (22%). Variants a mix of missense and startloss, and were confirmed de novo in 23/17 cases. Various functional studies showed reduced nuclear localization and enhanced cytoplasmic retention, with start-loss variants also leading to increased protein stability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | PTBP2 |
Lucy Spencer gene: PTBP2 was added gene: PTBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTBP2 were set to 40965981 Phenotypes for gene: PTBP2 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP2-related Review for gene: PTBP2 was set to AMBER Added comment: PMID: 40965981 2 males with developmental delay, ID, autistic features. 1 had some dysmorphic features and tonic-clonic seizures. both probands had a de novo variant in PTBP2 NM_021190.4:c.2T>C (p.Met1?) and NM_021190.4:c.41G>C (p.Arg14Thr), absent from gnomad. Transfection of the variants in transfection in NIH-3T3 cells showed the missense had cytoplasmic retention and colocalization with processing bodies, and that there were 2 alternative downstream start sites Met32 and Met35 that may be used instead. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | ITGAV | Zornitza Stark Phenotypes for gene: ITGAV were changed from Syndromic disease, MONDO:0002254, ITGAV-related to Neurodevelopmental disorder with speech delay and behavioural abnormalities, MIM# 621372 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.348 | ITGAV | Zornitza Stark edited their review of gene: ITGAV: Changed rating: GREEN; Changed phenotypes: Neurodevelopmental disorder with speech delay and behavioural abnormalities, MIM# 621372 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.348 | UBR5 | Zornitza Stark Phenotypes for gene: UBR5 were changed from Neurodevelopmental disorder MONDO:0700092, UBR5-related to Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.347 | UBR5 | Zornitza Stark reviewed gene: UBR5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.347 | DNM1L |
chirag patel Source Genetic Health Queensland was removed from DNM1L. Source ClinGen was added to DNM1L. Source Literature was added to DNM1L. Mode of pathogenicity for gene DNM1L was changed from to Other Phenotypes for gene: DNM1L were changed from Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388 to Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726 Publications for gene DNM1L were changed from 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748 to 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.346 | SF1 |
Sarah Milton gene: SF1 was added gene: SF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SF1 were set to PMID: 40987292 Phenotypes for gene: SF1 were set to Neurodevelopmental disorder, MONDO:0700092, SF1-related Review for gene: SF1 was set to GREEN Added comment: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15). Variant types included missense and high impact LOF (nonsense and frameshift). Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets. pLI for SF1 is 1 with overall few LOF variants in gene. Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.342 | LEO1 | chirag patel reviewed gene: LEO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 40993282, 33004838, 31785789, 40671880, 29674594; Phenotypes: Neurodevelopmental disorder MONDO:0700092, LEO-1 related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.342 | SYNE2 |
chirag patel gene: SYNE2 was added gene: SYNE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SYNE2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SYNE2 were set to 34573277 Phenotypes for gene: SYNE2 were set to Neurodevelopmental disorder, MONDO:0700092, SYNE2 related Review for gene: SYNE2 was set to RED Added comment: 1 individual with autism spectrum disorder, developmental delay and intellectual disability (from a cohort of 410 trios with neurodevelopmental disorders). Trio WES found compound heterozygous variants in SYNE2 [c.2483T>G; p.(Val828Gly) and c.2362G>A; p.(Glu788Lys)]. Both variants are rare, predicted to be highly damaging using in silico tools, and located in the nesprin-2 giant spectrin repeat domain. Both parents and the healthy brother were heterozygous. Expression and functional testing in patient lymphoblastoid cell lines showed a significant reduction of nesprin-2 giant protein levels, however SYNE2 transcription and the nuclear envelope localisation of the mutant proteins was unaffected as compared to parental control cells. SYNE 1-4 genes encode for nesprins (nuclear envelope spectrin repeat proteins) which play fundamental roles in nuclear architecture and positioning, directed cell migration, cellular signalling, ciliogenesis, and mechanobiology. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | INTS6 |
Sarah Milton changed review comment from: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature; to: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | INTS6 |
Sarah Milton gene: INTS6 was added gene: INTS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: INTS6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: INTS6 were set to PMID: 40966122 Phenotypes for gene: INTS6 were set to Neurodevelopmental disorder, MONDO:0700092, INTS6-related Review for gene: INTS6 was set to GREEN Added comment: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.339 | RNU2-2P | Zornitza Stark Mode of inheritance for gene: RNU2-2P was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.338 | RNU2-2P | Zornitza Stark edited their review of gene: RNU2-2P: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.337 | CRNKL1 | Boris Keren reviewed gene: CRNKL1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 40857589; Phenotypes: microcephaly, intellectual disability, simplified gyration, epilepsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.335 | MRPS36 |
Krithika Murali gene: MRPS36 was added gene: MRPS36 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRPS36 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MRPS36 were set to PMID: 41018056; 38685873 Phenotypes for gene: MRPS36 were set to Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related Review for gene: MRPS36 was set to AMBER Added comment: 3 individuals from 2 unrelated families reported with biallelic MRPS36 variants (current HGNC is KGD4). Gene encodes E4 subunit of OGDHC complex. Individuals present with a phenotype consistent with Leigh syndrome including seizures, hypotonia, dystonia, brain imaging anomalies, persistent lactic acidosis. GDD, ID and cardiomyopathy also reported. Patient-derived fibroblast studies demonstrates reduced OGDHC enzymatic activity, however, this functional evidence is not gene or variant-specific. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.332 | GTF2I | Zornitza Stark Mode of inheritance for gene: GTF2I was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.330 | GTF2I | Zornitza Stark edited their review of gene: GTF2I: Added comment: 7 individuals reported with de novo variants in this gene and a neurodevelopmental disorder. All but one of the variants are absent from gnomAD v4 (one het present for the indel variant).; Changed rating: GREEN; Changed publications: 40962490; Changed phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF2I-relatedder; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.329 | BBOX1 |
Zornitza Stark gene: BBOX1 was added gene: BBOX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BBOX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BBOX1 were set to 41022783 Phenotypes for gene: BBOX1 were set to Carnitine deficiency, MONDO:0017716, BBOX1-related Review for gene: BBOX1 was set to AMBER Added comment: Three individuals from two unrelated families reported, presenting with myopathy, neurodevelopmental delay, and later-onset psychiatric manifestations. C. elegans knockout and patient-variant models show embryonic lethality rescued by L‑carnitine supplementation Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.320 | RAC1 | Zornitza Stark Phenotypes for gene: RAC1 were changed from Mental retardation, autosomal dominant 48, MIM# 617751 to Intellectual developmental disorder, autosomal dominant 48 MIM#617751 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.319 | RAC1 | Zornitza Stark edited their review of gene: RAC1: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 48 MIM#617751 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.314 | ALG2 | chirag patel reviewed gene: ALG2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 12684507, 34980536, 23404334, 30397276, 33644825; Phenotypes: Congenital disorder of glycosylation, type Ii, MIM# 607906; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.311 | AP2S1 | Boris Keren reviewed gene: AP2S1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 31981491, 33057194, 35982160, 35982159; Phenotypes: intellectual disability, epilepsy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.310 | GPHN | Bryony Thompson reviewed gene: GPHN: Rating: GREEN; Mode of pathogenicity: None; Publications: 22040219, 11095995, 9812897, 34617111; Phenotypes: sulfite oxidase deficiency due to molybdenum cofactor deficiency type C MONDO:0014212; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.304 | GNAI2 | Rylee Peters reviewed gene: GNAI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 40926810, 39298586; Phenotypes: Syndromic disease MONDO:0002254, GNAI2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.304 | TRPC5 | Rylee Peters reviewed gene: TRPC5: Rating: AMBER; Mode of pathogenicity: None; Publications: 40907672; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TRPC5-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.304 | KDM5A | Rylee Peters reviewed gene: KDM5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 33350388; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), KDM5A-related, AD; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.302 | TMEM167A |
chirag patel gene: TMEM167A was added gene: TMEM167A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM167A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM167A were set to PMID: 40924476 Phenotypes for gene: TMEM167A were set to Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related Review for gene: TMEM167A was set to GREEN Added comment: 6 individuals from 6 unrelated families (4/6 consanguineous) presenting with neonatal diabetes onset <4mths (6/6), severe microcephaly (6/6), epilepsy (5/6), and developmental delay (4/6). Whole genome sequencing identified biallelic variants in TMEM167A gene. Variants were homozygous in 5/6 families, and variant types were missense (4), frameshift (1), and splice (1), and all variants were rare/unreported in gnomAD. Segregation studies not reported in paper. Microcephaly, epilepsy and diabetes syndrome has 2 known associated genes (IER3IP1 and YIPF5) which encode proteins involved in endoplasmic reticulum to Golgi trafficking. TMEM167A is highly expressed in developing and adult human pancreas and brain. Both TMEM167A depletion in EndoC-βH1 cells and knock‑in of p.Val59Glu variant in iPSC-derived β cells sensitized β cells to ER stress. The p.Val59Glu variant impaired proinsulin trafficking to the Golgi and induced iPSC-β cell dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.298 | ZNF865 | Zornitza Stark reviewed gene: ZNF865: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ZNF865‑associated neurodevelopmental disorder MONDO:0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.296 | ZNF865 |
Sangavi Sivagnanasundram gene: ZNF865 was added gene: ZNF865 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF865 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNF865 were set to 40936200 Phenotypes for gene: ZNF865 were set to ZNF865‑associated neurodevelopmental disorder MONDO:0700092 Review for gene: ZNF865 was set to AMBER Added comment: PMID: 40936200 18 patients reported with DD, hypotonia and six individuals were reported with some dysmorphic features (frontal bossing, a broad nasal bridge, hypertelorism, and low-set ears) All 18 individuals were reported with de novo truncating variants in ZNF865. All variants were rare/absent in gnomAD v4.1. The mechanism of disease for this gene is unknown. No pathogenic SNVs have been reported in ClinVar at this stage however there are reports of VUS’s and pathogenic CNVs. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.296 | SNAPIN |
Lucy Spencer gene: SNAPIN was added gene: SNAPIN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNAPIN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNAPIN were set to 40930097; 26539891 Phenotypes for gene: SNAPIN were set to Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related Review for gene: SNAPIN was set to GREEN Added comment: PMID: 40930097 6 patients from 5 families with neuroanatomical, craniofacial, and skeletal anomalies on prenatal ultrasound/MRI, all homozygous for variants in SNAPIN. 2 stopgain, 1 canonical splice, 5 missense. common phenotypes: ventriculomegaly 5/6, cerebellar hypoplasia/atrophy 5/6, clubfeet 4/6, corpus callosum agenesis 4/6, flexion contractures 4/6, microcephaly 3/6, micrognathia/retrognathia 4/6. The patients with the nonsense or splice variants did not survive the perinatal period, while those with missense survived into early childhood. This paper also mentions a 7th patient reported in PMID: 26539891, who has ID, microcephaly, cortical atrophy, bulbar and cerebellar hypoplasia, sensorineural polyneuropathy, and hypotonia. They are homozygous for a missense variant Asn55Tyr. Of note, the other paper report this as Arg55Trp and one of their patients also has this variant, based off the transcript information provided in both papers Arg55Trp is correct. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.295 | SKOR2 |
Zornitza Stark gene: SKOR2 was added gene: SKOR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SKOR2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SKOR2 were set to 40890458; 29997391; 21937600 Phenotypes for gene: SKOR2 were set to complex neurodevelopmental disorder with motor features MONDO:0100516 Review for gene: SKOR2 was set to GREEN Added comment: 3 unrelated families with consistent phenotypes and a supportive mouse model: PMID: 40890458 - 2 unrelated consanguineous Iranian families with a combination of learning disability, facial dysmorphisms, and motor and speech impairments with homozygous variants (c.374 G>C: p.Arg125Pro & c.1271_1274del: p.K424Rfs*71). The homozygous missense variant segregated with disease in 8 individuals (no unaffected individuals tested were homozygous). PMID: 29997391 - proband with neurodevelopmental delay, hypotonia, ataxia, cerebellar dysplasia from a consanguineous Turkish family with a homozygous null variant (NM_001278063.1:c.2750C>G; p.Ser917*). None of the 4 healthy siblings were homozygous for the variant. PMID: 21937600 - Skor2 -/- mouse model had defective Purkinje cell development, a severe reduction of granule cell proliferation and a malformed cerebellum. Mouse had unstable gait. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.293 | GBX1 |
Zornitza Stark gene: GBX1 was added gene: GBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GBX1 were set to 40519143 Phenotypes for gene: GBX1 were set to Neurodevelopmental disorder, MONDO:0700092, GBX1-related Review for gene: GBX1 was set to RED Added comment: Single individual with de novo LoF variant with DD and focal epilepsy. Zebrafish model had abnormal morphology of the interocular area. Furthermore, the zebrafish larvae exhibited an increased susceptibility to neurophysiological abnormalities associated with epileptiform activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.291 | MTERF3 |
Zornitza Stark gene: MTERF3 was added gene: MTERF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MTERF3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MTERF3 were set to 40543543 Phenotypes for gene: MTERF3 were set to Mitochondrial disease (MONDO:0044970), MTERF3-related Review for gene: MTERF3 was set to AMBER Added comment: Two individuals reported from unrelated families, presenting with DD/ID, intermittent hypoglycaemia and metabolic acidosis. Genetic testing identified compound heterozygous variants c.635dup p.(Asn212Lysfs*7) and c.1055C > T p.(Pro352Leu) in Patient 1, and a homozygous variant c.943A > Gp.(Met315Val) in Patient 2. Patient's fibroblasts and MTERF3 knockdown cells showed impaired mitochondrial respiration and reduced levels of OXPHOS complexes I, III, and IV. Transcription of MT-ND5, ND6, COII, and COIII was reduced, while other mitochondrial genes were upregulated. Wild-type MTERF3 expression restored these defects, but the variant Pro352Leu from patient failed to rescue mitochondrial dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.289 | ATP5A1 |
Zornitza Stark gene: ATP5A1 was added gene: ATP5A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP5A1 were set to 34483339; 34954817; 40859057 Phenotypes for gene: ATP5A1 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD Review for gene: ATP5A1 was set to GREEN Added comment: At least 12 individuals reported with de novo missense variants in this gene, several recurrent. PMIDs: 34483339, 34954817: 6xde novo patients 4 with Arg207His, 1 Arg182Gln 1 Ser346Phe. All Arg207His patients were neonates with failure to thrive, hyperammonemia, lactic acidosis, and respiratory defects in fibroblasts, major symptoms remitted with treatment by late infancy, and at age 14mo to 3yrs growth and development were normal. Other 2 patients are 17yo with ID, ataxia, spastic paraparesis and dystonia, and a 12yo with psychomotor retardation, spastic tetraparesis, generalised dystonia, absent speech, swallowing problems, and increased blood lactate concentrations. And an internal VCGS patient Arg182Gln (variant also seen in a different patient above) with ID, muscular hypotonia, clinodactyly of the 5th finger, and dysmorphic facial features, proteomics showed decreased ATP5F1A and a complex V deficiency. There is also an alternative change at this residue in the DECIPHER cohort Arg182Pro de novo in an individual with a neurodevelopmental disorder. PMID: 40672495: 6x de novo individuals - 4 variants p.Arg182Gln, p.Ser346Phe, p.Pro331Leu, and p.Leu109Ser - with complex but overlapping neurological phenotypes including developmental delays, intellectual disability, pyramidal tract dysfunction, and dystonia. In vivo functional studies in C. elegans were performed for three of the variants, showing growth defects and disruption of mitochondrial function (measured by mitochondrial stress). Authors suggest a dominant negative mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.285 | UPF1 |
Zornitza Stark edited their review of gene: UPF1: Added comment: Additional reports identified: PMID:28135719 (2017) reported four unrelated patients with de novo heterozygous missense variants in UPF1 gene from the Deciphering Developmental Disorders Study cohort, for which no detailed phenotypic information was available in the publication. Three patients were reported with global developmental delay (mild in one) and the fourth patient was reported with neurodevelopmental delay as one of the presenting phenotypes in the Decipher database (https://www.deciphergenomics.org/gene/UPF1/patient-overlap/snvs) PMID:28539120 (2017) reported a patient with significant intellectual disability (ID) and gross motor delay and with a heterozygous likely pathogenic variant in UPF1 gene (c.1576_1577delinsAA/ p.Ala526Asn). However, this patient also harboured a heterozygous likely pathogenic variant in SQSTM1 gene. As reviewed below by Ivone Leong, the authors suggested that it is plausible that the haploinsufficiency of SQSTM1 may have caused neurofunctional defects, which the haploinsufficiency of UPF1 may have exacerbated. PMID:39571789 (2024) reported two unrelated paediatric patients with intellectual disabilities, frontal bossing, hypertelorism, high frontal hairline, and thin upper lip. They both had language and motor delays and were identified with de novo heterozygous variants in UPF1 gene (c.949_951del/ p.Asp317del & c.1984G>A/ p.Asp662Asn). The p.Asp662Asn variant has also been previously reported in a patient from PMID:28135719. PMID:39993774 (2025) reported a 17‐year‐old male patient with moderate intellectual disability, atypical autism, ADHD, and aggressivity. He was identified with a de novo missense variant in UPF1 gene - c.1576G>A/ p.Ala526Thr.; Changed rating: GREEN; Changed publications: 33057194, 28135719, 28539120, 39571789, 39993774; Changed phenotypes: neurodevelopmental disorder, MONDO:0700092, UPF1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.285 | COMMD9 |
Krithika Murali gene: COMMD9 was added gene: COMMD9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COMMD9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COMMD9 were set to PMID: 40601774 Phenotypes for gene: COMMD9 were set to Neurodevelopmental disorder, MONDO:0700092, COMMD9-related Review for gene: COMMD9 was set to RED Added comment: PMID: 40601774 report a cohort ascertained through GeneMatcher with phenotypic features overlapping with Ritscher-Schinzel syndrome. Homozygous fs variant in COMMD9 [NM_014186.3:c.208_209del, p.Leu70Glyfs*5] identified in a 4 yo M with dev delay, dysmorphism, skeletal changes including brachydactyly and radioulnar dysostosis, hypotonia, MRI-B anomalies - dysgyria, dilated lateral ventricles, deep white matter periventricular demyelination, thin corpus callosum, cerebellar vermis hypoplasia and malrotation. Consanguineous parents confirmed to be heterozygous carriers. No information provided regarding segregation of these variants in unaffected siblings. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.283 | TBCB |
Krithika Murali gene: TBCB was added gene: TBCB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TBCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBCB were set to PMID: 40856104 Phenotypes for gene: TBCB were set to Neurodevelopmental disorder, MONDO:0700092, TBCB-related Review for gene: TBCB was set to AMBER Added comment: PMID: 40856104 Bratman, S. et al 2025 (Genetics in Medicine) report 10 individuals from 8 unrelated families of Ashkenazi Jewish descent with a homozygous missense founder variant in TBCB (c.589T>A, p.Tyr197Asn) identified through exome sequencing. This variant is present at 1.3% carrier frequency in the AJ population in gnomAD v4 with 0 homozygotes. Variant is reasonably well-conserved, REVEL 0.9 and in the Cap-Gly domain. No other homozygous missense variants in this region in gnomAD v4 and homozygous variants rare, overall. Phenotypic features included: - Motor/speech delays in infancy (almost all) - ASD (8/10) - ADHD (5/10) - Mild ID - formal cognitive evaluation (5/8). - Spastic paraparesis in late childhood (9-12y) with slowly progressive gait difficulties and lower limb spasticity. Urinary abnormalities were not reported. - Brain MRI was performed on five individuals - three displayed a thin corpus callosum, and two had decreased white matter. No prenatal features reported. Supportive Drosophilia models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.281 | COMMD4 |
Lucy Spencer gene: COMMD4 was added gene: COMMD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COMMD4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COMMD4 were set to 40601774 Phenotypes for gene: COMMD4 were set to Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related Review for gene: COMMD4 was set to RED Added comment: PMID: 40601774 3 siblings with Ritscher-Schinzel syndrome and a homozygous missense in COMMD4 NM_017828.5:c.122T>G; p.Leu41Arg. All three individuals died in infancy and the authors suggest there could be a dual diagnosis to explain the severity. This variant was expressed in a H4 neuroglioma cell line with COMMD4 knocked out, and showed an enhanced degradative turnover compared to WT when treated with cyclohexamide. Western blot in HEK293T cells showed a decrease in the steady-state abundance of COMMD4. Knock out of COMMD4 protein leads to destabilization of the Commander complex. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.280 | TMEM184B |
Lucy Spencer gene: TMEM184B was added gene: TMEM184B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM184B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TMEM184B were set to 39006436 Phenotypes for gene: TMEM184B were set to Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related Review for gene: TMEM184B was set to GREEN Added comment: A cohort of 6 patients with developmental delay (5/6), corpus callosum hypoplasia (4/6), microcephaly (1/6), seizures (3/6), and ID (2/6). 2 patients also had gastrointestinal motility disruption. All 6 have de novo variants in TMEM184B, 5 missense 1 canonical splice. 1 of the missense variants has 35 hets in gnomad but the rest are absent. The authors also say they are aware of a 7th patient with overlapping features by personal communication. A knockout zebrafish model showed a dose dependent reduction in head size and body length in larvae. Knock-in of 2 of the missense variants also showed head size and body length reduction, but the other missense did not. However the other three missense failed to rescue the phenotype of a knockout zebrafish while WT and a negative control did. The authors suggest the first 2 variants are dominant negative while the latter three and loss of function. The splice variant was shown to cause exon 7 skipping which is out of frame. Transfection of the missense and splice variants in HEK293T cells showed that all but 1 had reduced TMEM184B protein levels. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.280 | POLR3D |
Zornitza Stark gene: POLR3D was added gene: POLR3D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POLR3D was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLR3D were set to 37915380 Phenotypes for gene: POLR3D were set to Leukodystrophy, MONDO:0019046, POLR3D-related Review for gene: POLR3D was set to RED Added comment: PMID 37915380: single individual with compound het variants in POLR3D and childhood onset leukodystrophy manifesting as DD/ID. Additional neurological features included cerebellar signs (e.g., dysarthria, ataxia, and intention tremor) and dysphagia, while non-neurological features included hypodontia, hypogonadotropic hypogonadism, and dysmorphic facial features. Her MRI was notable for diffuse hypomyelination with myelin preservation of early myelinating structures, characteristic of POLR3-related leukodystrophy. Exome sequencing revealed the biallelic variants in POLR3D, a missense variant (c.541C > T, p.P181S) and an intronic splice site variant (c.656-6G > A, p.?). Functional studies of the patient's fibroblasts demonstrated significantly decreased RNA-level expression of POLR3D, along with reduced expression of other Pol III subunit genes. Notably, Pol III transcription was also shown to be aberrant, with a significant decrease in 7SK RNA and several distinct tRNA genes analyzed. Affinity purification coupled to mass spectrometry of the POLR3D p.P181S variant showed normal assembly of Pol III subunits yet altered interaction of Pol III with the PAQosome chaperone complex, indicating the missense variant is likely to alter complex maturation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.278 | HS6ST2 |
Bryony Thompson gene: HS6ST2 was added gene: HS6ST2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HS6ST2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: HS6ST2 were set to 40686562; 30471091; 36993824; 38015989 Phenotypes for gene: HS6ST2 were set to X-linked syndromic intellectual disability MONDO:0020119 Review for gene: HS6ST2 was set to GREEN Added comment: 4 males with a neurodevelopmental phenotype from 3 families (1 set monozygotic twins) hemizygous for rare missense variants and a supporting mouse model. PMID: 40686562 - a Chinese male child with a syndromic neurodevelopmental phenotype hemizygous c.764C>A (p.Pro255Glu) and in vitro assays showing the variant alters function. Parents were unaffected and variant was maternally inherited. PMID: 38015989 - knockout mouse model impairs dendritic spines of hippocampal neurons, and affects memory. PMID: 36993824 - an Iranian male child with a syndromic neurodevelopmental phenotype hemizygouc.979C>T p.Pro327Ser. PMID: 30471091 - Italian monozygotic male twins with a syndromic neurodevelopmental phenotype hemizygous c.916G>C (p.G306R - inherited from unaffected mother) and functional assay showing altered enzyme activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.277 | CSMD2 | Zornitza Stark reviewed gene: CSMD2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Focal epilepsy - MONDO:0005384, CSMD2-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.277 | FSCN1 |
Zornitza Stark gene: FSCN1 was added gene: FSCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FSCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FSCN1 were set to 40874942 Phenotypes for gene: FSCN1 were set to Neurodevelopmental disorder, MONDO:0700092, FSCN1-related Review for gene: FSCN1 was set to RED Added comment: Two individuals reported from an Iranian cohort with same missense variant, c.665C>A; p.Ala222Asp plus other circumstantial data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.276 | TTC1 |
Zornitza Stark gene: TTC1 was added gene: TTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TTC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC1 were set to 40879651 Phenotypes for gene: TTC1 were set to Pontocerebellar hypoplasia, MONDO:0020135, TTC1-related Review for gene: TTC1 was set to RED Added comment: Four individuals from two families reported with the same homozygous missense variant, NM_003314.3: c.784 T > G, p.Phe262Val. No other supporting data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.274 | MAEA |
Zornitza Stark gene: MAEA was added gene: MAEA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAEA were set to 40880485 Phenotypes for gene: MAEA were set to Neurodevelopmental disorder, MONDO:0700092, MAEA-related Review for gene: MAEA was set to AMBER Added comment: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.273 | CSMD2 |
Krithika Murali changed review comment from: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature; to: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. In addition, no information about unaffected/affected siblings and segregation testing has been provided Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.272 | CSMD2 |
Krithika Murali gene: CSMD2 was added gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688 Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related Review for gene: CSMD2 was set to RED Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.272 | CSMD2 |
Krithika Murali gene: CSMD2 was added gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688 Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related Review for gene: CSMD2 was set to RED Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.267 | CCDC93 | Zornitza Stark reviewed gene: CCDC93: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.267 | WDR18 |
Krithika Murali gene: WDR18 was added gene: WDR18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WDR18 were set to PMID: 40677927 Phenotypes for gene: WDR18 were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: WDR18 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.266 | MIS18BP1 |
Krithika Murali gene: MIS18BP1 was added gene: MIS18BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MIS18BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MIS18BP1 were set to PMID: 40677927 Phenotypes for gene: MIS18BP1 were set to Cornelia de Lange syndrome (MONDO:0016033) Review for gene: MIS18BP1 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.265 | HYPK |
Zornitza Stark gene: HYPK was added gene: HYPK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HYPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HYPK were set to Clinical Genetics Early View Phenotypes for gene: HYPK were set to Neurodevelopmental disorder, MONDO:0700092, HYPK-related Review for gene: HYPK was set to RED Added comment: Single case report - Patel, R. et al 2025 Clinical Genetics Early View Male proband with developmental delay, autism and facial dysmorphism with a de novo missense HYPK variant (p. R70I). Variant-specific biochemical analyses demonstrates enhanced inhibitory activity of HYPK on NatA-mediated N-terminal protein acetylation. GestaltMatcher analysis indicates that the proband's facial phenotype closely resembles Ogden syndrome (NAA10) and some resemblance to NAA15-NDS - both associated genes are also involved in the N-terminal acetylation pathway. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.264 | DDX39A |
Zornitza Stark gene: DDX39A was added gene: DDX39A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DDX39A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDX39A were set to 40726340 Phenotypes for gene: DDX39A were set to Neurodevelopmental disorder, MONDO:0700092, DDX39A-related Review for gene: DDX39A was set to RED Added comment: PMID: 40726340 Ahmed et al 2025 (Clinical Genetics) report a 7 month old F with GDD, seizures, microcephaly, hypotonia, corpus callosum thinning and homozygous missense variant (p.Lys137Gln) in DDX39A on trio WES with both non-consanguineous parents confirmed to be heterozygous carriers. DDX39A is involved in mRNA splicing and export. Patient-derived fibroblast studies showed that mutant protein resulted in aberrant nuclear clumping and failure to interact with the TREX complex. Of note, closely-related paralogue DDX39B is also a component of the TREX complex and has a definitive monoallelic association with neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.263 | ARID3A |
Zornitza Stark gene: ARID3A was added gene: ARID3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARID3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARID3A were set to 40677927 Phenotypes for gene: ARID3A were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: ARID3A was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.262 | PIK3C3 |
Zornitza Stark gene: PIK3C3 was added gene: PIK3C3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIK3C3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PIK3C3 were set to 40677927 Phenotypes for gene: PIK3C3 were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: PIK3C3 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.260 | GLYAT |
Zornitza Stark changed review comment from: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized. Sources: Literature; to: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of oedema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.260 | GLYAT |
Zornitza Stark gene: GLYAT was added gene: GLYAT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GLYAT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GLYAT were set to 40747359 Phenotypes for gene: GLYAT were set to Neurodevelopmental disorder, MONDO:0700092, GLYAT-related Review for gene: GLYAT was set to RED Added comment: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.258 | C1orf109 |
Zornitza Stark gene: C1orf109 was added gene: C1orf109 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: C1orf109 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C1orf109 were set to 40760247 Phenotypes for gene: C1orf109 were set to Neurodevelopmental disorder, MONDO:0700092, C1orf109-related Review for gene: C1orf109 was set to GREEN Added comment: Cohort of 11 unrelated families, encompassing 18 individuals with bi-allelic variants in C1orf109, 17 liveborn. Affected individuals presented with moderate-to-severe or severe global developmental delay/intellectual disability (17 of 17) and never achieved developmental milestones. Microcephaly and seizures were other common features. Reduced ribosome activity demonstrated during early brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.256 | ASAP2 |
Zornitza Stark gene: ASAP2 was added gene: ASAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ASAP2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ASAP2 were set to 40770811; 28191890; 33057194; 35982160 Phenotypes for gene: ASAP2 were set to Neurodevelopmental disorder, MONDO:0700092, ASAP2-related Review for gene: ASAP2 was set to AMBER Added comment: One individual reported with compound het missense variants. Identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811. Another individual with biallelic variants identified in the DDD cohort. Several others found with de novo variants through retrospective literature review of large cohort studies reporting multiple gene candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of ASAP2 in brain development. Rated AMBER as only two families with bi-allelic variants and minimal information on the cases with mono-allelic variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.254 | RTF1 |
Zornitza Stark gene: RTF1 was added gene: RTF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RTF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RTF1 were set to 40770811; 33057194; 35982160; 31038196 Phenotypes for gene: RTF1 were set to Neurodevelopmental disorder, MONDO:0700092, RTF1-related Review for gene: RTF1 was set to GREEN Added comment: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.253 | MED29 |
Sarah Milton gene: MED29 was added gene: MED29 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MED29 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MED29 were set to PMID: 40745490 Phenotypes for gene: MED29 were set to Pontocerebellar hypoplasia, MONDO:0020135, MED29-related Review for gene: MED29 was set to AMBER Added comment: MED29 encodes part of the mediator (MED) complex which has role in RNA polymerase II (Poll II) gene transcription. PMID: 40745490 describes 2 siblings from one consanguineous family affected with pontocerebellar hypoplasia, profound GDD, severe microcephaly, cataracts and variable seizures. Both shared the same homozygous missense variant with presumed LOF mechanism. No homozygous LOF variants in gnomAD v4. Extensive functional studies performed with morpholino knockdown of MED29 having marked reduction of GABAergic neurons and abnormal touch response. Studies of hippocampal neurons from mice with knockdown MED29 showed impaired development. Mouse embryos that had knockdown of MED29 during development demonstrated abnormal neuronal migration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.253 | CCDC93 |
Sarah Milton gene: CCDC93 was added gene: CCDC93 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC93 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC93 were set to PMID: 40601774 Phenotypes for gene: CCDC93 were set to Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related Review for gene: CCDC93 was set to AMBER Added comment: CCDC93 encodes the coiled coil domain containing subunit of commander complex involved in recycling of integral membrane proteins. PMID: 40601774 describes 1 affected individual with compound heterozygous variants in CCDC93 who presented with Ritscher Schinzel like phenotype. Features included hypoplasia of cerebellar hemispheres, hypoplasia of the brainstem and of the corpus callosum, distinctive facial features and multiple small renal cysts. Variants were missense and nonsense. No homozygous LOF variants in gnomAD v4. Some supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.252 | SCN3B |
Sarah Milton gene: SCN3B was added gene: SCN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SCN3B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SCN3B were set to PMID: 40879121 Phenotypes for gene: SCN3B were set to Neurodevelopmental disorder, MONDO:0700092, SCN3B-related Review for gene: SCN3B was set to AMBER Added comment: SCN3B Encodes b3 auxiliary subunit of the sodium channel. 4 affected individuals from 2 consanguineous families reported in PMID: 40879121 with biallelic variants in this gene with neurodevelopmental phenotypes. Presentation included GDD, ID of variable severity, autism, seizures. One variant was nonsense, one canonical splice site in the penultimate exon. No homozygous LOF variants in gnomAD v4. Some functional studies performed with loss of function of channel demonstrated for one variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.252 | XPO1 |
Sangavi Sivagnanasundram gene: XPO1 was added gene: XPO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: XPO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: XPO1 were set to 40819229 Phenotypes for gene: XPO1 were set to Neurodevelopmental disorder, XPO1-related, MONDO:0700092 Review for gene: XPO1 was set to GREEN Added comment: Established gene-disease association 22 probands with de novo XPO1 variants presenting with phenotypes associated with NDD (DD, ID, motor delay, behavioral problems, facial dysmorphisms, microcephaly and organ anomalies) along with supportive Drosophila knockdown model reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.252 | ZNF496 |
Zornitza Stark gene: ZNF496 was added gene: ZNF496 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF496 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNF496 were set to 40806714 Phenotypes for gene: ZNF496 were set to Neurodevelopmental disorder, MONDO:0700092, ZNF496-related Review for gene: ZNF496 was set to RED Added comment: Single individual with NDD and de novo LoF variant, no other supportive data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.251 | TRIM74 |
Sangavi Sivagnanasundram gene: TRIM74 was added gene: TRIM74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRIM74 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRIM74 were set to 40735933 Phenotypes for gene: TRIM74 were set to Neurodevelopmental disorder, TRIM74-related, MONDO:0700092 Review for gene: TRIM74 was set to RED Added comment: Only one reported case with DD. PMID: 40735933 5yr M presenting from non consanguineous parents with global developmental delay, hypotonia, seizures, and diffuse cerebral atrophy with mega cisterna magna. Parents of the proband were found to be carriers of the variant. Homozygous variant c.562C > T (p.Pro121Leu) - NFE AF 0.0188% - rare enough for AR Supportive functional analysis on human fibroblast showed protein function disruption leading to protein aggregation, proteostasis collapse, and cell death. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.250 | TP63 | Zornitza Stark Phenotypes for gene: TP63 were changed from ADULT syndrome, OMIM #103285; Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome 3, OMIM #604292; Hay-Wells syndrome, OMIM #106260; Limb-mammary syndrome, OMIM #603543; Orofacial cleft 8, OMIM #618149; Rapp-Hodgkin syndrome, OMIM #129400; Split-hand/foot malformation 4, OMIM #605289 to TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.249 | TP63 | Zornitza Stark reviewed gene: TP63: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.248 | TMPRSS7 |
Zornitza Stark gene: TMPRSS7 was added gene: TMPRSS7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMPRSS7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMPRSS7 were set to 40796295 Phenotypes for gene: TMPRSS7 were set to Neurodevelopmental disorder, TMPRSS7-related Review for gene: TMPRSS7 was set to RED Added comment: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.247 | PPP1R2 |
Zornitza Stark gene: PPP1R2 was added gene: PPP1R2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP1R2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PPP1R2 were set to 40597352; 26558779 Phenotypes for gene: PPP1R2 were set to Neurodevelopmental disorder, PPP1R2-related Review for gene: PPP1R2 was set to RED Added comment: Single individual reported with homozygous splicing variant c.403 + 3 A >T. Abnormal splicing demonstrated but leaky. Clinical features included pre and postnatal growth restriction, ventricular septal defect, dysmorphic features (proptosis, long eye lashes, thick eyebrows, low-set ears), microcephaly, sensorineural hearing loss, cortical cataracts, retinal defects, intellectual disability with limited speech, and autism spectrum disorder. Note mouse model is embryonically lethal, leading the authors to speculate survival may be due to fraction of normally spliced transcripts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.245 | BORCS5 |
Zornitza Stark gene: BORCS5 was added gene: BORCS5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BORCS5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BORCS5 were set to 40385417 Phenotypes for gene: BORCS5 were set to Lysosomal storage disease, MONDO:0002561, BORCS5-related Review for gene: BORCS5 was set to GREEN Added comment: preprint PMID 40385417, describing 12 individuals from 7 families with a spectrum of abnormalities (osteopetrosis not mentioned), suggestive of lysosomal disorder. Homozygous loss-of-function variants presented with prenatally lethal arthrogryposis multiplex congenita, brain malformations, and neuropathological evidence of diffuse neuroaxonal dystrophy. Individuals with missense variants presented differently, with microcephaly, developmental epileptic encephalopathy, intellectual disability, optic atrophy, spasticity, and progressive movement disorders. In this group, brain MRI showed diffuse hypomyelination and progressive global cerebral atrophy, consistent with neurodegeneration. Borcs5 knockout in zebrafish exhibited microcephaly, motor deficits, and seizures, mirroring the patients' clinical presentation. At the cellular level, BORCS5 loss-of-function but not missense variants, resulted in lower protein expression and impaired BORC assembly, paralleled by perinuclear lysosomal clustering. However, both loss-of-function and missense BORCS5 variants were associated with reduced total lysosomal proteolysis, reduced activity of the lysosomal hydrolases glucocerebrosidase and cathepsin B, and presence of multilamellar bodies, indicating lysosomal dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.244 | ARNTL |
Sarah Milton gene: ARNTL was added gene: ARNTL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARNTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARNTL were set to PMID: 40720646 Phenotypes for gene: ARNTL were set to Neurodevelopmental disorder, MONDO:0700092, BMAL1-related Review for gene: ARNTL was set to GREEN Added comment: Note has new HGNC approved name - BMAL1 BMAL1 encodes a transcription factor that plays a role in the mammalian molecular clock, binds to promoter of PER and CRY family genes to promote transcription. Other circardian genes have sleep phase disorder assoc but not neurodevelopmental phenotype. 10 affected individuals described in PMID: 40455867 with variable developmental delay/ID from average IQ to severe ID, seizures in 50%, autism, some had sleep disturbance and marfanoid habitus. Variants were LOF & missense and very rare or absent in gnomAD v4. 5 confirmed de novo, 2 confirmed inherited (one from apparently unaffected mother). Functional studies using luciferase reporter assay of downstream target PER showed reduced luminescence for most variants with presumed LOF mechanism. One variant p.(Ile201Thr) led to increased luminescence with author's postulating GOF mechanism for this variant. Drosophilia studies for 2 of the variants demonstrated altered circadian rhythm. ?needs more studies to further define mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.242 | MAN2A2 | Zornitza Stark edited their review of gene: MAN2A2: Added comment: PMID 40628855: second unrelated individual reported, presenting with ID/autism and with bi-allelic variants, one missense and the other LoF. Abnormal glycosylation patterns observed consistent with CDG.; Changed publications: 36357165, 40628855 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.241 | CCDC186 |
Zornitza Stark gene: CCDC186 was added gene: CCDC186 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC186 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC186 were set to 33259146; 37569695; 40633195 Phenotypes for gene: CCDC186 were set to Neurodevelopmental disorder, MONDO:0700092, CCDC186-related Review for gene: CCDC186 was set to GREEN Added comment: At least 3 unrelated families reported with bi-allelic LoF variants and a neurodevelopmental phenotype comprising ID and seizures, plus other more variable features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.238 | TAF13 | Zornitza Stark Phenotypes for gene: TAF13 were changed from Mental retardation, autosomal recessive 60, MIM# 617432 to Intellectual developmental disorder, autosomal recessive 60, MIM# 617432 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.236 | TAF13 | Zornitza Stark edited their review of gene: TAF13: Changed publications: 28257693, 40679298; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 60, MIM# 617432 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.233 | NDC1 | Zornitza Stark reviewed gene: NDC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.231 | TCF7L2 | Zornitza Stark Phenotypes for gene: TCF7L2 were changed from Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Myopia; Abnormality of skeletal system to Neurodevelopmental disorder, MONDO:0700092, TCF7L2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.225 | SMARCD1 | Zornitza Stark reviewed gene: SMARCD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder MONDO:0700092, SMARCD1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.224 | SLC6A17 | Zornitza Stark Phenotypes for gene: SLC6A17 were changed from Mental retardation, autosomal recessive 48, MIM# 616269 to Intellectual developmental disorder, autosomal recessive 48, MIM# 616269 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.223 | SLC6A17 | Zornitza Stark edited their review of gene: SLC6A17: Changed phenotypes: Intellectual developmental disorder, autosomal recessive 48, MIM# 616269 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.221 | YWHAZ | Zornitza Stark reviewed gene: YWHAZ: Rating: AMBER; Mode of pathogenicity: None; Publications: 31024343, 35143101, 35501409, 22124272, 26207352; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, YWHAZ-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.221 | THRA | Zornitza Stark reviewed gene: THRA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypothyroidism congenital nongoitrous 6 (MIM 614450); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.220 | TBC1D32 |
Zornitza Stark gene: TBC1D32 was added gene: TBC1D32 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: TBC1D32 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBC1D32 were set to 24285566; 32573025; 32060556; 31130284; 36826837; 40319332 Phenotypes for gene: TBC1D32 were set to Orofacial digital syndrome type IX, MIM#258865 Review for gene: TBC1D32 was set to GREEN Added comment: Multiple affected individuals reported from unrelated families. Midline brain abnormalities are a feature and DD/ID is variable. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.213 | ST5 |
Rylee Peters gene: ST5 was added gene: ST5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ST5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ST5 were set to 40717498 Phenotypes for gene: ST5 were set to Neurodevelopmental disorder (MONDO:0700092), DENND2B-related Review for gene: ST5 was set to GREEN Added comment: HGNC: DENND2B Cohort of 11 individuals all with a history of motor and/or language developmental delay, intellectual disability in 6/11 (mild to severe), brain structure/function abnormalities were reported in 9/11 patients (7/11 seizures; 5/9 abnormal findings on brain MRI), muscle weakness/hypotonia in 8/9, psychosis in 4/10 patients, symptoms of catatonia in 4/10, other psychiatric/behavioural concerns (anxiety, attention deficit, autism or autistic features) in 10/10. Total of 10 variants including 2x frameshift/nonsense, 6x missense, 1x splice, 1x single amino acid deletion – all absent from v4 and de novo except 1 inherited from a father with cognitive and psychiatric symptoms and the inframe del which has 2 hets in gnomAD and is inherited an unaffected father (no formal assessment). In vivo zebrafish modelling measuring cilia length suggests that patient variants tested (9/10 excluding the splice variant) did not induce cilia length shortening, which is consistent with KO models and therefore a loss of function effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.213 | BLOC1S1 | Rylee Peters reviewed gene: BLOC1S1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://www.medrxiv.org/content/10.1101/2025.07.17.25331211v1; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), BLOC1S1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.213 | CHTF18 | Zornitza Stark Phenotypes for gene: CHTF18 were changed from complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465 to Neurodevelopmental disorder MONDO#0700092, CHTF18-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.211 | CHTF18 | Zornitza Stark reviewed gene: CHTF18: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.210 | KDM2B | Zornitza Stark reviewed gene: KDM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 40420380; Phenotypes: neurodevelopmental disorder MONDO#0700092, KDM2B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.209 | SNW1 |
Lucy Spencer gene: SNW1 was added gene: SNW1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNW1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SNW1 were set to 40608414 Phenotypes for gene: SNW1 were set to Neurodevelopmental disorder (MONDO:0700092), SNW1-related Review for gene: SNW1 was set to GREEN Added comment: cohort of 9 patients with moderate to profound ID, microcephaly, seizures (7/9), facial dysmorphism, and brain malformations (6/9 - corpus callosum hypoplasia, Dandy-Walker malformation). 3 splice, 1 frameshift, 2 missense, 3 in frame deletions, 1 start loss. all but 1 de novo (the last parents not available). SNW1 is a core component of the spliceosome and facilitates the conformational changes of the spliceosome. Expression of variants in HEK293 cells showed some decreased SNW1 expression while others increased it (including the frameshift), and only the frameshift variant was mislocalised/in the cytoplasm instead of the nucleus. Several of the variants caused loss of binding to PPIL1 or other proteins which SNW1 usually recruits to the spliceosome. All variants in this study were found to either affect protein expression or localization or influence interactions with other proteins in the spliceosome complex suggesting loss of function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.208 | CHTF18 |
Sangavi Sivagnanasundram gene: CHTF18 was added gene: CHTF18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHTF18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHTF18 were set to 40717333 Phenotypes for gene: CHTF18 were set to complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465 Review for gene: CHTF18 was set to AMBER Added comment: Only two individuals reported with ID/DD: 1 - 9M with DD, autism and seizures. De novo variant identified - p.Leu355Val 2 - 23month F with congenital bilateral ventriculomegaly status post ventriculoperitoneal shunt placement, epilepsy, right eye optic nerve hypoplasia, hypotonic cerebral palsy complicated by left hip subluxation, and G-tube dependence. De novo variant identified - p.His645Pro 3 - 3F presenting with global DD, hypotonia, seizure and abnormal brain MRI. De novo variant identified - p.Leu676Arg Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.207 | SV2A | Ava Stevenson reviewed gene: SV2A: Rating: AMBER; Mode of pathogenicity: None; Publications: 36350923, 37861890; Phenotypes: Developmental and epileptic encephalopathy 113 (MIM#620772), AR, Neurodevelopmental disorder, MONDO:0700092, SV2A-related, AD; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.206 | RNU5A-1 |
Zornitza Stark gene: RNU5A-1 was added gene: RNU5A-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU5A-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU5A-1 were set to 40379786 Phenotypes for gene: RNU5A-1 were set to Neurodevelopmental disorder (MONDO:0700092), RNU5A-1 related Review for gene: RNU5A-1 was set to AMBER Added comment: PMID: 40379786 (2025) - three unrelated individuals with de novo variants in the RNU5A-1 gene (classified as VUS) and a neurodevelopmental disorder. Six individuals with rare de novo variants were identified in total but clinical details were only available for 3/6. Of these three individuals, two harboured the same variant (n.40_41insA) on the maternal allele, while the third individual harboured a different variant (n.39del) but also on the 5′ loop I domain of RNU5A-1. Clinical data showed neurodevelopmental abnormalities (mild ID (2), severe ID (1), epilepsy (2), brain MRI abnormalities (1)) with variable congenital malformations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.204 | BSN |
Zornitza Stark gene: BSN was added gene: BSN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: BSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BSN were set to 40393460 Phenotypes for gene: BSN were set to Neurodevelopmental disorder (MONDO:0700092), BSN-related Review for gene: BSN was set to GREEN Added comment: Guzman et al 2025: Described 12 additional patients with missense (3/12) and premature termination variants (9/12) which included de novo and inherited variants, suggesting incomplete penetrance. They assessed all reported patients (n=29) which revealed common clinical characteristics including epilepsy(13/29), febrile seizures (7/29), generalised tonic-clonic seizures (5/29), and focal-onset seizures (3/29). Behavioural phenotypes were present in almost half of all individuals (14/29), which included ADHD (7/29) and autistic behaviour (5/29). Additional common features included developmental delay (11/29), obesity (10/29), and delayed speech (8/29). In adults with BSN PTVs, milder features were common, suggesting phenotypic variability, including a range of individuals without obvious neurodevelopmental features (7/29). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.202 | CRBN | Elena Savva Phenotypes for gene: CRBN were changed from Intellectual developmental disorder, autosomal recessive 2, MIM# 607417 to Intellectual developmental disorder, autosomal recessive 2, MIM# 607417 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.202 | CRBN | Elena Savva Phenotypes for gene: CRBN were changed from Mental retardation, autosomal recessive 2, MIM# 607417 to Intellectual developmental disorder, autosomal recessive 2, MIM# 607417 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.201 | CRBN | Elena Savva Mode of inheritance for gene: CRBN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.200 | MARK2 | Zornitza Stark Phenotypes for gene: MARK2 were changed from Neurodevelopmental disorder MONDO:0700092 to Intellectual developmental disorder, autosomal dominant 76, MIM# 621285 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.199 | MARK2 | Zornitza Stark reviewed gene: MARK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 76, MIM# 621285; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.198 | PDE1B |
Zornitza Stark gene: PDE1B was added gene: PDE1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PDE1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDE1B were set to 40492975 Phenotypes for gene: PDE1B were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related Review for gene: PDE1B was set to GREEN Added comment: PMID:40492975 reported seven individuals from five unrelated families identified with biallelic PDE1B variants. Three truncating (p.Gln45Ter, p.Gln86Ter, p.Ser298Alafs*6) and three splicing variants (c.594 + 2 T>G, c.735 + 5G>A, c.837-1G>C) were identified from these patients in total. They presented with an early-onset movement disorder characterised by hypotonia in infancy, progressing to ataxia and dystonia in early childhood, with motor and speech delay, and intellectual disability. Functional evidence is also available for these variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.195 | FASTKD5 |
chirag patel gene: FASTKD5 was added gene: FASTKD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FASTKD5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FASTKD5 were set to PMID: 40499538 Phenotypes for gene: FASTKD5 were set to Leigh syndrome MONDO:0009723 Review for gene: FASTKD5 was set to GREEN Added comment: 3 unrelated individuals with Leigh syndrome (1 x severe/early-onset/fatal, 1 x milder/childhood-onset, 1 x adult-onset). WES identified compound heterozygous variants in FASTKD5 gene (3 x missense variants, 2 x frameshift variants leading to a premature stop codon). The FASTKD5 gene codes for a mitochondrial protein essential for processing mRNAs at non-canonical cleavage sites in the primary mitochondrial transcript. Analysis of fibroblasts from two subjects showed reduced steady-state levels of FASTKD5 protein by immunoblot, reduced translation of the cytochrome c oxidase subunit 1, impaired assembly of complex IV, and a consequent decrease in cytochrome c oxidase enzymatic activity. The extent of these deficiencies appeared to correlate with the severity of the clinical phenotype. Expression of a wild-type FASTKD5 cDNA, but not cDNAs expressing the missense variants, rescued all the molecular defects in the subjects' fibroblasts, demonstrating that the alleles are pathogenic. 2/3 missense variants resulted in near complete loss of function, while one was hypomorphic, resulting from impaired protein stability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.193 | NDUFA4 |
Sarah Milton gene: NDUFA4 was added gene: NDUFA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NDUFA4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA4 were set to PMID: 39967265 Phenotypes for gene: NDUFA4 were set to Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065 Review for gene: NDUFA4 was set to GREEN Added comment: HGNC symbol now COXFA4 Around 10 patients reported in literature thus far with most having developmental delay. Association with hypertrophic cardiomyopathy reported in 3 siblings from a family in PMID: 39967265 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.193 | FEM1B | Zornitza Stark Phenotypes for gene: FEM1B were changed from Syndromic disease MONDO:0002254, FEM1B-related to Neurodevelopmental disorder with behavioral, ear, and skeletal abnormalities, MIM# 621263 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.192 | FEM1B | Zornitza Stark edited their review of gene: FEM1B: Changed phenotypes: Neurodevelopmental disorder with behavioral, ear, and skeletal abnormalities, MIM# 621263 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.189 | LONP1 | Zornitza Stark Mode of inheritance for gene: LONP1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.188 | LONP1 |
Zornitza Stark edited their review of gene: LONP1: Added comment: New reports of autosomal dominant mitochondrial disease due to missense variants at p.Arg301. - PMID: 36353900; Hartley 2023: 1x heterozygous de novo individual with p.(Arg301Gln), with dystonia, hearing loss, seizures. p.(Arg301Gln) has been reported as de novo in a heterozygous individual with dystonia, delayed speech and language development (VCGS/MCRI internal case) - PMID: 31923470; Besse 2020: 1x heterozygous de novo individual with p.(Arg301Trp) with seizures, encephalopathy, pachygyria and microcephaly. - p.(Arg301Trp) has also been reported in a heterozygous individual with recurrent neonatal seizures, suspected mitochondrial disorder, elevated lactate, microcephaly, EEG showing significantly increased seizure susceptibility which was de novo but parentage not tested (ClinVar, personal communication). - p.(Arg301Trp) has also been identified in a heterozygous individual with neonatal intractable epileptic encephalopathy and lactic acidosis. MRI changes in keeping with mitochondrial disorder, a combined Complex I and complex IV defect identified in muscle (but not liver) by RCE (VCGS/MCRI internal case) - p.(Arg301Gly) has been reported de novo in a heterozygous individual with epileptic encephalopathy, microcephaly and dyskinesia (ClinVar, personal communication) LONP1 functions as both a chaperone and an ATP-dependent protease. Functional evidence in Besse shows p.(Arg301Trp) results in loss of chaperone activity but retains proteolytic activity. Expression of WT LONP1 in patient fibroblast cells did not rescue dysfunction (measured via levels of MRPL44, RPL11, PDHE1a, TFAM, PINK1, complex 1 and complex IV) - indicating NOT LoF effect. Overexpression of LONP1 in control fibroblast cells leads to dysfunction (decrease in NDUFB8, COXIV, MRPL44 and TFAM), however, MRPL11, PDHE1a and PINK1 proteins were unchanged compared to controls. Variant p.R721G associated with AR disease showed decreased homo-oligomerisation whilst p.R301W showed increased WT-Mut and WT-WT oligomers. GoF was suggested but no dose-dependent studies so DN cannot be excluded.; Changed publications: 31636596, 36353900 31923470; Changed phenotypes: CODAS syndrome, MIM#600373, mitochondrial disease (MONDO:0044970), LONP1-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.187 | PIGU | Zornitza Stark reviewed gene: PIGU: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 21, OMIM #618590; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.185 | LGI1 |
Krithika Murali gene: LGI1 was added gene: LGI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LGI1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LGI1 were set to PMID:40455867 Phenotypes for gene: LGI1 were set to Developmental and epileptic encephalopathy MONDO:0100062, LGI1-related Review for gene: LGI1 was set to GREEN Added comment: PMID: 40455867 report patients with biallelic variants in 6 individuals from 4 consanguineous families with a more severe DEE phenotype. All indivduals had seizures, global dev delay/ID and generalised hypotonia. Four out of five exhibited spasticity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.183 | WDR91 |
Bryony Thompson gene: WDR91 was added gene: WDR91 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR91 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR91 were set to 32732226; 38041506; 34791078; 40550703; 28860274; 34028500; ClinVar: SCV000965687.1 Phenotypes for gene: WDR91 were set to Complex neurodevelopmental disorder MONDO:0100038 Review for gene: WDR91 was set to GREEN Added comment: Homozygous LoF variants were identified in at least 5 families with a mainly neurodevelopmental disorder phenotype. Also, supporting mouse models 1. Brain malformation 2. Severe developmental delay, microcephaly, severe microlissencephaly, agenesis of corpus callosum, epilepsy, spastic tetraparesis, laryngomalacia, bicuspid aortic valve, congenital hip dislocation, growth retardation, dysmorphisms 3. Severe microcephaly, dysmorphic features, and organomegaly, along with early onset psychomotor delay, hypotonia, sensorineural hearing impairment, and visual impairment 4. Hygroma, macrocephaly, abnormal ears, unilateral simian crease, hydrocephaly, cerebellar hypoplasia, interventricular communication 5. Neurodevelopmental disorder with brain malformations and multiple congenital anomalies Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.178 | NSUN3 |
Zornitza Stark gene: NSUN3 was added gene: NSUN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NSUN3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NSUN3 were set to 27356879; 32488845; 40465263 Phenotypes for gene: NSUN3 were set to Combined oxidative phosphorylation deficiency 48, MIM# 619012 Review for gene: NSUN3 was set to GREEN Added comment: Six families reported. DD/ID can be part of the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.177 | SREK1 |
Sangavi Sivagnanasundram gene: SREK1 was added gene: SREK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SREK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SREK1 were set to 40549565 Phenotypes for gene: SREK1 were set to Prader-Willi-like syndrome, SREK1-related MONDO:0008300 Review for gene: SREK1 was set to AMBER Added comment: Three Pakistani probands from three consanguineous families identified with biallelic variants in SREK1. Affected individuals presented with hyperphagic obesity and neurodevelopmental delay. They also presented with psychological and behavioural issues and were phenotypically similar to Prader-Willi affected individuals. ID/DD is a feature in the affected individuals. Further testing was conducted using human induced pluripotent stem cell (iPSC) -derived neurons followed by RNA sequencing conducted on the neurons. The results of the assay was suggestive that variants located in the RNA recognition domain (residues 19–96 and 173–256) of SREK1 downregulation of SNORD115 and SNORD116 leading to Prader-Willi-like phenotype however proper validation and controls weren't used. No relevant mouse models were identified on IMPC (international mouse phenotype consortium) to further support gene-disease association there gene reviewed as Amber. Variants identified in SREK1 - AF's from gnomADv4.1 P95L - absent in gnomAD v4.1 T194M - EAS PopMax AF - 0.03787% (47 hets) E601K - SAS PopMax AF - 0.01319% (12 hets) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.176 | ADAM23 |
Sarah Milton gene: ADAM23 was added gene: ADAM23 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADAM23 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADAM23 were set to PMID: 40455867 Phenotypes for gene: ADAM23 were set to Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related Review for gene: ADAM23 was set to AMBER Added comment: ADAM23 encodes a transmembrane protein receptor which is a receptor for LGI1. LGI1/ADAM22/ADAM23 form a complex that regulates excitatory synaptic transmission and neuronal excitability in the brain. 1 affected individual described in PMID: 40455867 with severe neonatal seizures, joint contractures, absent reflexes. Noted to have a homozygous NMD predicted variant in ADAM23. Also had a de novo missense variant in PRKD1. Knockout ADAM23 mice show early lethal epilepsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.176 | ADD1 | Ava Stevenson reviewed gene: ADD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 34906466; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.176 | SMARCC1 |
Gemma Edwards gene: SMARCC1 was added gene: SMARCC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMARCC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMARCC1 were set to 29983323; 37285932 Phenotypes for gene: SMARCC1 were set to SMARCC1-associated developmental dysgenesis syndrome (MONDO:0700123) Review for gene: SMARCC1 was set to GREEN Added comment: Phenotype expansion since original literature. ClinGen - "SMARCC1-associated developmental dysgenesis syndrome is characterized by developmental delay, cerebral ventriculomegaly, aqueductal stenosis, and other associated structural brain and cardiac defects". See cases in PMIDs 29983323, 37285932. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.175 | IKZF2 |
Zornitza Stark gene: IKZF2 was added gene: IKZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IKZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: IKZF2 were set to 37316189 Phenotypes for gene: IKZF2 were set to Immunodysregulation, craniofacial anomalies, hearing impairment, athelia, and developmental delay, MIM# 621234 Review for gene: IKZF2 was set to AMBER Added comment: PMID 37316189: two individuals with de novo variants and syndromic immunodysregulation, including craniofacial anomalies, hearing impairment, athelia, and developmental delay. Note that variants in this gene are also associated with non-syndromic immune dysregulation and non-syndromic HL. Genotype-phenotype correlation unclear. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.173 | ANKS1B |
Lilian Rudd gene: ANKS1B was added gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: ANKS1B. Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKS1B were set to PMID: 31388001; 38129387 Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related Review for gene: ANKS1B was set to GREEN Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model. Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.171 | KCNA6 |
Zornitza Stark gene: KCNA6 was added gene: KCNA6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNA6 were set to 36318112; 40472070 Phenotypes for gene: KCNA6 were set to Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related Review for gene: KCNA6 was set to GREEN Added comment: PMID 36318112: four individuals with de novo variants in this gene and NDD/epilepsy phenotype. Supportive functional data. Additional individual in PMID 40472070 with de novo variant and epilepsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.169 | PIP5K1C | Zornitza Stark reviewed gene: PIP5K1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 37451268; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.168 | ZBTB7B |
Zornitza Stark gene: ZBTB7B was added gene: ZBTB7B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZBTB7B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZBTB7B were set to 40392549 Phenotypes for gene: ZBTB7B were set to Inborn error of immunity, MONDO:0003778, ZBTB7B-related Review for gene: ZBTB7B was set to AMBER Added comment: Single patient presented with a complex syndromic phenotype including CID, severe atopy, severe fibroinflammatory interstitial lung disease, corneal vascularization and scarring, sensorineural hearing loss, global developmental delay, and growth failure. K360N variant is not found in unaffected individuals; functional investigations indicate that K360N exhibits damaging multimorphic effects; and the causal relationship between K360N and the clinical phenotype was confirmed through gene transfer experiments in both T cells and pulmonary fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.167 | TOP2B | Zornitza Stark Phenotypes for gene: TOP2B were changed from Intellectual disability to Intellectual disability (MONDO:0001071), TOP2B-related; B-cell immunodeficiency, distal limb anomalies, and urogenital malformations MIM#609296 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.164 | PTPN1 |
Zornitza Stark gene: PTPN1 was added gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN1 were set to 39986310 Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related Review for gene: PTPN1 was set to GREEN Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.162 | WSB2 |
Krithika Murali gene: WSB2 was added gene: WSB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WSB2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WSB2 were set to PMID:40374945 Phenotypes for gene: WSB2 were set to Complex neurodevelopmental disorder, MONDO:0100038, WSB2-related Review for gene: WSB2 was set to GREEN Added comment: PMID: 40374945 describe 5 individuals from 4 unrelated families with biallelic WSB2 variants and a complex neurodevelopmental disorder. Phenotypic features include: - Dev delay (all) - Brain anomalies (4/5 including callosal anomalies and cerebellar hypoplasia) - Dysmorphic feature - IUGR/oligohydramnios (3/5) - Hypotonia (all) - Microcephaly (3/5) - Seizures (3/5) Includes two siblings with biallelic missense variants and shared phenotype. 3 unaffected siblings were heterozygous for the variant or hmz wt. Phenotypic features associated with hmz nonsense/fs variants were more severe than missense. Supportive mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.161 | NKAP | Zornitza Stark Mode of inheritance for gene: NKAP was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.156 | TAF1C | Zornitza Stark reviewed gene: TAF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 40371665; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.155 | TM2D3 |
Zornitza Stark gene: TM2D3 was added gene: TM2D3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TM2D3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TM2D3 were set to 40449487 Phenotypes for gene: TM2D3 were set to Neurodevelopmental disorder, MONDO:0700092, TM2D3-related Review for gene: TM2D3 was set to GREEN Added comment: Four individuals from 4 unrelated families identified with biallelic variants in this gene. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.153 | SLK |
Zornitza Stark gene: SLK was added gene: SLK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLK were set to 40347834 Phenotypes for gene: SLK were set to Neurodevelopmental disorder, MONDO:0700092, SLK-related Review for gene: SLK was set to GREEN Added comment: Three affected individuals from three unrelated families reported. Two of the families were consanguineous and homozygous LoF variants were present in the probands. Third individual had compound het missense variants. Functional data from a Drosophila model and transdifferentiated neurons. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.151 | RREB1 | chirag patel reviewed gene: RREB1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40418122; Phenotypes: Rasopathy, MONDO:0021060, RREB1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.150 | GON4L | Zornitza Stark reviewed gene: GON4L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Li-Takada-Miyake syndrome, MIM# 621212; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.150 | PRR12 | Boris Keren reviewed gene: PRR12: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33824499; Phenotypes: intellectual disability, ocular anomalies, heart defects, growth failure, kidney anomalies; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.148 | TOP2B | Chris Ciotta reviewed gene: TOP2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33459963, 31953910, 28343847; Phenotypes: Intellectual disability (MONDO:0001071), TOP2B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.146 | FAM177A1 | Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500, FAM177a1-related to Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.145 | FAM177A1 | Zornitza Stark reviewed gene: FAM177A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.145 | GTF3C3 | Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.144 | GTF3C3 | Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.144 | PTPMT1 | Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.143 | PTPMT1 | Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.142 | PPP2R5C | Zornitza Stark reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.141 | SMAD6 |
Boris Keren gene: SMAD6 was added gene: SMAD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMAD6 were set to PMID: 32499606 Penetrance for gene: SMAD6 were set to Incomplete Review for gene: SMAD6 was set to GREEN Added comment: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.140 | LSM1 | Zornitza Stark reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: FICUS syndrome, MIM# 621193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.138 | PLXNA2 | Zornitza Stark Phenotypes for gene: PLXNA2 were changed from Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology to Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.134 | AMOTL1 | Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.134 | NAV3 | Zornitza Stark Phenotypes for gene: NAV3 were changed from Neurodevelopmental disorder, MONDO:0700092, NAV3-related to Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.133 | NAV3 | Zornitza Stark edited their review of gene: NAV3: Changed phenotypes: Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | FBXO22 |
Sarah Milton gene: FBXO22 was added gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXO22 were set to PMID: 40215970 Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related Review for gene: FBXO22 was set to GREEN Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases. 14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4). Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies. Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | GAP43 |
Zornitza Stark gene: GAP43 was added gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GAP43 were set to 39738362 Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related Review for gene: GAP43 was set to RED Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities. The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P | Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.125 | BRF2 |
Zornitza Stark gene: BRF2 was added gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRF2 were set to 40229899 Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related Review for gene: BRF2 was set to GREEN Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.121 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | LSM1 |
Sarah Milton changed review comment from: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable.; to: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | LSM1 | Sarah Milton reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: (PMID: 31010896, 36100156, 40204357); Phenotypes: Neurodevelopmental disorder, MONDO:0700092, LSM1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | PCNA |
Sangavi Sivagnanasundram gene: PCNA was added gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCNA were set to 24911150, 33426167, 36990216 Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309 Review for gene: PCNA was set to AMBER Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778 Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown. Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | EIF3K |
Sangavi Sivagnanasundram gene: EIF3K was added gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3K were set to 40219605 Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092 Review for gene: EIF3K was set to RED Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported. Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%). The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype. The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID: 40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.115 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.113 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.111 | FMR1_FXS_CGG |
Bryony Thompson STR: FMR1_FXS_CGG was added STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184 Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624 Review for STR: FMR1_FXS_CGG was set to GREEN STR: FMR1_FXS_CGG was marked as clinically relevant STR: FMR1_FXS_CGG was marked as current diagnostic Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.106 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.104 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.100 | EEF1D | Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.100 | SPOUT1 | Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.99 | SPOUT1 | Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.97 | CDKL2 | Zornitza Stark reviewed gene: CDKL2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 | Zornitza Stark reviewed gene: CDKL1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 |
Sarah Milton gene: CDKL1 was added gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL1 were set to PMID: 40088891 Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related Mode of pathogenicity for gene: CDKL1 was set to Other Review for gene: CDKL1 was set to AMBER Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4). Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL2 |
Sarah Milton gene: CDKL2 was added gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL2 were set to PMID: 40088891 Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related Penetrance for gene: CDKL2 were set to Complete Mode of pathogenicity for gene: CDKL2 was set to Other Review for gene: CDKL2 was set to AMBER Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion. 2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging. Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5) Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.94 | MED16 | Zornitza Stark reviewed gene: MED16: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081376; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, MED16-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.93 | CELF4 |
Zornitza Stark gene: CELF4 was added gene: CELF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CELF4 were set to 40108438 Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related Review for gene: CELF4 was set to GREEN Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.92 | SVBP | Zornitza Stark Phenotypes for gene: SVBP were changed from Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly; OMIM #618569 to Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569; Spastic paraplegia 94, autosomal recessive, MIM# 621150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.90 | SVBP | Zornitza Stark edited their review of gene: SVBP: Added comment: PMID 39412222: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).; Changed publications: 39412222; Changed phenotypes: Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569, Spastic paraplegia 94, autosomal recessive, MIM# 621150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.89 | CRMP1 |
Zornitza Stark gene: CRMP1 was added gene: CRMP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CRMP1 were set to 36511780; 39758889 Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092, CRMP2-related Review for gene: CRMP1 was set to GREEN Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants. PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID. Four individuals with neurodevelopmental disorders and de novo variants in this gene. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.82 | MEG3 |
Zornitza Stark gene: MEG3 was added gene: MEG3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: MEG3 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Publications for gene: MEG3 were set to 33010492; 33746039; 33067531; 38212313 Phenotypes for gene: MEG3 were set to Kagami-Ogata syndrome, MIM# 608149 Review for gene: MEG3 was set to GREEN Added comment: Small deletions of MAG3 reported in multiple patients as one of the mechanisms of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.79 | PPP2R5E |
chirag patel gene: PPP2R5E was added gene: PPP2R5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP2R5E was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2R5E were set to PMID: 39284558 Phenotypes for gene: PPP2R5E were set to Mendelian neurodevelopmental disorder MONDO:0100500 Review for gene: PPP2R5E was set to RED Added comment: One 20yrs old individual with learning issues, motor coordination disorders, hypotonia (myopathy on EMG), and behavioural issues (mood and emotional dysregulation). WES testing identified a de novo heterozygous missense variant (Glu191Lys) in PPP2R5E gene. The variant was not found in the 4 healthy brothers of the individual. The variant is located within a conserved LFDSEDPRER motif common to all PPP2R5 B-subunits. Biochemical assays demonstrated a decreased interaction with the PP2A A and C subunits, leading to disturbances in holoenzyme formation. Protein phosphatase 2A (PP2A) is a family of multifunctional enzymatic complexes crucial for cellular signalling, playing a pivotal role in brain function and development. Mutations in specific genes encoding PP2A complexes have been associated with neurodevelopmental disorders with hypotonia and high risk of seizures (e.g. PP2AR-1A, 2B, 3C, 5C, 5D). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.76 | CDO1 |
Zornitza Stark gene: CDO1 was added gene: CDO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDO1 were set to 39949058 Phenotypes for gene: CDO1 were set to Syndromic disease, MONDO:0002254, CDO1-related Review for gene: CDO1 was set to AMBER Added comment: Three children with overlapping features including severe microcephaly and DD/ID. Three missense de novo variants were identified and were clustered around exon 3 and exon 4. The three missense variants identified p.(His147Arg, Ala131Val, Glu143Lys) are all absent from gnomAD v4.1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.74 | PHACTR4 |
Zornitza Stark gene: PHACTR4 was added gene: PHACTR4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PHACTR4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHACTR4 were set to 40012205 Phenotypes for gene: PHACTR4 were set to Syndromic disease, MONDO:0002254, PHACTR4-related Review for gene: PHACTR4 was set to AMBER Added comment: Two individuals with syndromic disease and de novo missense variants reported together with aggregate information on additional individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.72 | C14orf80 |
Zornitza Stark gene: C14orf80 was added gene: C14orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: C14orf80. Mode of inheritance for gene: C14orf80 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C14orf80 were set to 39979680; 38252227 Phenotypes for gene: C14orf80 were set to Primary microcephaly, MONDO:0016660 Review for gene: C14orf80 was set to AMBER Added comment: New HGNC approved Gene Name: TEDC1 Only two families reported with biallelic variants in this gene - Reports of a supportive functional assay however rated as Amber given that one of the reported families are consanguineous with hmz missense. PMID: 39979680 - Male sibs from non-consanguineous parents presenting with a range of phenotypes including growth development abnormalities, microcephaly, DD, ID and endocrine insufficiency. The brothers were found to carry chet variants identified in trans [NM_001134877.1 c.[104-5C>G];[787delG] p.[?];[(Ala263LeufsTer29)]. Homozygous zebrafish model recapitulated the human phenotype and is supportive of the loss of function mechanism of disease. PMID: 38252227 - Iranian consanguineous families identified with a rare biallelic missense variant (Gln269Arg). The affected brothers presented with a range of developmental phenotypes including cognitive impairment and microcephaly. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.70 | SPOUT1 |
Bryony Thompson gene: SPOUT1 was added gene: SPOUT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPOUT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPOUT1 were set to 39962046 Phenotypes for gene: SPOUT1 were set to complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related Review for gene: SPOUT1 was set to GREEN Added comment: Biallelic SPOUT1 variants were identified in 28 individuals with a complex neurodevelopmental disorder from 21 unrelated families. Common phenotypes include microcephaly (18/21), seizures (20/28), intellectual disability (14/14), and varying degrees of developmental delays (28/28). Also, supporting zebrafish model. The suggested name of the disorder is SpADMiSS (SPOUT1 Associated Development delay Microcephaly Seizures Short stature). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.68 | SIN3B | Zornitza Stark reviewed gene: SIN3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SIN3B-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.68 | DDX39B |
Sangavi Sivagnanasundram gene: DDX39B was added gene: DDX39B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DDX39B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DDX39B were set to 39918047 Phenotypes for gene: DDX39B were set to neurodevelopmental disorder MONDO:0700092, DDX39B-related Review for gene: DDX39B was set to GREEN Added comment: Established gene-disease association - ID/DD is a prominent feature in affected individuals. 6 individuals from 5 families with variable neurological and developmental phenotypes including hypotonia, DD, ID and epilepsy. 4 de novo missense variants and 1 inherited splice variant were identified. All variants are absent from gnomAD v4.1. In vivo functional assay using Drosophila transgenic flies was supportive of a loss of function phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.67 | SMARCA1 |
Zornitza Stark gene: SMARCA1 was added gene: SMARCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMARCA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SMARCA1 were set to 37841849 Phenotypes for gene: SMARCA1 were set to Neurodevelopmental disorder, MONDO:0700092, SMARCA1-related Review for gene: SMARCA1 was set to GREEN Added comment: 40 individuals from 30 families with NDD and variants in this gene reported in this preprint, publication imminent Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.66 | C12orf66 | Zornitza Stark Phenotypes for gene: C12orf66 were changed from complex neurodevelopmental disorder MONDO:0100038 to Intellectual developmental disorder, autosomal recessive 83, MIM# 621100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.64 | C12orf66 | Zornitza Stark edited their review of gene: C12orf66: Changed rating: GREEN; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 83, MIM# 621100; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.64 | EEFSEC | Zornitza Stark Phenotypes for gene: EEFSEC were changed from Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related to Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.63 | EEFSEC | Zornitza Stark edited their review of gene: EEFSEC: Changed phenotypes: Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.62 | ARHGEF40 | Zornitza Stark reviewed gene: ARHGEF40: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.62 | C12orf66 | chirag patel reviewed gene: C12orf66: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39824192; Phenotypes: Neurodevelopmental disorder MONDO:0700092; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.62 | ARHGEF40 |
chirag patel gene: ARHGEF40 was added gene: ARHGEF40 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARHGEF40 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARHGEF40 were set to PMID: 39838643 Phenotypes for gene: ARHGEF40 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: ARHGEF40 was set to RED Added comment: 2 individuals with global developmental delay, hypotonia, short stature, hearing impairment, nystagmus, feeding issues, and dysmorphism (bifid uvula, narrow mouth, high palate, micrognathia). Trio clinical whole exome sequencing identified de novo variants in the ARHGEF40 gene at position p.Arg225, which is fully conserved in mammals and located within the n-terminal keratin binding region (p.Arg225Trp and p.Arg225Gln). Of note, multiple additional probands with rare missense variants at the p.Arg225 residue have been identified by the same laboratory (but there was no consent for publication, providing further evidence of the importance of this residue. The ARHGEF40 gene (aka SOLO) is a member of the Rho guanine nucleotide exchange factor (Rho-GEF) family of proteins, which stimulate Rho signal transduction molecules by converting them from inactive GDP-bound form to the active GTP-bound state. No functional studies to characterise disease-gene relationship or disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.59 | HECTD1 |
chirag patel gene: HECTD1 was added gene: HECTD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HECTD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HECTD1 were set to PMID: 39879987 Phenotypes for gene: HECTD1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: HECTD1 was set to GREEN Added comment: 14 unrelated individuals (identified through GeneMatcher) with 15 variants of uncertain significance (VUS) in HECTD1 (10 missense, 3 frameshift, 1 nonsense, and 1 splicing variant). Of the 15 different variants in HECTD1, 10 occurred de novo, 3 had unknown inheritance, and 2 were compound heterozygous. All variants were absent in gnomAD, and HECTD1 is highly intolerant to loss-of-function variation (loss-of-function-intolerant score of 1). Clinical presentation was variable developmental delay, intellectual disability, autism spectrum disorder, ADHD, and epilepsy. The one individual with compound heterozygous variants had growth impairment along with NDD. The variants were inherited from apparently healthy parents, suggesting that genetic or environmental modifiers may be required to develop the phenotype. Significant enrichment of de novo variants in HECTD1 was also shown in an independent cohort of 53,305 published trios with NDDs or congenital heart disease. HECT-domain-containing protein 1 (HECTD1) mediates developmental pathways, including cell signalling, gene expression, and embryogenesis. Conditional knockout of Hectd1 in the neural lineage in mice resulted in microcephaly, severe hippocampal malformations, and complete agenesis of the corpus callosum, supporting a role for Hectd1 in embryonic brain development. Functional studies of 2 missense variants and 1 nonsense variant in C. elegans revealed dominant effects, including either change-of-function or loss-of-function/haploinsufficient mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.57 | PTPMT1 |
Bryony Thompson gene: PTPMT1 was added gene: PTPMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPMT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTPMT1 were set to 39279645; 37672386 Phenotypes for gene: PTPMT1 were set to inborn mitochondrial metabolism disorder MONDO:0004069 Review for gene: PTPMT1 was set to GREEN Added comment: 6 cases from 3 independent families with biallelic variants in PTPMT1 (a mitochondrial tyrosine phosphatase required for de novo cardiolipin biosynthesis). All cases presented with a complex, neonatal/infantile onset neurological and neurodevelopmental syndrome including developmental delay, microcephaly, facial dysmorphism, epilepsy, spasticity, cerebellar ataxia and nystagmus, sensorineural hearing loss, optic atrophy and bulbar dysfunction. Supporting knockout zebrafish and mouse models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.55 | ITGAV |
Zornitza Stark gene: ITGAV was added gene: ITGAV was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ITGAV was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ITGAV were set to 39526957 Phenotypes for gene: ITGAV were set to Syndromic disease, MONDO:0002254, ITGAV-related Review for gene: ITGAV was set to AMBER Added comment: Three unrelated families reported: two with affected children (one hmz missense; other compound het LoF with missense) and one family with four affected fetuses. Clinical features included brain and eye anomalies and IBD/immune dysregulation. TGF-beta signalling pathway affected. The deletion of itgav in zebrafish recapitulated patient phenotypes including retinal and brain defects and the loss of microglia in early development as well as colitis in juvenile zebrafish with reduced SMAD3 expression and transcriptional regulation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.52 | RYBP |
Zornitza Stark gene: RYBP was added gene: RYBP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RYBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RYBP were set to 39891528 Phenotypes for gene: RYBP were set to Neurodevelopmental disorder, MONDO:0700092, RYBP-related Review for gene: RYBP was set to GREEN Added comment: Seven individuals with heterozygous de novo variants in RYBP reported. Clinical findings include severe developmental delay, dysmorphisms and multiple congenital anomalies. All the single nucleotide variants in RYBP localized to the N-terminal domain of the gene, which encodes the zinc finger domain and ubiquitin binding moiety. Further supportive in vitro and Drosophila functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.50 | SEL1L | Zornitza Stark reviewed gene: SEL1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068, Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.47 | TRPM7 |
Zornitza Stark gene: TRPM7 was added gene: TRPM7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRPM7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRPM7 were set to 35561741; 35712613; 39099563 Phenotypes for gene: TRPM7 were set to Familial primary hypomagnesemia, MONDO:0018100, TRPM7-related Review for gene: TRPM7 was set to GREEN Added comment: Protein expressed in the distal tubule, related to TRPM6. Postulated link with hypoMg with secondary hypoCa. PMID 35561741: two families reported with dominant inheritance. F1: three affected individuals with splicing variant; some supportive functional data. F2: single affected individual, de novo missense variant. PMID 35712613: de novo missense variant in an individual with hypoMg. PMID 39099563: three affected individuals with missense variants, all de novo. Probands had DD, two had seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.45 | TAOK2 |
Zornitza Stark gene: TAOK2 was added gene: TAOK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TAOK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TAOK2 were set to 39737487 Phenotypes for gene: TAOK2 were set to neurodevelopmental disorder, MONDO:0700092, TAOK2-related Review for gene: TAOK2 was set to GREEN Added comment: PMID:39737487 reported 10 individuals with monoallelic TAOK2 variants and with a neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.44 | GTF3C3 | chirag patel reviewed gene: GTF3C3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39636576; Phenotypes: Neurodevelopmental disorder MONDO:0700092, GTF3C3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.43 | INPP4A | chirag patel reviewed gene: INPP4A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 39315527; Phenotypes: INPP4A-related neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.42 | LRRC45 |
Zornitza Stark gene: LRRC45 was added gene: LRRC45 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC45 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LRRC45 were set to 39638757 Phenotypes for gene: LRRC45 were set to Neurodevelopmental disorder MONDO:0700092, LRRC45-related Review for gene: LRRC45 was set to AMBER Added comment: Three individuals from two families reported with two homozygous variants, one splice site and the other missense. Features of a neurological ciliopathy with some supportive experimental evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.41 | WASHC3 |
Zornitza Stark gene: WASHC3 was added gene: WASHC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WASHC3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: WASHC3 were set to DOI: https://doi.org/10.1016/j.gimo.2024.101915 Phenotypes for gene: WASHC3 were set to neurodevelopmental disorder MONDO:0700092, WASHC3 related Review for gene: WASHC3 was set to RED Added comment: One family with de novo missense. Two families with homozygous start loss variant. The functional evidence provided does not directly link to the human phenotype. Given two variants and two different MOIs, RED rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.39 | NAV3 |
Zornitza Stark gene: NAV3 was added gene: NAV3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAV3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAV3 were set to 39708122; 38977784 Phenotypes for gene: NAV3 were set to Neurodevelopmental disorder, MONDO:0700092, NAV3-related Review for gene: NAV3 was set to GREEN Added comment: 17 individuals from 11 families reported with bi-allelic variants and neurodevelopmental phenotypes, including DD/ID and behavioural abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.37 | EEFSEC |
Zornitza Stark gene: EEFSEC was added gene: EEFSEC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EEFSEC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EEFSEC were set to 39753114 Phenotypes for gene: EEFSEC were set to Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related Review for gene: EEFSEC was set to GREEN Added comment: Nine individuals from 8 unrelated families reported with bi-allelic variants in this gene and progressive neurodevelopmental disorder manifesting with global developmental delay, progressive spasticity, ataxia, and seizures. Cerebral MRI primarily demonstrated a cerebellar pathology, including hypoplasia and progressive atrophy. In line with the clinical phenotype, an eEFSec-RNAi Drosophila model displays progressive impairment of motor function, which is reflected in the synaptic defects in this model organisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.35 | CCT3 | Zornitza Stark reviewed gene: CCT3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with speech or visual impairment and brain hypomyelination, MIM# 621034; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.34 | TCP1 | Zornitza Stark reviewed gene: TCP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.33 | EP400 |
Sangavi Sivagnanasundram gene: EP400 was added gene: EP400 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EP400 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EP400 were set to 39708813 Phenotypes for gene: EP400 were set to neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930 Review for gene: EP400 was set to GREEN Added comment: 6 unrelated probands presenting with epilepsy with NDD (including ID and DD) had compound heterozygous variants in EP400. They were confirmed in trans and inherited from their asymptomatic parents. Knockdown of EP400 ortholog in Drosophila showed an increase in seizure-like susceptibility and abnormal neurological behaviour. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.33 | LRRC8C |
Sangavi Sivagnanasundram gene: LRRC8C was added gene: LRRC8C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC8C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LRRC8C were set to 39623139 Phenotypes for gene: LRRC8C were set to TIMES syndrome MIM#621056 Mode of pathogenicity for gene: LRRC8C was set to Other Review for gene: LRRC8C was set to AMBER Added comment: TIMES syndrome is a multisystem disorder characterised by considerable phenotypic variability, but overlapping features include telangiectasia, impaired intellectual development, microcephaly, metaphyseal dysplasia, eye abnormalities, and short stature. Patients exhibit striking cutis marmorata in infancy. Two individuals from unrelated families presenting with similar features consistent with TIMES syndrome. Leu400IlefsTer8 and Val390Leu variants were identified however the proposed mechanism of disease is GoF. Supporting in vitro functional assay was conducted however further evidence is required to upgrade the gene classification. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.32 | RICTOR |
Bryony Thompson gene: RICTOR was added gene: RICTOR was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RICTOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RICTOR were set to 39738822 Phenotypes for gene: RICTOR were set to Neurodevelopmental disorder MONDO:0700092, RICTOR-related Review for gene: RICTOR was set to GREEN Added comment: 8 unrelated cases presenting with ID and/or developmental delay with de novo or heterozygous variants inherited from one affected parent, including three missense variants, four loss-of-function variants and one 3 kb deletion encompassing RICTOR. Possible gain of function and loss of function mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.30 | UBR5 |
Bryony Thompson gene: UBR5 was added gene: UBR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBR5 were set to 39721588 Phenotypes for gene: UBR5 were set to Neurodevelopmental disorder MONDO:0700092, UBR5-related Review for gene: UBR5 was set to GREEN Added comment: 29 individuals with a neurodevelopment syndrome (24 de novo variants) with a core phenotype characterised by developmental delay (26/28), autism (16/26), and intellectual disability (56%). Additionally, some individuals presented with epilepsy/seizures (11/27), movement disorders, and/or genital anomalies (35%). Loss of function is the expected mechanism of disease with functional experiments in C. elegans and in vitro ubiquitination assays. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.28 | ZNF711 | Zornitza Stark reviewed gene: ZNF711: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 97, MIM# 300803; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.27 | FRYL | Zornitza Stark reviewed gene: FRYL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pan-Chung-Bellen syndrome, MIM# 621049; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.27 | PIGG | Ain Roesley Phenotypes for gene: PIGG were changed from Mental retardation, autosomal recessive 53, MIM#616917 to Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy MIM#616917 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.23 | RUNX1T1 |
chirag patel gene: RUNX1T1 was added gene: RUNX1T1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RUNX1T1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340 Phenotypes for gene: RUNX1T1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: RUNX1T1 was set to GREEN Added comment: RUNX1T1 encodes a transcription regulator for hematopoietic genes and is well-known for its involvement in hematologic malignancies. Germline RUNX1T1 variants may also play a role in human congenital neurodevelopmental disorders. PMID: 39568205 3 unrelated individuals with developmental delay, learning disability, ASD, ADHD, and dysmorphism (1 x heart defects). Trio WES identified de novo variants in RUNX1T1 gene (1 x nonsense variant in 5' region [p.Gln36Ter], 2 x missense variants in C-terminus [p.Gly412Arg and p.His521Tyr]). PMID: 19172993 1 individual with mild-moderate ID and congenital heart disease, and chromosome t(5;8)(q32;q21.3) translocation. Molecular characterization revealed that one of the break points was within the RUNX1T1 gene. Analysis of RUNX1T1 expression in human embryonic and fetal tissues suggests a role of RUNX1T1 in brain and heart development. PMID: 22644616 1 individual with mild ID and dysmorphism, and de novo deletion exons 3-7 in RUNX1T1. PMID: 31223340 1 individual with ID, anaemia, atrial septal defect, dysmorphism, and seizures. Found to have a 2.1 Mb deletion at 8q21.3q22.1 involving entire RUNX1T1 gene (and 2 adjacent genes - SLC26A7 and TRIQK), and a benign familial 4.3 Mb duplication at 1p22.1p21.3 (present in unaffected healthy brother). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.19 | CAPZA2 | Chris Ciotta reviewed gene: CAPZA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32338762, 38374166, 35856264; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CAPZA2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.18 | CCT6A |
Ain Roesley gene: CCT6A was added gene: CCT6A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCT6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CCT6A were set to 39480921 Phenotypes for gene: CCT6A were set to neurodevelopmental disorder MONDO:0700092, CCT6A-related Penetrance for gene: CCT6A were set to Complete Review for gene: CCT6A was set to GREEN gene: CCT6A was marked as current diagnostic Added comment: previously known as CCT6 5x individuals including 4x de novo 3x PTCS + 1x +5C>G + 1x missense 4/5 DD/ID 2/5 visual impairment 2/5 seizures Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.16 | TCP1 |
Ain Roesley gene: TCP1 was added gene: TCP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TCP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TCP1 were set to 39480921 Phenotypes for gene: TCP1 were set to neurodevelopmental disorder MONDO:0700092, TCP1-related Penetrance for gene: TCP1 were set to Complete Review for gene: TCP1 was set to GREEN gene: TCP1 was marked as current diagnostic Added comment: previously known as CCT1 8x individuals including 5x de novo 6x PTCs + 2x missense 6/8 DD/ID 2/8 visual impairment 6/8 seizures 6/8 polymicrogyria + 1x Ventriculomegaly, white matter hyperintensities Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.14 | CCT3 |
Ain Roesley gene: CCT3 was added gene: CCT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CCT3 were set to 39480921 Phenotypes for gene: CCT3 were set to neurodevelopmental disorder MONDO:0700092, CCT3-related Penetrance for gene: CCT3 were set to Complete Review for gene: CCT3 was set to GREEN gene: CCT3 was marked as current diagnostic Added comment: 4x de novo - 3x PTCs and 1x missense overlapping phenotypes: 4/4 ID/DD 3/4 visual impairment 2/4 seizures 4/4 Hypomyelination of white matter Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.13 | CLASP1 |
Ain Roesley gene: CLASP1 was added gene: CLASP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLASP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CLASP1 were set to 39040917 Phenotypes for gene: CLASP1 were set to neurodevelopmental disorder MONDO:0700092, CLASP1-related Review for gene: CLASP1 was set to RED gene: CLASP1 was marked as current diagnostic Added comment: 3 siblings from a consanguineous family, homozygous for p.(Arg1481His) at birth, all had low weight and microcephaly (< 3-4SD), profound dev delay, spasticity, seizures and lissencephaly Arg1481His - 3 hets 0 Homs in v4 codon is highly conserved with a high REVEL score 0.83 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.11 | GPATCH11 | Zornitza Stark reviewed gene: GPATCH11: Rating: GREEN; Mode of pathogenicity: None; Publications: 39572588; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.10 | MGA |
Zornitza Stark gene: MGA was added gene: MGA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MGA were set to 39600096; 20044811 Phenotypes for gene: MGA were set to Syndromic disease, MONDO:0002254, MGA-related Review for gene: MGA was set to GREEN Added comment: Three individuals with de novo LoF variants reported in individuals with ID and congenital anomalies. Zebrafish model supports role of this transcription factor in organogenesis. Note there are previous, less clear reports of association with NDD/CHD. Gene is constrained for LoF variants in gnomad v4; however, note there are ~30 individuals with LoF variants present. Borderline Green/Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.7 | PPP2R2B |
Bryony Thompson gene: PPP2R2B was added gene: PPP2R2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP2R2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2R2B were set to 25356899; 39565297 Phenotypes for gene: PPP2R2B were set to Neurodevelopmental disorder MONDO:0700092, PPP2R2B-related Review for gene: PPP2R2B was set to AMBER Added comment: 5 cases with NDD and heterozygous missense (4/5 confirmed de novo): p.Thr246Lys (unknown inheritance), p.Asn310Lys (confirmed de novo), p.Glu37Lys (confirmed de novo, also had RNU4-2 path de novo Path variant), p.Ile427Thr (confirmed de novo, also had TAOK1 inherited Path variant), p.Arg149Pro (confirmed de novo). 5/5 with intellectual disability and developmental delay, 4/5 with seizures, 2/5 with hearing loss/auditory neuropathy. Study includes in vitro functional assays supporting a possible loss of function mechanism of disease. The 2 missense with additional diagnoses (E37K & I427T) demonstrated a partial reduction in PP2A holoenzyme assembly. Only 3 cases with a possible diagnosis that could be attributed to the PPP2R2B only, and only 2 were confirmed de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.5 | WDR47 |
Bryony Thompson gene: WDR47 was added gene: WDR47 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR47 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR47 were set to 39609633 Phenotypes for gene: WDR47 were set to Complex neurodevelopmental disorder MONDO:0100038, WDR47-related Review for gene: WDR47 was set to GREEN Added comment: 7 cases from 5 unrelated families with biallelic variants and a complex neurodevelopmental syndrome. The most frequent phenotypes were corpus callosum dysgenesis (7/7), microcephaly (7/7), mild to severe intellectual disability (7/7), epilepsy (7/7). Additionally, mouse models recapitulate the human phenotype. Loss of function is the mechanism of disease. Heterozygous parents had no phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.3 | PPP5C |
Lucy Spencer gene: PPP5C was added gene: PPP5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP5C were set to 35361529; 25363768; 33057194 Phenotypes for gene: PPP5C were set to Neurodevelopmental disorder, MONDO:0700092, PPP5C-related Review for gene: PPP5C was set to AMBER Added comment: PMID: 35361529 - reported a de novo missense in a proband with microcephaly, developmental delay and epilepsy. However, after personal communication with the undiagnosed disease network this proband has since been found to have a different diagnosis with a nonsense and a missense in VARS1 identified, so unclear if the PPP5C variant is contributing to their phenotype. 3 more probands with de novo missense variants have been published in large autism or developmental disorder cohort with limited information (PMIDs: 25363768, 33057194) An internal VCGS proband with intellectual disability and failure to thrive was also found to have a de novo missense variant in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.2 | WDR83OS | Zornitza Stark reviewed gene: WDR83OS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.1 | LINC01578 | Zornitza Stark Phenotypes for gene: LINC01578 were changed from Neurodevelopmental disorder, MONDO:0700092, CHASERR-related to Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.0 | LINC01578 | Zornitza Stark edited their review of gene: LINC01578: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6909 | FMR1 | Zornitza Stark Mode of inheritance for gene: FMR1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6906 | HADHA | Zornitza Stark Mode of inheritance for gene: HADHA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6902 | PCNT | Zornitza Stark Mode of inheritance for gene: PCNT was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6901 | PCNT | Zornitza Stark Mode of inheritance for gene: PCNT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6897 | PC | Zornitza Stark Mode of inheritance for gene: PC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6894 | PAX8 | Zornitza Stark Mode of inheritance for gene: PAX8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6890 | PAX6 | Zornitza Stark Mode of inheritance for gene: PAX6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6889 | PARN | Zornitza Stark Phenotypes for gene: PARN were changed from to Dyskeratosis congenita, autosomal recessive 6, MIM# 616353 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6887 | PARN | Zornitza Stark Mode of inheritance for gene: PARN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6884 | OTX2 | Zornitza Stark Mode of inheritance for gene: OTX2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6880 | OPA3 | Zornitza Stark Mode of inheritance for gene: OPA3 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6879 | OPA3 | Zornitza Stark Mode of inheritance for gene: OPA3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6876 | OCLN | Zornitza Stark Mode of inheritance for gene: OCLN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6871 | NRAS | Zornitza Stark Mode of inheritance for gene: NRAS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6867 | NPHP1 | Zornitza Stark Mode of inheritance for gene: NPHP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6863 | NF1 | Zornitza Stark Mode of inheritance for gene: NF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6858 | NDUFS8 | Zornitza Stark Mode of inheritance for gene: NDUFS8 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6857 | NDUFS8 | Zornitza Stark Mode of inheritance for gene: NDUFS8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6854 | NDUFS4 | Zornitza Stark Mode of inheritance for gene: NDUFS4 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6853 | NDUFS4 | Zornitza Stark Mode of inheritance for gene: NDUFS4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6851 | MYCN | Zornitza Stark reviewed gene: MYCN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Feingold syndrome 1 MIM#164280; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6850 | MYCN | Zornitza Stark Mode of inheritance for gene: MYCN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6846 | LARS2 | Zornitza Stark Mode of inheritance for gene: LARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6845 | LARGE1 | Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6843 | LARGE1 | Zornitza Stark Mode of inheritance for gene: LARGE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6839 | LAMP2 | Zornitza Stark Mode of inheritance for gene: LAMP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6835 | KRAS | Zornitza Stark Mode of inheritance for gene: KRAS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6832 | KMT2E | Zornitza Stark Mode of inheritance for gene: KMT2E was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6831 | KAT6B | Zornitza Stark Phenotypes for gene: KAT6B were changed from KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 to KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6830 | KAT6B | Zornitza Stark Phenotypes for gene: KAT6B were changed from to KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6828 | KAT6B | Zornitza Stark Mode of inheritance for gene: KAT6B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6825 | KAT6A | Zornitza Stark Mode of inheritance for gene: KAT6A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6822 | INPP5K | Zornitza Stark Mode of inheritance for gene: INPP5K was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6819 | IKBKG | Zornitza Stark Mode of inheritance for gene: IKBKG was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6815 | IFT172 | Zornitza Stark Mode of inheritance for gene: IFT172 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6812 | IFIH1 | Zornitza Stark Mode of inheritance for gene: IFIH1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6808 | IDUA | Zornitza Stark Mode of inheritance for gene: IDUA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6805 | IDS | Zornitza Stark Mode of inheritance for gene: IDS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6802 | IDH2 | Zornitza Stark Mode of inheritance for gene: IDH2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6799 | HTRA2 | Zornitza Stark Mode of inheritance for gene: HTRA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6794 | HSPD1 | Zornitza Stark Mode of inheritance for gene: HSPD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6793 | HSPD1 | Zornitza Stark reviewed gene: HSPD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571143, 27405012, 32532876, 28377887, 27405012, 11898127, 17420924; Phenotypes: Leukodystrophy, hypomyelinating, 4, MIM# 612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6790 | HSD17B10 | Zornitza Stark Mode of inheritance for gene: HSD17B10 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6787 | HPRT1 | Zornitza Stark Mode of inheritance for gene: HPRT1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6784 | HPD | Zornitza Stark Mode of inheritance for gene: HPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6783 | HPD | Zornitza Stark reviewed gene: HPD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: tyrosinemia type III MONDO:0010162; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6783 | HOXA1 | Zornitza Stark Mode of inheritance for gene: HOXA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6778 | HNRNPK | Zornitza Stark Mode of inheritance for gene: HNRNPK was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6775 | HMGCL | Zornitza Stark Mode of inheritance for gene: HMGCL was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6772 | HLCS | Zornitza Stark Mode of inheritance for gene: HLCS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6771 | HLCS | Zornitza Stark Mode of inheritance for gene: HLCS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6767 | HIBCH | Zornitza Stark Mode of inheritance for gene: HIBCH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6763 | HEXB | Zornitza Stark Mode of inheritance for gene: HEXB was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6762 | HEXB | Zornitza Stark Mode of inheritance for gene: HEXB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6759 | HEXA | Zornitza Stark Mode of inheritance for gene: HEXA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6756 | HESX1 | Zornitza Stark Mode of inheritance for gene: HESX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6755 | HESX1 | Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6753 | HEPACAM | Zornitza Stark Mode of inheritance for gene: HEPACAM was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6752 | HCCS | Zornitza Stark Phenotypes for gene: HCCS were changed from to linear skin defects with multiple congenital anomalies 1 (MONDO:0024552) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6750 | HCCS | Zornitza Stark Mode of inheritance for gene: HCCS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6749 | HCCS | Zornitza Stark reviewed gene: HCCS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6747 | GTF2H5 | Zornitza Stark Mode of inheritance for gene: GTF2H5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6746 | GTF2H5 | Zornitza Stark reviewed gene: GTF2H5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Trichothiodystrophy 3, photosensitive MIM#616395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6746 | GRM1 | Zornitza Stark Phenotypes for gene: GRM1 were changed from to autosomal recessive spinocerebellar ataxia 13 MONDO:0013905 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6744 | GRM1 | Zornitza Stark Mode of inheritance for gene: GRM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6743 | GRM1 | Zornitza Stark reviewed gene: GRM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: autosomal recessive spinocerebellar ataxia 13 MONDO:0013905; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6741 | GPC3 | Zornitza Stark Mode of inheritance for gene: GPC3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6738 | GNS | Zornitza Stark Mode of inheritance for gene: GNS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6735 | GNPTAB | Zornitza Stark Mode of inheritance for gene: GNPTAB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6732 | GNPAT | Zornitza Stark Mode of inheritance for gene: GNPAT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6729 | GMPPB | Zornitza Stark Mode of inheritance for gene: GMPPB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6726 | GMPPA | Zornitza Stark Mode of inheritance for gene: GMPPA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6723 | GM2A | Zornitza Stark Mode of inheritance for gene: GM2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6721 | PSPH | Ain Roesley Mode of inheritance for gene: PSPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6720 | PSPH | Ain Roesley reviewed gene: PSPH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37347880; Phenotypes: Phosphoserine phosphatase deficiency MIM#614023; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6719 | PRPS1 | Ain Roesley Mode of inheritance for gene: PRPS1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6718 | PRPS1 | Ain Roesley reviewed gene: PRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24961627; Phenotypes: PRPS1 deficiency disorder MONDO:0100061; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6718 | PRODH | Ain Roesley Mode of inheritance for gene: PRODH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6718 | PRODH | Ain Roesley Mode of inheritance for gene: PRODH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6717 | PRODH | Ain Roesley Mode of inheritance for gene: PRODH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6716 | PRODH | Ain Roesley reviewed gene: PRODH: Rating: GREEN; Mode of pathogenicity: None; Publications: 17412540, 12217952; Phenotypes: Hyperprolinemia, type I MIM#239500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6716 | PPT1 | Ain Roesley Mode of inheritance for gene: PPT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6715 | PPT1 | Ain Roesley Mode of inheritance for gene: PPT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6714 | PPT1 | Ain Roesley reviewed gene: PPT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7637805, 9425237, 9664077; Phenotypes: Ceroid lipofuscinosis, neuronal, 1 MIM#256730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6711 | FTSJ1 | Zornitza Stark Mode of inheritance for gene: FTSJ1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6710 | PPP3CA | Ain Roesley Mode of inheritance for gene: PPP3CA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6709 | PPP3CA | Ain Roesley reviewed gene: PPP3CA: Rating: GREEN; Mode of pathogenicity: None; Publications: 29432562, 32593294; Phenotypes: Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development MIM#618265, Developmental and epileptic encephalopathy 91 MIM617711; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6708 | POMT2 | Ain Roesley Mode of inheritance for gene: POMT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6707 | POMT2 | Ain Roesley reviewed gene: POMT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMT2 MONDO:0700071; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6707 | POMT1 | Ain Roesley Mode of inheritance for gene: POMT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6706 | POMT1 | Ain Roesley reviewed gene: POMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMT1 MONDO:0700070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6706 | POMGNT2 | Ain Roesley Mode of inheritance for gene: POMGNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6705 | POMGNT2 | Ain Roesley reviewed gene: POMGNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMGNT2 MONDO:0700069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6705 | POMGNT1 | Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6704 | POMGNT1 | Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6704 | POMGNT1 | Ain Roesley Mode of inheritance for gene: POMGNT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6703 | POMGNT1 |
Ain Roesley changed review comment from: DD/ID is a feature the following has been lumped by clingen as one entity Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 MIM#253280 Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 3 MIM#613151 Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157; to: DD/ID is a feature the following has been lumped by clingen as one entity Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 MIM#253280 Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 3 MIM#613151 Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157 https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_03bb8479-2ed3-4b15-9e54-378ea0729ab2-2024-08-14T190000.000Z?page=1&size=25&search= |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6703 | POMGNT1 | Ain Roesley reviewed gene: POMGNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: myopathy caused by variation in POMGNT1 MONDO:0700068; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6703 | POLR3B | Ain Roesley Mode of inheritance for gene: POLR3B was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6702 | POLR3B | Ain Roesley Mode of inheritance for gene: POLR3B was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6701 | POLR3B | Ain Roesley reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33417887; Phenotypes: POLR3B-related disorder MONDO:0700277, Charcot-Marie-Tooth disease, demyelinating, type 1I MIM#619742, Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism MIM#614381; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6700 | POLR3A | Ain Roesley Mode of inheritance for gene: POLR3A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6699 | POLR3A | Ain Roesley reviewed gene: POLR3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: POLR3A-related disorder MONDO:0700276; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6699 | POLG | Ain Roesley Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 to Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6698 | POLG | Ain Roesley Phenotypes for gene: POLG were changed from to Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662; Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459; Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450; Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6698 | POLG | Ain Roesley Mode of inheritance for gene: POLG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6697 | POLG | Ain Roesley reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301791; Phenotypes: Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700, Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662, Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459, Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450, Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6697 | PNPLA6 | Ain Roesley Phenotypes for gene: PNPLA6 were changed from retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6697 | PNPLA6 | Ain Roesley Phenotypes for gene: PNPLA6 were changed from retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Mode of inheritance for gene: PNPLA6 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Phenotypes for gene: PNPLA6 were changed from to retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6696 | PNPLA6 | Ain Roesley Mode of inheritance for gene: PNPLA6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6695 | PNPLA6 | Ain Roesley reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25299038; Phenotypes: retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6695 | PMM2 | Ain Roesley Mode of inheritance for gene: PMM2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6694 | PMM2 | Ain Roesley Mode of inheritance for gene: PMM2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6692 | PMM2 | Ain Roesley reviewed gene: PMM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301289; Phenotypes: Congenital disorder of glycosylation, type Ia MIM#212065; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6692 | PLA2G6 | Ain Roesley Mode of inheritance for gene: PLA2G6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6691 | PLA2G6 | Ain Roesley reviewed gene: PLA2G6: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301718; Phenotypes: nfantile neuroaxonal dystrophy 1 MIM#256600, Neurodegeneration with brain iron accumulation 2B MIM#610217; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6690 | PIK3CA | Ain Roesley Mode of inheritance for gene: PIK3CA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6689 | PIK3CA | Ain Roesley reviewed gene: PIK3CA: Rating: GREEN; Mode of pathogenicity: None; Publications: 23946963; Phenotypes: PIK3CA-related overgrowth spectrum MONDO:1040002; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6688 | PHGDH | Ain Roesley Mode of inheritance for gene: PHGDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6687 | PHGDH | Ain Roesley reviewed gene: PHGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37347880; Phenotypes: Neu-Laxova syndrome 1 MIM#256520, Phosphoglycerate dehydrogenase deficiency MIM#601815; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6686 | PEX7 | Ain Roesley Mode of inheritance for gene: PEX7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6685 | PEX7 | Ain Roesley reviewed gene: PEX7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301447; Phenotypes: Peroxisome biogenesis disorder 9B MIM#614879, Rhizomelic chondrodysplasia punctata, type 1 MIM#215100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6684 | PEX6 | Ain Roesley Mode of inheritance for gene: PEX6 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6683 | PEX6 | Ain Roesley edited their review of gene: PEX6: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6683 | PEX6 | Ain Roesley edited their review of gene: PEX6: Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6683 | PEX5 | Ain Roesley Mode of inheritance for gene: PEX5 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6682 | PEX5 | Ain Roesley Mode of inheritance for gene: PEX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6681 | PEX5 | Ain Roesley reviewed gene: PEX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110, Peroxisome biogenesis disorder 2B MIM#202370; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6681 | PEX3 | Ain Roesley Mode of inheritance for gene: PEX3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6680 | PEX3 | Ain Roesley reviewed gene: PEX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10942428, 10958759, 10968777, 27557811, 33101983, 20301621; Phenotypes: Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882, Peroxisome biogenesis disorder 10B , MIM# 617370; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6679 | PEX26 | Ain Roesley Mode of inheritance for gene: PEX26 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6677 | PEX26 | Ain Roesley reviewed gene: PEX26: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872, Peroxisome biogenesis disorder 7B MIM614873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6677 | PEX2 | Ain Roesley Mode of inheritance for gene: PEX2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6677 | PEX2 | Ain Roesley Mode of inheritance for gene: PEX2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6676 | PEX2 | Ain Roesley reviewed gene: PEX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866, Peroxisome biogenesis disorder 5B MIM#614867; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6675 | PEX19 | Ain Roesley Mode of inheritance for gene: PEX19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6674 | PEX19 | Ain Roesley reviewed gene: PEX19: Rating: GREEN; Mode of pathogenicity: None; Publications: 10051604, 20683989, 11883941, 28391327; Phenotypes: Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6674 | PEX16 | Ain Roesley Mode of inheritance for gene: PEX16 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6673 | PEX16 | Ain Roesley Mode of inheritance for gene: PEX16 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6672 | PEX16 | Ain Roesley reviewed gene: PEX16: Rating: ; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876, Peroxisome biogenesis disorder 8B MIM#614877; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6671 | PEX14 | Ain Roesley Mode of inheritance for gene: PEX14 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6670 | PEX14 | Ain Roesley reviewed gene: PEX14: Rating: GREEN; Mode of pathogenicity: None; Publications: 37493040, 20301621; Phenotypes: Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887, peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6670 | PEX13 | Ain Roesley Mode of inheritance for gene: PEX13 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6669 | PEX13 | Ain Roesley Mode of inheritance for gene: PEX13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6668 | PEX13 | Ain Roesley reviewed gene: PEX13: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 11A (Zellweger) MIM#614883, Peroxisome biogenesis disorder 11B MIM#614885; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6667 | PEX12 | Ain Roesley Mode of inheritance for gene: PEX12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6666 | PEX12 | Ain Roesley reviewed gene: PEX12: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859, Peroxisome biogenesis disorder 3B MIM#266510; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6665 | TSHZ3 |
Bryony Thompson gene: TSHZ3 was added gene: TSHZ3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TSHZ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TSHZ3 were set to 27668656; 34919690; 36553458; 39420202 Phenotypes for gene: TSHZ3 were set to congenital anomaly of kidney and urinary tract MONDO:0019719 Review for gene: TSHZ3 was set to AMBER Added comment: More evidence for the gene-disease association is required PMID: 27668656 - TSHZ3 is included in the region deleted in chromosome 19q13.11 Deletion Syndrome, which includes intellectual disability and behavioural issues, congenital anomalies of the kidney and urinary tract (CAKUT) PMID: 34919690 - haploinsufficient mouse model leads to kidney defects PMID: 36553458 - heterozygous frameshift variant c.119_120dup p.Pro41SerfsTer79 in a case with intellectual disability, behavioural issues, pyelocaliceal dilatation, and mild urethral stenosis. PMID: 39420202 - 12 CAKUT patients from 9/301 (3%) families carried 5 different rare heterozygous TSHZ3 missense variants. However, 1 of the variants (p.Ser58Gly) present in 5 of the families is more common in gnomAD v4.1 than you would expect for a dominant disease including 5 homozygotes (1,408/1,612,114 alleles, 5 hom, AF=0.0008734). The authors state this is not unexpected in a condition, such as CAKUT. However, the different missense variants are inherited from unaffected parents in at least 2/9 families (there was no phenotype information available for an additional 3 parents). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6663 | WDR83OS |
Bryony Thompson gene: WDR83OS was added gene: WDR83OS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR83OS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR83OS were set to 39471804; 30250217 Phenotypes for gene: WDR83OS were set to complex neurodevelopmental disorder MONDO:0100038; neurodevelopmental disorder with hypercholanemia Review for gene: WDR83OS was set to GREEN Added comment: Now 14 cases from 9 unrelated families with homozygous LoF variants, including the family reported in 2019. Consistent clinical features include NDD (14/14), facial dysmorphism (13/14), intractable itching (9/14), and elevated bile acids (5/6). Also, supporting null zebrafish model that recapitulates the human phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6661 | GON4L |
Bryony Thompson gene: GON4L was added gene: GON4L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GON4L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GON4L were set to 39500882; 21937992 Phenotypes for gene: GON4L were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: GON4L was set to GREEN Added comment: 2 LoF variants in 4 cases from 3 unrelated consanguineous families, and supporting null zebrafish model PMID: 39500882 - 2 homozygous truncating GON4L variants [NM_001282860.2: c.62_63del, p.(Gln21Argfs*12) and c.5517+1G>A] in 3 patients from 2 consanguineous families with prenatal-onset growth impairment, developmental delay, mild intellectual disability, speech impairment, progressive and disproportionate microcephaly, facial asymmetry, congenital heart anomaly, and brain structure abnormalities. Null zebrafish model had distinct morphological and size abnormalities in the craniofacial cartilage of zebrafish larvae Heterozygous carriers in biallelic families were unaffected PMID: 21937992 - a case from Iran from a consanguineous family homozygous for c.5517+1G>A with syndromic ID. No other clinical details provided Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6654 | BHLHE22 |
Zornitza Stark gene: BHLHE22 was added gene: BHLHE22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BHLHE22 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: BHLHE22 were set to 39502664 Phenotypes for gene: BHLHE22 were set to Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related Review for gene: BHLHE22 was set to GREEN Added comment: Four individuals with de novo missense variants within the highly conserved helix-loop-helix domain and seven individuals from five unrelated families with a recurrent homozygous frameshift variant, p.(Gly74Alafs*18). Individuals presented with absent or limited speech, severely impaired motor abilities, intellectual disability (ID), involuntary movements, autistic traits with stereotypies, abnormal muscle tone. The majority of individuals had partial or complete agenesis of the corpus callosum (ACC). Additional symptoms comprised epilepsy, variable dysmorphic features, and eye anomalies. One additional individual had spastic paraplegia without delayed development and ACC, expanding the phenotype to milder and later onset forms. Mice lacking bhlhe22 show nearly complete loss of three brain comminsure, including the corpus callosum. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6652 | MRPL49 |
Zornitza Stark gene: MRPL49 was added gene: MRPL49 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRPL49 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MRPL49 were set to 39417135 Phenotypes for gene: MRPL49 were set to Mitochondrial disease, MONDO:0044970, MRPL49-related Review for gene: MRPL49 was set to GREEN Added comment: Five unrelated families with presentations ranging from Perrault syndrome (primary ovarian insufficiency and sensorineural hearing loss) to severe childhood onset of leukodystrophy, learning disability, microcephaly and retinal dystrophy and bi-allelic variants in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6651 | SATB1 | Sangavi Sivagnanasundram reviewed gene: SATB1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008481; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6648 | PEX11B | Ain Roesley Mode of inheritance for gene: PEX11B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6647 | PEX11B | Ain Roesley reviewed gene: PEX11B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28129423, 22581968; Phenotypes: Peroxisome biogenesis disorder 14B MIM#614920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6646 | PEX10 | Ain Roesley Mode of inheritance for gene: PEX10 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6645 | PEX10 | Ain Roesley reviewed gene: PEX10: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870, Peroxisome biogenesis disorder 6B MIM#614871; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6645 | PEX1 | Ain Roesley Mode of inheritance for gene: PEX1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6644 | PEX1 | Ain Roesley reviewed gene: PEX1: Rating: ; Mode of pathogenicity: None; Publications: 20301621; Phenotypes: Heimler syndrome 1 MIM#234580, Peroxisome biogenesis disorder 1A (Zellweger) MIM#214100, Peroxisome biogenesis disorder 1B (NALD/IRD) MIM#601539; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6643 | PEPD | Ain Roesley Mode of inheritance for gene: PEPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6642 | PEPD | Ain Roesley reviewed gene: PEPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 26110198, 32455636; Phenotypes: Prolidase deficiency MIM#170100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6639 | PDSS2 | Ain Roesley Mode of inheritance for gene: PDSS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6638 | PDSS2 | Ain Roesley reviewed gene: PDSS2: Rating: RED; Mode of pathogenicity: None; Publications: 28125198, 29032433, 25349199, 17186472, 21723727, 10972372; Phenotypes: Coenzyme Q10 deficiency, primary, 3 MIM#614652; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6637 | PDHX | Ain Roesley Mode of inheritance for gene: PDHX was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6636 | PDHX | Ain Roesley reviewed gene: PDHX: Rating: GREEN; Mode of pathogenicity: None; Publications: 34138529; Phenotypes: Lacticacidemia due to PDX1 deficiency MIM#245349; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6635 | PDHA1 | Ain Roesley Mode of inheritance for gene: PDHA1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6634 | PDHA1 | Ain Roesley reviewed gene: PDHA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23021068; Phenotypes: Pyruvate dehydrogenase E1-alpha deficiency MIM#312170; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6633 | PDGFRB | Ain Roesley Mode of inheritance for gene: PDGFRB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6632 | PDGFRB | Ain Roesley reviewed gene: PDGFRB: Rating: GREEN; Mode of pathogenicity: None; Publications: 31710779, 35221873; Phenotypes: Kosaki overgrowth syndrome MIM#616592; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6632 | PCNT | Ain Roesley reviewed gene: PCNT: Rating: AMBER; Mode of pathogenicity: None; Publications: 34978779; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type II MIM#210720; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6632 | PCCA | Ain Roesley Mode of inheritance for gene: PCCA was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6631 | PCCA | Ain Roesley Mode of inheritance for gene: PCCA was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6632 | PCCB | Ain Roesley Mode of inheritance for gene: PCCB was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6631 | PCCA | Ain Roesley Mode of inheritance for gene: PCCA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6630 | PCCB | Ain Roesley Mode of inheritance for gene: PCCB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6629 | PCCB | Ain Roesley reviewed gene: PCCB: Rating: GREEN; Mode of pathogenicity: None; Publications: 22593918; Phenotypes: Propionicacidemia MIM#606054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6628 | PCCA | Ain Roesley reviewed gene: PCCA: Rating: GREEN; Mode of pathogenicity: None; Publications: 22593918; Phenotypes: Propionicacidemia MIM#606054; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6628 | MARK2 |
chirag patel gene: MARK2 was added gene: MARK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MARK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MARK2 were set to PMID: 39419027, 39436150 Phenotypes for gene: MARK2 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: MARK2 was set to GREEN Added comment: 31 individuals with autism spectrum disorder (30/31), intellectual disability/developmental delay (100%), motor delay (62%), speech-language problems (100%), seizure/epilepsy (46%), behaviour disorders (ADHD, aggression, anxiety)(74%), and distinctive facial features (narrow face, abnormal or broad forehead, downslanting palpebral fissures, and large or dysplastic ears). WES/WGS identified 25 LOF and 6 missense variants in MARK2 gene (Microtubule affinity-regulating kinase 2) which contributes to establishing neuronal polarity and developing dendritic spines. LOF variants were de novo (16/25), inherited (4/25), or unk (5/25). All 6 missense variants were de novo and clustered in the kinase or KA1 domains. The mRNA and protein expression of MARK2 in PBMCs were significantly lower in affected individuals with LOF variants than in the control group. In vitro expression assay of missense variants supported the effect of MARK2 loss. Proband-derived and CRISPR-engineered isogenic induced pluripotent stem cells (iPSCs) showed MARK2 loss leads to early neuronal developmental and functional deficits, including anomalous polarity and disorganization in neural rosettes, as well as imbalanced proliferation and differentiation in neural progenitor cells (NPCs). Mark2+/- mice showed abnormal cortical formation and partition and ASD-like behaviour. Through the use of RNA sequencing (RNA-seq) and lithium treatment, they linked MARK2 loss to downregulation of the WNT/β-catenin signaling pathway and identified lithium as a potential drug for treating MARK2-associated ASD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6627 | UBTF | chirag patel reviewed gene: UBTF: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 39366741; Phenotypes: Global developmental delay without neuroregression; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6627 | SGSM3 | Sangavi Sivagnanasundram reviewed gene: SGSM3: Rating: GREEN; Mode of pathogenicity: None; Publications: 39390489; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), SGSM3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6626 | LINC01578 |
Zornitza Stark gene: LINC01578 was added gene: LINC01578 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: LINC01578. Mode of inheritance for gene: LINC01578 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LINC01578 were set to 39442041 Phenotypes for gene: LINC01578 were set to Neurodevelopmental disorder, MONDO:0700092, CHASERR-related Review for gene: LINC01578 was set to GREEN Added comment: CHASERR encodes a human long noncoding RNA (lncRNA) adjacent to CHD2, a coding gene in which de novo loss-of-function variants cause developmental and epileptic encephalopathy. Three unrelated children reported with a syndromic, early-onset neurodevelopmental disorder, each of whom had a de novo deletion in the CHASERR locus. The children had severe encephalopathy, shared facial dysmorphisms, cortical atrophy, and cerebral hypomyelination - a phenotype that is distinct from the phenotypes of patients with CHD2 haploinsufficiency. CHASERR deletion results in increased CHD2 protein abundance in patient-derived cell lines and increased expression of the CHD2 transcript in cis, indicating bidirectional dosage sensitivity in human disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6623 | RNU5B-1 |
Zornitza Stark gene: RNU5B-1 was added gene: RNU5B-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU5B-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1 Review for gene: RNU5B-1 was set to GREEN Added comment: 20 individuals reported in two preprints with de novo variants in this gene and a neurodevelopmental phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6622 | MBOAT7 | Zornitza Stark Mode of inheritance for gene: MBOAT7 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6621 | MBOAT7 | Zornitza Stark reviewed gene: MBOAT7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual disability MIM#617188; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6619 | KCNJ11 | Zornitza Stark Mode of inheritance for gene: KCNJ11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6616 | YAP1 | Zornitza Stark Mode of inheritance for gene: YAP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6613 | SUOX | Zornitza Stark Mode of inheritance for gene: SUOX was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6612 | SPTBN2 | Zornitza Stark Phenotypes for gene: SPTBN2 were changed from to Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386; Spinocerebellar ataxia 5, MIM# 600224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6609 | SLC6A19 | Zornitza Stark Mode of inheritance for gene: SLC6A19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6608 | SLC6A19 | Zornitza Stark reviewed gene: SLC6A19: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hartnup disorder, MIM# 234500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6608 | DHX9 | Zornitza Stark Phenotypes for gene: DHX9 were changed from Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 to Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6607 | DHX9 | Zornitza Stark Phenotypes for gene: DHX9 were changed from Neurodevelopmental disorder, MONDO:0700092, DHX9-related to Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6606 | DHX9 | Zornitza Stark edited their review of gene: DHX9: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 75, MIM# 620988 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6604 | ANKRD31 |
Megan Ball gene: ANKRD31 was added gene: ANKRD31 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ANKRD31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKRD31 were set to 27541642 Review for gene: ANKRD31 was set to RED Added comment: 1 individual with Rett-like phenotype. De novo missense. C.196A>T, p.Ile66Phe. Onset of features at 3 years, delayed ambulation, epilepsy, developmental regression, stereotypies, non-verbal. 17 years old at time of publication. A C.elegans model of ANKRD31 with a deletion showed significantly defective locomotion and asymmetric dynamics of axonal and dendritic microtubule defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6604 | SLC35A2 | Zornitza Stark Phenotypes for gene: SLC35A2 were changed from to Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854; Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6602 | SLC35A2 | Zornitza Stark Mode of inheritance for gene: SLC35A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6601 | SLC35A2 | Zornitza Stark reviewed gene: SLC35A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23561849, 24115232, 27743886, 25778940, 33407896; Phenotypes: Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854, Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6599 | SLC33A1 | Zornitza Stark Mode of inheritance for gene: SLC33A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6598 | SLC33A1 | Zornitza Stark reviewed gene: SLC33A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31194315; Phenotypes: Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6596 | SLC2A1 | Zornitza Stark Mode of inheritance for gene: SLC2A1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6595 | SLC2A1 | Zornitza Stark reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32913944; Phenotypes: GLUT1-deficiency syndrome, MONDO:0000188, Dystonia 9 601042, GLUT1 deficiency syndrome 1, infantile onset, severe 606777, GLUT1 deficiency syndrome 2, childhood onset 612126, Stomatin-deficient cryohydrocytosis with neurologic defects 608885; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6593 | SLC25A22 | Zornitza Stark Mode of inheritance for gene: SLC25A22 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6592 | SLC25A22 | Zornitza Stark reviewed gene: SLC25A22: Rating: GREEN; Mode of pathogenicity: None; Publications: 15592994, 19780765, 24596948, 33821742, 33342683, 31285529; Phenotypes: Developmental and epileptic encephalopathy 3, MIM# 609304; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6589 | SLC25A12 | Zornitza Stark Mode of inheritance for gene: SLC25A12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6588 | SLC25A12 | Zornitza Stark reviewed gene: SLC25A12: Rating: GREEN; Mode of pathogenicity: None; Publications: 19641205, 24515575, 35008954, 32700846, 31766059, 31514314; Phenotypes: Developmental and epileptic encephalopathy 39, MIM# 612949; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6586 | SLC17A5 | Zornitza Stark Mode of inheritance for gene: SLC17A5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6585 | SLC17A5 | Zornitza Stark commented on gene: SLC17A5: Sialic acid storage diseases are autosomal recessive neurodegenerative disorders that may present as a severe infantile form, including DD/IDD or a slowly progressive adult form, which is prevalent in Finland and referred to as Salla disease. p.Arg39Cys is a founder Finnish variant. Multiple families reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6585 | SLC17A5 | Zornitza Stark reviewed gene: SLC17A5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sialic acid storage disorder, infantile, MIM# 269920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6583 | SLC12A6 | Zornitza Stark Mode of inheritance for gene: SLC12A6 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6582 | SLC12A6 | Zornitza Stark Mode of inheritance for gene: SLC12A6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6581 | SLC12A6 | Zornitza Stark reviewed gene: SLC12A6: Rating: GREEN; Mode of pathogenicity: None; Publications: 31439721, 27485015, 16606917, 21628467, 12368912, 17893295; Phenotypes: Agenesis of the corpus callosum with peripheral neuropathy, MIM# 218000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6580 | AJAP1 |
Zornitza Stark gene: AJAP1 was added gene: AJAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AJAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AJAP1 were set to 38985877 Phenotypes for gene: AJAP1 were set to neurodevelopmental disorder, MONDO:0700092, AJAP1-related Review for gene: AJAP1 was set to GREEN Added comment: PMID:38985877 reported five unrelated individuals with monoallelic variants or a deletion in AJAP1 gene and they presented with epilepsy, neurodevelopmental problems, or intellectual disability. There is also supporting functional evidence available. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6579 | KIF5A | Zornitza Stark Phenotypes for gene: KIF5A were changed from Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237 to Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6578 | KIF5A | Zornitza Stark Phenotypes for gene: KIF5A were changed from to Spastic paraplegia 10, autosomal dominant, MIM# 604187; inherited neurodegenerative disorder MONDO:0024237 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6575 | KIF5A | Zornitza Stark Mode of inheritance for gene: KIF5A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6569 | KIF7 | Zornitza Stark Mode of inheritance for gene: KIF7 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6569 | KIF7 | Zornitza Stark Mode of inheritance for gene: KIF7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6565 | KLHL7 | Zornitza Stark Mode of inheritance for gene: KLHL7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6562 | L2HGDH | Zornitza Stark Mode of inheritance for gene: L2HGDH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6561 | L2HGDH | Zornitza Stark Mode of inheritance for gene: L2HGDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6558 | LAMA1 | Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6557 | LAMA1 | Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6556 | LAMA1 | Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6555 | LAMA1 | Zornitza Stark Mode of inheritance for gene: LAMA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6554 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6551 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6550 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6549 | ISPD | Sangavi Sivagnanasundram reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23288328; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6549 | LAMA1 | Sangavi Sivagnanasundram reviewed gene: LAMA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24013853; Phenotypes: ataxia - intellectual disability - oculomotor apraxia - cerebellar cysts syndrome MONDO:0014419; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6549 | L2HGDH | Sangavi Sivagnanasundram reviewed gene: L2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 37113859; Phenotypes: Mitochondrial disease MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6549 | KLHL7 | Sangavi Sivagnanasundram reviewed gene: KLHL7: Rating: GREEN; Mode of pathogenicity: None; Publications: 27392078, 30142437, 29074562; Phenotypes: PERCHING syndrome MONDO:0014890, acrocallosal syndrome MONDO:0008708; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6549 | KIF7 | Sangavi Sivagnanasundram reviewed gene: KIF7: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301500; Phenotypes: acrocallosal syndrome MONDO:0008708, KIF7-related ciliopathy MONDO:0800463, Joubert syndrome 12 MIM#200990; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6549 | KIF5A | Sangavi Sivagnanasundram reviewed gene: KIF5A: Rating: AMBER; Mode of pathogenicity: None; Publications: 18853458; Phenotypes: Spastic paraplegia 10, autosomal dominant, MIM# 604187, inherited neurodegenerative disorder MONDO:0024237; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6548 | DHRSX |
Zornitza Stark gene: DHRSX was added gene: DHRSX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DHRSX was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DHRSX were set to 38821050 Phenotypes for gene: DHRSX were set to congenital disorder of glycosylation, MONDO:0015286, DHRSX-related Added comment: PMID:38821050 reported the identification of biallelic missense variants in DHRSX gene in four patients from three unrelated families with a congenital disorder of glycosylation. They displayed distinct facial features, severe neurological involvement including hypotonia, scoliosis, contractures, profound intellectual disability, epilepsy, and sensorineural hearing loss. These patients also experienced severe failure to thrive (requiring tube feeding); variable respiratory insufficiency; and involvement of the eyes, the gastrointestinal system, and other organs. Gene located in PAR. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6544 | ITPR1 | Zornitza Stark Mode of inheritance for gene: ITPR1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6541 | IVD | Zornitza Stark Mode of inheritance for gene: IVD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6538 | KCNT1 | Zornitza Stark Mode of inheritance for gene: KCNT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6534 | KCTD7 | Zornitza Stark Mode of inheritance for gene: KCTD7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6531 | KDM6A | Zornitza Stark Mode of inheritance for gene: KDM6A was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6529 | KIAA0586 | Zornitza Stark Mode of inheritance for gene: KIAA0586 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6528 | KIAA0586 | Sangavi Sivagnanasundram reviewed gene: KIAA0586: Rating: GREEN; Mode of pathogenicity: None; Publications: 26096313; Phenotypes: Joubert syndrome 23 MIM#616490; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6528 | KDM6A | Sangavi Sivagnanasundram reviewed gene: KDM6A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33674768; Phenotypes: Kabuki syndrome 2 MONDO:0010465; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6528 | KCTD7 | Sangavi Sivagnanasundram reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 30295347, 31197948; Phenotypes: progressive myoclonus epilepsy MONDO:0020074; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6528 | KCNT1 | Sangavi Sivagnanasundram reviewed gene: KCNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23086397, 24029078; Phenotypes: childhood-onset epilepsy syndrome MONDO:0020072; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6528 | IVD | Sangavi Sivagnanasundram reviewed gene: IVD: Rating: GREEN; Mode of pathogenicity: None; Publications: 26018748; Phenotypes: isovaleric acidemia MONDO:0009475; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6528 | ITPR1 | Sangavi Sivagnanasundram reviewed gene: ITPR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27108797, 27108798, 15623688, 22986007, 28488678; Phenotypes: aniridia-cerebellar ataxia-intellectual disability syndrome MONDO:0008795, spinocerebellar ataxia type 29 MONDO:0007298; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6527 | BORCS8 | Zornitza Stark Phenotypes for gene: BORCS8 were changed from Neurodevelopmental disorder (MONDO#0700092), BORCS8-related to Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6526 | BORCS8 | Zornitza Stark reviewed gene: BORCS8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6524 | GLYCTK | Bryony Thompson Mode of inheritance for gene: GLYCTK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6522 | GLYCTK | Bryony Thompson reviewed gene: GLYCTK: Rating: AMBER; Mode of pathogenicity: None; Publications: 20949620, 31837836, 3588091, 30637540, 28462797, 20949620, 28190537; Phenotypes: D-glyceric aciduria MONDO:0009070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6520 | GLI3 | Bryony Thompson Mode of inheritance for gene: GLI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6519 | GLI3 | Bryony Thompson reviewed gene: GLI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301619, 20301638; Phenotypes: Greig cephalopolysyndactyly syndrome MONDO:0008287; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6519 | GLI2 | Bryony Thompson Phenotypes for gene: GLI2 were changed from to postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome MONDO:0014369 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6517 | GLI2 | Bryony Thompson Mode of inheritance for gene: GLI2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6516 | GLI2 | Bryony Thompson reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24744436; Phenotypes: postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome MONDO:0014369; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6514 | GLDC | Bryony Thompson Mode of inheritance for gene: GLDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6513 | GLDC | Bryony Thompson reviewed gene: GLDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301531; Phenotypes: glycine encephalopathy MONDO:0011612; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6511 | GLB1 | Bryony Thompson Mode of inheritance for gene: GLB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6510 | GLB1 | Bryony Thompson reviewed gene: GLB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24156116; Phenotypes: GM1 gangliosidosis MONDO:0018149, mucopolysaccharidosis type 4B MONDO:0009660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6508 | GK | Bryony Thompson Mode of inheritance for gene: GK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6507 | GK | Bryony Thompson reviewed gene: GK: Rating: GREEN; Mode of pathogenicity: None; Publications: 37091526, 33212314; Phenotypes: inborn glycerol kinase deficiency MONDO:0010613, X-linked adrenal hypoplasia congenita MONDO:0010264; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6507 | MAL | Zornitza Stark Phenotypes for gene: MAL were changed from Leukodystrophy MONDO:0019046, MAL-related to Leukodystrophy, hypomyelinating, 28, MIM# 620978 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6506 | MAL | Zornitza Stark edited their review of gene: MAL: Changed phenotypes: Leukodystrophy, hypomyelinating, 28, MIM# 620978 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6505 | GJC2 | Bryony Thompson reviewed gene: GJC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29276893; Phenotypes: hypomyelinating leukodystrophy 2 MONDO:0012125, hereditary spastic paraplegia 44 MONDO:0013179; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6504 | GJC2 | Bryony Thompson Mode of inheritance for gene: GJC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6501 | GFM1 | Bryony Thompson Mode of inheritance for gene: GFM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6500 | GFM1 | Bryony Thompson reviewed gene: GFM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25852744, 31680380, 21986555, 32776492; Phenotypes: Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6498 | SLC12A5 | Zornitza Stark Mode of inheritance for gene: SLC12A5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6497 | SLC12A5 |
Zornitza Stark changed review comment from: Note LIMITED by ClinGen. However, note functional evidence including mouse model. Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship.; to: LIMITED by ClinGen. However, note functional evidence including mouse model and additional family in 38660387, again with supportive functional data. Ten variants (missense, small in-frame deletions, and splicing) that have been reported in six probands in three publications (PMIDs: 26333769, 27436767, 31618474) are included in this curation. There is some preliminary evidence to suggest that the mechanism of pathogenicity may be loss of function. Electrophysiological studies showed reduced transporter activity of proteins with some variants, although few studies are available at this time (PMIDs: 26333769, 27436767). This gene-disease relationship is also supported by a knockout mouse model in which gentle handling or movement of the mother and littermates triggered seizures (PMID: 12000122). In summary, there is limited evidence to support this gene-disease relationship. Although more evidence is needed to support a causal role, no convincing evidence has emerged that contradicts the gene-disease relationship. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6497 | SLC12A5 | Zornitza Stark reviewed gene: SLC12A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26333769, 27436767, 31618474, 12000122; Phenotypes: Developmental and epileptic encephalopathy 34, MIM# 616645; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6495 | SC5D | Zornitza Stark Mode of inheritance for gene: SC5D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6494 | SC5D | Zornitza Stark reviewed gene: SC5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lathosterolosis, MIM#607330; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6494 | RTEL1 | Zornitza Stark Phenotypes for gene: RTEL1 were changed from Dyskeratosis congenita, autosomal recessive 5, MIM#615190 to Dyskeratosis congenita, autosomal recessive 5, MIM#615190 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6493 | RTEL1 | Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal recessive 5, MIM#615190 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6492 | RTEL1 | Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6491 | RTEL1 | Zornitza Stark reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dyskeratosis congenita, autosomal recessive 5, MIM#615190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6490 | RRM2B | Zornitza Stark Mode of inheritance for gene: RRM2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6489 | RRM2B | Zornitza Stark reviewed gene: RRM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075, Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6489 | UFC1 | Zornitza Stark reviewed gene: UFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with spasticity and poor growth, OMIM #618076; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6488 | RPS6KA3 | Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6487 | RPS6KA3 | Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Lowry syndrome MIM# 303600; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6486 | RPGRIP1L | Zornitza Stark Mode of inheritance for gene: RPGRIP1L was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6485 | RPGRIP1L | Zornitza Stark reviewed gene: RPGRIP1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Joubert syndrome 7, MIM# 611560, Meckel syndrome 5, MIM# 611561; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6483 | RNASET2 | Zornitza Stark Mode of inheritance for gene: RNASET2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6482 | RNASET2 | Zornitza Stark reviewed gene: RNASET2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6481 | RNASEH2C | Zornitza Stark Mode of inheritance for gene: RNASEH2C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6480 | RNASEH2C | Zornitza Stark reviewed gene: RNASEH2C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 3, MIM# 610329; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6479 | RNASEH2B | Zornitza Stark Mode of inheritance for gene: RNASEH2B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6478 | RNASEH2B | Zornitza Stark reviewed gene: RNASEH2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 2, MIM# 610181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6477 | RNASEH2A | Zornitza Stark Mode of inheritance for gene: RNASEH2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6476 | RNASEH2A | Zornitza Stark reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 4, MIM# 610333; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6474 | RMND1 | Zornitza Stark Mode of inheritance for gene: RMND1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6473 | RMND1 | Zornitza Stark reviewed gene: RMND1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined oxidative phosphorylation deficiency 11 MIM#614922; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6470 | RIT1 | Zornitza Stark Mode of inheritance for gene: RIT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6468 | RFC4 | Zornitza Stark reviewed gene: RFC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RFC4-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6466 | RARS2 | Zornitza Stark Mode of inheritance for gene: RARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6465 | RARS2 | Zornitza Stark reviewed gene: RARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17847012, 20635367, 25809939; Phenotypes: Pontocerebellar hypoplasia, type 6, MIM# 611523; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6464 | IPO8 |
Zornitza Stark gene: IPO8 was added gene: IPO8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IPO8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IPO8 were set to 34010604; 33875846; 34010605 Phenotypes for gene: IPO8 were set to Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472; Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities Review for gene: IPO8 was set to GREEN Added comment: There are 35 unrelated cases with a IPO8 variant, 4/35 with mild ID, 1/35 with severe ID and 7 global developmental delay. There is a further case with severe ID, but the patient also has a 1.779Mb deletion in 19q13.4, which could be responsible for the ID (PMID: 34010605). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6457 | RAF1 | Zornitza Stark Mode of inheritance for gene: RAF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6456 | RAB18 | Zornitza Stark changed review comment from: Autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. At least 7 families reported, including 4 Pakistani families with a founder variant, p.Leu24Gln; to: Autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe ID, spastic diplegia, and hypogonadism. At least 7 families reported, including 4 Pakistani families with a founder variant, p.Leu24Gln | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6454 | RAB18 | Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6453 | RAB18 | Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6453 | PYCR1 | Zornitza Stark Phenotypes for gene: PYCR1 were changed from to Cutis laxa, autosomal recessive, type IIB, MIM# 612940; Cutis laxa, autosomal recessive, type IIIB, MIM# 614438 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6451 | PYCR1 | Zornitza Stark Mode of inheritance for gene: PYCR1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6450 | PYCR1 | Zornitza Stark reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19648921, 4076251, 22052856, 19576563, 19648921, 9648921, 22052856, 28294978, 27756598; Phenotypes: Cutis laxa, autosomal recessive, type IIB, MIM# 612940, Cutis laxa, autosomal recessive, type IIIB, MIM# 614438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6448 | PUS1 | Zornitza Stark Mode of inheritance for gene: PUS1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6448 | PUS1 | Zornitza Stark Mode of inheritance for gene: PUS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6447 | PUS1 | Zornitza Stark reviewed gene: PUS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25227147, 17056637, 15108122, 32287105, 31641589, 28832011; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6445 | PTS | Zornitza Stark Mode of inheritance for gene: PTS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6444 | PTS | Zornitza Stark reviewed gene: PTS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6441 | PTPN11 | Zornitza Stark Mode of inheritance for gene: PTPN11 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6438 | PTF1A | Zornitza Stark Mode of inheritance for gene: PTF1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6437 | PTF1A | Zornitza Stark reviewed gene: PTF1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 21749365, 10507728, 15543146, 19650412; Phenotypes: Pancreatic and cerebellar agenesis, MIM# 609069; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6434 | PTDSS1 | Zornitza Stark Mode of inheritance for gene: PTDSS1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6433 | PTDSS1 |
Zornitza Stark commented on gene: PTDSS1: Lenz-Majewski hyperostotic dwarfism is a rare condition characterized by intellectual disability, sclerosing bone dysplasia, distinct craniofacial and dental anomalies, loose skin, and distal limb anomalies, particularly brachydactyly and symphalangism. Patients have multiple radiographic abnormalities due to progressive generalized hyperostosis that affects the cranium, vertebrae, and diaphyses of tubular bones, leading to severe growth retardation. Multiple families. Gain-of-function is the established or expected mechanism of disease for these variants. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6433 | PTDSS1 | Zornitza Stark reviewed gene: PTDSS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lenz-Majewski hyperostotic dwarfism MIM#151050; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6432 | PTCH1 | Zornitza Stark Mode of inheritance for gene: PTCH1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6431 | PTCH1 | Zornitza Stark Mode of inheritance for gene: PTCH1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6430 | PTCH1 | Zornitza Stark reviewed gene: PTCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holoprosencephaly 7, MIM# 610828; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6429 | KBTBD2 |
Zornitza Stark gene: KBTBD2 was added gene: KBTBD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KBTBD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KBTBD2 were set to 39313616 Phenotypes for gene: KBTBD2 were set to neurodevelopmental disorder MONDO:0700092, KBTBD2-related Review for gene: KBTBD2 was set to GREEN Added comment: 3 families - 2 compound hets and 1 hom phenotypes include: Microcephaly, hypotonia, failure to thrive, IUGR, delayed gross motor development, dysmorphism Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6424 | MAP2K1 | Zornitza Stark Mode of inheritance for gene: MAP2K1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6423 | MAP2K1 | Zornitza Stark Mode of inheritance for gene: MAP2K1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6419 | MAP2K2 | Zornitza Stark Mode of inheritance for gene: MAP2K2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6418 | MAT1A | Zornitza Stark Phenotypes for gene: MAT1A were changed from to Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850; Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850; Disorders of the metabolism of sulphur amino acids | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6416 | MAT1A | Zornitza Stark Mode of inheritance for gene: MAT1A was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6413 | MBOAT7 | Zornitza Stark Mode of inheritance for gene: MBOAT7 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6410 | MKKS | Zornitza Stark Mode of inheritance for gene: MKKS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6407 | MKS1 | Zornitza Stark Mode of inheritance for gene: MKS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6404 | MLC1 | Zornitza Stark Mode of inheritance for gene: MLC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6403 | MMAA | Zornitza Stark Phenotypes for gene: MMAA were changed from to Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6401 | MMAA | Zornitza Stark Mode of inheritance for gene: MMAA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6400 | MMAB | Zornitza Stark Phenotypes for gene: MMAB were changed from to Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6398 | MMAB | Zornitza Stark Mode of inheritance for gene: MMAB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6397 | MMADHC | Zornitza Stark Phenotypes for gene: MMADHC were changed from to Homocystinuria, cblD type, variant 1 MIM#277410; Methylmalonic aciduria and homocystinuria, cblD type MIM#277410; Methylmalonic aciduria, cblD type, variant 2 MIM#277410; Disorders of cobalamin absorption, transport and metabolism | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6395 | MMADHC | Zornitza Stark Mode of inheritance for gene: MMADHC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6394 | MUT | Zornitza Stark Phenotypes for gene: MUT were changed from to Methylmalonic aciduria, mut(0) type, MIM# 251000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6392 | MUT | Zornitza Stark Mode of inheritance for gene: MUT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6389 | MOCS2 | Zornitza Stark Mode of inheritance for gene: MOCS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6386 | POLR3K |
Bryony Thompson gene: POLR3K was added gene: POLR3K was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POLR3K was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLR3K were set to https://doi.org/10.1155/2024/8807171; 30584594 Phenotypes for gene: POLR3K were set to POLR3-related leukodystrophy MONDO:0700282 Review for gene: POLR3K was set to GREEN Added comment: 3 apparently unrelated cases (1 compound het & 2 homozygous for the same missense & supporting functional assays) with phenotypes consistent with POLR3-related leukodystrophy which includes ID and DD as part of the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6383 | GFAP | Bryony Thompson Mode of inheritance for gene: GFAP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6382 | GFAP | Bryony Thompson reviewed gene: GFAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301351; Phenotypes: Alexander disease MONDO:0008752; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6382 | ATAD2B |
Zornitza Stark gene: ATAD2B was added gene: ATAD2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATAD2B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATAD2B were set to 39313616 Phenotypes for gene: ATAD2B were set to neurodevelopmental disorder MONDO:0700092, ATAD2B-related Review for gene: ATAD2B was set to AMBER Added comment: 3 families including 2 siblings 1 fam is hom for a highly conserved missense Amber because of the lack of specific phenotypes: Abnormality of the nervous system and Abnormality of the eye Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6379 | MRPS22 | Zornitza Stark Mode of inheritance for gene: MRPS22 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6375 | MTFMT | Zornitza Stark Mode of inheritance for gene: MTFMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6373 | MVK | Zornitza Stark Mode of inheritance for gene: MVK was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6372 | MVK | Zornitza Stark Mode of inheritance for gene: MVK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6369 | MYO5A | Zornitza Stark Mode of inheritance for gene: MYO5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6366 | MTHFR | Zornitza Stark Mode of inheritance for gene: MTHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6362 | NPC2 | Zornitza Stark Mode of inheritance for gene: NPC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6359 | NPC1 | Zornitza Stark Mode of inheritance for gene: NPC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6354 | NKX2-1 | Zornitza Stark Mode of inheritance for gene: NKX2-1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6352 | NGLY1 | Zornitza Stark reviewed gene: NGLY1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24651605, 27388694, 32259258; Phenotypes: Congenital disorder of deglycosylation (OMIM 615273); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6351 | NGLY1 | Zornitza Stark Mode of inheritance for gene: NGLY1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6347 | NFIX | Zornitza Stark Mode of inheritance for gene: NFIX was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6344 | NEU1 | Zornitza Stark Mode of inheritance for gene: NEU1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6341 | NDUFV1 | Zornitza Stark Mode of inheritance for gene: NDUFV1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6338 | NDUFS7 | Zornitza Stark Mode of inheritance for gene: NDUFS7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6334 | NDUFA1 | Zornitza Stark Mode of inheritance for gene: NDUFA1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6331 | NALCN | Zornitza Stark Mode of inheritance for gene: NALCN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6328 | NAGLU | Zornitza Stark Mode of inheritance for gene: NAGLU was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6325 | NAGA | Zornitza Stark Mode of inheritance for gene: NAGA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6322 | SCO2 | Zornitza Stark Mode of inheritance for gene: SCO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6319 | SKI | Zornitza Stark Mode of inheritance for gene: SKI was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6318 | SKI | Zornitza Stark reviewed gene: SKI: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SKI-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6316 | SHH | Zornitza Stark Mode of inheritance for gene: SHH was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6313 | SECISBP2 | Zornitza Stark Phenotypes for gene: SECISBP2 were changed from #609698 THYROID HORMONE METABOLISM, ABNORMAL to Thyroid hormone metabolism, abnormal, 1, MIM# 609698 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6310 | SECISBP2 | Zornitza Stark reviewed gene: SECISBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 39315526; Phenotypes: Thyroid hormone metabolism, abnormal, 1, MIM# 609698; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | FLVCR1 | Bryony Thompson reviewed gene: FLVCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39306721; Phenotypes: neurodevelopmental disorder MONDO:0700092, FLVCR1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | LRRC7 |
Sangavi Sivagnanasundram gene: LRRC7 was added gene: LRRC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LRRC7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LRRC7 were set to 39256359 Phenotypes for gene: LRRC7 were set to neurodevelopmental disorder (MONDO:0700092) Review for gene: LRRC7 was set to GREEN Added comment: Well established gene-disease association. Neurodevelopmental disorder with a clinical spectrum - symptoms include ID, ADHD, aggression and in many cases, hyperphagia associate obesity. Heterozygous missense and LoF variants have been reported and functional assays were conducted on missense and truncating variants that support LoF mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | SHH | chirag patel reviewed gene: SHH: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22791840, 19057928; Phenotypes: Holoprosencephaly 3 (MIM#142945); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | SKI | chirag patel reviewed gene: SKI: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23023332, 23103230, 24736733, 30071989; Phenotypes: Shprintzen-Goldberg syndrome, MIM# 182212; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | SCO2 | chirag patel reviewed gene: SCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10545952, 10749987, 18924171; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | NAGA | chirag patel reviewed gene: NAGA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11313741, 31468281, 15619430, 8782044; Phenotypes: Kanzaki disease, MIM# 609242, Schindler disease, type I and type II 609241, alpha-N-acetylgalactosaminidase deficiency MONDO:0017779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | NAGLU | chirag patel reviewed gene: NAGLU: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8650226; Phenotypes: Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | NALCN | chirag patel reviewed gene: NALCN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25683120, 30167850, 23749988, 24075186; Phenotypes: Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266, Hypotonia, infantile, with psychomotor retardation and characteristic facies 1, MIM # 615419; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6307 | USP9X | Ain Roesley Phenotypes for gene: USP9X were changed from Mental retardation, X-linked 99, XLR (MIM#300919) and XLD (MIM#300968) to Intellectual developmental disorder 99 MIM#300919; syndromic, female-restricted Intellectual developmental disorder 99 MIM#300968 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | NDUFA1 | chirag patel reviewed gene: NDUFA1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29506883, 19185523, 17262856, 21596602; Phenotypes: Mitochondrial complex I deficiency, nuclear type 12 MIM#301020; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | NDUFS7 | chirag patel reviewed gene: NDUFS7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22644603; Phenotypes: Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | NDUFS8 | chirag patel reviewed gene: NDUFS8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23430795, 9837812, 15159508, 22499348, 20818383, 20819849; Phenotypes: Mitochondrial complex I deficiency, nuclear type 2 MIM#618222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | NDUFV1 | chirag patel reviewed gene: NDUFV1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34807224; Phenotypes: Mitochondrial complex I deficiency, nuclear type 4 MIM#618225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | NEU1 | chirag patel reviewed gene: NEU1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8985184, 9054950, 11063730; Phenotypes: Sialidosis, type I and type II, MIM# 256550, MONDO:0009738; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | NFIX | chirag patel reviewed gene: NFIX: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33034087, 29897170, 30548146, 25118028; Phenotypes: Sotos syndrome 2 (MIM#614753), Marshall-Smith syndrome, MIM# 602535; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | NGLY1 | chirag patel reviewed gene: NGLY1: Rating: GREEN; Mode of pathogenicity: None; Publications: Congenital disorder of deglycosylation (OMIM 615273); Phenotypes: PMID: 24651605, 27388694, 32259258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | NKX2-1 | chirag patel reviewed gene: NKX2-1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10931427, 27066577, 26839702, 26103969, 23911641, 11854319, 24714694; Phenotypes: Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978, Chorea, hereditary benign MIM#118700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6304 | PPP2R5D | Ain Roesley Phenotypes for gene: PPP2R5D were changed from Mental retardation, autosomal dominant 35, MIM#616355 to Houge-Janssens syndrome 1, MIM#616355 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | NPC1 | chirag patel reviewed gene: NPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 9211849, 11333381; Phenotypes: Niemann-Pick disease, type C1 and type D, MIM# 257220, MONDO:0009757; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | NPC2 | chirag patel reviewed gene: NPC2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11125141, 17470133; Phenotypes: Niemann-pick disease, type C2, MIM# 607625, MONDO:0011873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MTHFR | chirag patel reviewed gene: MTHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7920641; Phenotypes: Homocystinuria due to MTHFR deficiency MIM#236250, Disorders of folate metabolism and transport; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MYO5A | chirag patel reviewed gene: MYO5A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 32275080, 22711375, 25283056; Phenotypes: Griscelli syndrome, type 1 MIM#214450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MVK | chirag patel reviewed gene: MVK: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29047407, 26409462; Phenotypes: Hyper-IgD syndrome (MIM#260920), Mevalonic aciduria (MIM#610377); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MTFMT | chirag patel reviewed gene: MTFMT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21907147, 23499752, 24461907, 22499348; Phenotypes: Combined oxidative phosphorylation deficiency 15, MIM# 614947, Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MRPS22 | chirag patel reviewed gene: MRPS22: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29566152,17873122, 25663021, 28752220; Phenotypes: Combined oxidative phosphorylation deficiency 5 MIM#611719, Ovarian dysgenesis 7 MIM#618117; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MOCS2 | chirag patel reviewed gene: MOCS2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 10053004; Phenotypes: Molybdenum cofactor deficiency B MIM#252160, Disorders of molybdenum cofactor metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MUT | chirag patel reviewed gene: MUT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116, 1977311, 11528502, 12948746; Phenotypes: Methylmalonic aciduria, mut(0) type, MIM# 251000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MMADHC | chirag patel reviewed gene: MMADHC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116,27604308, 18385497; Phenotypes: Homocystinuria, cblD type, variant 1 MIM#277410, Methylmalonic aciduria and homocystinuria, cblD type MIM#277410, Methylmalonic aciduria, cblD type, variant 2 MIM#277410, Disorders of cobalamin absorption, transport and metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MMAB | chirag patel reviewed gene: MMAB: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116; Phenotypes: Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MMAA | chirag patel reviewed gene: MMAA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301409, 37420116; Phenotypes: Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MLC1 | chirag patel reviewed gene: MLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11254442, 18757878, 16652334; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MKS1 | chirag patel reviewed gene: MKS1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 17377820, 24886560, 19776033, 33193692, 27570071, 27377014, 18327255, 24608809; Phenotypes: Joubert syndrome 28, MIM# 617121, MONDO:0014928, Meckel syndrome 1, MIM# 249000, MONDO:0009571, Bardet-Biedl syndrome 13, MIM# 615990, MONDO:0014441; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MKKS | chirag patel reviewed gene: MKKS: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10973251, 10802661, 26900326; Phenotypes: McKusick-Kaufman syndrome, MIM# 236700, Bardet-Biedl syndrome 6, MIM# 605231, Retinitis pigmentosa; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MBOAT7 | chirag patel reviewed gene: MBOAT7: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33335874, 32645526, 32744787, 31852446, 31282596, 30701556; Phenotypes: Intellectual disability MIM#617188; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MAT1A | chirag patel reviewed gene: MAT1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7560086; Phenotypes: Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850, Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850, Disorders of the metabolism of sulphur amino acids; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MAP2K2 | chirag patel reviewed gene: MAP2K2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20358587, 16439621, 18042262; Phenotypes: Cardiofaciocutaneous syndrome 3, MIM# 615279; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MAP2K1 | chirag patel reviewed gene: MAP2K1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 16439621, 17551924, 18042262, 20301365; Phenotypes: Cardiofaciocutaneous syndrome 3, MIM# 615279; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6302 | ZDHHC16 |
Ain Roesley gene: ZDHHC16 was added gene: ZDHHC16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZDHHC16 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZDHHC16 were set to 39313616 Phenotypes for gene: ZDHHC16 were set to neurodevelopmental disorder MONDO:0700092, ZDHHC16-related Review for gene: ZDHHC16 was set to AMBER gene: ZDHHC16 was marked as current diagnostic Added comment: 6 families including a pair of siblings Amber because 5 of the families had non specific phenotypes listed Abnormality of: the nervous system, metabolism/homeostasis, head/neck, immune system, the integument, the digestive system, the respiratory system, the endocrine system, Growth abnormality the skeletal system, the musculature, the eye Specific HPOs were provided for one individual (homoyzygous for a canonical splice) Abnormality of the face; Cerebellar hypoplasia; Developmental regression; Encephalopathy; Hyperreflexia; Hypertonia; Hypotonia; Inguinal hernia; Laryngomalacia; Microcephaly; Motor delay; Optic atrophy; Seizure; Spastic paraparesis; Spasticity; Talipes equinovarus; Umbilical hernia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6300 | EPB41L3 |
Bryony Thompson gene: EPB41L3 was added gene: EPB41L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EPB41L3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EPB41L3 were set to 39292993 Phenotypes for gene: EPB41L3 were set to neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063 Review for gene: EPB41L3 was set to GREEN Added comment: 6 cases from 5 unrelated consanguineous families (2nd & 3rd degree) with homozygous LoF variants and a neurodevelopmental condition, including ID and seizures. Epb41l3 shRNA-mediated downregulation in mouse oligodendroglia demonstrated impaired oligodendrocyte function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6296 | GCH1 | Bryony Thompson Mode of inheritance for gene: GCH1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6295 | GCH1 | Bryony Thompson reviewed gene: GCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22473768, 7869202; Phenotypes: GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6293 | GAMT | Bryony Thompson Mode of inheritance for gene: GAMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6292 | GAMT | Bryony Thompson reviewed gene: GAMT: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301745; Phenotypes: guanidinoacetate methyltransferase deficiency MONDO:0012999; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6290 | GALE | Bryony Thompson Mode of inheritance for gene: GALE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6289 | GALE | Bryony Thompson reviewed gene: GALE: Rating: GREEN; Mode of pathogenicity: None; Publications: 21290786; Phenotypes: galactose epimerase deficiency MONDO:0009257; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6287 | GALC | Bryony Thompson Mode of inheritance for gene: GALC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6286 | GALC | Bryony Thompson reviewed gene: GALC: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301416; Phenotypes: Krabbe disease MONDO:000949; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6284 | GABRB2 | Bryony Thompson Mode of inheritance for gene: GABRB2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6283 | GABRB2 | Bryony Thompson reviewed gene: GABRB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 38996765; Phenotypes: epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6281 | FUCA1 | Bryony Thompson Mode of inheritance for gene: FUCA1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6280 | FUCA1 | Bryony Thompson reviewed gene: FUCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33266441; Phenotypes: Fucosidosis MONDO:0009254; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6278 | FOXRED1 | Bryony Thompson Mode of inheritance for gene: FOXRED1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6277 | FOXRED1 | Bryony Thompson reviewed gene: FOXRED1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31434271, 20818383, 20858599; Phenotypes: Mitochondrial disease MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6275 | FOXG1 | Bryony Thompson Mode of inheritance for gene: FOXG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6274 | FOXG1 | Bryony Thompson reviewed gene: FOXG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571142, 19578037, 19564653, 28661489; Phenotypes: FOXG1 disorder MONDO:0100040; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6272 | FKTN | Bryony Thompson Mode of inheritance for gene: FKTN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6271 | FKTN | Bryony Thompson reviewed gene: FKTN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301385; Phenotypes: Myopathy caused by variation in FKTN MONDO:0700067; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6268 | FKRP | Bryony Thompson Mode of inheritance for gene: FKRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6267 | FKRP | Bryony Thompson reviewed gene: FKRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 33200426, 11053680, 12654965, 14652796, 15121789; Phenotypes: myopathy caused by variation in FKRP MONDO:0700066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6265 | FIG4 | Bryony Thompson Mode of inheritance for gene: FIG4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6264 | FIG4 | Bryony Thompson reviewed gene: FIG4: Rating: GREEN; Mode of pathogenicity: None; Publications: 32385905, 34122524, 36529678; Phenotypes: Charcot-Marie-Tooth disease MONDO:0015626; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6262 | FBXL4 | Bryony Thompson reviewed gene: FBXL4: Rating: GREEN; Mode of pathogenicity: None; Publications: 28383868; Phenotypes: Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6262 | FBXL4 | Bryony Thompson Mode of inheritance for gene: FBXL4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6261 | FAT4 | Bryony Thompson Phenotypes for gene: FAT4 were changed from to Hennekam syndrome MONDO:0016256; van Maldergem syndrome MONDO:0017813 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6259 | FAT4 | Bryony Thompson Mode of inheritance for gene: FAT4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6258 | FAT4 | Bryony Thompson reviewed gene: FAT4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29681106; Phenotypes: Hennekam syndrome MONDO:0016256, van Maldergem syndrome MONDO:0017813; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6256 | FAM20C | Bryony Thompson Mode of inheritance for gene: FAM20C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6255 | FAM20C | Bryony Thompson reviewed gene: FAM20C: Rating: GREEN; Mode of pathogenicity: None; Publications: 34360805; Phenotypes: lethal osteosclerotic bone dysplasia MONDO:0009821; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6253 | FAM126A | Bryony Thompson Mode of inheritance for gene: FAM126A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6252 | FAM126A | Bryony Thompson reviewed gene: FAM126A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301737; Phenotypes: hypomyelinating leukodystrophy 5 MONDO:0012514; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6250 | ESCO2 | Bryony Thompson Mode of inheritance for gene: ESCO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6249 | ESCO2 | Bryony Thompson reviewed gene: ESCO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301332; Phenotypes: Roberts-SC phocomelia syndrome MONDO:0100253; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6249 | INPP5K | Sangavi Sivagnanasundram reviewed gene: INPP5K: Rating: GREEN; Mode of pathogenicity: None; Publications: 28190456, 28190459; Phenotypes: congenital muscular dystrophy with cataracts and intellectual disability MONDO:0024607; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6249 | IKBKG | Sangavi Sivagnanasundram reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301645; Phenotypes: Incontinentia pigmenti MONDO:0010631; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6249 | RAF1 | chirag patel reviewed gene: RAF1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 17603483, 17603482, 31145547, 31030682, 29271604; Phenotypes: Noonan syndrome 5, MIM# 611553; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6249 | RIT1 | chirag patel reviewed gene: RIT1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 23791108, 25124994, 24939608, 27101134; Phenotypes: Noonan syndrome 8, MIM# 615355; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6248 | PTPN11 | chirag patel reviewed gene: PTPN11: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 11992261,21533187, 24935154; Phenotypes: LEOPARD syndrome 1, 151100 AD (for reporting use Noonan syndrome with multiple lentigines), Metachondromatosis, 156250 AD, Noonan syndrome 1, 163950 AD, Leukemia, juvenile myelomonocytic, somatic, 607785; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6248 | KRAS | chirag patel reviewed gene: KRAS: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 21797849, 16474404, 16474405, 16773572, 17056636; Phenotypes: Noonan syndrome 3, MIM# 609942, Cardiofaciocutaneous syndrome 2, MIM# 615278; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6248 | NRAS | chirag patel reviewed gene: NRAS: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 19966803, 26467218, 28594414; Phenotypes: Noonan syndrome 6, MIM# 613224; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6248 | NPHP1 | chirag patel reviewed gene: NPHP1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15138899, 32139166, 28347285, 8852662, 9856524; Phenotypes: Joubert syndrome 4, MIM# 609583, Nephronophthisis 1, juvenile, MIM# 256100, Senior-Loken syndrome-1, MIM# 266900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6248 | OTX2 | chirag patel reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24167467, 25589041, 31969185,; Phenotypes: Microphthalmia, syndromic 5, MIM# 610125, Pituitary hormone deficiency, combined, 6, MIM# 613986, Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125, Otocephaly-dysgnathia complex; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6248 | OPA3 | chirag patel reviewed gene: OPA3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25159689, 31119193, 31928268; Phenotypes: 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR, Optic atrophy 3 with cataract (MIM#165300), AD; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6248 | OCLN | chirag patel reviewed gene: OCLN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20727516, 32240828, 29192239, 28386946; Phenotypes: Pseudo-TORCH syndrome 1, MIM#251290; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6246 | ERCC8 | Bryony Thompson Mode of inheritance for gene: ERCC8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6245 | ERCC8 | Bryony Thompson reviewed gene: ERCC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301516; Phenotypes: Cockayne syndrome type 1 MONDO:0019569; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6243 | ERCC6L2 | Bryony Thompson Mode of inheritance for gene: ERCC6L2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6242 | ERCC6L2 | Bryony Thompson reviewed gene: ERCC6L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36790458; Phenotypes: pancytopenia-developmental delay syndrome MONDO:0014317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6240 | ERCC6 | Bryony Thompson Mode of inheritance for gene: ERCC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6237 | ERCC3 | Bryony Thompson Mode of inheritance for gene: ERCC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6233 | ERCC2 | Bryony Thompson Mode of inheritance for gene: ERCC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6229 | EP300 | Bryony Thompson Mode of inheritance for gene: EP300 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6226 | ELOVL4 | Bryony Thompson Mode of inheritance for gene: ELOVL4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6225 | EIF2AK3 | Bryony Thompson Mode of inheritance for gene: EIF2AK3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | DIAPH1 | Bryony Thompson reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39076976, 24781755, 26463574, 33662367; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | ERCC6L2 | Ken Lee Wan reviewed gene: ERCC6L2: Rating: AMBER; Mode of pathogenicity: None; Publications: 24507776, 27185855, 28815563, 29633571; Phenotypes: pancytopenia-developmental delay syndrome MONDO:0014317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | ERCC3 | Ken Lee Wan reviewed gene: ERCC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301571; Phenotypes: xeroderma pigmentosum group B MONDO:0012531; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | ERCC2 | Ken Lee Wan reviewed gene: ERCC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301571; Phenotypes: xeroderma pigmentosum group D MONDO:0010212, trichothiodystrophy 1, photosensitive MONDO:0011125, cerebrooculofacioskeletal syndrome 2 MONDO:0012553; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | EP300 |
Ken Lee Wan changed review comment from: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature, and intellectual disability (https://search.clinicalgenome.org/CCID:004751). Mechanism of disease: loss of function; to: EP300 is definitively associated with autosomal dominant Rubinstein-Taybi syndrome. Rubinstein-Taybi syndrome is characterized by distinctive facial features, broad and angulated thumbs and halluces, short stature and intellectual disability (https://search.clinicalgenome.org/CCID:004751). Mechanism of disease: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | EP300 | Ken Lee Wan reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Rubinstein-Taybi syndrome MONDO:0019188; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | ELOVL4 | Ken Lee Wan reviewed gene: ELOVL4: Rating: GREEN; Mode of pathogenicity: None; Publications: 37592902; Phenotypes: congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | IFT172 | Sangavi Sivagnanasundram reviewed gene: IFT172: Rating: AMBER; Mode of pathogenicity: None; Publications: 24290075, 26763875; Phenotypes: Bardet-Biedl syndrome MONDO:0015229; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | IFIH1 | Sangavi Sivagnanasundram reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 20301648, 25620204; Phenotypes: IFIH1-related type 1 interferonopathy MONDO:0700262; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | ERCC6 | Mark Cleghorn reviewed gene: ERCC6: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301516; Phenotypes: Cockayne syndrome type B, Cerebrooculofacioskeletal syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | IDUA | Sangavi Sivagnanasundram reviewed gene: IDUA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301341; Phenotypes: mucopolysaccharidosis type 1 MONDO:0001586; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | IDH2 | Sangavi Sivagnanasundram reviewed gene: IDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20847235, 35359529; Phenotypes: mitochondrial disease MONDO:0044970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HTRA2 | Sangavi Sivagnanasundram reviewed gene: HTRA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27208207, 27696117, 30114719, 32445293; Phenotypes: 3-methylglutaconic aciduria type 8 MONDO:0044723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HSPD1 | Sangavi Sivagnanasundram reviewed gene: HSPD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 18571143, 27405012; Phenotypes: Leukodystrophy, hypomyelinating, 4, MIM #612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HSD17B10 | Sangavi Sivagnanasundram reviewed gene: HSD17B10: Rating: GREEN; Mode of pathogenicity: None; Publications: 22132097, 17618155; Phenotypes: HSD10 mitochondrial disease MONDO:0010327; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HPD | Sangavi Sivagnanasundram reviewed gene: HPD: Rating: AMBER; Mode of pathogenicity: None; Publications: 31537781; Phenotypes: tyrosinemia type III MONDO:0010162; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HMGCL | Sangavi Sivagnanasundram reviewed gene: HMGCL: Rating: AMBER; Mode of pathogenicity: None; Publications: 36771238, 35646072; Phenotypes: 3-hydroxy-3-methylglutaric aciduria MONDO:0009520; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HLCS | Sangavi Sivagnanasundram reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: 18974016, 18429047, 12124727; Phenotypes: holocarboxylase synthetase deficiency MONDO:0009666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HIBCH | Sangavi Sivagnanasundram reviewed gene: HIBCH: Rating: GREEN; Mode of pathogenicity: None; Publications: 24299452, 30847210, 17160907, 26163321, 26026795, 31523596, 32022391, 24299452, 32677093; Phenotypes: 3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603, Leigh syndrome MONDO:0009723; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HEXB | Sangavi Sivagnanasundram reviewed gene: HEXB: Rating: GREEN; Mode of pathogenicity: None; Publications: 35420740; Phenotypes: Sandhoff disease MONDO:0010006; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HEXA | Sangavi Sivagnanasundram reviewed gene: HEXA: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301397; Phenotypes: Tay-Sachs disease MONDO:0010100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HESX1 | Sangavi Sivagnanasundram reviewed gene: HESX1: Rating: AMBER; Mode of pathogenicity: None; Publications: 19623216, 30888394; Phenotypes: septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HEPACAM | Sangavi Sivagnanasundram reviewed gene: HEPACAM: Rating: GREEN; Mode of pathogenicity: None; Publications: 21419380, 24202401, 27389245, 31372844, 21419380, 24202401, 27322623; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts 2A MONDO:0013490, Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without intellectual disability MONDO:0013491; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HCCS | Sangavi Sivagnanasundram reviewed gene: HCCS: Rating: AMBER; Mode of pathogenicity: None; Publications: 18950397; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | HADHA | Sangavi Sivagnanasundram reviewed gene: HADHA: Rating: AMBER; Mode of pathogenicity: None; Publications: 36063482; Phenotypes: long chain 3-hydroxyacyl-CoA dehydrogenase deficiency MONDO:0012173; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | GTF2H5 | Sangavi Sivagnanasundram reviewed gene: GTF2H5: Rating: AMBER; Mode of pathogenicity: None; Publications: 30359777, 24986372; Phenotypes: Trichothiodystrophy 3, photosensitive MIM#616395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | GRM1 | Sangavi Sivagnanasundram reviewed gene: GRM1: Rating: AMBER; Mode of pathogenicity: None; Publications: 26308914, 22901947, 31319223, 36675067; Phenotypes: autosomal recessive spinocerebellar ataxia 13 MONDO:0013905; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | GNS | Sangavi Sivagnanasundram reviewed gene: GNS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31536183, 25851924, 17998446, 6450420; Phenotypes: mucopolysaccharidosis type 3D MONDO:0009658; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | GNPTAB | Sangavi Sivagnanasundram reviewed gene: GNPTAB: Rating: ; Mode of pathogenicity: None; Publications: 20301728; Phenotypes: GNPTAB-mucolipidosis MONDO:0100122; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | GNPAT | Sangavi Sivagnanasundram reviewed gene: GNPAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843043, 19270340, 21990100; Phenotypes: glyceronephosphate O-acyltransferase deficiency MONDO:0100273; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | GMPPB | Sangavi Sivagnanasundram reviewed gene: GMPPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 23768512, 26133662, 27147698; Phenotypes: myopathy caused by variation in GMPPB MONDO:0700084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | GMPPA | Sangavi Sivagnanasundram reviewed gene: GMPPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 31898852, 35607266; Phenotypes: alacrima, achalasia, and intellectual disability syndrome MONDO:0014219; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6222 | GM2A | Sangavi Sivagnanasundram reviewed gene: GM2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 33819415, 20301397; Phenotypes: Tay-Sachs disease AB variant MONDO:0010099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6220 | DIAPH1 | Zornitza Stark Mode of inheritance for gene: DIAPH1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6219 | DIAPH1 | Zornitza Stark reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6219 | EIF2AK3 | Ken Lee Wan reviewed gene: EIF2AK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20202148; Phenotypes: Wolcott-Rallison syndrome MONDO:0009192; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6218 | DYNC1H1 | Zornitza Stark Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6217 | DYNC1H1 |
Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism. Mechanism of disease: gain of function (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6215 | DIAPH1 |
Ken Lee Wan changed review comment from: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development, and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632). Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).; to: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632). Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6215 | DIS3L2 | Zornitza Stark Mode of inheritance for gene: DIS3L2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6214 | DNMT3B |
Ken Lee Wan changed review comment from: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692). Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860). Mechanism of disease: loss of function; to: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692). Immunodeficiency, centromeric instability and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9 and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860). Mechanism of disease: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6214 | DYNC1H1 |
Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT) and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6214 | DYNC1H1 |
Ken Lee Wan changed review comment from: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM#600112); to: DYNC1H1 is definitively associated with autosomal dominant dyneinopathy. A spectrum of diseases related to monoallelic variants in DYNC1H1 and characterized by variable neuromuscular and/or neurodevelopmental presentations. DYNC1H1 have been reported with a predominantly neuromuscular presentation, including congenital myopathy, spinal muscular atrophy, Charcot-Marie-Tooth (CMT), and less frequently, intellectual disability and autism. (https://search.clinicalgenome.org/CCID:004713) (http://purl.obolibrary.org/obo/MONDO_1040031) (OMIM: 600112) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6214 | DYNC1H1 | Ken Lee Wan reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: dyneinopathy MONDO:1040031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6214 | DIS3L2 | Zornitza Stark Mode of inheritance for gene: DIS3L2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6211 | DNAJC19 | Zornitza Stark Mode of inheritance for gene: DNAJC19 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6210 | DNAJC19 | Zornitza Stark Mode of inheritance for gene: DNAJC19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6209 | DNMT3B | Zornitza Stark Phenotypes for gene: DNMT3B were changed from to immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6208 | DNMT3B | Zornitza Stark Mode of inheritance for gene: DNMT3B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6207 | DNMT3B | Ken Lee Wan reviewed gene: DNMT3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6207 | DNAJC19 | Ken Lee Wan reviewed gene: DNAJC19: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria type 5 MONDO:0012435; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6207 | DIS3L2 |
Ken Lee Wan changed review comment from: Perlman syndrome is a well-established gene-disease association with autosomal recessive Perlman syndrome (https://search.clinicalgenome.org/CCID:004649) Perlman syndrome (PRLMNS) is an autosomal recessive congenital overgrowth syndrome with similarities to Beckwith-Wiedemann syndrome (BWS; 130650). Affected children are large at birth, are hypotonic and show organomegaly, characteristic facial dysmorphisms, renal anomalies, frequent neurodevelopmental delay and high neonatal mortality. Perlman syndrome is associated with a high risk of Wilms tumour (OMIM: 267000). PMID 16278893: 6 out of 22 patients have developmental delay PMID 22306653: 5 surviving patients with at least one loss-of-function variant identified have developmental delay. PMID 28328139: 1 surviving patient with compound heterozygous (splice site and missense variants) has developmental delay Mechanism of disease causation: loss of function; to: DIS3L2 is a well-established gene-disease association with autosomal recessive Perlman syndrome (https://search.clinicalgenome.org/CCID:004649) Perlman syndrome (PRLMNS) is an autosomal recessive congenital overgrowth syndrome with similarities to Beckwith-Wiedemann syndrome (BWS; 130650). Affected children are large at birth, are hypotonic and show organomegaly, characteristic facial dysmorphisms, renal anomalies, frequent neurodevelopmental delay and high neonatal mortality. Perlman syndrome is associated with a high risk of Wilms tumour (OMIM: 267000). PMID 16278893: 6 out of 22 patients have developmental delay PMID 22306653: 5 surviving patients with at least one loss-of-function variant identified have developmental delay. PMID 28328139: 1 surviving patient with compound heterozygous (splice site and missense variants) has developmental delay Mechanism of disease causation: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6207 | DIS3L2 | Ken Lee Wan reviewed gene: DIS3L2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16278893, 22306653, 28328139; Phenotypes: Perlman syndrome MONDO:0009965; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6207 | DIAPH1 | Ken Lee Wan reviewed gene: DIAPH1: Rating: AMBER; Mode of pathogenicity: None; Publications: 24781755, 26463574; Phenotypes: progressive microcephaly-seizures-cortical blindness-developmental delay syndrome MONDO:0014714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6206 | RBSN | Zornitza Stark reviewed gene: RBSN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kariminejad-Reversade neurodevelopmental syndrome, MIM# 620937; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6205 | RNU2-2P |
Zornitza Stark gene: RNU2-2P was added gene: RNU2-2P was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU2-2P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 Phenotypes for gene: RNU2-2P were set to Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related Review for gene: RNU2-2P was set to GREEN Added comment: 15 individuals reported with de novo, recurrent variants in this gene at nucleotide positions 4 and 35. The disorder is characterized by intellectual disability, neurodevelopmental delay, autistic behavior, microcephaly, hypotonia, epilepsy and hyperventilation. All cases display a severe and complex seizure phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6197 | MRAS | Krithika Murali Mode of inheritance for gene: MRAS was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6196 | MRAS |
Krithika Murali gene: MRAS was added gene: MRAS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MRAS were set to Noonan syndrome 11 - MIM#618499 Review for gene: MRAS was set to GREEN Added comment: Developmental delay is a phenotypic feature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6195 | CEP76 |
Mark Cleghorn gene: CEP76 was added gene: CEP76 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038; Joubert syndrome; Bardet-Biedl syndrome; retinitis pigmentosa Penetrance for gene: CEP76 were set to unknown Review for gene: CEP76 was set to GREEN Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago ESHG presentation 4/6/24, unpublished CEP76 associated with syndromic ciliopathy CEP76 localizes to centrioles and basal body primary cilia Role in normal centriolar duplication Index case Bardet Biedl syndrome Compound heterozygous pLoF variants in CEP76 Via Gene matcher 7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum: Obesity Ocular phenotype Structural brain anomalies Renal? 3/7 families clinical Dx Joubert syndrome 1/7 BBS 1/7 GDD/ID NOS 2/7 retinitis pigmentosa (1 of these with learning difficulties) Mixture of biallelic pLOF and missense variant CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6195 | EIF3I |
Mark Cleghorn gene: EIF3I was added gene: EIF3I was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: EIF3I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EIF3I were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: EIF3I were set to unknown Review for gene: EIF3I was set to AMBER Added comment: Marcello Scala, Genoa ESHG presentation 4/6/24, unpublished De novo EIF3I missense variants as a cause for novel NDD syndrome EIF3 complex involved in regulating initiation of mRNA translation Negative regulator of the TGF beta pathway 8 individuals from 8 families Mod/severe GDD or ID Short stature Midline brain anomalies (hypoplasia/agenesis of corpus callosum and pituitary hypoplasia) Frontal bossing, hypertelorism, long philtrum All w rare de novo missense variants om EIF3I, clustering within highly conserved WD repeats Functional studies Transfected HEK293 cell studies suggested EIF3I protein from variant alleles (from patients above) had disrupted interaction with other EIF subunits, and cells had reduced protein synthesis overall No animal models Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6192 | DDHD2 | Bryony Thompson Mode of inheritance for gene: DDHD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6191 | DDHD2 | Bryony Thompson reviewed gene: DDHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23486545, 23176823, 36090575, 26113134, 25417924; Phenotypes: hereditary spastic paraplegia 54 MONDO:0014018; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6190 | DDC | Bryony Thompson Mode of inheritance for gene: DDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6189 | DDC | Bryony Thompson reviewed gene: DDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 37824694; Phenotypes: Aromatic L-amino acid decarboxylase deficiency MONDO:0012084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6189 | FKBP4 |
Mark Cleghorn gene: FKBP4 was added gene: FKBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: FKBP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FKBP4 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: FKBP4 were set to unknown Review for gene: FKBP4 was set to AMBER Added comment: Rebecca Yarwood, University of Manchester ESHG presentation 4/6/24, unpublished Bilalleic FKBP4 w NDD + DSD Protein has functions in hormone receptor trafficking FKPB4 highly expressed in stem cell and progenitor cells in gonad and neuronal degeneration Index case Severe GDD abN external genitalia CV AbN FBBP4 p.E196* Via GeneMatcher 7 families (12 individuals) 12/12 severe GDD/ID 9/10 microcephaly 11/12 external genital abnormalities (details not provided) All w homozygous pLoF variants (mixture of canonical splice, frameshift, nonsense) Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | MED16 |
Mark Cleghorn gene: MED16 was added gene: MED16 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED16 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: MED16 were set to unknown Review for gene: MED16 was set to GREEN Added comment: MED16 Charlotte Guillouet, Imagine institute Paris ESHG presentation 4/6/24, unpublished MED16 is part of tail of ‘mediator complex’ Plays a role in enhancer/promotor regions Disruptive variants in other genes encoding proteins within this mediator complex (MED11/12/12/17/20, CDK8) are assoc w neurodevelopmental/neurodegenerative disorders Cases index family Sibs (M/F) to consanguineous parents w NDD/mod ID, tetralogy of Fallot or VSD, bilat deafness, micrognathia, malar hypoplasia, dental AbN, pre auricular tags, hypoplastic nails, brachydactly WES: biallelic MED16 p.Asp217Asn Via genematcher 16 families total, 22 individuals, homozygous or compound het rare MED16 variants Mixture of pLoF and missense variants Motor delay in 16/17 DD or ID in 17/17 Speech delay in 15/15 6/19 ToF 7/19 other septal/aortic defects 6/18 deafness 11/18 microretognathia 6/17 cleft palate 8/19 preauricular tags 9/20 puffy eyelids 12/20 nasal dysplasia (most commonly short columella w bulbous nasal tip) 7/20 corpus callosum anomalies Not clear that functional work recapitulated phenotype as yet? Immunofluroescence on HeLa cells transfected with variants observed ?conclusion MED16 knockout mouse > growth delay, pre weaning lethality MED16 knockout zebrafish > reduced body length, early death, no obvious craniofacial phenotype Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | LARS2 | chirag patel reviewed gene: LARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29205794, 32423379, 30737337, 26537577, 23541342; Phenotypes: Perrault syndrome 4, MIM# 615300, Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | LARGE1 | chirag patel reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 12966029, 19067344, 17436019, 21248746, 19299310; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | LAMP2 | chirag patel reviewed gene: LAMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 10972294; Phenotypes: Danon disease, MIM# 300257, MONDO:0010281; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | PARN | chirag patel reviewed gene: PARN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25893599, 26342108; Phenotypes: Dyskeratosis congenita, autosomal recessive 6, MIM# 616353; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | PAX6 | chirag patel reviewed gene: PAX6: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 26130484, 31700164; Phenotypes: Microphthalmia/coloboma 12, OMIM #120200; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | PAX8 | chirag patel reviewed gene: PAX8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33272083, 9590296 11232006 15356023 15718293; Phenotypes: Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | PC | chirag patel reviewed gene: PC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 9585612, 12112657; Phenotypes: Pyruvate carboxylase deficiency - MIM#266150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6186 | SLC6A3 | Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6185 | SLC6A3 | Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6183 | SRD5A3 | Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6182 | SRD5A3 | Zornitza Stark reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323; Phenotypes: Congenital disorder of glycosylation, type Iq, MIM#612379, Kahrizi syndrome, MIM# 612713; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6180 | SLC6A8 | Zornitza Stark Mode of inheritance for gene: SLC6A8 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6179 | SLC6A8 | Zornitza Stark reviewed gene: SLC6A8: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 16738945; Phenotypes: Cerebral creatine deficiency syndrome 1, MIM# 300352; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6179 | SPTBN2 | Zornitza Stark Mode of inheritance for gene: SPTBN2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6178 | SPTBN2 | Zornitza Stark reviewed gene: SPTBN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23236289, 23838597, 22781464, 31617442, 31066025; Phenotypes: Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386, Spinocerebellar ataxia 5, MIM# 600224; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6178 | ST3GAL3 | Zornitza Stark Phenotypes for gene: ST3GAL3 were changed from to Intellectual disability, autosomal recessive 12 MIM# 611090 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6176 | ST3GAL3 | Zornitza Stark Mode of inheritance for gene: ST3GAL3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6175 | ST3GAL3 | Zornitza Stark reviewed gene: ST3GAL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23252400, 21907012, 31584066, 37938134; Phenotypes: Intellectual disability, autosomal recessive 12 MIM# 611090; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6175 | SUCLG1 | Zornitza Stark Phenotypes for gene: SUCLG1 were changed from Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6174 | SUCLG1 | Zornitza Stark Phenotypes for gene: SUCLG1 were changed from to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6172 | SUCLG1 | Zornitza Stark Mode of inheritance for gene: SUCLG1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6171 | SUCLG1 | Zornitza Stark Mode of inheritance for gene: SUCLG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6170 | SUCLG1 | Zornitza Stark reviewed gene: SUCLG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33230783, 28358460; Phenotypes: Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6168 | SURF1 | Zornitza Stark Mode of inheritance for gene: SURF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6167 | SURF1 | Zornitza Stark reviewed gene: SURF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843204, 9837813; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 1, MIM# 220110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6167 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6164 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6163 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6160 | TSEN2 | Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6159 | TSEN2 | Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6158 | TSEN2 | Zornitza Stark reviewed gene: TSEN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23562994, 20952379; Phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6156 | TTC19 | Zornitza Stark Mode of inheritance for gene: TTC19 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6155 | TTC19 |
Zornitza Stark changed review comment from: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances. At least 4 unrelated families reported.; to: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances. Included due to phenotypic overlap. At least 4 unrelated families reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6155 | TTC19 | Zornitza Stark reviewed gene: TTC19: Rating: GREEN; Mode of pathogenicity: None; Publications: 21278747, 23532514, 24368687, 24397319; Phenotypes: Mitochondrial complex III deficiency, nuclear type 2, MIM#615157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6154 | TUBA1A | Zornitza Stark Mode of inheritance for gene: TUBA1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6153 | TUBA1A | Zornitza Stark reviewed gene: TUBA1A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lissencephaly 3, MIM# 611603; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6152 | ZNRF3 |
Bryony Thompson gene: ZNRF3 was added gene: ZNRF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNRF3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNRF3 were set to 39168120 Phenotypes for gene: ZNRF3 were set to Complex neurodevelopmental disorder MONDO:0100038 Review for gene: ZNRF3 was set to GREEN Added comment: 12 individuals with ZNRF3 variants and various phenotypes. 8 individuals with de novo missense and neurodevelopment disorders (NDD), including cluster of variants in the RING ligase domain with macrocephalic NDD. Plus 4 individuals from 3 families with de novo truncating or de novo/inherited large in-frame deletion variants with non-NDD phenotypes, including heart, adrenal, or nephrotic problems. Overall, 4 individuals had congenital heart defects and 2 had microcephaly. Also, supporting in vitro functional assays. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6149 | DHTKD1 | Zornitza Stark Mode of inheritance for gene: DHTKD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6144 | DCX | Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6141 | DARS2 | Zornitza Stark Mode of inheritance for gene: DARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6138 | D2HGDH | Zornitza Stark Mode of inheritance for gene: D2HGDH was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6137 | D2HGDH | Zornitza Stark Mode of inheritance for gene: D2HGDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6134 | GPN2 |
Mark Cleghorn gene: GPN2 was added gene: GPN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: GPN2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPN2 were set to complex neurodevelopmental disorder MONDO:0100038; Perrault syndrome Review for gene: GPN2 was set to AMBER Added comment: GPN2 ESHG talk 2/6/24, unpublished Thomas Smith, University of Manchester Biallelic GPN2 proposed to cause Perrault syndrome (SNHL, ovarian dysfunction, NDD) RNA polymerase assembly factor 4 families (14 affected individuals) w biallalic GPN2 rare missense variants Segregated w phenotype Fam 2 and 3 may be distantly related (leaving 3 distinct kindreds) Clinical features 13/14 SNHL 3/4 families all females of adolescent age or older had primary ovarian insufficiency 4/4 GDD, ataxia (no data on family w 10 affected indiv.) Some functional work, not conclusive Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6134 | ATP6V1C1 |
Zornitza Stark gene: ATP6V1C1 was added gene: ATP6V1C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP6V1C1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V1C1 were set to 39210597 Phenotypes for gene: ATP6V1C1 were set to neurodevelopmental disorder MONDO:0700092, ATP6V1C1-related Review for gene: ATP6V1C1 was set to RED Added comment: 1x de novo missense p.Glu289Lys (absent in v4 gnomad). Manual inspection of IGV found the dad was mosaic 7% VAF and he shared some of the clinical features (minor digit anomalies). Some functional studies using patient fibroblasts were performed, demonstrating similar effects as known pathogenic variants in ATP6V1B2. - lysosomal morphology - autophagic flux dysregulation - increased acidification of lysosome borderline red/amber Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6127 | RFC4 |
chirag patel gene: RFC4 was added gene: RFC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RFC4 were set to PMID: 39106866 Phenotypes for gene: RFC4 were set to RFC4-related multisystem disorder Review for gene: RFC4 was set to GREEN gene: RFC4 was marked as current diagnostic Added comment: 9 affected individuals (aged birth to 47yrs) from 8 unrelated families with a multisystem disorder. Clinical features included: muscle weakness/myopathy (9/9), motor incoordination/gait disturbance (8/8), delayed gross motor development (6/9), dysarthria (5/5), peripheral neuropathy (3/3 adults), bilateral sensorineural hearing impairment (6/9), decreased body weight (8/9), short stature (5/9), microcephaly (4/9), respiratory issues/insufficiency (6/9), cerebellar atrophy (4/9), pituitary hypoplasia (3/9). WES or WGS identified biallelic loss-of-function variants in RFC4 (3 frameshift, 2 splice site, 1 single AA duplication, 2 single AA deletions, 2 missense), and almost all are likely to disrupt the C-terminal domain indispensable for Replication factor C (RFC) complex formation. All variants segregated with the disease. The RFC complex (with 5 subunits) is central to process of regulation of DNA replication, and it loads proliferating cell nuclear antigen onto DNA to facilitate the recruitment of replication and repair proteins and enhance DNA polymerase processivity. RFC1 is associated with CANVAS but the contributions of RFC2-5 subunits on human Mendelian disorders is unknown. Analysis of a previously determined cryo-EM structure of RFC bound to proliferating cell nuclear antigen suggested that the variants disrupt interactions within RFC4 and/or destabilize the RFC complex. Cellular studies using RFC4-deficient HeLa cells and primary fibroblasts demonstrated decreased RFC4 protein, compromised stability of the other RFC complex subunits, and perturbed RFC complex formation. Additionally, functional studies of the RFC4 variants affirmed diminished RFC complex formation, and cell cycle studies suggested perturbation of DNA replication and cell cycle progression. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6126 | LARP1 |
Sangavi Sivagnanasundram gene: LARP1 was added gene: LARP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: LARP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LARP1 were set to 39182167 Phenotypes for gene: LARP1 were set to Neurodevelopmental disorder; MONDO:0700092 Review for gene: LARP1 was set to GREEN Added comment: Seven unrelated probands (6 males and 1 female) with ASD or another variable NDD phenotype (ID, hypotonia, motor delay and/or ASD). Variants were showed to be de novo null variants or missense variants that resulted in haploinsufficiency. Ex vivo (knockout CRISPR-Cas9) functional assay using lymphoblasts that was collected and immortilised from one proband was conducted to assess the functional impact of the LARP1 variant. The results showed a reduction in protein compared to WT causing reduced rates of aerobic respiration and glycolysis Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6124 | PNPLA8 |
chirag patel gene: PNPLA8 was added gene: PNPLA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PNPLA8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PNPLA8 were set to PMID: 39082157 Phenotypes for gene: PNPLA8 were set to PNPLA8-related neurological diseases Review for gene: PNPLA8 was set to GREEN gene: PNPLA8 was marked as current diagnostic Added comment: Cohort analysis of clinical features of new and previously reported individuals with biallelic PNPLA8 variants (25 affected individuals across 20 families). They showed that PNPLA8-related neurological diseases manifest as a continuum ranging from variable developmental and/or degenerative epileptic-dyskinetic encephalopathy to childhood-onset neurodegeneration. Complete loss of PNPLA8 was associated with the more profound end of the spectrum. 13/19 individuals (info available) had developmental delay and/or severe intellectual disability. Using cerebral organoids generated from human induced pluripotent stem cells, they found that loss of PNPLA8 led to developmental defects by reducing the number of basal radial glial cells and upper-layer neurons. Neural progenitor cells lacking PNPLA8 showed a reduced amount of lysophosphatidic acid, lysophosphatidylethanolamine and phosphatidic acid. They show that PNPLA8 is crucial to meet phospholipid synthetic needs and to produce abundant basal radial glial cells in human brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | MED22 |
Mark Cleghorn gene: MED22 was added gene: MED22 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MED22 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED22 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: MED22 were set to unknown Review for gene: MED22 was set to AMBER Added comment: ESHG talk 2/6/24, unpublished Elisa Cali, UCL Recurrent homozygous MED22:c.397_399del (p.Glu133del) inframe variant in 8 individuals from 6 families w progressive NDD, microcepahly, cerebellar atrophy, dystonia, seizures Rare in gnomad v4.1 (9 het alleles, no homozygotes) Functional work on patient fibroblasts: quantity of protein comparable to controls, did not mentioned assays of protein function (?mechanism proposed) Drosophilia heterozygous model with equivalent of p.Glu133del variant: structural anomalies, less movements, all died prior to pupae stage Zebrafish: MED22 mutants less mobile, died prior to adulthood, reduced brain size Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | BICRA | Mark Cleghorn reviewed gene: BICRA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Siris syndrome-12, MIM#619325; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | SF3B1 |
Mark Cleghorn gene: SF3B1 was added gene: SF3B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: SF3B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SF3B1 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: SF3B1 were set to unknown Review for gene: SF3B1 was set to AMBER Added comment: SF3B1 Delphine Bernard, University of Brest ESHG talk 2/6/24, unpublished De novo germline SF3B1 variants, proposed spliceosomopathy/NDD gene SF3B1 is an RNA binding protein that stabilizes the U2 snRNP complex at branchpoint sequences Somatic SF3B1 missense commonly occur in haematological malignancy (K700E recurrent) 25 patients with syndromic NDD + de novo heterozygous rare SF3B1 variants identified on WES, genematcher 13 missense (incl recurrent xxx and xxx) within HEAT domain 5 nonsense 4 splicing 1 frameshift Patients w missense variants may have more severe phenotype incl mircocepahly, palate anomalies, cerebral anomalies, GI/cardiac anomalies Cellular models of missense variants: erythroluekaemia K562, HEK293T Suggest missense variants do not cause loss of function, but increase exon skipping and alternative 3’ splice sites Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | C12orf66 |
Mark Cleghorn gene: C12orf66 was added gene: C12orf66 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: C12orf66 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: C12orf66 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: C12orf66 were set to unknown Review for gene: C12orf66 was set to AMBER Added comment: KICS2 (previously known as C12ORF66) Rebecca Buchert, Universitatklinikum Tubingen ESHG talk 2/6/24, unpublished Proposed ID + epilepsy gene 8 families w 11 affected individuals Phenotypes: 11/11 ID, 9/11 epilepsy, 3/11 hearing impairment 3/8 homozygous missense variants (p.Asp296Glu, p.Tyr393Cys, p.Tyr393Cys), all highly conserved 1/8 compound het PTC (p.Lys262*) with 1.1Mb deletion 4/8 homozygous PTC (p.Glu3*, p.Gly79Valfs*18, p.Gly79Valfs*18, p.Lys260Asnfs*18) Gene appears to be involved in mTOR pathway, and cilia function mTORC1 activity in CRISPR-HEK293T cells – reduced activity in cells w variants above Zebrafish model: otolith defects, ciliary dysfunction ?not clear if truly mimics phenotype observed in patient cohort described Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | REPS2 |
Mark Cleghorn gene: REPS2 was added gene: REPS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: REPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: REPS2 were set to complex neurodevelopmental disorder MONDO:0100038; Cerebral palsy HP:0100021 Penetrance for gene: REPS2 were set to unknown Review for gene: REPS2 was set to AMBER Added comment: REPS2 Hao Hu, Guangzhou Women and Children’s MC ESHG talk 1/6/24, unpublished Proposed X-linked cerebral palsy + NDD gene 4 unrelated males with predicted deleterious hemizygous REPS2 variants, 2 PTC, 2 missense. 2 de novo, 2 maternally inherited Phenotypes: 2 w CP + moderate ID/ASD, 2 w NDD NOS Variants described: c.1050_1052delGAA;p.K351del c.1040T>C; p.I347T c.962C>G; p.S321C c.1736delA; p.N579Tfs*17 In vitro assay of above 4 variants suggest reduced REPS2 protein stability Zebrafish model: REPS2 expressed in neuronal cells, REPS2 knock down have reduced motor activity and abN neuronal morphology Mouse model hemizygous w one of above variants (not specified): reduced performance in cognitive tasks, abnormal neuronal migration pattern on post mortem examination Mechanism may relate to dopamine signalling? Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | TTL |
Mark Cleghorn gene: TTL was added gene: TTL was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: TTL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTL were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: TTL was set to AMBER Added comment: TTL Valentina Serpieri, University of Pavia ESHG talk 1/6/24 FAM1 (Italy) 2 affected sisters born to consanguineous Pakistani parents GDD, spastic tetraparesis, optic atrophy, brain anomalies resembling tubulinopathies (dysplasia of corpus callosum, basal ganglia, brainstem) WES: homozygous TTL:c.1013G>A; p.Cys338Tyr in both affected sisters Via genematcher 5 more families (9 individuals) w similar phenotypes and biallelic variants in TTL FAM2 (Egypt): homozygous p.Arg46Pro FAM3 (Egypt): homozygous p.Arg46Pro FAM4 (Australia): homozygous p.Gln183Arg FAM5 (France): homozygous p.Trp147* FAM6 (Saudi Arabia): homozygous p.His243Tyr TTL KO mice: death soon after birth, no overt malformations, but defects in organisation of cerebral layers Functional work on patient fibroblasts FAM1 – reduced quantity of TTL protein compared to control on Western blot, decreased function of TTL protein (increase in detyrosinated tubulin) compared to controls – infer LoF as mechanism FAM3 – mentioned but no details FAM4– mentioned but no details Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | DHTKD1 | Sumudu Perera reviewed gene: DHTKD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 23141293, 37499576, 1112064, 6434826, 4442872, 4430147; Phenotypes: 2-aminoadipic 2-oxoadipic aciduria MIM#204750, Disorders of histidine, tryptophan or lysine metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | DARS2 | Sumudu Perera reviewed gene: DARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17384640, 21815884, 20506600; Phenotypes: Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | DCX |
Sumudu Perera changed review comment from: Pathology: PMID: 26743950 - DCX mutations usually cause anterior dominant lissencephaly in males and subcortical band heterotopia (SBH) in females Phenotype: Demelas et al. (2001) (PMID:11468322) demonstrated three brothers with phenotype of microcephaly, mild to moderate developmental delay, seizures and other neurologic abnormalities, as well as classic lissencephaly on MRI. Lawrence et al. (2010) (PMID: 20726879) discuss 3 male members had severe epilepsy and intellectual disability; finding of missense mutation in DCX. Of note all 3 had been diagnosed with Lennox-Gastaut syndrome. GeneReviews (PMID: 20301364): "Males with classic DCX-related lissencephaly typically have early and profound cognitive and language impairment, cerebral palsy, and epileptic seizures. The clinical phenotype in females with SBH varies widely with cognitive abilities that range from average or mild cognitive impairment to severe intellectual disability and language impairment." Other papers: 1) Somatic mosaicism and variable penetrance - PMID: 12552055 2) Functional testing: PMID: 9489699; to: Pathology: PMID: 26743950 - DCX mutations usually cause anterior dominant lissencephaly in males and subcortical band heterotopia (SBH) in females Phenotype: Demelas et al. (2001) (PMID:11468322) demonstrated three brothers with phenotype of microcephaly, mild to moderate developmental delay, seizures and other neurologic abnormalities, as well as classic lissencephaly on MRI. Lawrence et al. (2010) (PMID: 20726879) discuss 3 male members had severe epilepsy and intellectual disability; finding of missense mutation in DCX. Of note all 3 had been diagnosed with Lennox-Gastaut syndrome. GeneReviews (PMID: 20301364): "Males with classic DCX-related lissencephaly typically have early and profound cognitive and language impairment, cerebral palsy, and epileptic seizures. The clinical phenotype in females with SBH varies widely with cognitive abilities that range from average or mild cognitive impairment to severe intellectual disability and language impairment." Other papers: 1) Somatic mosaicism and variable penetrance - PMID: 12552055 2) Functional testing: PMID: 9489699 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | DCX | Sumudu Perera reviewed gene: DCX: Rating: ; Mode of pathogenicity: None; Publications: 26743950, 11468322, 20726879, 20301364, 12552055, 9489699; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | D2HGDH | Sumudu Perera reviewed gene: D2HGDH: Rating: GREEN; Mode of pathogenicity: None; Publications: 15609246, 16081310, 31349060, 20020533, 38825343; Phenotypes: D-2-hydroxyglutaric aciduria MIM#600721; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6123 | GTPBP1 | Zornitza Stark Phenotypes for gene: GTPBP1 were changed from Neurodevelopmental disorder (MONDO#0700092), GTPBP1-related to Neurodevelopmental disorder with characteristic facial and ectodermal features and tetraparesis 1, MIM# 620888 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6122 | GTPBP1 | Zornitza Stark reviewed gene: GTPBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with characteristic facial and ectodermal features and tetraparesis 1, MIM# 620888; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6122 | CSNK1G1 | Rylee Peters reviewed gene: CSNK1G1: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 33009664; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CSNK1G-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6121 | CSMD1 |
Krithika Murali gene: CSMD1 was added gene: CSMD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD1 were set to PMID 38816421 Phenotypes for gene: CSMD1 were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: CSMD1 was set to GREEN Added comment: PMID 38816421 Werren et al 2024 report 8 individuals from 6 families with biallelic missense CSMD1 variants identified through exome sequencing and subsequent gene-sharing efforts. Shared phenotypic features included: GDD, ID, microcephaly and polymicrogyria. Other features included dysmorphism, IUGR, hypotonia, arthrogryposis, seizures, opthalmological anomalies and other brain white matter anomalies Heterozygous parents were unaffected. Loss of function is the postulated mechanism based on experimental data involving early-stage forebrain organoids differentiated from CSMD1 knockout human embryonic stem cells. ClinGen haploinsufficiency score of 1, however, this curation was last reviewed in 2018. This gene is within the scope of review for the ClinGen Autisim and ID GCEP. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6120 | ZSCAN10 | Zornitza Stark reviewed gene: ZSCAN10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Otofacial neurodevelopmental syndrome, MIM# 620910; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6118 | COQ8A | Zornitza Stark Mode of inheritance for gene: COQ8A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6115 | CTDP1 | Zornitza Stark Mode of inheritance for gene: CTDP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6112 | CTSA | Zornitza Stark Mode of inheritance for gene: CTSA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6110 | CTSD | Zornitza Stark Mode of inheritance for gene: CTSD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6107 | CYB5R3 | Zornitza Stark Mode of inheritance for gene: CYB5R3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6104 | SOX9 | Zornitza Stark Mode of inheritance for gene: SOX9 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6102 | SOX9 | Zornitza Stark reviewed gene: SOX9: Rating: AMBER; Mode of pathogenicity: None; Publications: 21373255; Phenotypes: campomelic dysplasia MONDO:0007251; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6100 | GLS | Zornitza Stark Mode of inheritance for gene: GLS was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6099 | SOX9 | Ken Lee Wan reviewed gene: SOX9: Rating: RED; Mode of pathogenicity: None; Publications: 20301724, 26663529; Phenotypes: campomelic dysplasia MONDO:0007251; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6096 | CYB5R3 | Ken Lee Wan reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 38303731; Phenotypes: Methemoglobinemia MONDO:0001117; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6096 | CTSD | Ken Lee Wan reviewed gene: CTSD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neuronal ceroid lipofuscinosis MONDO:0016295; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6096 | CTSA | Ken Lee Wan reviewed gene: CTSA: Rating: GREEN; Mode of pathogenicity: None; Publications: 23915561, 36713078; Phenotypes: Galactosialidosis MONDO:0009737; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6096 | CTDP1 | Ken Lee Wan reviewed gene: CTDP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301787; Phenotypes: congenital cataracts-facial dysmorphism-neuropathy syndrome MONDO:0011402; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6093 | HDAC3 |
Zornitza Stark gene: HDAC3 was added gene: HDAC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HDAC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HDAC3 were set to 39047730 Review for gene: HDAC3 was set to GREEN Added comment: Six individuals with de novo missense variants in this gene and variable NDD phenotypes, including ID, seizures. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6092 | SLC39A14 | Zornitza Stark Mode of inheritance for gene: SLC39A14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6089 | COQ8A | Ken Lee Wan reviewed gene: COQ8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 31621627, 31741144; Phenotypes: coenzyme Q10 deficiency MONDO:0018151; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6089 | COL4A2 | Zornitza Stark Phenotypes for gene: COL4A2 were changed from Brain small vessel disease 2, MIM# 614483; familial porencephaly MONDO:0020496 to Brain small vessel disease 2, MIM# 614483; familial porencephaly MONDO:0020496 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6088 | COL4A2 | Zornitza Stark Phenotypes for gene: COL4A2 were changed from to Brain small vessel disease 2, MIM# 614483; familial porencephaly MONDO:0020496 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6086 | COL4A2 | Zornitza Stark Mode of inheritance for gene: COL4A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6082 | COQ4 | Zornitza Stark Mode of inheritance for gene: COQ4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6081 | COQ4 | Ken Lee Wan reviewed gene: COQ4: Rating: GREEN; Mode of pathogenicity: None; Publications: 34656997; Phenotypes: mitochondrial disease MONDO:0044970, neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6081 | COL4A2 | Ken Lee Wan reviewed gene: COL4A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36324412, 39016117; Phenotypes: familial porencephaly MONDO:0020496; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6080 | CLN8 | Zornitza Stark Mode of inheritance for gene: CLN8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6079 | CLN8 | Ken Lee Wan reviewed gene: CLN8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neuronal ceroid lipofuscinosis MONDO:0016295; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6078 | LEO1 |
Zornitza Stark gene: LEO1 was added gene: LEO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LEO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LEO1 were set to 38965372 Phenotypes for gene: LEO1 were set to neurodevelopmental disorder MONDO:0700092, LEO-1 related Review for gene: LEO1 was set to AMBER Added comment: cohort of individuals with delayed motor and speech development, ASD 8x de novo – 6x missense + 2x PTC 1x pat splice (father unaffected) 2x unknown_inh PTCs Of the missense variants, G370E has 8 hets in gnomad v4 This gene is not constraint for LoF with 4 hets with an NMD variant in gnomad v4 3 of the missense are said to lie within a region of missense constraint, however this isn't the case in v4 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6075 | CHD2 | Zornitza Stark reviewed gene: CHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 94, MIM# 615369; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6075 | CHD2 | Ken Lee Wan reviewed gene: CHD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26677509; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6073 | PCBP2 |
Ain Roesley gene: PCBP2 was added gene: PCBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PCBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PCBP2 were set to 38965372 Phenotypes for gene: PCBP2 were set to neurodevelopmental disorder MONDO:0700092, PCBP2-related Review for gene: PCBP2 was set to GREEN gene: PCBP2 was marked as current diagnostic Added comment: 3x individuals with de novo variants Motor and speech delay and ASD 2x missense + 1x fs There are 2 NMD variants with 9 and 8 hets respectively in gnomad v4, however the IGV looks to be low quality Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6068 | SRPK3 |
Zornitza Stark gene: SRPK3 was added gene: SRPK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRPK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SRPK3 were set to 38429495; 39073169 Phenotypes for gene: SRPK3 were set to Neurodevelopmental disorder, MONDO:0700092, SRPK3-related Review for gene: SRPK3 was set to GREEN Added comment: PMID 39073169: 9 individuals from 5 unrelated families reported with 4 missense and 1 putative truncating variant and a neurodevelopmental phenotype. The 8 patients ascertained postnatally shared common clinical features including intellectual disability, agenesis of the corpus callosum, abnormal eye movement, and ataxia. A ninth case, ascertained prenatally, had a complex structural brain phenotype. Supportive animal model data (mouse and zebrafish). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6066 | RBBP5 |
Ain Roesley gene: RBBP5 was added gene: RBBP5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RBBP5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RBBP5 were set to 39036895 Review for gene: RBBP5 was set to GREEN gene: RBBP5 was marked as current diagnostic Added comment: 5x Indivs (4x de novo) = 3x PTCs + 2x missense 4/5 dev delay/ID 2/5 short stature (<=-3 SD) + 2/5 <= -2 SD 1/5 microcephaly (<= -3 SD) + 3/5 <= -2 SD 2/5 SNHL 2/5 seizures 3/5 hypotonia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6064 | NDC1 |
Bryony Thompson gene: NDC1 was added gene: NDC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NDC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDC1 were set to 39003500; 19782045 Phenotypes for gene: NDC1 were set to triple-A syndrome MONDO:0009279 Review for gene: NDC1 was set to GREEN Added comment: 7 cases from 4 consanguineous families (3 different variants: 1 intronic variants that causes in-frame RNA splice impact, 2 missense) with a Triple-A-like syndrome (including ID and neuropathy). Supporting cellular localisation studies were conducted in patient cell lines with the splice variant. NDC1 is required to anchor ALADIN (encoded by AAAS, the gene that causes Triple-A syndrome) in the nuclear pore complex. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6063 | SLC39A14 | Kushani Jayasinghe reviewed gene: SLC39A14: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27231142, 29685658; Phenotypes: Hypermanganesemia with dystonia 2; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6062 | CRNKL1 |
Mark Cleghorn gene: CRNKL1 was added gene: CRNKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CRNKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CRNKL1 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: CRNKL1 were set to Complete Review for gene: CRNKL1 was set to GREEN Added comment: Unpublished, presented at ESHG June 2024 - Louise Bicknell, University of Otago NZ 8 unrelated families via gene matcher with rare, de novo, missense variants in CRNKL1 severe microcephaly (all, -8 to -11 SD) ID/epilepsy pontocerebellar hypoplasia (6/8) simplified gyration (8/8) 7 variants are missense at p.Arg267 residue 1 variant missense at p.Arg301 RNA-seq on patient fibroblasts - no alteration in gene expression Zebrafish homolog of Arg267 and Arg301 - mimics observed phenotype (reduced brain development), increased in embryo apoptosis RNQ seq on affected zebrafish embryos - transcriptome strongly disrupted Splicing analysis in progress CRKNL1 supports U6 structure in spliceosome Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6062 | B9D1 | Achchuthan Shanmugasundram reviewed gene: B9D1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 32622957; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6060 | FDXR | Zornitza Stark Phenotypes for gene: FDXR were changed from Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717 to Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6059 | FDXR | Zornitza Stark Phenotypes for gene: FDXR were changed from Auditory neuropathy and optic atrophy, MIM# 617717 to Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887; Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6057 | FDXR | Zornitza Stark edited their review of gene: FDXR: Added comment: Multiple reports of individuals with extra-ocular features, including ID and regression.; Changed rating: GREEN; Changed publications: 30250212, 29040572, 33348459, 37046037, 37481223; Changed phenotypes: Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887, Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6057 | RNU4-2 | Zornitza Stark Phenotypes for gene: RNU4-2 were changed from Neurodevelopmental disorder, MONDO:0700092, RNU4-2 related to Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6056 | RNU4-2 | Zornitza Stark edited their review of gene: RNU4-2: Changed phenotypes: Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6055 | SREBF2 |
Zornitza Stark gene: SREBF2 was added gene: SREBF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SREBF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SREBF2 were set to 38847193 Phenotypes for gene: SREBF2 were set to Neurocutaneous syndrome, MONDO:0042983, SREBF2-related Review for gene: SREBF2 was set to AMBER Added comment: Two individuals with de novo missense variants, presenting with neurological, cutaneous and skeletal features; supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6051 | PSMF1 |
Zornitza Stark gene: PSMF1 was added gene: PSMF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMF1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSMF1 were set to https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 Phenotypes for gene: PSMF1 were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related Review for gene: PSMF1 was set to GREEN Added comment: 22 individuals from 15 families reported with a range of neurological phenotypes ranging from early-onset Parkinson's disease; childhood conditions typified by ID and a range of movement disorders; through to perinatal lethal presentations with arthrogryposis multiplex. Genotype-phenotype correlation: biallelic missense variants resulted in the milder phenotypes, while bi-allelic LoF variants in the more severe phenotypes. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6050 | PSMC5 | Rylee Peters reviewed gene: PSMC5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38776958, 38293138; Phenotypes: Neurodevelopmental disorder (MONDO#0700092), PSMC5-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6049 | VPS50 | Ain Roesley reviewed gene: VPS50: Rating: GREEN; Mode of pathogenicity: None; Publications: 38876772; Phenotypes: Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis MIM#619685; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6048 | PSMD11 |
Bryony Thompson gene: PSMD11 was added gene: PSMD11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PSMD11 were set to 38866022; 30733659 Phenotypes for gene: PSMD11 were set to Neurodevelopmental disorder, MONDO:0700092, PSMD11-related Review for gene: PSMD11 was set to GREEN Added comment: PMID: 38866022 - 10 unrelated children with early-onset syndromic intellectual disability and neurodevelopmental delay with recurrent obesity. Cognitive impairment is recapitulated in a drosophila model. Loss of function is the mechanism of disease PMID: 30733659 - 4 probands with ID and different 17q11.2 deletions spanning PSMD11 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6046 | PAK2 |
Ain Roesley gene: PAK2 was added gene: PAK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PAK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PAK2 were set to 33693784; 38894571; 38712026 Phenotypes for gene: PAK2 were set to Knobloch 2 syndrome MIM#618458 Review for gene: PAK2 was set to GREEN gene: PAK2 was marked as current diagnostic Added comment: total of 3 families including 2 siblings with intra-familial variability Siblings' phenotypes: Both had retinal detachment and interstitial parenchymal pulmonary changes on chest X-rays, but only one child had additional significant features such as cataract, posterior encephalocele, severe DD/ID with ASD, and epilepsy. Other 2 pro bands: GDD, delayed motor (but normal verbal) skills, hypotonia Missense variants with in vitro functional demonstrating reduction in PAK2 auto phosphorylation Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6045 | MTSS1L | Ain Roesley Phenotypes for gene: MTSS1L were changed from ntellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086 to Intellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6044 | MTSS1L | Ain Roesley Phenotypes for gene: MTSS1L were changed from Intellectual disability, MTSS2-related (MONDO#0001071) to ntellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6043 | ZNF292 | Ain Roesley Phenotypes for gene: ZNF292 were changed from Intellectual developmental disorder, autosomal dominant 63, MIM# 619188; Intellectual disability; autism; ADHD to Intellectual developmental disorder, autosomal dominant 64 MIM#619188 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6042 | MYH10 | Zornitza Stark Phenotypes for gene: MYH10 were changed from Microcephaly; Intellectual Disability to AD complex neurodevelopmental disorder with or without congenital anomalies (MONDO:0100465) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6040 | AFF2 | Zornitza Stark Mode of inheritance for gene: AFF2 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6039 | AFF2 | Zornitza Stark Mode of inheritance for gene: AFF2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6038 | AFF2 | Zornitza Stark edited their review of gene: AFF2: Changed phenotypes: Intellectual disability, X-linked, FRAXE type 309548; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6038 | RDH14 |
Zornitza Stark gene: RDH14 was added gene: RDH14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RDH14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RDH14 were set to 34848785 Phenotypes for gene: RDH14 were set to Neurodevelopmental disorder, MONDO:0700092, RDH14-related Review for gene: RDH14 was set to RED Added comment: Two related individuals with ID and cerebellar atrophy and homozygous LoF variant reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6032 | MSL2 | Sangavi Sivagnanasundram reviewed gene: MSL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 38815585, 38702431; Phenotypes: MSL2-Related Developmental Disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6030 | ANO4 |
Ain Roesley gene: ANO4 was added gene: ANO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ANO4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANO4 were set to 38744284 Phenotypes for gene: ANO4 were set to neurodevelopmental disorder MONDO:0700092, ANO4-related Review for gene: ANO4 was set to GREEN gene: ANO4 was marked as current diagnostic Added comment: aka TMEM16D 5x de novo + 2x inherited missense (73% penetrance + asymptomatic) the ones with de novo variants: all had ID, hypotonia 4x skeletal features (scoliosis, funnel chest, pet plants, hyper extensible joints) all had epilepsy all had abnormal MRI Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6027 | KCND1 |
Ain Roesley gene: KCND1 was added gene: KCND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCND1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: KCND1 were set to 38772379 Phenotypes for gene: KCND1 were set to neurodevelopmental disorder MONDO:0700092, KCND1-related Review for gene: KCND1 was set to GREEN gene: KCND1 was marked as current diagnostic Added comment: 18 males from 17 families 2x de novo missense + 3x maternal NMDs + 12x maternal missense Some functional studies were done 14x ID 4x delayed motor dev 7x muscular hypotonia 6x epilepsy Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6025 | ATXN7L3 |
chirag patel gene: ATXN7L3 was added gene: ATXN7L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATXN7L3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN7L3 were set to PMID: 38753057 Phenotypes for gene: ATXN7L3 were set to Neurodevelopmental disorder, MONDO_0100500 Review for gene: ATXN7L3 was set to GREEN gene: ATXN7L3 was marked as current diagnostic Added comment: This study reports 9 unrelated individuals with de novo heterozygous variants in ATXN7L3 identified through WES testing and GeneMatcher. Core clinical features included: global motor and language developmental delay, hypotonia, and dysmorphic features (hypertelorism, epicanthal folds, blepharoptosis, small nose, small mouth, and low-set posteriorly rotated ears). Variable features included: feeding difficulties, seizures, mild periventricular leukomalacia, and structural cardiac abnormalities. A recurrent nonsense variant [p.(Arg114Ter)] was found in 5/9 individuals. The other variants were 1 frameshift [p.(Ser112LysfsTer12)] and 3 missense variants [p.(Ile71Thr), p.(Ser92Arg), and p.(Leu106Pro)]. They investigated the effects of the recurrent nonsense variant [p.(Arg114Ter)] in fibroblasts of an affected individual. ATXN7L3 protein levels were reduced, and deubiquitylation was impaired (as indicated by an increase in histone H2Bub1 levels). This is consistent with the previous observation of increased H2Bub1 levels in Atxn7l3-null mouse embryos, which have developmental delay and embryonic lethality. Pathogenic variants in deubiquitinating enzymes (DUBs) have been implicated in neurodevelopmental disorders (ND) and congenital abnormalities. ATXN7L3 is a component of the DUB module of the SAGA complex, and two other related DUB modules, and serves as an obligate adaptor protein of 3 ubiquitin-specific proteases (USP22, USP27X or USP51). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6022 | FAM177A1 |
chirag patel gene: FAM177A1 was added gene: FAM177A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FAM177A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FAM177A1 were set to PMID: 38767059, 25558065 Phenotypes for gene: FAM177A1 were set to Neurodevelopmental disorder, MONDO_0100500 Review for gene: FAM177A1 was set to GREEN gene: FAM177A1 was marked as current diagnostic Added comment: PMID: 38767059 5 individuals from 3 unrelated families reported with with biallelic loss of function variants in FAM177A1. Clinical features included: global developmental delay, intellectual disability, seizures, behavioural abnormalities, hypotonia, gait disturbance, and macrocephaly. They showed that FAM177A1 localizes to the Golgi complex in mammalian and zebrafish cells. Intersection of the RNA-seq and metabolomic datasets from FAM177A1-deficient human fibroblasts and whole zebrafish larvae demonstrated dysregulation of pathways associated with apoptosis, inflammation, and negative regulation of cell proliferation. PMID: 25558065 A study of 143 multiplex consanguineous families identified a homozygous frameshift variant in FAM177A1 in 1 family with 4 affected siblings with intellectual disability, dolicocephaly, obesity, and macrocephaly. The variant segregated with all 4 affected siblings and parents were confirmed heterozygous carriers. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6020 | ERF | chirag patel reviewed gene: ERF: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 38824261; Phenotypes: Noonan syndrome-like with or without craniosynostosis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6017 | SSR4 | Zornitza Stark Mode of inheritance for gene: SSR4 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6016 | SSR4 | Zornitza Stark reviewed gene: SSR4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type Iy, MIM# 300934; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6015 | RELN | Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lissencephaly 2 (Norman-Roberts type), MIM# 257320; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6014 | RELN | Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6013 | RELN |
Tashunka Taylor-Miller changed review comment from: 7 individuals from 4 families with biallelic variants, and 13 individuals from 7 families with monoallelic (heterozygous) variants of RELN and frontotemporal or temporal-predominant lissencephaly variant. Associated features: intellectual disability (16/20), seizures (5/20), unprovoked aggression (6/20), sleep disturbance (7/20) Variant spectrum includes: loss of function, missense, splice-site variants. MRI features include: anterior-predominant “thin”lisencephaly pachygyria with cerebellar hypoplasia Biallelic variants are associated with a severe phenotype that includes cerebellar hypoplasia. Monoallelic variants are associated with incomplete penetrance and variable expressivity (eg: one adult with abnormal MRI but normal intelligence and neurological profile).; to: 7 individuals from 4 families with biallelic variants, and 13 individuals from 7 families with monoallelic (heterozygous) variants of RELN and frontotemporal or temporal-predominant lissencephaly variant. Associated features: intellectual disability (16/20), seizures (5/20), unprovoked aggression (6/20), sleep disturbance (7/20) Variant spectrum includes: loss of function, missense, splice-site variants. MRI features include: anterior-predominant “thin” lisencephaly pachygyria with cerebellar hypoplasia. Biallelic variants are associated with a severe phenotype that includes cerebellar hypoplasia. Monoallelic variants are associated with incomplete penetrance and variable expressivity (eg: one adult with abnormal MRI but normal intelligence and neurological profile). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6013 | RELN | Tashunka Taylor-Miller reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35769015, 29671837; Phenotypes: OMIM *600514, HP:0001339, DOID:0070338; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6011 | DPYD | Zornitza Stark Mode of inheritance for gene: DPYD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6008 | DMD | Zornitza Stark Mode of inheritance for gene: DMD was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6007 | DMD | Zornitza Stark reviewed gene: DMD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Duchenne muscular dystrophy MIM#310200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6007 | SSR4 |
Katie Thompson changed review comment from: Decipher - only disorder of glycosolation (XLR) ORPHA:370927 OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females Western blot showed complete loss of protein; to: Decipher - disorder of glycosolation (XLR), strong evidence ORPHA:370927 GenCC strong. Not in gene2phenotype. OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females Western blot showed complete loss of protein. All variants caused loss of function mainly from premature termination. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6005 | COG7 | Zornitza Stark Mode of inheritance for gene: COG7 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6005 | COG7 | Zornitza Stark Mode of inheritance for gene: COG7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6004 | COG7 | Zornitza Stark reviewed gene: COG7: Rating: GREEN; Mode of pathogenicity: None; Publications: 15107842, 17356545, 28883096; Phenotypes: Congenital disorder of glycosylation, type IIe , MIM#608779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6004 | SSR4 |
Katie Thompson changed review comment from: PMID: 24218363; 26264460 SSR4 Decipher - only disorder of glycosolation (XLR) ORPHA:370927 OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females; to: Decipher - only disorder of glycosolation (XLR) ORPHA:370927 OMIM: 300934. 2 good quality papers, one with 4 unrelated families, two with mendelian inheritance. Evidence of less severe phenotype in heterozygote females Western blot showed complete loss of protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6002 | COG1 | Zornitza Stark Mode of inheritance for gene: COG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6001 | SSR4 | Katie Thompson reviewed gene: SSR4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24218363, 26264460; Phenotypes: intellectual disabilities, hypotonia, microcephaly, seizures, Feeding problems, Facial dysmorphism, Gastrointestinal abnormalities, Failure to thrive, strabismus; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6001 | COG1 | Zornitza Stark reviewed gene: COG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16537452, 19008299, 17904886, 11980916; Phenotypes: Congenital disorder of glycosylation, type IIg, MIM# 611209; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5999 | COL4A1 | Zornitza Stark Mode of inheritance for gene: COL4A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5997 | SNAP29 | Zornitza Stark Mode of inheritance for gene: SNAP29 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5996 | SNAP29 | Zornitza Stark Mode of inheritance for gene: SNAP29 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5995 | SNAP29 | Zornitza Stark reviewed gene: SNAP29: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5993 | GABRA4 | Zornitza Stark reviewed gene: GABRA4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder MONDO:0700092, GABRA4-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5993 | SNAP29 | Gunjan Garg reviewed gene: SNAP29: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33977139, 30793783, 29051910; Phenotypes: cerebral dysgenesis, 609528, Global developmental delay, schizencephaly, polymicrogyria, intellectual disability, neurodevelopment delay; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5993 | COL4A1 | Hali Van Niel reviewed gene: COL4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30413629, 33912663, 36786861, 32042920; Phenotypes: COL4A1-related disorder MONDO:0800461, brain small vessel disease 1 with or without ocular anomalies MONDO:0008289, microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5992 | CLN6 | Zornitza Stark Mode of inheritance for gene: CLN6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5991 | CLN6 | Zornitza Stark reviewed gene: CLN6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 6, MIM# 601780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5990 | CLN3 | Zornitza Stark Mode of inheritance for gene: CLN3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5989 | CLN3 | Zornitza Stark reviewed gene: CLN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 3 MIM#204200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5988 | CHD7 | Zornitza Stark Mode of inheritance for gene: CHD7 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5987 | CHD7 | Zornitza Stark reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: CHARGE syndrome, MIM# 214800; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5986 | CC2D2A | Zornitza Stark Mode of inheritance for gene: CC2D2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5985 | CC2D2A | Zornitza Stark reviewed gene: CC2D2A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: COACH syndrome 2, MIM# 619111, Joubert syndrome 9, 612285, Meckel syndrome 6, 612284; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5983 | CBL | Zornitza Stark Mode of inheritance for gene: CBL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5980 | CACNA1A | Zornitza Stark Mode of inheritance for gene: CACNA1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5977 | C12orf65 | Zornitza Stark Mode of inheritance for gene: C12orf65 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5974 | BTD | Zornitza Stark Mode of inheritance for gene: BTD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5971 | BSCL2 | Zornitza Stark Mode of inheritance for gene: BSCL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5968 | BCS1L | Zornitza Stark Mode of inheritance for gene: BCS1L was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5965 | BCKDHB | Zornitza Stark Mode of inheritance for gene: BCKDHB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5962 | BCKDHA | Zornitza Stark Mode of inheritance for gene: BCKDHA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5959 | BBS2 | Zornitza Stark Mode of inheritance for gene: BBS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5956 | BBS12 | Zornitza Stark Mode of inheritance for gene: BBS12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5953 | BBS10 | Zornitza Stark Mode of inheritance for gene: BBS10 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5950 | BBS1 | Zornitza Stark Mode of inheritance for gene: BBS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5947 | TBCE | Zornitza Stark Mode of inheritance for gene: TBCE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5944 | SLC25A1 | Zornitza Stark Mode of inheritance for gene: SLC25A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5943 | SLC25A1 | Zornitza Stark reviewed gene: SLC25A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072, Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5943 | ROR2 | Zornitza Stark Phenotypes for gene: ROR2 were changed from to Robinow syndrome, autosomal recessive, MIM#268310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5940 | ROR2 | Zornitza Stark Mode of inheritance for gene: ROR2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5939 | ROR2 | Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Robinow syndrome, autosomal recessive, MIM#268310; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5937 | SOX10 | Zornitza Stark Mode of inheritance for gene: SOX10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5936 | SLC4A4 | Zornitza Stark Mode of inheritance for gene: SLC4A4 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5935 | SLC4A4 | Zornitza Stark Mode of inheritance for gene: SLC4A4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5933 | SLC4A4 | Zornitza Stark Phenotypes for gene: SLC4A4 were changed from to Renal tubular acidosis, proximal, with ocular abnormalities MIM#604278 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5930 | SLX4 | Zornitza Stark Mode of inheritance for gene: SLX4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5928 | SLX4 | Zornitza Stark reviewed gene: SLX4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Fanconi anemia, complementation group P, MIM# 613951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5926 | SCN8A | Zornitza Stark Mode of inheritance for gene: SCN8A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5923 | THRA | Zornitza Stark Mode of inheritance for gene: THRA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5922 | SIX3 | Zornitza Stark Phenotypes for gene: SIX3 were changed from to Holoprosencephaly 2, autosomal dominant, MIM#157170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5920 | SIX3 | Zornitza Stark Mode of inheritance for gene: SIX3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5919 | SIX3 | Zornitza Stark reviewed gene: SIX3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holoprosencephaly 2, autosomal dominant, MIM#157170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5917 | SAMHD1 | Zornitza Stark Mode of inheritance for gene: SAMHD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5914 | SCN2A | Zornitza Stark Mode of inheritance for gene: SCN2A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5913 | SCN2A | Zornitza Stark Mode of inheritance for gene: SCN2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5909 | BMP4 | Zornitza Stark Mode of inheritance for gene: BMP4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5908 | BMP4 | Zornitza Stark reviewed gene: BMP4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Microphthalmia, syndromic 6, MIM# 607932; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5906 | CDON | Zornitza Stark Mode of inheritance for gene: CDON was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5903 | RBBP8 | Zornitza Stark Mode of inheritance for gene: RBBP8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5902 | RBBP8 | Zornitza Stark reviewed gene: RBBP8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Jawad syndrome, MIM#251255, Seckel syndrome 2, MIM#606744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5902 | RBBP8 | James The reviewed gene: RBBP8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:30561437, 34270086, 32379725; Phenotypes: 606744, 251255, 113705; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5902 | CDON | Hali Van Niel reviewed gene: CDON: Rating: GREEN; Mode of pathogenicity: None; Publications: 21802063, 26728615, 31502381, 32729136, 26529631; Phenotypes: holoprosencephaly 11 MONDO:0013642; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5899 | SAMD9 | Zornitza Stark Mode of inheritance for gene: SAMD9 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5898 | SAMD9 | Zornitza Stark reviewed gene: SAMD9: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: MIRAGE Syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5898 | BMP4 | Hali Van Niel reviewed gene: BMP4: Rating: AMBER; Mode of pathogenicity: None; Publications: 22581619, 31053785, 30568244, 18252212, 21340693, 34926457, 36140739, 37107605; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5896 | LIG4 | Zornitza Stark Mode of inheritance for gene: LIG4 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5895 | LIG4 | Zornitza Stark Mode of inheritance for gene: LIG4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5892 | SLC35A1 | Zornitza Stark Mode of inheritance for gene: SLC35A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5890 | SLC35A1 | Zornitza Stark reviewed gene: SLC35A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28856833, 23873973, 11157507; Phenotypes: Congenital disorder of glycosylation, type IIf, MIM# 603585; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5888 | LRPPRC | Zornitza Stark Mode of inheritance for gene: LRPPRC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5887 | LRPPRC | Zornitza Stark reviewed gene: LRPPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian), MIM#220111; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5885 | TREX1 | Zornitza Stark Mode of inheritance for gene: TREX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5883 | SERAC1 | Zornitza Stark Mode of inheritance for gene: SERAC1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5882 | SERAC1 | Zornitza Stark Mode of inheritance for gene: SERAC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SERAC1 | Zornitza Stark reviewed gene: SERAC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24741715, 37711114, 37090937, 28916646, 32684373; Phenotypes: 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL), MIM#614739; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | TREX1 | Hali Van Niel reviewed gene: TREX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25604658, 16845398, 17357087; Phenotypes: Aicardi-Goutieres syndrome MONDO:0018866; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | LRPPRC | Kirsty Choi reviewed gene: LRPPRC: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21266382, 8392290, 8392291, 26510951; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian), 220111, developmental delay, hypotonia, mild facial dysmorphism, chronic well-compensated metabolic acidosis, high mortality due to episodes of severe acidosis and coma, hypertension, cerebrospinal fluid lactate levels, decreased blood bicarbonate levels, microvesicular steatosis, psychomotor delay, ataxia, hypotonia, transient tachypnea of the newborn, poor sucking, tremor, hypoglycemia, seizures; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SLC35A1 |
Anissa Johnson changed review comment from: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation". AR inheritance.; to: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents, consanguineous, were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation". AR inheritance. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SLC35A1 |
Anissa Johnson changed review comment from: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation".; to: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation". AR inheritance. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SLC35A1 | Anissa Johnson commented on gene: SLC35A1: PMID: 23873973: 1 patient identified, homozygous with a variant in SLC35A1. Parents were heterozygous for the variant. Presented with "intellectual disability, seizures, ataxia, macrothrombocytopaenia, renal and cardiac involvement, and abnormal protein glycosylation". Biochemical assay showed "combined N- and O-glycosylation abnormalities and specific reduction in sialylation". | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SLC35A1 | Anissa Johnson reviewed gene: SLC35A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23873973; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | LIG4 | Santosh Varughese reviewed gene: LIG4: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 16088910, 9823897, 10911993, 15333585, 9809069, 12023982, 11040211, 15175260, 19451691, 17554302; Phenotypes: lIG4 syndrome, MULTIPLE MYELOMA, RESISTANCE TO; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SAMD9 | Raluca Rusu reviewed gene: SAMD9: Rating: RED; Mode of pathogenicity: Other; Publications: PMID: 27182967, 34659124, 32194975, 29175836, 37195360, 30900330, 37745698; Phenotypes: MIRAGE Syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SAMHD1 | Reetoo Ramessur reviewed gene: SAMHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301648, 29239743, 25246298, 19525956, 21102625, 33307271, 35418820; Phenotypes: Aicardi-Goutieres syndrome 5, MIM# 612952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SIX3 | Laura Mazurkijevic reviewed gene: SIX3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20531442, 19346217, 20157829, 15635066; Phenotypes: Holoprosencephaly 2, autosomal dominant, MIM#157170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | THRA |
Hnin Aung changed review comment from: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed. Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938). Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899].; to: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestations for truncating variants have been observed. Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938). Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899]. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | THRA |
Hnin Aung changed review comment from: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed. Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938). Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899].; to: Over 10 sequence variants (including truncating nonsense and frameshift as well as missense) have been reported in the literature in association with consistent phenotype of mild hypothyroidism (growth retardation, relatively high birth length and weight, mild-to-moderate mental retardation, mild skeletal dysplasia, delayed dentition and constipation) and specific facial features. Milder outcomes for missense variants and more severe phenotype manifestation for truncating variants have been observed. Most of the variants are located in the last exon of the THRA isoform 1 (NM_199334.5; a shorter isoform) affecting the C-terminal ligand binding domain with nonsense and frameshift variants predicted to escape nonsense mediated decay. These variants are either de novo or inherited from an affected parent. A few pedigrees are also available with segregation data. Truncating variants appear to have near complete penetrance whereas missense variants may be associated with variable expressivity (Family C - PMID: 27144938). Functional evidence suggests altered gene product with possible dominant negative effect (PMID: 22168587, 28471274). Knock in mouse model available for E403X presenting with similar phenotype as seen in the human patients, including growth retardation and variable presentation of psychomotor deficit (PMID: 32924834). A small number THRA sequence variant (missense) reported among autism cohort [PMID: 28856816, 25621899]. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | THRA | Hnin Aung reviewed gene: THRA: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22494134, 23940126, 24847461, 25670821, 26037512, 25621899, 27144938, 28856816, 30842990, 37469961; Phenotypes: Hypothyroidism congenital nongoitrous 6 (MIM 614450), Intellectual disability syndromic, Growth retardation, Facial dysmorphism, Constipation; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SCN8A | Tinashe Nhindiri reviewed gene: SCN8A: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 34353676, 38233770, 30171078; Phenotypes: Epileptic encephalopathy, Developmental delay, Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SLX4 | Lovepreet Gill reviewed gene: SLX4: Rating: RED; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: (PMID: 21240277, 21240275, 23093618, 26453996); Phenotypes: Franconia anemia, complementation group P; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SLC4A4 | Adam Ivey reviewed gene: SLC4A4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29914390, 11274232, 15930088; Phenotypes: OMIM:604278-RENAL TUBULAR ACIDOSIS, PROXIMAL, WITH OCULAR ABNORMALITIES AND IMPAIRED INTELLECTUAL DEVELOPMENT; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SOX10 | David Fairbairn reviewed gene: SOX10: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10762540, 34667088, 38132479; Phenotypes: PCWH (Peripheral demyelinating neuropathy Central demyelination, Waardenburg and Hirschsprung disease) syndrome (OMIM #609136), Waardenburg syndrome, type 2E, with or without neurologic involvement (OMIM #611584); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | ROR2 | Shani Stuart reviewed gene: ROR2: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 33937263, 32954672, 32172608; Phenotypes: Intellectual disability; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SLC25A1 | Alyson Lewis reviewed gene: SLC25A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31527857, PMID: 26870663; Phenotypes: Impaired intellectual development, mild, Learning disabilities, Delayed motor development; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | TBCE | Leanne Baxter reviewed gene: TBCE: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID:27666369: PMID:17699660: PMID:34356170: PMID: 34134906; Phenotypes: Encephalopathy, progressive, with amyotrophy and optic atrophy MIM:617207, Hypoparathyroidism-retardation-dysmorphism syndrome MIM:241410, Kenny-Caffey syndrome, type 1 MIM:244460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5879 | SLC19A3 | Zornitza Stark Mode of inheritance for gene: SLC19A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5878 | SLC19A3 | Jane Lin reviewed gene: SLC19A3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15871139, PMID: 34276785, PMID: 23482991, PMID: 20065143; Phenotypes: # 607483 BASAL GANGLIA DISEASE, BIOTIN-THIAMINE RESPONSIVE (BBTGD), THIAMINE METABOLISM DYSFUNCTION SYNDROME 2; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5877 | SASS6 |
Zornitza Stark gene: SASS6 was added gene: SASS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: SASS6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SASS6 were set to 24951542; 30639237 Phenotypes for gene: SASS6 were set to Microcephaly 14, primary, autosomal recessive, MIM# 616402 Review for gene: SASS6 was set to GREEN Added comment: At least 3 unrelated families reported, severe ID is part of the phenotype. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5874 | SPECC1L | Zornitza Stark Mode of inheritance for gene: SPECC1L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5873 | SPECC1L | Zornitza Stark reviewed gene: SPECC1L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Teebi hypertelorism syndrome 1, MIM# 145420; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5873 | SPECC1L | Ibrahim El-Deek changed review comment from: There is paucity of literature directly linking SPECC1L variants to intellectual disability and developmental delay. However, Zhang et al. (PMID: 31953237) reviewed 33 patients from 14 families with SPECC1L variants, noting that the most common features were dysmorphic facial characteristics. Developmental delays were reported in 24.2% of patients (8/33), with some achieving normal development during childhood.; to: There is paucity of literature directly linking SPECC1L variants to intellectual disability and developmental delay. However, Zhang et al. (PMID: 31953237) reviewed 33 patients from 14 families with SPECC1L variants (including 10 missense point mutation and 1 deletion), noting that the most common features were dysmorphic facial characteristics. Developmental delays were reported in 24.2% of patients (8/33), with some achieving normal development during childhood. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5873 | SPECC1L | Ibrahim El-Deek reviewed gene: SPECC1L: Rating: RED; Mode of pathogenicity: Other; Publications: 31953237, 30472488; Phenotypes: Teebi hypertelorism syndrome 1, Oblique Facial Clefting 1, Opitz GBBB syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5873 | GABRA4 |
Adam Ivey gene: GABRA4 was added gene: GABRA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABRA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABRA4 were set to PMID: 38565639 Phenotypes for gene: GABRA4 were set to Developmental delay; Intellectual disability; Epileptic seizures Penetrance for gene: GABRA4 were set to Complete Review for gene: GABRA4 was set to GREEN Added comment: Four unrelated individuals with unique de novo missense variants in the transmembrane domain of GABRA4 have developmental delay and varying degrees of intellectual disability (PMID: 38565639). These variants are not present in gnomAD and three of the four variants have pathogenic REVEL scores. Two of the GABRA4 variants were heterozygous, while the remaining two were mosaic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5872 | L1CAM | Zornitza Stark Mode of inheritance for gene: L1CAM was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5871 | LAMC3 | Zornitza Stark Phenotypes for gene: LAMC3 were changed from to complex neurodevelopmental disorder MONDO:0100038; Cortical malformations, occipital, MIM# 614115 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5869 | LAMC3 | Zornitza Stark Mode of inheritance for gene: LAMC3 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5867 | LAMC3 | Zornitza Stark reviewed gene: LAMC3: Rating: AMBER; Mode of pathogenicity: None; Publications: 38758065, 21572413; Phenotypes: complex neurodevelopmental disorder MONDO:0100038, Cortical malformations, occipital, MIM# 614115; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5864 | MBTPS2 | Zornitza Stark Mode of inheritance for gene: MBTPS2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5862 | MED12 | Zornitza Stark Mode of inheritance for gene: MED12 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5859 | MED13L | Zornitza Stark Mode of inheritance for gene: MED13L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5856 | MED23 | Zornitza Stark Mode of inheritance for gene: MED23 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5854 | MID1 | Zornitza Stark Mode of inheritance for gene: MID1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5852 | NDP | Zornitza Stark Mode of inheritance for gene: NDP was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5850 | NSD1 | Zornitza Stark Mode of inheritance for gene: NSD1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5848 | OCRL | Zornitza Stark Mode of inheritance for gene: OCRL was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5845 | OFD1 | Zornitza Stark Mode of inheritance for gene: OFD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5843 | PLP1 | Zornitza Stark Mode of inheritance for gene: PLP1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5842 | PORCN | Zornitza Stark Phenotypes for gene: PORCN were changed from to focal dermal hypoplasia MONDO:0010592 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5840 | PORCN | Zornitza Stark Mode of inheritance for gene: PORCN was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5838 | PTCHD1 | Zornitza Stark Mode of inheritance for gene: PTCHD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5835 | SETBP1 | Zornitza Stark Mode of inheritance for gene: SETBP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5831 | SLC25A15 | Zornitza Stark Mode of inheritance for gene: SLC25A15 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5826 | ZNF41 | Zornitza Stark Mode of inheritance for gene: ZNF41 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5822 | SHANK2 | Zornitza Stark Mode of inheritance for gene: SHANK2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SHANK2 | Zornitza Stark reviewed gene: SHANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SHANK2 | Aaron Meyers reviewed gene: SHANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20473310, 22346768, 20531469, 35456494, 32987185, 25188300, 22699619, 22699620; Phenotypes: Autism, susceptibility to, 17, MIM#613436, Autism spectrum disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | ZNF81 | Sangavi Sivagnanasundram reviewed gene: ZNF81: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006590; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | ZNF674 | Sangavi Sivagnanasundram reviewed gene: ZNF674: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006588; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | ZNF41 | Sangavi Sivagnanasundram reviewed gene: ZNF41: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006585; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | ZDHHC15 | Sangavi Sivagnanasundram reviewed gene: ZDHHC15: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006573; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | WAC | Sangavi Sivagnanasundram reviewed gene: WAC: Rating: GREEN; Mode of pathogenicity: None; Publications: 26757981, https://search.clinicalgenome.org/CCID:006532; Phenotypes: DeSanto-Shinawi syndrome MONDO:0018760; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | TCF7L2 | Sangavi Sivagnanasundram reviewed gene: TCF7L2: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006339; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SLC6A4 | Sangavi Sivagnanasundram reviewed gene: SLC6A4: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006198; Phenotypes: autism spectrum disorder MONDO:0005258; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SLC25A15 |
Rajkumar Krishnaswamy changed review comment from: Rare genetic disorder representing a heterogeneous disease with high clinical variability. Pyramidal dysfunction, developmental, cognitive and behavioural abnormalities have been reported. ID/mental retardation ranging from mild, moderate to severe have been reported in several cases usually manifesting in the childhood or as adult onset.; to: Rare genetic disorder representing a heterogeneous disease with high clinical variability. Lethargy, feeding difficulties, seizures, pyramidal dysfunction, developmental, cognitive and behavioural abnormalities have been reported with various features exhibited at various stages of life e.g. neonates, infantile/childhood and adults. ID/mental retardation ranging from mild, moderate to severe have been reported in several cases usually manifesting in childhood or adults. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SHROOM4 | Sangavi Sivagnanasundram reviewed gene: SHROOM4: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:006141; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 | Sangavi Sivagnanasundram reviewed gene: SETBP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28346496, 21037274; Phenotypes: Schinzel-Giedion syndrome MONDO:0010010, complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SLC25A15 | Rajkumar Krishnaswamy reviewed gene: SLC25A15: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 18978333, 25874378; Phenotypes: Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome, 238970, hyperammonemia, lethargy, somnolence, refusal to feed, vomiting, tachypnea with respiratory alkalosis, seizures, protein intolerance, developmental delay, spasticity, intellectual disability / mental retardation, dysarthria, learning disabilities, spasticity, liver dysfunction; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SETBP1 | Sangavi Sivagnanasundram reviewed gene: SETBP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28346496, 21037274; Phenotypes: Schinzel-Giedion syndrome MONDO:0010010, complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | PTCHD1 | Sangavi Sivagnanasundram reviewed gene: PTCHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005921; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | PORCN | Sangavi Sivagnanasundram reviewed gene: PORCN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301712; Phenotypes: focal dermal hypoplasia MONDO:0010592; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | PLP1 | Sangavi Sivagnanasundram reviewed gene: PLP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: https://search.clinicalgenome.org/CCID:005834; Phenotypes: Pelizeaus-Merzbacher spectrum disorder MONDO:0010714; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | OFD1 | Sangavi Sivagnanasundram reviewed gene: OFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24884629; Phenotypes: ciliopathy MONDO:0005308; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | OCRL | Sangavi Sivagnanasundram reviewed gene: OCRL: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005696; Phenotypes: oculocerebrorenal syndrome MONDO:0010645; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | NSD1 | Sangavi Sivagnanasundram reviewed gene: NSD1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005680; Phenotypes: Sotos syndrome MONDO:0019349; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | NDP | Sangavi Sivagnanasundram reviewed gene: NDP: Rating: AMBER; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005574; Phenotypes: Norrie disease MONDO:0010691; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | MID1 | Sangavi Sivagnanasundram reviewed gene: MID1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005386; Phenotypes: X-linked Opitz G/BBB syndrome MONDO:0010222; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | MED23 | Sangavi Sivagnanasundram reviewed gene: MED23: Rating: GREEN; Mode of pathogenicity: None; Publications: 21868677, 25845469, 27311965, 27457812, 30847200, 31164858; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | MED13L | Sangavi Sivagnanasundram reviewed gene: MED13L: Rating: GREEN; Mode of pathogenicity: None; Publications: 28645799, 29511999; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | MED12 | Sangavi Sivagnanasundram reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005361; Phenotypes: MED12-related intellectual disability syndrome MONDO:0100000; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | MBTPS2 | Sangavi Sivagnanasundram reviewed gene: MBTPS2: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005345; Phenotypes: IFAP syndrome 1, with or without BRESHECK syndrome MONDO:0100213; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | MAGT1 | Sangavi Sivagnanasundram reviewed gene: MAGT1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005319; Phenotypes: X-linked intellectual disability MONDO:0100284; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | LAMC3 | Sangavi Sivagnanasundram reviewed gene: LAMC3: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005265; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | L1CAM | Sangavi Sivagnanasundram reviewed gene: L1CAM: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005260; Phenotypes: L1 syndrome MONDO:0017140; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | KIRREL3 | Sangavi Sivagnanasundram reviewed gene: KIRREL3: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005235; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | KATNAL2 | Sangavi Sivagnanasundram reviewed gene: KATNAL2: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005176; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | KAT6B | Sangavi Sivagnanasundram reviewed gene: KAT6B: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005174; Phenotypes: KAT6B-related multiple congenital anomalies syndrome MONDO:0036042; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | KAT6A | Sangavi Sivagnanasundram reviewed gene: KAT6A: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005173; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | IGBP1 | Sangavi Sivagnanasundram reviewed gene: IGBP1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005117; Phenotypes: corpus callosum agenesis-intellectual disability-coloboma-micrognathia syndrome MONDO:0010333; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | IDS | Sangavi Sivagnanasundram reviewed gene: IDS: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005112; Phenotypes: mucopolysaccharidosis type 2 MONDO:0010674; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | HPRT1 | Sangavi Sivagnanasundram reviewed gene: HPRT1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005082; Phenotypes: Lesch-Nyhan syndrome MONDO:0010298; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | HOXA1 | Sangavi Sivagnanasundram reviewed gene: HOXA1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005077; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | HNRNPK | Sangavi Sivagnanasundram reviewed gene: HNRNPK: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005073; Phenotypes: neurodevelopmental disorder-craniofacial dysmorphism-cardiac defect-hip dysplasia syndrome (Au-Kline syndrome) MONDO:0018681; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | GPC3 | Sangavi Sivagnanasundram reviewed gene: GPC3: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004990; Phenotypes: Simpson-Golabi-Behmel syndrome MONDO:0010731; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | GDI1 | Sangavi Sivagnanasundram reviewed gene: GDI1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004941; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | FTSJ1 | Sangavi Sivagnanasundram reviewed gene: FTSJ1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004892; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | FMR1 | Sangavi Sivagnanasundram reviewed gene: FMR1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004870; Phenotypes: fragile X syndrome MONDO:0010383; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5819 | SPR | Zornitza Stark Mode of inheritance for gene: SPR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5818 | SPR | Zornitza Stark reviewed gene: SPR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5816 | AGTR2 | Zornitza Stark Mode of inheritance for gene: AGTR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5811 | CASK | Zornitza Stark Mode of inheritance for gene: CASK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5807 | DHCR7 | Zornitza Stark Mode of inheritance for gene: DHCR7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5804 | DKC1 | Zornitza Stark Mode of inheritance for gene: DKC1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5803 | DPP6 | Zornitza Stark Phenotypes for gene: DPP6 were changed from Mental retardation, autosomal dominant 33 (MIM#616311) to Intellectual disability, autosomal dominant 33 (MIM#616311) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5799 | FLNA | Zornitza Stark Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | FLNA | Sangavi Sivagnanasundram reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004863; Phenotypes: periventricular nodular heterotopia MONDO:0020341; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | FBN1 | Sangavi Sivagnanasundram reviewed gene: FBN1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004823; Phenotypes: Shprintzen-Goldberg syndrome MONDO:0008426; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | DPP6 | Sangavi Sivagnanasundram reviewed gene: DPP6: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004701; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | DKC1 | Sangavi Sivagnanasundram reviewed gene: DKC1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004651; Phenotypes: DKC1-related disorder MONDO:0100152; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | DHCR7 | Sangavi Sivagnanasundram reviewed gene: DHCR7: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004643; Phenotypes: Smith-Lemli-Opitz syndrome MONDO:0010035; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | CNTN6 | Sangavi Sivagnanasundram reviewed gene: CNTN6: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004489; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | CLIC2 | Sangavi Sivagnanasundram reviewed gene: CLIC2: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004469; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | CDH15 | Sangavi Sivagnanasundram reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004393; Phenotypes: intellectual disability MONDO:0001071; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | CASK | Sangavi Sivagnanasundram reviewed gene: CASK: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004345; Phenotypes: X-linked syndromic intellectual disability MONDO:0020119; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | BCORL1 | Sangavi Sivagnanasundram reviewed gene: BCORL1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004254; Phenotypes: Shukla-Vernon syndrome MONDO:0026727; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5798 | BAZ2B | Sangavi Sivagnanasundram reviewed gene: BAZ2B: Rating: AMBER; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004237; Phenotypes: complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5797 | ANKRD11 | Sangavi Sivagnanasundram reviewed gene: ANKRD11: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 25413698, https://search.clinicalgenome.org/CCID:004133; Phenotypes: KBG syndrome MONDO:0007846; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5797 | AGTR2 | Sangavi Sivagnanasundram reviewed gene: AGTR2: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004075; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5797 | SPR |
Amy Chiang edited their review of gene: SPR: Added comment: SPR has been classified to have definitive association with dopa-responsive dystonia (reviewed by the Aminoacidopathy Expert Panel on 06/04/2021). Clinical phenotypes are mainly neuromuscular with characteristic features of axial hypotonia, dystonia, delayed psychomotor development, oculogyric crises, diurnal fluctuation with improvement after sleep; though cognitive impairment ranging from mild to severe levels have been reported in patients with sepiapterin reductase deficiency (PMID: 16049044, 17188538) - 7 Maltese patients with the same homozygous spice variants in SPR (founder effect due to relative small Maltese population); note there was no significant improvement in cognitive ability with L-dopa treatment in these patients despite improvement in their motor abilities (PMID: 16049044) - ? other causes to cognitive impairment in these patients other than SPR associated sepiapterin reductase deficiency There are 271 SPR variants registered in ClinVar to date with only 1 submission from a research lab reported 2 affected individuals with intellectual disability + family history (ClinVar # 625209) - no publication available to verify, ? from BRIDGE consortium study: SPEED project cohort A start loss variant detected in 5 affected individuals with ID & epilepsy from a Persian consanguineous family - LOD score = 4.027 (PMID: 29302074); Changed publications: PMID: 29302074, 16049044, 17188538; Changed phenotypes: MONDO #0012994, OMIM #612716, axial hypotonia, dystonia with diurnal fluctuation, oculogyric crises, delayed psychomotor development, sepiapterin reductase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5796 | SPR | Amy Chiang reviewed gene: SPR: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 29302074; Phenotypes: dopa-responsive dystonia due to sepiapterin reductase deficiency, MONDO: 0012994, Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, OMIM: 612716; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5794 | DAGLA |
Zornitza Stark gene: DAGLA was added gene: DAGLA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DAGLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DAGLA were set to 35737950 Phenotypes for gene: DAGLA were set to Neuroocular syndrome 2, paroxysmal type, MIM# 168885 Review for gene: DAGLA was set to GREEN Added comment: 9 individuals from 8 families reported with daily paroxysmal spells characterized by eye deviation or nystagmus with abnormal head posturing apparent from birth or early infancy. The episodes tend to be triggered after sleeping, and most patients show improvement of the ocular symptoms over time. Affected individuals also have hypotonia, mild developmental delay, dysarthria, and gait ataxia; most have mildly impaired intellectual development. Seizures are not observed. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5792 | CYHR1 | Bryony Thompson reviewed gene: CYHR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 38641995; Phenotypes: neurodevelopmental disorder MONDO:0700092, ZTRAF1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5791 | NOTCH3 | Ain Roesley Mode of inheritance for gene: NOTCH3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5790 | NOTCH3 | Ain Roesley reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder MONDO:0700092, NOTCH3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5788 | SLC35C1 | Zornitza Stark Mode of inheritance for gene: SLC35C1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5786 | PRMT9 |
chirag patel gene: PRMT9 was added gene: PRMT9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRMT9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PRMT9 were set to PMID: 38561334 Phenotypes for gene: PRMT9 were set to Neurodevelopmental disorder, MONDO:0100500 Review for gene: PRMT9 was set to RED Added comment: A homozygous variant (G189R) in PRMT9 is reported based on large WGS study in 136 consanguineous families - unclear if only found in 1 family and no clinical information on case(s). PMRTs (protein arginine methyltransferases) catalyse post translational modification via arginine methylation. Functional studies showed that the G189R variant abolishes PRMT9's methyltransferase activity - specifically at the R508 residue of SF3B2 RNA (exclusively methylated by PRMT9) - and leads to heavy PRMT9 ubiquitination, and abnormal splicing activity of SF3B2. Knock out mouse model showed PRMT9 loss in excitatory neurons leads to aberrant synapse development and impaired learning and memory. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5784 | SLC35C1 | Yixin JIANG reviewed gene: SLC35C1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33836758, 32313197, 34389986; Phenotypes: Congenital disorder of glycosylation, type IIc, MIM# 266265, MONDO:0009953; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5782 | PTRH2 | Bryony Thompson reviewed gene: PTRH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33092935, 37239392; Phenotypes: neurologic, endocrine, and pancreatic disease, multisystem, infantile-onset 1 MONDO:8000012; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5782 | DMAP1 | Ben Lundie reviewed gene: DMAP1: Rating: AMBER; Mode of pathogenicity: Other; Publications: ; Phenotypes: Unknown.; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5780 | MAB21L1 | Zornitza Stark reviewed gene: MAB21L1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebellar, ocular, craniofacial, and genital syndrome MIM#618479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5779 | FOSL2 | Zornitza Stark reviewed gene: FOSL2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aplasia cutis-enamel dysplasia syndrome, MIM# 620789; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5779 | ACBD6 | Zornitza Stark Phenotypes for gene: ACBD6 were changed from Neurodevelopmental disorder (MONDO#0700092), ACBD6-related to Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5778 | ACBD6 | Zornitza Stark reviewed gene: ACBD6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5775 | STRA6 | Zornitza Stark Mode of inheritance for gene: STRA6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5772 | NSUN6 | Zornitza Stark Phenotypes for gene: NSUN6 were changed from neurodevelopmental disorder MONDO:0700092, NSUN6-related to Intellectual developmental disorder, autosomal recessive 82, MIM# 620779 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5771 | NSUN6 | Zornitza Stark reviewed gene: NSUN6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 82, MIM# 620779; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5768 | SNF8 | Zornitza Stark reviewed gene: SNF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 115, MIM#620783; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5768 | PURA | Ain Roesley Phenotypes for gene: PURA were changed from Mental retardation, autosomal dominant 31, MIM# 616158 to Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5767 | BANF1 |
Zornitza Stark gene: BANF1 was added gene: BANF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BANF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BANF1 were set to 35982159 Phenotypes for gene: BANF1 were set to Neurodevelopmental disorder, MONDO:0700092, BANF1-related Review for gene: BANF1 was set to RED Added comment: Single individual reported with a de novo variant, p.Ala87Thr, and a neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5765 | RNU4-2 |
Zornitza Stark gene: RNU4-2 was added gene: RNU4-2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU4-2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RNU4-2 were set to Neurodevelopmental disorder, MONDO:0700092, RNU4-2 related Review for gene: RNU4-2 was set to GREEN Added comment: Emerging evidence that de novo variants in this gene cause ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5763 | YKT6 |
Zornitza Stark gene: YKT6 was added gene: YKT6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YKT6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YKT6 were set to 38522068 Phenotypes for gene: YKT6 were set to Syndromic disease, MONDO:0002254, YKT6-related Review for gene: YKT6 was set to AMBER Added comment: Two individuals homozygous for YKT6 [NM_006555.3:c.554A>G p.(Tyr185Cys)] exhibited normal prenatal course followed by failure to thrive, developmental delay and progressive liver disease. Haplotype analysis identified a shared homozygous region flanking the variant, suggesting a common ancestry. The third individual homozygous for YKT6 [NM_006555.3:c.191A>G p.(Tyr64Cys)] exhibited neurodevelopmental disorders and optic atrophy. Supportive functional data in Drosophila. Amber rating due to homozygous missense variants and founder effect in two of the families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5761 | SEPHS1 |
Zornitza Stark gene: SEPHS1 was added gene: SEPHS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SEPHS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SEPHS1 were set to 38531365 Phenotypes for gene: SEPHS1 were set to Neurodevelopmental disorder, MONDO:0700092, SEPHS1-related Review for gene: SEPHS1 was set to GREEN Added comment: Nine individuals from eight families with developmental delay, growth and feeding problems, hypotonia, and dysmorphic features, all with heterozygous missense variants in SEPHS1. Eight of these individuals had a recurrent variant at amino acid position 371 of SEPHS1 (p.Arg371Trp, p.Arg371Gln, and p.Arg371Gly); seven of these variants were known to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5758 | GLUL | Zornitza Stark Mode of inheritance for gene: GLUL was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5757 | GLUL | Zornitza Stark reviewed gene: GLUL: Rating: GREEN; Mode of pathogenicity: None; Publications: 16267323, 21353613, 33150193; Phenotypes: Developmental and epileptic encephalopathy, MONDO:0100062, GLUL-related, Glutamine deficiency, congenital MIM#610015, disorder of amino acid metabolism; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5756 | GTF3C5 |
Bryony Thompson gene: GTF3C5 was added gene: GTF3C5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GTF3C5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTF3C5 were set to 38520561; 35503477 Phenotypes for gene: GTF3C5 were set to neurodevelopmental disorder MONDO:0700092, GTF3C5-related Review for gene: GTF3C5 was set to GREEN gene: GTF3C5 was marked as current diagnostic Added comment: 4 families/probands with syndromic ID. Loss of function is the expected PMID: 38520561 - Biallelic variants identified (3 missense & 1 stopgain) in 4 individuals from 3 families presenting with multisystem developmental syndrome including the features: growth retardation, developmental delay, intellectual disability, dental anomalies, cerebellar malformations, delayed bone age, skeletal anomalies, and facial dysmorphism. Gene-disease relationship supported by: reduced protein expression in patient cells, yeast assays, and a zebrafish model PMID: 35503477 - 1 proband with biallelic missense variants and hypomelanosis of Ito, seizures, growth retardation, abnormal brain MRI, developmental delay, and facial dysmorphism Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5752 | DISP1 | Zornitza Stark Mode of inheritance for gene: DISP1 was changed from Other to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5750 | DISP1 |
Zornitza Stark edited their review of gene: DISP1: Added comment: PMID: 38529886 25 individuals from 20 unrelated families with a phenotype associated with mild holoprosencephaly (HPE). A total of 23 different variants were identified in DISP1 (missense, frameshift and nonsense). 14 heterozygous individuals , 5 compound heterozygous individuals, 6 homozygous individuals (5 of the individuals were from 3 unrelated consanguineous families). HPE phenotype was also seen prenatally as one of the reported monoallelic individuals was a fetus at 20+6 GW prior to passing due to MTP.; Changed publications: 19184110, 26748417, 23542665, 38529886; Changed phenotypes: Holoprosencephaly (MONDO:0016296), DISP1-related; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5748 | DOCK4 | Bryony Thompson Mode of inheritance for gene: DOCK4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5746 | DOCK4 |
Sangavi Sivagnanasundram changed review comment from: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).; to: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Two of the individuals are reportedly compound heterozygous. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5746 | DOCK4 |
Sangavi Sivagnanasundram changed review comment from: Well-established gene-disease association 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS).; to: 7 unrelated individuals reported with heterozygous variants (missense or null variants) in DOCK4. The individuals either had ID or DD between mild and moderate with brain abnormalities. Functional assay neuro-2A Dock4 knockout cells by using the Alt-R CRISPR-Cas9 system utilizing two different guide RNAs (ko1 and ko2) and one nonspecific control guide RNA (C: control). The assay depicted the loss of function mechanism in the presence of either p.Arg853Leu and p.Asp946_Lys1966delinsValSer* (described as 945VS). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5745 | FRYL |
Ain Roesley gene: FRYL was added gene: FRYL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FRYL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FRYL were set to 38479391 Phenotypes for gene: FRYL were set to neurodevelopmental disorder MONDO:0700092, FRYL-related Review for gene: FRYL was set to GREEN gene: FRYL was marked as current diagnostic Added comment: 14 individuals, all de novo except 1x duo testing (not present in tested father) 5x missense + 8x fs/stopgain + 1x canonical splice 13/13 with ID/DD (1x deceased) 4/14 seizures 7/14 with cardiac anomalies such as PDA, TOF, VSD, dextrocardia 1x also has a de novo fs variant in SF3B4 1x also has a de novo stop gain variant in SDHA functional studies using flies were performed Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5743 | KCNB2 |
Ain Roesley gene: KCNB2 was added gene: KCNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNB2 were set to 38503299 Phenotypes for gene: KCNB2 were set to neurodevelopmental disorder MONDO:0700092, KCNB2-related Review for gene: KCNB2 was set to GREEN gene: KCNB2 was marked as current diagnostic Added comment: 7 individuals, all missense 5 de novo + 1x inherited from father who has hypotonia + 1x from asymptomatic father 2/5 MRI anomalies 2/5 cardiac anomalies 2/7 urogenital anomalies 7/7 with ID 2/7 epilepsy 2/7 hypotonia Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5741 | PLXNB2 |
chirag patel gene: PLXNB2 was added gene: PLXNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLXNB2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLXNB2 were set to PMID: 38458752 Phenotypes for gene: PLXNB2 were set to Amelogenesis imperfecta MONDO:0019507, PLXNB2 -related; Sensorineural hearing loss disorder MONDO:0020678, PLXNB2 -related Review for gene: PLXNB2 was set to GREEN gene: PLXNB2 was marked as current diagnostic Added comment: 8 individuals from 6 families with core features of amelogenesis imperfecta and sensorineural hearing loss. Intellectual disability, ocular disease, ear developmental abnormalities and lymphoedema were also present in multiple cases. WES and WGS identified biallelic pathogenic variants in PLXNB2 (missense, nonsense, splice and a multiexon deletion variants). Variants segregated with disease. PLXNB2 is a large transmembrane semaphorin receptor protein, and semaphorin-plexin signalling controls cellular interactions that are critical during development as well as in adult life stages. Plxnb2 expression was detected in differentiating ameloblasts in mice. Human phenotype overlaps with that seen in Plxnb2 knockout mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5738 | CEP295 |
chirag patel gene: CEP295 was added gene: CEP295 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CEP295 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CEP295 were set to PMID: 38154379 Phenotypes for gene: CEP295 were set to Seckel syndrome 11, OMIM # 620767 Review for gene: CEP295 was set to GREEN gene: CEP295 was marked as current diagnostic Added comment: 4 children from 2 unrelated families with Seckel-like syndrome - severe primary microcephaly, short stature, developmental delay, intellectual disability, facial deformities, and abnormalities of fingers and toes. WES identified biallelic pathogenic variants in CEP295 gene (p(Q544∗) and p(R1520∗); p(R55Efs∗49) and p(P562L)). Patient-derived fibroblasts and CEP295-depleted U2OS and RPE1 cells were used to clarify the underlying mechanisms. Depletion of CEP295 resulted in a decrease in the numbers of centrioles and centrosomes and triggered p53-dependent G1 cell cycle arrest. Loss of CEP295 caused extensive primary ciliary defects in both patient-derived fibroblasts and RPE1 cells. The results from complementary experiments revealed that the wild-type CEP295, but not the mutant protein, can correct the developmental defects of the centrosome/centriole and cilia in the patient-derived skin fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5731 | FEM1B | Zornitza Stark edited their review of gene: FEM1B: Added comment: Five individuals reported now with same recurrent missense variant, NM_015322.5:c.377G>A NP_056137.1:p.(Arg126Gln). Affected individuals shared a severe neurodevelopmental disorder with behavioral phenotypes and a variable set of malformations, including brain anomalies, clubfeet, skeletal abnormalities, and facial dysmorphism. Overexpression of the the FEM1BR126Q variant but not FEM1B wild-type protein, during mouse brain development, resulted in delayed neuronal migration of the target cells.; Changed rating: GREEN; Changed publications: 31036916, 38465576; Changed phenotypes: Syndromic disease MONDO:0002254, FEM1B-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5729 | USP14 |
Zornitza Stark gene: USP14 was added gene: USP14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: USP14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: USP14 were set to 38469793; 35066879 Phenotypes for gene: USP14 were set to Syndromic disease MONDO:0002254, USP14-related Review for gene: USP14 was set to AMBER Added comment: AMBER rating as two of the families had affected fetuses, one had a severely affected newborn, and fourth had a progressive course: none fit well with ID, though there's likely to be a continuum. PMID 35066879: 3 fetuses from 2 different branches of a consanguineous family, presenting with distal arthrogryposis, underdevelopment of the corpus callosum, and dysmorphic facial features. Exome sequencing identified a biallelic 4-bp deletion (c.233_236delTTCC; p.Leu78Glnfs*11) in USP14, and sequencing of family members showed segregation with the phenotype. Ubiquitin-specific protease 14 (USP14) encodes a major proteasome-associated deubiquitinating enzyme with an established dual role as an inhibitor and an activator of proteolysis, maintaining protein homeostasis. Usp14-deficient mice show a phenotype similar to lethal human multiple congenital contractures phenotypes, with callosal anomalies, muscle wasting, and early lethality, attributed to neuromuscular junction defects due to decreased monomeric ubiquitin pool. RT-qPCR experiment in an unaffected heterozygote revealed that mutant USP14 was expressed, indicating that abnormal transcript escapes nonsense-mediated mRNA decay. PMID 38469793: biallelic USP14 variants in four individuals from three unrelated families: one fetus, a newborn with a syndromic NDD, and two siblings affected by a progressive neurological disease. Specifically, the two siblings from the latter family carried two compound heterozygous variants c.8T>C p.(Leu3Pro) and c.988C>T p.(Arg330*), while the fetus had a homozygous frameshift c.899_902del p.(Lys300Serfs*24) variant and the newborn patient harbored a homozygous frameshift c.233_236del p.(Leu78Glnfs*11) variant. The fetus and the newborn had extensive brain malformations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5728 | DOCK4 | Sangavi Sivagnanasundram reviewed gene: DOCK4: Rating: ; Mode of pathogenicity: None; Publications: PMID: 38526744; Phenotypes: DOCK4-related neurodevelopmental disorder (MONDO:0060490); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5726 | SLC32A1 | Zornitza Stark reviewed gene: SLC32A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 114, MIM# 620774; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5725 | CRELD1 | Zornitza Stark reviewed gene: CRELD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Jeffries-Lakhani neurodevelopmental syndrome, MIM# 620771; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5724 | SV2A | Zornitza Stark reviewed gene: SV2A: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 113, MIM# 620772; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5722 | PTRHD1 | Zornitza Stark Phenotypes for gene: PTRHD1 were changed from Parkinsonism; Intellectual disability to Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5721 | PTRHD1 | Zornitza Stark edited their review of gene: PTRHD1: Changed phenotypes: Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5721 | SLC4A10 | Zornitza Stark Phenotypes for gene: SLC4A10 were changed from Neurodevelopmental disorderMONDO:0700092, SLC4A10-related to Neurodevelopmental disorder with hypotonia and characteristic brain abnormalities, MIM# 620746 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5720 | SLC4A10 | Zornitza Stark reviewed gene: SLC4A10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and characteristic brain abnormalities, MIM# 620746; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5717 | CELSR3 |
Crystle Lee gene: CELSR3 was added gene: CELSR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELSR3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CELSR3 were set to PMID: 38429302 Phenotypes for gene: CELSR3 were set to Neurodevelopmental disorder (MONDO#0700092), CELSR3-related Review for gene: CELSR3 was set to GREEN Added comment: PMID: 38429302:12 affected individuals from 11 families reported with bi-allelic variants. Phenotype ranged from CNS anomalies (7/12), CNS and CAKUT (3/12) and CAKUT only (2/12). 8/12 has ID/DD. Only missense variants reported and 1 inframe variant. Functional studies done in zebrafish demonstrate similar structural anomalies of the developing pronephros and neuronal abnormalities to affected individuals Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5715 | ZSCAN10 |
Rylee Peters gene: ZSCAN10 was added gene: ZSCAN10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZSCAN10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZSCAN10 were set to PMID: 38386308 Phenotypes for gene: ZSCAN10 were set to Syndromic disease MONDO:0002254 Review for gene: ZSCAN10 was set to GREEN Added comment: Bi-allelic ZSCAN10 loss-of-function variants were identified in seven affected individuals from five unrelated families with syndromic neurodevelopmental disorder. Highly consistent phenotypic features include global developmental delay, behavioural abnormalities, and variable facial asymmetry with outer and inner ear malformations leading to profound SNHL. Facial asymmetry was recapitulated in the Zscan10 mouse model along with inner and outer ear malformations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5715 | SNF8 | Elena Savva Phenotypes for gene: SNF8 were changed from Severe developmental delay, epileptic encephalopathy, brain MRI abnormality; intellectual disability, childhood-onset optic atrophy, ataxia to Neurodevelopmental disorder (MONDO:0700092), SNF8-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5714 | SLC12A9 |
Zornitza Stark gene: SLC12A9 was added gene: SLC12A9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC12A9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC12A9 were set to 38334070 Phenotypes for gene: SLC12A9 were set to Neurodevelopmental disorder, MONDO:0700092, SLC12A9-related Review for gene: SLC12A9 was set to GREEN Added comment: Three individuals from unrelated families with bi-allelic LoF variants and a neurodevelopmental phenotype, skeletal abnormalities, brain abnormalities, hypopigmentation, dysmorphic features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5713 | DIP2C |
Melanie Marty gene: DIP2C was added gene: DIP2C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DIP2C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DIP2C were set to PMID: 38421105 Phenotypes for gene: DIP2C were set to Neurodevelopmental disorder (MONDO#0700092), DIP2C-related Review for gene: DIP2C was set to GREEN Added comment: PMID: 38421105 - Twenty three patients with het DIP2C variants (10 de novo). All patients had developmental delays affecting expressive language and speech, most had mild dev delay and ID. Four patients had seizures. Additional phenotypic findings were non-specific but recurrent anomalies did include a high anterior hair-line, prominent forehead, and a broad nasal tip. Four patients had cardiac defects (hypertrophic cardiomyopathy, atrial septal defects,and bicuspid aortic valve) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5712 | SNF8 |
Chern Lim gene: SNF8 was added gene: SNF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNF8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNF8 were set to 38423010 Phenotypes for gene: SNF8 were set to Severe developmental delay, epileptic encephalopathy, brain MRI abnormality; intellectual disability, childhood-onset optic atrophy, ataxia Review for gene: SNF8 was set to GREEN gene: SNF8 was marked as current diagnostic Added comment: PMID: 38423010 - Nine individuals from six families presenting with a spectrum of neurodevelopmental/neurodegenerative features caused by bi-allelic variants in SNF8. In total, three putative LoF variants and four missense variants were identified. - The phenotypic spectrum included four individuals with severe developmental and epileptic encephalopathy, massive reduction of white matter, hypo-/aplasia of the corpus callosum, neurodevelopmental arrest, and early death. A second cohort shows a milder phenotype with intellectual disability, childhood-onset optic atrophy, or ataxia. All mildly affected individuals shared the same hypomorphic variant, c.304G>A (p.Val102Ile) as compound heterozygous. - Functional studies using fibroblasts derived from patients and zebrafish model showed LoF is the disease mech. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5711 | POP1 | Belinda Chong reviewed gene: POP1: Rating: AMBER; Mode of pathogenicity: None; Publications: 38351533; Phenotypes: Anauxetic dysplasia 2, MIM#617396; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5711 | RREB1 |
Zornitza Stark gene: RREB1 was added gene: RREB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RREB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RREB1 were set to 32938917; 38332451 Phenotypes for gene: RREB1 were set to Rasopathy, MONDO:0021060, RREB1-related Review for gene: RREB1 was set to AMBER Added comment: PMID 32938917: Single individual reported with Noonan syndrome-like features and a deletion encompassing RREB1. Overlapping deletions in publicly reported databases examined, and RREB1 postulated to be the key gene. Rreb1 hemizygous mice display orbital hypertelorism and age dependent cardiac hypertrophy. RREB1 recruits SIN3A and KDM1A to an RRE in target promoters in human and murine cells to control histone H3K4 methylation of MAPK pathway genes. In summary, single well phenotyped individual with a CNV and experimental data to support gene-disease association. PMID 38332451: de novo LoF variant in an individual with phenotype consistent with the previous reports. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5709 | FEZF2 |
Ain Roesley gene: FEZF2 was added gene: FEZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FEZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FEZF2 were set to 38425142 Phenotypes for gene: FEZF2 were set to neurodevelopmental disorder MONDO:0700092, FEZF2-related Review for gene: FEZF2 was set to GREEN gene: FEZF2 was marked as current diagnostic Added comment: - 7 indiv but 1 has whole gene deletion and 6x SNV (4x PTCs and 2x same missense Arg344Cys) - of the 6x SNV, 4x de novo + 1x from affected father - all have ID/ASD - 1x seizures - 1x hypotonia - 1x motor coordination disorder - 2x enuresis after 7yo Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5706 | ZFX |
Sarah Leigh gene: ZFX was added gene: ZFX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZFX was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: ZFX were set to 26350204; 26740508; 38325380 Phenotypes for gene: ZFX were set to X-linked neurodevelopmental disorder with recurrent facial gestalt Review for gene: ZFX was set to GREEN Added comment: To date, germline variants in ZFX have not been associated with a phenotype in OMIM or Gen2Phen. A single ZFX variant has been associated with a neurodevelopmental disorder, that has a Rett syndrome-like phenotype disorder, in a 14 year old male. The ZFX variant was allelic with another X-linked variant in SHROOM4. These variants were inherited from the mother, who had random X inactivation pattern (PMID: 26740508). PMID: 38325380 reports 11 ZFX variants in 18 subjects from 16 unrelated families (14 males and 4 females) with an X-linked neurodevelopmental disorder with recurrent facial gestalt. Seven variants were truncating and the remaining were missense variants within the Zinc finger array. In the pedigree of family 6 (figure 3, PMID: 38325380), it was apparent that there were female carriers of the ZFX variant (GRCh38 chrX: 24229396A>G, c.2438A>G, p.Tyr774Cys) with hyperparathyroidism and two affected males and one affected female, with the neurodevelopmental disorder. It appeared that skewed X-inactivation in the female carriers was responsible for the different phenotypic features. The association between ZFX variants and a novel neurodevelopmental disorder, was further supported by functional studies showing altered transcriptional activity in missense variants and altered behavior in a zebrafish loss-of-function model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5706 | PI4K2A | Zornitza Stark Phenotypes for gene: PI4K2A were changed from complex neurodevelopmental disorder with motor features, PI4K2A-related, MONDO:0100516 to Neurodevelopmental disorder with hyperkinetic movements, seizures and structural brain abnormalities, MIM# 620732 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | CBL | Hali Van Niel reviewed gene: CBL: Rating: GREEN; Mode of pathogenicity: None; Publications: 20694012, 20543203, 11315197; Phenotypes: CBL-related disorder MONDO:0013308; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | CACNA1A | Hali Van Niel reviewed gene: CACNA1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 27476654, 33985586; Phenotypes: developmental and epileptic encephalopathy, 42 MONDO:0014917; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | C12orf65 | Hali Van Niel reviewed gene: C12orf65: Rating: GREEN; Mode of pathogenicity: None; Publications: 24284555, 20598281, 23188110, 24080142, PMID: 3479531; Phenotypes: hereditary spastic paraplegia 55 MONDO:0014020; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BTD | Hali Van Niel reviewed gene: BTD: Rating: GREEN; Mode of pathogenicity: None; Publications: 7550325, 9375914, 37751899, 32741581; Phenotypes: biotinidase deficiency MONDO:0009665; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BSCL2 | Hali Van Niel reviewed gene: BSCL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 12362029, 26072926, 28916377; Phenotypes: congenital generalized lipodystrophy type 2 MONDO:0010020; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BCS1L | Hali Van Niel reviewed gene: BCS1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 9777342, 17314340, 11528392, 30582773, 30582773, 25914718; Phenotypes: Bjornstad syndrome MONDO:0009872; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BCKDHB | Hali Van Niel reviewed gene: BCKDHB: Rating: GREEN; Mode of pathogenicity: None; Publications: 7672509, 11509994, 14742428; Phenotypes: maple syrup urine disease type 1B MONDO:0023692; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BCKDHA | Hali Van Niel reviewed gene: BCKDHA: Rating: GREEN; Mode of pathogenicity: None; Publications: 7883996, 7672509, 34288399; Phenotypes: maple syrup urine disease type 1A MONDO:0023691; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BBS2 | Hali Van Niel reviewed gene: BBS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 11285252, 11567139; Phenotypes: Bardet-Biedl syndrome 2 MONDO:0014432; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BBS12 | Hali Van Niel reviewed gene: BBS12: Rating: GREEN; Mode of pathogenicity: None; Publications: 17160889, 20827784; Phenotypes: Bardet-Biedl syndrome 12 MONDO:0014440; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BBS10 | Hali Van Niel reviewed gene: BBS10: Rating: GREEN; Mode of pathogenicity: None; Publications: 16582908, 20805367, 27245532; Phenotypes: Phenotype: Bardet-Biedl syndrome 10 MONDO:0014438; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | BBS1 | Hali Van Niel reviewed gene: BBS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12118255, 12677556, 12567324; Phenotypes: Bardet-Biedl syndrome 1 MONDO:0008854; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5705 | WASHC4 | Elena Savva Phenotypes for gene: WASHC4 were changed from ?Mental retardation, autosomal recessive 43; OMIM #615817 to Intellectual developmental disorder, autosomal recessive 43 MIM#615817 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5704 | PUM1 | Zornitza Stark Phenotypes for gene: PUM1 were changed from Spinocerebellar ataxia 47, MIM#617931; intellectual disability; epilepsy to Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5703 | PUM1 | Zornitza Stark edited their review of gene: PUM1: Changed phenotypes: Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5703 | PUM1 | Zornitza Stark edited their review of gene: PUM1: Changed phenotypes: Spinocerebellar ataxia 47, MIM#617931, Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5703 | TRMT1 | Elena Savva Phenotypes for gene: TRMT1 were changed from Mental retardation, autosomal recessive 68; OMIM #618302 to Intellectual developmental disorder, autosomal recessive 68 MIM#618302 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5700 | HMBS |
Zornitza Stark gene: HMBS was added gene: HMBS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: HMBS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HMBS were set to 15534187 Phenotypes for gene: HMBS were set to Encephalopathy, porphyria-related MIM#620704; Leukoencephalopathy, porphyria-related, MIM#620711 Review for gene: HMBS was set to GREEN Added comment: Several families reported with encephalopathy/leukoencephalopathy and ballelic variants in this gene. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5699 | DDX3X |
Abhijit Kulkarni changed review comment from: Genotype-Phenotype Correlations Females. Affected females with a subset of missense variants generally are more severely affected than those with truncating variants [Lennox et al 2020]. Polymicrogyria has been associated with missense or in-frame deletions [Lennox et al 2020]. Males. While all affected males have had missense DDX3X variants (see Table 6), their female relatives who are heterozygous for the same DDX3X variant do not manifest an atypical neurodevelopmental phenotype.; to: Genotype-Phenotype Correlations Females. Affected females with a subset of missense variants generally are more severely affected than those with truncating variants PMID: 32135084 Polymicrogyria has been associated with missense or in-frame deletions PMID: 32135084 Males. While all affected males have had missense DDX3X variants , their female relatives who are heterozygous for the same DDX3X variant do not manifest an atypical neurodevelopmental phenotype. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5698 | FBXO31 | Lucy Spencer reviewed gene: FBXO31: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 45 (MIM#615979); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5698 | TET3 | Elena Savva Phenotypes for gene: TET3 were changed from Intellectual disability; dysmorphic features; abnormal growth; movement disorders to Beck-Fahrner syndrome MIM#618798 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5695 | TAF1C | Elena Savva Phenotypes for gene: TAF1C were changed from Global developmental delay; Intellectual disability; Spasticity; Strabismus; Seizures; Abnormality of nervous system morphology to Neurodevelopmental disorder (MONDO#0700092), TAF1C-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5692 | ASCC3 |
Zornitza Stark gene: ASCC3 was added gene: ASCC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: ASCC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ASCC3 were set to 21937992; 35047834 Phenotypes for gene: ASCC3 were set to Intellectual developmental disorder, autosomal recessive 81, MIM# 620700 Review for gene: ASCC3 was set to GREEN Added comment: Combined neuromuscular and neurobehavioral phenotype. 11 individuals from 7 unrelated families with homozygous (missense) or compound heterozygous variants (missense with a presumed LoF variant or 2 missense, no biallelic LoF) with a neurologic phenotype that ranges from severe developmental delay to muscle fatigue Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5690 | SYN1 | Zornitza Stark Mode of inheritance for gene: SYN1 was changed from BIALLELIC, autosomal or pseudoautosomal to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5687 | WDR44 |
Zornitza Stark gene: WDR44 was added gene: WDR44 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR44 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: WDR44 were set to 38191484 Phenotypes for gene: WDR44 were set to Ciliopathy, MONDO:0005308, WDR44-related Review for gene: WDR44 was set to GREEN Added comment: 11 male patients with 6 missense and 1 nonsense variant in WDR44 displaying a wide range of cognitive impairment and variable congenital anomalies associated with primary cilium dysfunction. All patients had learning difficulties with 8 labelled as intellectually disabled (mild-moderate). Other clinical features included anomalies of craniofacial, musculoskeletal, brain, renal and cardiac development. WDR44 is a negative regulator of ciliogenesis. Increased binding is hypothesised to underlie the pathogenicity of WDR44 variants identified in this cohort. Functional data supported impaired ciliogenesis initiation in patient fibroblasts and a zebrafish model. A zebrafish model recapitulated the human phenotype when morphants expressed WDR44 L668S, D669N, S764F, G782C, H839R, and R733* variants. Of note, D648G or N840S did not recapitulate the phenotype in the zebrafish model. The studies supported a GoF mechanism, but the authors could not rule out that LoF of WDR44 contributes to the ciliopathy-like phenotype observed, because protein expression data was only available for a limited number of patients. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5685 | ACACA |
Zornitza Stark gene: ACACA was added gene: ACACA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ACACA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ACACA were set to 34552920; 10677481; 16717184; 36709796 Phenotypes for gene: ACACA were set to Acetyl-CoA carboxylase deficiency, MIM# 613933 Review for gene: ACACA was set to AMBER Added comment: Two families with molecular testing, missense variants, supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5683 | SP9 |
Suliman Khan gene: SP9 was added gene: SP9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SP9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SP9 were set to PMID: 38288683 Phenotypes for gene: SP9 were set to neurodevelopmental disorder MONDO:0700092 Review for gene: SP9 was set to GREEN Added comment: PMID: 38288683: reported 5 unrelated patients with de novo heterozygous variants (missense and PTV) in SP9 gene. In silico and in vitro studies suggested a novel form of interneuronopathy with variable severity depending on the presence of loss or gain of function variants. Patients with loss-of-function variants had ID, ASD, and epilepsy, whereas missense variants in the second C2H2 binding domain result in hypomorphic and neomorphic DNA binding functions that cause severe epileptic encephalopathy. The author suggested a novel form of interneuronopathy with variable severity depending on the presence of loss or gain of function variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5682 | CAMK2D |
Elena Savva gene: CAMK2D was added gene: CAMK2D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CAMK2D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CAMK2D were set to PMID: 38272033 Phenotypes for gene: CAMK2D were set to Neurodevelopmental disorder (MONDO#0700092), CAMK2D-related Review for gene: CAMK2D was set to GREEN Added comment: PMID: 38272033 - 8 patients (5/8 de novo) with mostly missense and a single splice site variant, ages range from 5 weeks to 20 years old - Most variants functionally shown to have a GOF mechanism causing addition DCM phenotype, LOF is only neurological - Phenotypes include dev delay (mild-severe) (7/7 patients), skeletal anomalies (7/8, scoliosis, kyphosis, involving spine/hands/feet/palate), DCM (6/8), seizures (3/8), visual anomalies (astigmatism, cortical vision impairment, myopia, strabismus 5/5), enlarged brain ventricles (3/5) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5675 | POLR1A | Zornitza Stark Mode of inheritance for gene: POLR1A was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5674 | POLR1A | Zornitza Stark reviewed gene: POLR1A: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 27, MIM# 620675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5671 | KCTD13 | Elena Savva Mode of inheritance for gene: KCTD13 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5666 | PPFIA3 |
Zornitza Stark gene: PPFIA3 was added gene: PPFIA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPFIA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPFIA3 were set to 37034625 Phenotypes for gene: PPFIA3 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA3-related Review for gene: PPFIA3 was set to GREEN Added comment: 19 individuals with mono-allelic variants presenting with features including developmental delay, intellectual disability, hypotonia, micro/macrocephaly, autism, and epilepsy. One individual with compound het variants: insufficient evidence for bi-allelic variants causing disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5661 | MAX |
Rylee Peters gene: MAX was added gene: MAX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAX were set to 38141607 Phenotypes for gene: MAX were set to Syndromic disease (MONDO:0002254), MAX-related Review for gene: MAX was set to GREEN Added comment: Three individuals who each share a recurrent de novo germline variant in the MAX gene, resulting in a p.Arg60Gln substitution in the loop of the b-HLH-LZ domain. Affected individuals have a complex disorder consisting primarily of macrocephaly, polydactyly, and delayed ophthalmic development. Other phenotypes reported include intellectual disability, perianal abscesses, pectus carinatum, hypospadias, renal agenesis, single umbilical artery, flattened thoracic vertebrae. Functional analysis of the p.Arg60Gln variant shows a significant increase in CCND2 protein and a more efficient heterodimerization with c-Myc resulting in an increase in transcriptional activity of c-Myc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5660 | ZRSR2 |
Chris Ciotta gene: ZRSR2 was added gene: ZRSR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZRSR2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: ZRSR2 were set to PMID: 38158857 Phenotypes for gene: ZRSR2 were set to Orofacialdigital syndrome MONDO:0015375, ZRSR2-related Review for gene: ZRSR2 was set to GREEN Added comment: Oral-facial-digital (OFD) syndrome with brain anomalies ranging from alobar holoprosencephaly to pituitary anomalies. Six unrelated families with two truncating variants and functional studies: - p.(Gly404GlufsTer23): detected in one family with 2x affected males - p.(Arg403GlyfsTer24): 5 unrelated families, both de novo and inherited Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5660 | BORCS8 |
Lauren Rogers changed review comment from: 3 unrelated families with five affected children with homozygous or compound heterozygous loss of function missense and PTC variants. HEK293T cells show the missense variants are expressed at normal levels but exhibit reduced assembly with other BORC subunits and reduced ability to drive lysosome distribution. The BORCS8 PTC frameshift variant is expressed at lower levels and is completely incapable of assembling with other BORC subunits and promoting lysosome distribution. Zebrafish KO of the orthologous brocs8 causes decreased brain and eye size, neuromuscular anomalies and impaired locomotion, recapitulating some of the key traits of the human disease. Sources: Literature; to: 3 unrelated families with five affected children with homozygous or compound heterozygous loss of function missense and PTC variants. 5/5 hypotonia, failure to thrive, global developmental delay, profound intellectual disability, muscle weakness and atrophy, dysmorphic features. 3/5 with microcephaly, 3/5 with seizures, 4/5 with spasticity, 3/5 with scoliosis, 4/4 with optic atrophy. HEK293T cells show the missense variants are expressed at normal levels but exhibit reduced assembly with other BORC subunits and reduced ability to drive lysosome distribution. The BORCS8 PTC frameshift variant is expressed at lower levels and is completely incapable of assembling with other BORC subunits and promoting lysosome distribution. Zebrafish KO of the orthologous brocs8 causes decreased brain and eye size, neuromuscular anomalies and impaired locomotion, recapitulating some of the key traits of the human disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5660 | SOX8 |
Paul De Fazio changed review comment from: Proband presented to genetics clinic at 27 years of age with BMI -3.4SD, height -2.7SD, head circumference -1.8SD. She had mild intellectual delay and clinical features of a congenital, nonprogressive myopathy with moderate proximal and distal weakness. X-rays showed skeletal dysplasia, including cervical thoracic scoliosis and lumbar scoliosis. She was reported as having had weakness at birth with poor suck, micrognathia, hypotonia, and talipes. She was documented to have significant motor delay as a child. MRI of the brain demonstrated large posterior fossa CSF spaces. Biallelic SOX8 variants biallelic (NM_014587.3:c.422+5G>C; c.583dup p.(His195ProfsTer11)) were identified by WGS. The +5 variant was shown to affect splicing, while the frameshift variant resulted in production of low-level truncated protein (not NMD predicted). Sources: Literature; to: Proband presented to genetics clinic at 27 years of age with BMI -3.4SD, height -2.7SD, head circumference -1.8SD. She had mild intellectual delay and clinical features of a congenital, nonprogressive myopathy with moderate proximal and distal weakness. X-rays showed skeletal dysplasia, including cervical thoracic scoliosis and lumbar scoliosis. She was reported as having had weakness at birth with poor suck, micrognathia, hypotonia, and talipes. She was documented to have significant motor delay as a child. MRI of the brain demonstrated large posterior fossa CSF spaces. Biallelic SOX8 variants biallelic (NM_014587.3:c.422+5G>C; c.583dup p.(His195ProfsTer11)) were identified by WGS. The +5 variant was shown to affect splicing, while the frameshift variant resulted in production of low-level truncated protein (not NMD predicted). Functional studies on patient fibroblasts showed misregulation of downstream SOX8 targets. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5660 | CACHD1 |
Suliman Khan gene: CACHD1 was added gene: CACHD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACHD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CACHD1 were set to PMID: 38158856 Phenotypes for gene: CACHD1 were set to syndromic complex neurodevelopmental disorder MONDO:0800439 Penetrance for gene: CACHD1 were set to unknown Review for gene: CACHD1 was set to GREEN Added comment: PMID: 38158856 - Six affected individuals from four unrelated families with homozygous CACHD1 variants (3 splice, 2 frameshift and 1 nonsense variant). Excluding the two fatal cases, all other were affected by syndromic neurodevelopmental abnormalities, multiple organ systems featuring global impairment of psychomotor development, dysmorphic facial features, genitourinary abnormalities, oculo-auricular and congenital malformation. Seizure was reported in one case. Whole exome sequencing identified bi-allelic loss of function variants in the CACHD1 gene. In vitro human neural models of CACHD1 depletion displayed dysregulated of Wnt signaling in the developing brain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5660 | SOX8 |
Paul De Fazio gene: SOX8 was added gene: SOX8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SOX8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SOX8 were set to https://www.neurology.org/doi/full/10.1212/NXG.0000000000200088 Phenotypes for gene: SOX8 were set to Neurodevelopmental disorder (MONDO:0700092), SOX8-related Review for gene: SOX8 was set to RED gene: SOX8 was marked as current diagnostic Added comment: Proband presented to genetics clinic at 27 years of age with BMI -3.4SD, height -2.7SD, head circumference -1.8SD. She had mild intellectual delay and clinical features of a congenital, nonprogressive myopathy with moderate proximal and distal weakness. X-rays showed skeletal dysplasia, including cervical thoracic scoliosis and lumbar scoliosis. She was reported as having had weakness at birth with poor suck, micrognathia, hypotonia, and talipes. She was documented to have significant motor delay as a child. MRI of the brain demonstrated large posterior fossa CSF spaces. Biallelic SOX8 variants biallelic (NM_014587.3:c.422+5G>C; c.583dup p.(His195ProfsTer11)) were identified by WGS. The +5 variant was shown to affect splicing, while the frameshift variant resulted in production of low-level truncated protein (not NMD predicted). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5660 | BORCS8 |
Lauren Rogers gene: BORCS8 was added gene: BORCS8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BORCS8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BORCS8 were set to 38128568 Phenotypes for gene: BORCS8 were set to Neurodevelopmental disorder (MONDO#0700092), BORCS8-related Review for gene: BORCS8 was set to GREEN Added comment: 3 unrelated families with five affected children with homozygous or compound heterozygous loss of function missense and PTC variants. HEK293T cells show the missense variants are expressed at normal levels but exhibit reduced assembly with other BORC subunits and reduced ability to drive lysosome distribution. The BORCS8 PTC frameshift variant is expressed at lower levels and is completely incapable of assembling with other BORC subunits and promoting lysosome distribution. Zebrafish KO of the orthologous brocs8 causes decreased brain and eye size, neuromuscular anomalies and impaired locomotion, recapitulating some of the key traits of the human disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5659 | GTPBP1 |
Lucy Spencer gene: GTPBP1 was added gene: GTPBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GTPBP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTPBP1 were set to 38118446 Phenotypes for gene: GTPBP1 were set to Neurodevelopmental disorder (MONDO#0700092), GTPBP1-related Review for gene: GTPBP1 was set to GREEN Added comment: PMID: 38118446- Cohort of individuals with variants in GTPBP2 (which has been previously described) and GTPBP1 (new) who have an identical neurodevelopmental syndrome. 4 homozygous individuals from 3 consanguineous families. 2 families have different NMD-predicted nonsense variants and the third has a missense, all are absent from gnomad v4. The shared cardinal features of GTPBP1 and 2 related disease are microcephaly, profound neurodevelopmental impairment, and distinctive craniofacial features. Epilepsy was present in 10 of 20 individuals but its not clear if those individuals had GTPBP1 or 2 variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5659 | PUS3 | Zornitza Stark Phenotypes for gene: PUS3 were changed from Mental retardation, autosomal recessive 55, MIM# 617051 to Neurodevelopmental disorder with microcephaly and gray sclerae, MIM# 617051 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5654 | PRICKLE2 | Zornitza Stark reviewed gene: PRICKLE2: Rating: AMBER; Mode of pathogenicity: None; Publications: 34092786, 21276947, 26942291, 26942292; Phenotypes: Neurodevelopmental disorder MONDO:0700092, PRICKLE2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5653 | ERI1 | Zornitza Stark reviewed gene: ERI1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hoxha-Aliu syndrome, MIM# 620662; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5653 | ALG8 | Rylee Peters reviewed gene: ALG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 35716054; Phenotypes: Congenital disorder of glycosylation, type Ih, MIM# 608104; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5653 | PDE2A | Lauren Rogers reviewed gene: PDE2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 32467598, 29392776, 37317634; Phenotypes: Intellectual developmental disorder with paroxysmal dyskinesia or seizures MIM#619150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5653 | RAP1B | Zornitza Stark Phenotypes for gene: RAP1B were changed from Syndromic disease, MONDO:0002254, RAP1B-related to Thrombocytopenia 1 with multiple congenital anomalies and dysmorphic facies, MIM# 620654 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5652 | RAP1B | Zornitza Stark edited their review of gene: RAP1B: Changed phenotypes: Thrombocytopenia 1 with multiple congenital anomalies and dysmorphic facies, MIM# 620654 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5652 | GPT2 | Zornitza Stark Phenotypes for gene: GPT2 were changed from Mental retardation, autosomal recessive 49, MIM#616281 to Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5650 | CASP2 | Zornitza Stark Phenotypes for gene: CASP2 were changed from neurodevelopmental disorder MONDO:0700092, CASP2-related to Intellectual developmental disorder, autosomal recessive 80, with variant lissencephaly, MIM# 620653 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5649 | CASP2 | Zornitza Stark reviewed gene: CASP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 80, with variant lissencephaly, MIM# 620653; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5647 | CAPRIN1 | Zornitza Stark reviewed gene: CAPRIN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 36136249; Phenotypes: Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5646 | MANF |
Zornitza Stark gene: MANF was added gene: MANF was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: MANF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MANF were set to 26077850; 33500254; 34815294 Phenotypes for gene: MANF were set to Diabetes, deafness, developmental delay, and short stature syndrome, MIM# 620651 Review for gene: MANF was set to AMBER Added comment: Two individuals reported with homozygous variants. Mouse model recapitulates deafness phenotype. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5643 | GCDH | Zornitza Stark Mode of inheritance for gene: GCDH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5642 | GCDH | Zornitza Stark reviewed gene: GCDH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Glutaric aciduria, type I MIM#231670; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5641 | PRPF19 |
Zornitza Stark gene: PRPF19 was added gene: PRPF19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRPF19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRPF19 were set to 37962958 Phenotypes for gene: PRPF19 were set to Neurodevelopmental disorder (MONDO:0700092), PRPF19-related Review for gene: PRPF19 was set to GREEN Added comment: PMID: 37962958 Six unrelated individuals with de novo variants. Five had speech language motor delay, four had formal diagnosis of autism, three hypotonia and one fetus with multiple congenital abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5641 | PRPF19 |
Zornitza Stark gene: PRPF19 was added gene: PRPF19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRPF19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRPF19 were set to 37962958 Phenotypes for gene: PRPF19 were set to Neurodevelopmental disorder (MONDO:0700092), PRPF19-related Review for gene: PRPF19 was set to GREEN Added comment: PMID: 37962958 Six unrelated individuals with de novo variants. Five had speech language motor delay, four had formal diagnosis of autism, three hypotonia and one fetus with multiple congenital abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5639 | PLA2G16 | Zornitza Stark Mode of inheritance for gene: PLA2G16 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5631 | SV2A |
Karina Sandoval gene: SV2A was added gene: SV2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SV2A was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: SV2A were set to PMID: 37985816 Phenotypes for gene: SV2A were set to Epilepsy, MONDO:0005027; microcephaly MONDO:0001149; intellectual disability MONDO:0001071 Review for gene: SV2A was set to AMBER Added comment: Monoallelic variants cause epilepsy. Biallelic variant in this 5yo with p.Arg289Ter and another 5yo from another paper with homozygous p.Arg383Gln, reported to cause severe phenotype of drug-resistant epileptic encephalopathy with microcephaly, DD, movement disorder and growth retardation. This paper references 5 other families with both AR & AD Family #1 – p.Arg383Gln, AR, 2 affected in family, parents healthy carriers Family #2 – p.Arg570Cys, AD, 2 affected, inherited from affected mother (in gnomAD v2 1 het, absent from gnomAD v3) Family #3 – p.Gly660Arg, AD, de novo Family #4 – p.Gly660Arg, AD, segregated in 11 family members Family #5 (this study) – p.Arg289Ter, AR, parents and 2 sibs asymptomatic carriers Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5631 | FUK | Lisa Norbart reviewed gene: FUK: Rating: AMBER; Mode of pathogenicity: None; Publications: (PMID: 35718084, 36426412); Phenotypes: Congenital disorder of glycosylation with defective fucosylation 2 (MIM#618324); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5631 | CRELD1 |
Naomi Baker gene: CRELD1 was added gene: CRELD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CRELD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRELD1 were set to PMID: 37947183 Phenotypes for gene: CRELD1 were set to Neurodevelopmental disorder (MONDO:0700092), CRELD1-related Review for gene: CRELD1 was set to GREEN Added comment: Publication reports 18 individuals from 14 unrelated families affected by biallelic recessive variants in CRELD1, presenting with early-onset neurodevelopmental features, most notably hypotonia and epilepsy, with developmental plateauing and slowly progressive nonneurologic medical complexities in survivors, including cardiac rhythm disturbances and frequent infections. Most individuals have a missense variant in trans with a putative null allele. Four variants were re-current: p.(Cys192Tyr) in 10 families, p.(Gln320Argfs) in 5 families, p.(Ala377Thrfs) in 2 families, and p.(Met369Val) also in 2 families. Some functional studies also reported (Xenopus tropicalis). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5631 | RAB1A |
Chris Ciotta gene: RAB1A was added gene: RAB1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB1A were set to PMID: 37924809 Phenotypes for gene: RAB1A were set to neurodevelopmental disorder MONDO:0700092, CASP2-related Review for gene: RAB1A was set to AMBER Added comment: 4 families and 5 individuals, 2/5 have speech delay and 4/5 have motor delay. Anxiety in 3/5 and autism in 2/5. Microcephaly in only one individual, spastic paraplegia observed in 2 individuals from one family. In 2 families variants were inherited from an affected parent. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5628 | PLA2G16 | Lauren Rogers reviewed gene: PLA2G16: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37919452; Phenotypes: Lipodystrophy (MONDO:0006573); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5628 | PLA2G16 | Lauren Rogers reviewed gene: PLA2G16: Rating: ; Mode of pathogenicity: None; Publications: PMID: 37919452; Phenotypes: Lipodystrophy (MONDO:0006573); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5628 | PLA2G16 | Lauren Rogers reviewed gene: PLA2G16: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37919452; Phenotypes: Lipodystrophy (MONDO:0006573); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5628 | PLA2G16 |
Lauren Rogers gene: PLA2G16 was added gene: PLA2G16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLA2G16 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PLA2G16 were set to PMID: 37919452 Phenotypes for gene: PLA2G16 were set to Lipodystrophy (MONDO:0006573) Added comment: 7 patients from 4 unrelated consanguineous families with homozygous loss of function PTC variants. Features: 4/7 metabolic features, 6/7 neurological/skeletal features, 3/7 Psychomotor retardation/intellectual disability, 5/7 demyelinating peripheral neuropathy. Null mouse and patient derived white adipose tissue showed enrichment of arachidonic acid-containing membrane phospholipids and a strong decrease in PPARγ. CRISPR–Cas9-mediated PLAAT3 inactivation in human adipose stem cells induced insulin resistance, altered adipocyte differentiation with decreased lipid droplet formation and reduced the expression of adipogenic and mature adipocyte markers, including PPARγ. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5628 | MARK4 |
Rylee Peters changed review comment from: Missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother. Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway. Sources: Literature; to: Heterozygous missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother. Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5627 | DDX17 |
Melanie Marty gene: DDX17 was added gene: DDX17 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DDX17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DDX17 were set to https://www.medrxiv.org/search/DDX17 Phenotypes for gene: DDX17 were set to Neurodevelopmental disorder (MONDO#0700092), DDX17-related Review for gene: DDX17 was set to GREEN Added comment: https://www.medrxiv.org/search/DDX17 (pre-print) 11 patients with het de novo variants in DDX17 (5 NMD, 6 missense). Patient's phenotype included mild-moderate intellectual disability, delayed speech and language development and global developmental delay. 64% had dysmorphic facial features. Some patients also have gross and fine motor delay, generalized hypotonia, stereotypy, and evidence of autism spectrum disorder. Knockdown of Ddx17 in newborn mice showed impaired axon outgrowth and reduced axon outgrowth and branching was observed in primary cortical neurons in vitro. This result was replicated in Crispant Xenopus tadpoles, which had clear functional neural defects and showed an impaired neurobehavioral phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5627 | MARK4 |
Rylee Peters gene: MARK4 was added gene: MARK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MARK4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MARK4 were set to PMID: 38041405 Phenotypes for gene: MARK4 were set to neurodevelopmental disorder (MONDO:0700092), MARK4-related Mode of pathogenicity for gene: MARK4 was set to Other Review for gene: MARK4 was set to AMBER gene: MARK4 was marked as current diagnostic Added comment: Missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother. Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5627 | SEL1L |
Sarah Pantaleo gene: SEL1L was added gene: SEL1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SEL1L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SEL1L were set to PMID: 37943610; PMID: 37943617 Phenotypes for gene: SEL1L were set to Neurodevelopmental disorder, MONDO:0700092, SEL1L-related Penetrance for gene: SEL1L were set to Complete Review for gene: SEL1L was set to GREEN Added comment: Wang paper PMID: 37943610 SEL1L protein is involved in the SEL1L-HRD1 endoplasmic reticulum (ER)-associated degradation. Report two biallelic missense variants in SEL1L in six children from three independent families presenting with developmental delay, intellectual disability, microcephaly, facial dysmorphisms, hypotonia and/or ataxia (termed ERAD-associated neurodevelopment disorder with onset in infancy (ENDI). The variants were hypomorphic and impaired ERAD function. Identified by WES. Parents heterozygous and asymptomatic. P.(Gly585Asp) in Patient 1, p.(Met528Arg) in Patients 2 and 3 (siblings). All variants cause substrate accumulation. The extent of substrate accumulation in knockin cells was modest compared to those in knockout cells, pointing to a hypomorphic nature. They also had a variant in HRD1. Weis paper PMID: 37943617 Third variant p.(Cys141Tyr), biallelic, causing premature death in five patients from a consanguineous family with early-onset neurodevelopmental disorders and agammaglobulinaemia due to severe SEL1L-HRD1 ERAD dysfunction. This variant appears to have a more severe outcome, exhibiting B cell depletion and agammaglobulinaemia, causing the most severe dysfunction among all of the variants described by this group so far. They postulate that functionality of SEL1L-HRD1 ERAD is inversely correlated with disease severity in humans. Their symptoms were dev delay, neurological disorder and agammaglobulinaemia in childhood. Along with severe axial hypotonia, short stature and microcephaly. “Not a complete loss-of-function variant”. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5624 | RBFOX1 | Dean Phelan reviewed gene: RBFOX1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37962958; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), RBFOX1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5624 | PPID |
Elena Savva gene: PPID was added gene: PPID was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPID was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PPID were set to 37977818 Phenotypes for gene: PPID were set to Stutter disorder, (MONDO:0000723), PPID-related Review for gene: PPID was set to RED Added comment: PMID: 37977818 - a large family (10 affected confirmed to have the variant) with stuttering/language disorder and a het missense (p.(Pro270Ser)). Mouse K/I model showed microstructural changes in the corticospinal tract Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5622 | GRIA3 | Zornitza Stark Mode of inheritance for gene: GRIA3 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5621 | GRIA3 | Zornitza Stark reviewed gene: GRIA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 38038360; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, Wu type (MIM#300699); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5619 | WBP4 | Zornitza Stark reviewed gene: WBP4: Rating: GREEN; Mode of pathogenicity: None; Publications: 37963460; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, WBP4-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5618 | WNK3 | Zornitza Stark reviewed gene: WNK3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Prieto syndrome, MIM# 309610; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5618 | WDR11 | Elena Savva Mode of inheritance for gene: WDR11 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5616 | DOT1L |
Zornitza Stark gene: DOT1L was added gene: DOT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DOT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DOT1L were set to 37827158 Phenotypes for gene: DOT1L were set to Neurodevelopmental disorder, MONDO:0700092, DOT1L-related Mode of pathogenicity for gene: DOT1L was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: DOT1L was set to GREEN Added comment: Nine individuals reported with seven de novo missense variants. All had DD/ID and variable patterns of associated congenital anomalies. Variants demonstrated to be GoF and lead to increased H3K79 methylation levels in flies and human cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5615 | PBX1 | Zornitza Stark Phenotypes for gene: PBX1 were changed from to Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, OMIM #617641 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5614 | PBX1 | Zornitza Stark Mode of inheritance for gene: PBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5613 | PBX1 | chirag patel reviewed gene: PBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, OMIM #617641; Phenotypes: Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, OMIM #617641; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5611 | KCNA3 | Zornitza Stark reviewed gene: KCNA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 37964487; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, KCNA3-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5610 | FOXP4 | Elena Savva Phenotypes for gene: FOXP4 were changed from Neurodevelopmental disorder; multiple congenital abnormalities to Neurodevelopmental disorder (MONDO#0700092), FOXP4-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5606 | VCP |
Manny Jacobs gene: VCP was added gene: VCP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: VCP were set to PMID: 37883978 Phenotypes for gene: VCP were set to Neurodevelopmental disorder (MONDO: 0700092) Review for gene: VCP was set to GREEN Added comment: 13 unrelated individuals with childhood onset ID/DD disorder including macrocephaly, hypotonia and dysmorphic features. Non-specific / mild MRI findings. 12 de novo - 1 inherited Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5602 | SGSM3 |
Dean Phelan gene: SGSM3 was added gene: SGSM3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SGSM3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SGSM3 were set to PMID: 37833060 Phenotypes for gene: SGSM3 were set to Neurodevelopmental disorder (MONDO:0700092), SGSM3-related Review for gene: SGSM3 was set to GREEN Added comment: PMID: 37833060 - 13 patients from 8 families of Ashkenazi Jewish origin all had the same homozygous frameshift variant (c.981dup). Predicted to cause NMD. The variant co-segregated with disease in all available family members. The affected individuals displayed mild global developmental delay and mild to moderate intellectual disability. Additional prevalent phenotypes observed included hypotonia, behavioural challenges and short stature. Considered a founder variant (1 in 52 Ashkenazi Jews carry the variant). Also present in other populations but no homozygotes in gnomAD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5602 | AGPAT3 |
Ee Ming Wong gene: AGPAT3 was added gene: AGPAT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AGPAT3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AGPAT3 were set to PMID: 37821758 Phenotypes for gene: AGPAT3 were set to Neurodevelopmental disorder (MONDO#0700092), AGPAT3-related Review for gene: AGPAT3 was set to GREEN gene: AGPAT3 was marked as current diagnostic Added comment: - Single consanguineous family with four individuals with severe intellectual disability and retinitis pigmentosa - All affected individuals were homozygous for a nonsense variant in AGPAT3, healthy unaffected individuals who were tested were heterozygous for the variant - Overexpression of mutant transcript revealed absence of AGPAT3 protein compared to WT transcript via Western blot analysis - KO AGPAT3 mouse demonstrated impaired neuronal migration Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5601 | DLG2 |
Elena Savva gene: DLG2 was added gene: DLG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DLG2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DLG2 were set to PMID: 37860969 Phenotypes for gene: DLG2 were set to Intellectual disability (MONDO#0001071), DLG2-related Review for gene: DLG2 was set to AMBER Added comment: PMID: 37860969 - 13 patients from 10 families with neurodevelopmental disorders, dysmorphic features and intragenic deletions including both exonic (minimal affect all transcripts) and UTR regions. Majority of variants were inherited, some de novo. But many NMD PTCs in gnomAD (some looking messy, in noncanonical transcript etc.) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5599 | CASP2 |
Ain Roesley gene: CASP2 was added gene: CASP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CASP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CASP2 were set to 37880421 Phenotypes for gene: CASP2 were set to neurodevelopmental disorder MONDO:0700092, CASP2-related Penetrance for gene: CASP2 were set to Complete Review for gene: CASP2 was set to GREEN gene: CASP2 was marked as current diagnostic Added comment: 7 patients from 5 families 4 families hom for PTCs, 1 family Chet for splice+PTC RNA studies done for the splice to indicate usage of 2 cryptic splice donor sites 5/5 have ID/dev delay 1/5 has seizures 2/5 hypotonia 3/5 lissencephaly (pachygyria and cortical thickening) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5598 | ELP1 |
Sarah Pantaleo gene: ELP1 was added gene: ELP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ELP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ELP1 were set to PMID: 36864284 Phenotypes for gene: ELP1 were set to Neurodevelopmental disorder, MONDO:0700092, ELP1-related Review for gene: ELP1 was set to RED Added comment: “A novel ELP1 mutation impairs the function of the Elongator complex and causes a severe neurodevelopment disorder”. The Elongator complex is suggested to play a role in NDDs, given that patient-derived mutations in its ELP2, ELP3, ELP4 and ELP6 subunits have been associated with these disorders. Pathogenic variants in ELP1 have been previously found in familial dysautonomia and medulloblastoma, with no link to NDDs affecting primarily the central nervous system. Clinical investigation included patient history and physical, neurological and MRI. A novel homozygous likely pathogenic ELP1 variant was identified by WGS (absent from gnomAD). Functional studies included in silico analysis of the mutated ELP1 in the context of the holo-complex, production and purification of the ELP1 harbouring the identified mutation and in vitro analyses. Report a novel missense mutation in the ELP1 identified in two siblings with ID and GDD (both less than 10 years old). The mutation is shown to perturb the ability of ELP123 to bind tRNAs and compromises the function of the Elongator in vitro and in human cells. Both sibling are non-verbal and had severe ID/GDD. MRI revealed white matter lesions with enlarged perivascular spaces, suggestive of an inflammatory reaction associate with demyelination. WGS identified c.2444A>C; p.(Lys815Thr), homozygous in both siblings. Consanguineous family. Parents heterozygous and asymptomatic. Carry out significant functional studies. Conclude that screening for ELP1 mutations “may be beneficial”. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5597 | AXIN1 | Zornitza Stark reviewed gene: AXIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniometadiaphyseal osteosclerosis with hip dysplasia, MIM# 620558; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5597 | KDM5B | Zornitza Stark Phenotypes for gene: KDM5B were changed from Mental retardation, autosomal recessive 65 MIM#618109; Intellectual disability and/or autism, autosomal dominant to Mental retardation, autosomal recessive 65 MIM#618109; Neurodevelopmental disorder (MONDO#0700092), KDM5B-related, autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5596 | KDM5B | Lauren Rogers reviewed gene: KDM5B: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder (MONDO#0700092), KDM5B-related, Intellectual developmental disorder, autosomal recessive 65 (MIM#618109); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5592 | COG3 | Zornitza Stark reviewed gene: COG3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type IIbb, MIM# 620546; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5591 | ZFHX3 | chirag patel edited their review of gene: ZFHX3: Added comment: 41 patients with protein truncating variants (PTVs) or (partial) deletions of ZFHX3. Presentations included (mild) ID and/or behavioural problems, postnatal growth retardation, feeding difficulties, dysmorphism (rarely cleft palate). Nuclear abundance of ZFHX3 increases during human brain development and neuronal differentiation in neural stem cells and SH-SY5Y cells, ZFHX3 interacts with the chromatin remodelling BRG1/Brm-associated factor complex and the cleavage and polyadenylation complex. ZFHX3 haploinsufficiency associates with a specific DNA methylation profile in leukocyte-derived DNA, and participates in chromatin remodelling and mRNA processing.; Changed rating: GREEN; Changed publications: PMID: 37292950; Changed phenotypes: Neurodevelopmental disorder; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Set current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5590 | B4GALNT1 | Zornitza Stark Phenotypes for gene: B4GALNT1 were changed from to Spastic paraplegia 26, autosomal recessive (MIM #609195) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5589 | B4GALNT1 | Zornitza Stark Mode of inheritance for gene: B4GALNT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5588 | B4GALNT1 | Zornitza Stark reviewed gene: B4GALNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 26, autosomal recessive (MIM #609195); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5587 | AUH | Zornitza Stark Mode of inheritance for gene: AUH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5586 | AUH | Zornitza Stark reviewed gene: AUH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria, type I, MIM# 250950; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5586 | ATP6V0A2 | Zornitza Stark Phenotypes for gene: ATP6V0A2 were changed from to Cutis laxa, autosomal recessive, type IIA, MIM# 219200; Wrinkly skin syndrome, MIM#278250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5585 | ATP6V0A2 | Zornitza Stark Mode of inheritance for gene: ATP6V0A2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5584 | ATP6V0A2 | Zornitza Stark reviewed gene: ATP6V0A2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cutis laxa, autosomal recessive, type IIA, MIM# 219200, Wrinkly skin syndrome, MIM#278250; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5583 | ATR | Zornitza Stark Mode of inheritance for gene: ATR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5582 | ATR | Zornitza Stark reviewed gene: ATR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Seckel syndrome 1, MIM# 210600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5581 | ATP6V1B2 | Zornitza Stark Mode of inheritance for gene: ATP6V1B2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5580 | ATP6V1B2 | Zornitza Stark reviewed gene: ATP6V1B2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Zimmermann-Laband syndrome 2, MIM# 616455; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5579 | ATP6AP2 | Zornitza Stark Mode of inheritance for gene: ATP6AP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5578 | ATP6AP2 | Zornitza Stark reviewed gene: ATP6AP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type IIr MIM#301045 Intellectual developmental disorder, X-linked, syndromic, Hedera type MIM#300423; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5576 | KCNH5 | Zornitza Stark reviewed gene: KCNH5: Rating: GREEN; Mode of pathogenicity: None; Publications: 36307226; Phenotypes: Developmental and epileptic encephalopathy 112, MIM# 620537; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5576 | U2AF2 | Zornitza Stark Phenotypes for gene: U2AF2 were changed from Neurodevelopmental disorder, U2AF2-related (MONDO:0700092) to Developmental delay, dysmorphic facies, and brain anomalies, MIM# 620535 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5569 | ATP13A2 | Zornitza Stark Mode of inheritance for gene: ATP13A2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5567 | ATP13A2 | Zornitza Stark reviewed gene: ATP13A2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Kufor-Rakeb syndrome, MIM# 606693; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5564 | BRAF | Zornitza Stark Mode of inheritance for gene: BRAF was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5560 | SMARCA4 | Zornitza Stark Mode of inheritance for gene: SMARCA4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5557 | SMC3 | Zornitza Stark Mode of inheritance for gene: SMC3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5554 | SMC1A | Zornitza Stark Mode of inheritance for gene: SMC1A was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5550 | SMARCB1 | Zornitza Stark Mode of inheritance for gene: SMARCB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5549 | SMARCB1 | Kaitlyn Dianna Weldon reviewed gene: SMARCB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23556151; Phenotypes: Coffin-Siris syndrome MONDO:0015452; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5549 | SMC1A | Kaitlyn Dianna Weldon reviewed gene: SMC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301283; Phenotypes: Cornelia de Lange syndrome 2 MONDO:0010370; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5549 | SMC3 | Kaitlyn Dianna Weldon reviewed gene: SMC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301283; Phenotypes: Cornelia de Lange syndrome 3 MONDO:0012555; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5549 | SMARCB1 | Claire Fryer-Smith reviewed gene: SMARCB1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 22426308, 29907796, 3175698; Phenotypes: Coffin-Siris syndrome 3 (MIM# 614608); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5549 | SMARCA4 |
Claire Fryer-Smith changed review comment from: Coffin-Siris syndrome is a congenital malformation syndrome characterized by developmental delay, intellectual disability, coarse facial features, feeding difficulties, and hypoplastic or absent fifth fingernails and fifth distal phalanges. Missense and an in-frame deletion in SCARCA4 have been observed across 15 CSS patients in the literature (22426308, 23637025, 23929686), suggesting a dominant negative GoF effect. LoF variants in SMARCA4 result in Rhabdoid tumor predisposition syndrome, which does not exhibit ID.; to: Coffin-Siris syndrome is a congenital malformation syndrome characterized by developmental delay, intellectual disability, coarse facial features, feeding difficulties, and hypoplastic or absent fifth fingernails and fifth distal phalanges. Missense and an in-frame deletion in SMARCA4 have been observed across 15 CSS patients in the literature (22426308, 23637025, 23929686), suggesting a dominant negative GoF effect. LoF variants in SMARCA4 result in Rhabdoid tumor predisposition syndrome, which does not exhibit ID. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5549 | SMARCA4 | Claire Fryer-Smith reviewed gene: SMARCA4: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 22426308, 23929686, 23637025; Phenotypes: Coffin-Siris syndrome 4 (MIM# 614609); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5549 | BRAF | Claire Fryer-Smith reviewed gene: BRAF: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 10610177, 16474404, 19206169; Phenotypes: Cardiofaciocutaneous syndrome (MIM# 115150), Noonan syndrome (MIM# 613706), LEOPARD syndrome (MIM# 613707); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5547 | STXBP1 | Zornitza Stark Mode of inheritance for gene: STXBP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5544 | FH | Zornitza Stark Mode of inheritance for gene: FH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5541 | FH | Claire Fryer-Smith reviewed gene: FH: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31746132, 29052812, 21560188; Phenotypes: Fumarase deficiency (MIM# 606812); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5541 | TMEM70 | Zornitza Stark Mode of inheritance for gene: TMEM70 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5540 | TMEM70 | Zornitza Stark reviewed gene: TMEM70: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2, MIM# 614052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5538 | TMEM240 | Zornitza Stark Mode of inheritance for gene: TMEM240 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5535 | TMEM216 | Zornitza Stark Mode of inheritance for gene: TMEM216 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5534 | TMCO1 | Zornitza Stark Phenotypes for gene: TMCO1 were changed from to Craniofacial dysmorphism, skeletal anomalies, and impaired intellectual development 1, MIM# 213980; cerebrofaciothoracic dysplasia MONDO:0008952 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5532 | TMCO1 | Zornitza Stark Mode of inheritance for gene: TMCO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5529 | TCF4 | Zornitza Stark Mode of inheritance for gene: TCF4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5528 | STRA6 | Kaitlyn Dianna Weldon reviewed gene: STRA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273977; Phenotypes: Matthew-Wood syndrome MONDO:0011010; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5526 | TBC1D24 | Zornitza Stark Mode of inheritance for gene: TBC1D24 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5524 | STXBP1 | Kaitlyn Dianna Weldon reviewed gene: STXBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27905812; Phenotypes: developmental and epileptic encephalopathy, 4 MONDO:0012812; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5523 | TAZ | Zornitza Stark Mode of inheritance for gene: TAZ was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5520 | TAT | Zornitza Stark Mode of inheritance for gene: TAT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5517 | TANGO2 | Zornitza Stark Mode of inheritance for gene: TANGO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5516 | NF1 | Claire Fryer-Smith reviewed gene: NF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23931823, 10762507; Phenotypes: Neurofibromatosis, type 1 (MIM#162200); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5516 | SUOX | Kaitlyn Dianna Weldon reviewed gene: SUOX: Rating: GREEN; Mode of pathogenicity: None; Publications: 28933809; Phenotypes: isolated sulfite oxidase deficiency MONDO:0010089; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5515 | SYN1 | Zornitza Stark Mode of inheritance for gene: SYN1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5514 | SYN1 | Kaitlyn Dianna Weldon reviewed gene: SYN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148, epilepsy, X-linked 1, with variable learning disabilities and behavior disorders MONDO:0010339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5514 | MYCN | Naomi Baker commented on gene: MYCN: Three individuals now reported with gain-of-function missense variants (identical variant in two individuals). Clinical presentation includes megalencephaly, hypoplastic corpus callosum, postaxial polydactyly, intellectual disability and motor delay. Knock-in mouse model showed morphological manifestations in multiple tissues including digits, female reproductive system and kidney. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5513 | MYCN | Naomi Baker reviewed gene: MYCN: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID:37710961; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), MYCN-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5512 | MAST4 |
Ain Roesley gene: MAST4 was added gene: MAST4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAST4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAST4 were set to 36910266; 33057194 Phenotypes for gene: MAST4 were set to neurodevelopmental disorder MONDO:0700092, MAST4-related Penetrance for gene: MAST4 were set to Complete Review for gene: MAST4 was set to GREEN gene: MAST4 was marked as current diagnostic Added comment: PMID: 36910266 - 4 families with 4 affecteds, all de novo missense 2x borderline microcephaly (-2SD) 2x gross motor delay 2x dysmorphism 4x ID + seizures 3x abnormal brain MRI findings PMID: 33057194 - 5x de novos, 4x missense + 1x PTC Cohort of individuals with severe developmental disorder individual phenotypic information not provided Recurrent variants are Thr1471Ile (3x) and Ser1181Phe) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5509 | ATP2B2 |
Andrew Fennell gene: ATP2B2 was added gene: ATP2B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP2B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP2B2 were set to PMID: 37675773 Phenotypes for gene: ATP2B2 were set to Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related Mode of pathogenicity for gene: ATP2B2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: ATP2B2 was set to GREEN Added comment: 7 unrelated individuals reported with a variable phenotype including dystonia, ataxia, intellectual disability, behavioural symptoms, and seizures. All patients have either missense variants or frameshift variants in the penultimate exon not expected to lead to NMD. This is in contrast to patients with isolated deafness previously reported to have nonsense, frameshift, or splice-site variants outside of this region. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5509 | COG3 |
Daniel Flanagan gene: COG3 was added gene: COG3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: COG3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COG3 were set to PMID: 37711075 Phenotypes for gene: COG3 were set to Neurodevelopmental disorder (MONDO#0700092), COG3-related Review for gene: COG3 was set to AMBER Added comment: Two COG3 homozygous missense variants in four individuals from two unrelated consanguineous families. Clinical phenotypes of affected individuals include global developmental delay, severe intellectual disability, microcephaly, epilepsy, facial dysmorphism, and variable neurological findings. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5509 | ZBTB47 |
Elena Savva gene: ZBTB47 was added gene: ZBTB47 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZBTB47 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ZBTB47 were set to 37743782 Phenotypes for gene: ZBTB47 were set to Neurodevelopmental disorder (MONDO#0700092), ZBTB47-related Review for gene: ZBTB47 was set to GREEN Added comment: PMID 37743782: - 5 patients with de novo missense, 4/5 have a recurring p.Gly477Lys. Probands have intellectual disability (5/5), seizures (5/5), hypotonia (5/5), gait abnormalities, and variable movement abnormalities (5/5). - Missense variants are positioned close to His and Cys residues involved in forming C2H2 zinc fingers. - No functional studies performed - Minimal PTCs in gnomAD Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TANGO2 | Kaitlyn Dianna Weldon reviewed gene: TANGO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29369572; Phenotypes: obsolete metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration MONDO:0014812; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TAT | Kaitlyn Dianna Weldon reviewed gene: TAT: Rating: GREEN; Mode of pathogenicity: None; Publications: 28255985; Phenotypes: tyrosinemia type II MONDO:0010160; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TAZ | Kaitlyn Dianna Weldon reviewed gene: TAZ: Rating: GREEN; Mode of pathogenicity: None; Publications: 25299040; Phenotypes: Barth syndrome MONDO:0010543; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TBC1D24 | Kaitlyn Dianna Weldon reviewed gene: TBC1D24: Rating: GREEN; Mode of pathogenicity: None; Publications: 25719194; Phenotypes: familial infantile myoclonic epilepsy MONDO:0011506, DOORS syndrome MONDO:0009079; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TCF4 | Kaitlyn Dianna Weldon reviewed gene: TCF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22934316; Phenotypes: Pitt-Hopkins syndrome MONDO:0012589; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TMCO1 | Kaitlyn Dianna Weldon reviewed gene: TMCO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1204988, 1640432, 15326640, 20018682; Phenotypes: obsolete cerebrofaciothoracic dysplasia MONDO:0008952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TMEM216 | Kaitlyn Dianna Weldon reviewed gene: TMEM216: Rating: GREEN; Mode of pathogenicity: None; Publications: 20036350; Phenotypes: Joubert syndrome 2 MONDO:0011963; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TMEM240 | Kaitlyn Dianna Weldon reviewed gene: TMEM240: Rating: GREEN; Mode of pathogenicity: None; Publications: 25070513; Phenotypes: spinocerebellar ataxia type 21 MONDO:0011833; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5508 | TMEM70 | Kaitlyn Dianna Weldon reviewed gene: TMEM70: Rating: GREEN; Mode of pathogenicity: None; Publications: 18953340; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5507 | ATRX | Zornitza Stark Mode of inheritance for gene: ATRX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5506 | ATRX | Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ATR-X-related syndrome MONDO:0016980; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5506 | DHX32 | Zornitza Stark Phenotypes for gene: DHX32 were changed from Intellectual disability, spastic diplegia, dystonia, brain abnormalities to Neurodevelopmental disorder, MONDO:0700092, DHX32-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5504 | CSNK1G1 | Zornitza Stark Phenotypes for gene: CSNK1G1 were changed from Global developmental delay; Intellectual disability; Autism; Seizures; Abnormality of the face; Abnromality of limbs to Neurodevelopmental disorder, MONDO:0700092, CSNK1G-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5499 | TSEN54 | Zornitza Stark Mode of inheritance for gene: TSEN54 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5496 | TSFM | Zornitza Stark Mode of inheritance for gene: TSFM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5495 | TSFM | Zornitza Stark reviewed gene: TSFM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined oxidative phosphorylation deficiency 3, MIM#610505; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5493 | TSHB | Zornitza Stark Mode of inheritance for gene: TSHB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5492 | TSHB | Zornitza Stark reviewed gene: TSHB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Central congenital hypothyroidism Orphanet:226298; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5491 | TSEN54 | Kaitlyn Dianna Weldon reviewed gene: TSEN54: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301773; Phenotypes: pontocerebellar hypoplasia type 2A MONDO:0010190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5491 | TSFM | Kaitlyn Dianna Weldon reviewed gene: TSFM: Rating: GREEN; Mode of pathogenicity: None; Publications: 25037205, 33816677, 31451716, 22499341; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5491 | TSHB | Kaitlyn Dianna Weldon reviewed gene: TSHB: Rating: GREEN; Mode of pathogenicity: None; Publications: 15292359, 27362444; Phenotypes: Central congenital hypothyroidism Orphanet:226298; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5485 | TTC37 | Zornitza Stark Mode of inheritance for gene: TTC37 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5484 | TTC37 | Zornitza Stark Mode of inheritance for gene: TTC37 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5480 | ASTN2 |
Zornitza Stark gene: ASTN2 was added gene: ASTN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ASTN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ASTN2 were set to 28940097; 34412080; 27138430 Phenotypes for gene: ASTN2 were set to Neurodevelopmental disorder, MONDO:0700092, ASTN2-related Review for gene: ASTN2 was set to AMBER Added comment: Candidate gene reported by Anazi et al; rare CNVs also reported; other circumstantial evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5479 | TTC37 | Kaitlyn Dianna Weldon reviewed gene: TTC37: Rating: GREEN; Mode of pathogenicity: None; Publications: 29334452; Phenotypes: trichohepatoenteric syndrome 1 MONDO:0024541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5477 | MCCC1 | Bryony Thompson Mode of inheritance for gene: MCCC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5475 | MCCC1 | Bryony Thompson reviewed gene: MCCC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 36822454, 31730530; Phenotypes: 3-Methylcrotonyl-CoA carboxylase 1 deficiency MIM#210200, Organic acidurias; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5472 | TUBB3 | Zornitza Stark Phenotypes for gene: TUBB3 were changed from to complex cortical dysplasia with other brain malformations 1 MONDO:0013541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5470 | TUBB3 | Zornitza Stark Mode of inheritance for gene: TUBB3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5467 | TUBB4A | Zornitza Stark Mode of inheritance for gene: TUBB4A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5464 | TH | Zornitza Stark Mode of inheritance for gene: TH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5462 | PTEN | Zornitza Stark Mode of inheritance for gene: PTEN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5461 | TUBG1 | Zornitza Stark Phenotypes for gene: TUBG1 were changed from to complex cortical dysplasia with other brain malformations 4 MONDO:0014171 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5459 | TUBG1 | Zornitza Stark Mode of inheritance for gene: TUBG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5456 | TWIST1 | Zornitza Stark Mode of inheritance for gene: TWIST1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5452 | UBA5 | Zornitza Stark Mode of inheritance for gene: UBA5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5449 | UBE3A | Zornitza Stark Mode of inheritance for gene: UBE3A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5446 | SDHA | Zornitza Stark Mode of inheritance for gene: SDHA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5443 | VLDLR | Zornitza Stark Mode of inheritance for gene: VLDLR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5440 | VPS13B | Zornitza Stark Mode of inheritance for gene: VPS13B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5439 | SCAF4 | Zornitza Stark Phenotypes for gene: SCAF4 were changed from Mild intellectual disability; seizures; behavioral abnormalities to Fliedner-Zweier syndrome, MIM#620511 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5438 | SCAF4 | Zornitza Stark reviewed gene: SCAF4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fliedner-Zweier syndrome, MIM#620511; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5436 | VRK1 | Zornitza Stark Mode of inheritance for gene: VRK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5433 | WDR45 | Zornitza Stark Mode of inheritance for gene: WDR45 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5430 | WDR73 | Zornitza Stark Mode of inheritance for gene: WDR73 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5427 | SMAD4 | Zornitza Stark Mode of inheritance for gene: SMAD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5426 | WWOX | Zornitza Stark Phenotypes for gene: WWOX were changed from to developmental and epileptic encephalopathy, 28 MONDO:0014533; autosomal recessive spinocerebellar ataxia 12 MONDO:0013687 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5424 | WWOX | Zornitza Stark Mode of inheritance for gene: WWOX was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5421 | XRCC4 | Zornitza Stark Mode of inheritance for gene: XRCC4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5420 | TUBB2B | Zornitza Stark Phenotypes for gene: TUBB2B were changed from to Cortical dysplasia, complex, with other brain malformations 7 MIM#610031 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5418 | TUBB2B | Zornitza Stark Mode of inheritance for gene: TUBB2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5415 | ZDHHC9 | Zornitza Stark Mode of inheritance for gene: ZDHHC9 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5414 | ZFYVE26 | Zornitza Stark Phenotypes for gene: ZFYVE26 were changed from to Spastic paraplegia 15, autosomal recessive, MIM# 270700; hereditary spastic paraplegia 15, MONDO:0010044 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5412 | ZFYVE26 | Zornitza Stark Mode of inheritance for gene: ZFYVE26 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5409 | ZIC2 | Zornitza Stark Mode of inheritance for gene: ZIC2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5406 | TSC1 | Zornitza Stark Mode of inheritance for gene: TSC1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5403 | TSC2 | Zornitza Stark Mode of inheritance for gene: TSC2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | TUBB3 | Kaitlyn Dianna Weldon reviewed gene: TUBB3: Rating: GREEN; Mode of pathogenicity: None; Publications: 20829227; Phenotypes: complex cortical dysplasia with other brain malformations 1 MONDO:0013541; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | TH | Claire Fryer-Smith reviewed gene: TH: Rating: GREEN; Mode of pathogenicity: None; Publications: 22815559, 11196107, 10585338; Phenotypes: Segawa syndrome, recessive MIM#605407; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | PTEN | Claire Fryer-Smith reviewed gene: PTEN: Rating: GREEN; Mode of pathogenicity: None; Publications: 21194675, 1859181, 23470840; Phenotypes: Cowden syndrome 1 MIM#158350, Lhermitte-Duclos disease MIM#158350, Macrocephaly/autism syndrome MIM#605309, Prostate cancer, somatic MIM#176807; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | TUBG1 | Kaitlyn Dianna Weldon reviewed gene: TUBG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29706637, 23603762; Phenotypes: complex cortical dysplasia with other brain malformations 4 MONDO:0014171, lissencephaly spectrum disorders MONDO:0018838; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | TWIST1 | Kaitlyn Dianna Weldon reviewed gene: TWIST1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301368; Phenotypes: Saethre-Chotzen syndrome MONDO:0007042; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | UBA5 | Kaitlyn Dianna Weldon reviewed gene: UBA5: Rating: GREEN; Mode of pathogenicity: None; Publications: 33811063; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | UBE3A | Kaitlyn Dianna Weldon reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301323; Phenotypes: Angelman syndrome MONDO:0007113; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | SDHA | Claire Fryer-Smith reviewed gene: SDHA: Rating: GREEN; Mode of pathogenicity: None; Publications: 1492653, 23322652; Phenotypes: Cardiomyopathy, dilated, 1GG MIM#613642, Mitochondrial complex II deficiency, nuclear type 1 MIM#252011, Neurodegeneration with ataxia and late-onset optic atrophy MIM#619259, Paragangliomas MIM#614165; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | VLDLR | Kaitlyn Dianna Weldon reviewed gene: VLDLR: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301729; Phenotypes: cerebellar ataxia, intellectual disability, and dysequilibrium syndrome 1 MONDO:0024542; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | VPS13B | Kaitlyn Dianna Weldon reviewed gene: VPS13B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301655; Phenotypes: Cohen syndrome MONDO:0008999; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | VRK1 | Kaitlyn Dianna Weldon reviewed gene: VRK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19646678; Phenotypes: pontocerebellar hypoplasia type 1A MONDO:0011866; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | WDR45 | Kaitlyn Dianna Weldon reviewed gene: WDR45: Rating: GREEN; Mode of pathogenicity: None; Publications: 28211668; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148, neurodegeneration with brain iron accumulation 5 MONDO:0010476; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | WDR73 | Kaitlyn Dianna Weldon reviewed gene: WDR73: Rating: GREEN; Mode of pathogenicity: None; Publications: 26123727; Phenotypes: Galloway-Mowat syndrome 1 MONDO:0033005; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | SMAD4 | Claire Fryer-Smith reviewed gene: SMAD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843046, 22243968, 7296942, 8261650; Phenotypes: Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome MIM#175050, Myhre syndrome MIM#139210, Pancreatic cancer, somatic MIM#260350, Polyposis, juvenile intestinal MIM#174900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | WWOX | Kaitlyn Dianna Weldon reviewed gene: WWOX: Rating: GREEN; Mode of pathogenicity: None; Publications: 25411445, 24369382; Phenotypes: developmental and epileptic encephalopathy, 28 MONDO:0014533, autosomal recessive spinocerebellar ataxia 12 MONDO:0013687; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | XRCC4 | Claire Fryer-Smith reviewed gene: XRCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25872942, 25839420, 18695064; Phenotypes: Short stature, microcephaly, and endocrine dysfunction MIM#616541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | XRCC4 | Kaitlyn Dianna Weldon reviewed gene: XRCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25728776; Phenotypes: short stature, microcephaly, and endocrine dysfunction MONDO:0014686; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | TUBB2B | Claire Fryer-Smith reviewed gene: TUBB2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 11425694, 23001566, 19465910, 22333901; Phenotypes: Cortical dysplasia, complex, with other brain malformations 7 MIM#610031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | ZDHHC9 | Kaitlyn Dianna Weldon reviewed gene: ZDHHC9: Rating: GREEN; Mode of pathogenicity: None; Publications: 17436253; Phenotypes: Syndromic X-linked intellectual disability Raymond type MONDO:0010427; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | ZFYVE26 | Kaitlyn Dianna Weldon reviewed gene: ZFYVE26: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301682; Phenotypes: hereditary spastic paraplegia 15 MONDO:0010044; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | ZIC2 | Kaitlyn Dianna Weldon reviewed gene: ZIC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21940735; Phenotypes: holoprosencephaly 5 MONDO:0012322; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | TSC1 | Claire Fryer-Smith reviewed gene: TSC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10533067, 18830229, 15798777, 17304050; Phenotypes: Tuberous sclerosis-1 MIM#191100; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | TSC2 | Claire Fryer-Smith reviewed gene: TSC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14985384, 10533067, 10205261, 17304050; Phenotypes: Tuberous sclerosis-2 MIM#613254; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | NR2F2 | Achchuthan Shanmugasundram reviewed gene: NR2F2: Rating: GREEN; Mode of pathogenicity: None; Publications: 37500725; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5399 | GABBR1 | Zornitza Stark Phenotypes for gene: GABBR1 were changed from Neurodevelopmental disorder, GABBR1-related, MONDO:0700092 to Neurodevelopmental disorder with language delay and variable cognitive abnormalities, MIM#620502 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5395 | FTCD | Bryony Thompson Mode of inheritance for gene: FTCD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5393 | COL4A3BP | Zornitza Stark Phenotypes for gene: COL4A3BP were changed from Mental retardation, autosomal dominant 34, MIM# 616351 to Intellectual developmental disorder 34 (MIM#616351) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5387 | RAB5C |
Rylee Peters gene: RAB5C was added gene: RAB5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB5C were set to PMID: 37552066 Phenotypes for gene: RAB5C were set to Neurodevelopmental disorder MONDO:0700092, RAB5C-related Penetrance for gene: RAB5C were set to Complete Review for gene: RAB5C was set to GREEN gene: RAB5C was marked as current diagnostic Added comment: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5387 | AXIN1 |
Elena Savva gene: AXIN1 was added gene: AXIN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AXIN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AXIN1 were set to PMID: 37582359 Phenotypes for gene: AXIN1 were set to Syndromic disease, (MONDO:0002254), AXIN1-related Review for gene: AXIN1 was set to GREEN Added comment: PMID: 37582359 - four families (7 individuals) with three homozygous truncating variants. - all variant shown to result in reduced protein, though 1/3 would be NMD predicted - Probands had macrocephaly (4/6), GDD (3/7), hip dysplasia (5/6), cardiac anomalies eg. VSD/ASD (3/7), cranial hyperostosis and vertebral endplate sclerosis Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5385 | PPP1R3F |
Andrew Fennell gene: PPP1R3F was added gene: PPP1R3F was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP1R3F was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: PPP1R3F were set to 37531237 Phenotypes for gene: PPP1R3F were set to Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related Review for gene: PPP1R3F was set to GREEN Added comment: 13 unrelated hemizygous individuals reported with functional evidence Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5383 | ATM | Zornitza Stark edited their review of gene: ATM: Added comment: Progressive cerebellar dysfunction. Intellectual ability is typically normal. However, learning can be impaired due to motor and speech difficulties.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5383 | ATM | Zornitza Stark reviewed gene: ATM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ataxia-telangiectasia, MIM#208900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5383 | SOX11 | Zornitza Stark Phenotypes for gene: SOX11 were changed from Coffin-Siris syndrome 9, OMIM # 615866 to Intellectual developmental disorder with microcephaly and with or without ocular malformations or hypogonadotropic hypogonadism, MIM# 615866 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5381 | SOX11 | Zornitza Stark reviewed gene: SOX11: Rating: GREEN; Mode of pathogenicity: None; Publications: 29459093, 24886874, 33086258, 33785884, 35642566, 35341651; Phenotypes: Intellectual developmental disorder with microcephaly and with or without ocular malformations or hypogonadotropic hypogonadism, MIM# 615866; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5379 | ATP5O |
Zornitza Stark gene: ATP5O was added gene: ATP5O was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ATP5O was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATP5O were set to 35621276; 34954817 Phenotypes for gene: ATP5O were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359 Review for gene: ATP5O was set to GREEN Added comment: Three unrelated families reported. Presenting features included DD, hypotonia, seizures. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5377 | HIKESHI |
Zornitza Stark gene: HIKESHI was added gene: HIKESHI was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: HIKESHI was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HIKESHI were set to 34111619; 26545878 Phenotypes for gene: HIKESHI were set to Leukodystrophy, hypomyelinating, 13, MIM# 616881 Review for gene: HIKESHI was set to GREEN Added comment: Over 10 individuals reported with recurrent homozygous c.160G>C;p.(Val54Leu) variant, high carrier frequency in the Ashkenazi Jewish population. Optic atrophy reported in several. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5375 | FAM111A | Zornitza Stark Mode of inheritance for gene: FAM111A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5373 | FAM111A | Zornitza Stark reviewed gene: FAM111A: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Kenny-Caffey syndrome, type 2, MIM# 127000; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5370 | PTCD3 |
Zornitza Stark gene: PTCD3 was added gene: PTCD3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: PTCD3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTCD3 were set to 30607703; 19427859; 36450274 Phenotypes for gene: PTCD3 were set to Combined oxidative phosphorylation deficiency-51, MIM#619057; Intellectual disability; optic atrophy; Leigh-like syndrome Review for gene: PTCD3 was set to GREEN Added comment: Four families and functional data. ID is a feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5368 | ASS1 | Zornitza Stark Mode of inheritance for gene: ASS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5367 | ASS1 | Zornitza Stark reviewed gene: ASS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Citrullinemia MIM#215700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5366 | ASPA | Zornitza Stark Mode of inheritance for gene: ASPA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5365 | ASPA | Zornitza Stark reviewed gene: ASPA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Canavan disease MIM#271900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5364 | ARX | Zornitza Stark Mode of inheritance for gene: ARX was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5363 | ARX | Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lissencephaly, X-linked 2, MIM# 300215; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5361 | ARV1 | Zornitza Stark Mode of inheritance for gene: ARV1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5360 | ARV1 | Zornitza Stark reviewed gene: ARV1: Rating: GREEN; Mode of pathogenicity: None; Publications: 35227294, 27270415, 25558065; Phenotypes: Developmental and epileptic encephalopathy 38, MIM# 617020; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5358 | ARID1A | Zornitza Stark Mode of inheritance for gene: ARID1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5357 | UBAP2L | Zornitza Stark Phenotypes for gene: UBAP2L were changed from Neurodevelopmental disorder, MONDO:0700092, UBAP2L-related; Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system to Neurodevelopmental disorder with impaired language, behavioral abnormalities, and dysmorphic facies, MIM# 620494; Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5356 | UBAP2L | Zornitza Stark edited their review of gene: UBAP2L: Changed phenotypes: Neurodevelopmental disorder with impaired language, behavioral abnormalities, and dysmorphic facies, MIM# 620494 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5354 | AP3B1 | Zornitza Stark Mode of inheritance for gene: AP3B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5353 | AP3B1 | Zornitza Stark reviewed gene: AP3B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10024875, 11809908, 14566336; Phenotypes: Hermansky-Pudlak syndrome 2, MIM# 608233, MONDO:0011997; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5352 | AMT | Zornitza Stark Mode of inheritance for gene: AMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5351 | AMT | Zornitza Stark reviewed gene: AMT: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Glycine encephalopathy MIM#605899; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5351 | ALDH18A1 | Zornitza Stark Phenotypes for gene: ALDH18A1 were changed from to Spastic paraplegia 9B, autosomal recessive, MIM# 616586 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5350 | ALDH18A1 | Zornitza Stark Mode of inheritance for gene: ALDH18A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5349 | ALDH18A1 | Zornitza Stark reviewed gene: ALDH18A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 9B, autosomal recessive, MIM# 616586; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5348 | AIFM1 | Zornitza Stark Mode of inheritance for gene: AIFM1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5347 | AIFM1 | Zornitza Stark reviewed gene: AIFM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Combined oxidative phosphorylation deficiency 6, 300816, Cowchock syndrome, 310490, Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5346 | ADSL | Zornitza Stark Mode of inheritance for gene: ADSL was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5345 | ADSL | Zornitza Stark reviewed gene: ADSL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Adenylosuccinase deficiency, MIM# 103050; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5343 | ADGRG1 | Zornitza Stark Mode of inheritance for gene: ADGRG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5342 | ADGRG1 | Zornitza Stark reviewed gene: ADGRG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16240336; Phenotypes: Polymicrogyria, bilateral frontoparietal 606854; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5341 | NEUROG1 |
Zornitza Stark gene: NEUROG1 was added gene: NEUROG1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NEUROG1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NEUROG1 were set to 23419067; 26077850; 33439489; 36647078 Phenotypes for gene: NEUROG1 were set to Cranial dysinnervation disorder, congenital, with absent corneal reflex and developmental delay, OMIM:620469 Review for gene: NEUROG1 was set to GREEN Added comment: There are four unrelated cases reported with global developmental delay/ intellectual disability. PMID:23419067 - A homozygous micro deletion of NEUROG1 was identified in a six year-old boy presenting with profound sensorineural deafness, balance disorder, severe disorder of oral motor function, and mild global developmental delay. His IQ was normal. PMID:26077850 - A homozygous NEUROG1 variant (p.Arg116Leu) was identified in a 12 year-old boy presented with syndromic corneal opacity, mild intellectual disability and absent corneal reflex. PMID:33439489 - A homozygous loss-of-function variant (p.Glu68Ter) was identified in a 12 year-old boy presenting with hypotonia, global developmental delay, sensorineural hearing loss, and keratoconjunctivitis due to lack of corneal reflex. This patient had a global IQ of 62 at the age of ten. PMID:36647078 - A female proband was identified with a novel homozygous truncating frameshift variant (p.Thr78ProfsTer122 and was reported with profound global developmental delay, autism spectrum disorder, hearing loss, corneal opacity and no eye blinking. Her sister also had a similar, but less severe phenotype and also harboured the same variant at homozygous state. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5340 | SRSF1 | Zornitza Stark Phenotypes for gene: SRSF1 were changed from Neurodevelopmental disorder, SRSF1-related MONDO:0700092 to Neurodevelopmental disorder with dysmorphic facies and behavioral abnormalities, MIM# 620489 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5339 | SRSF1 | Zornitza Stark reviewed gene: SRSF1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with dysmorphic facies and behavioral abnormalities, MIM# 620489; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5338 | CCDC115 |
Elena Savva gene: CCDC115 was added gene: CCDC115 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC115 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CCDC115 were set to Congenital disorder of glycosylation, type IIo MIM# 616828 Review for gene: CCDC115 was set to GREEN Added comment: Added following CAM discussion Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5337 | FBXO31 | Ain Roesley reviewed gene: FBXO31: Rating: AMBER; Mode of pathogenicity: None; Publications: 35019165, 24623383; Phenotypes: intellectual developmental disorder 45 (MIM#615979); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5333 | HNRNPC |
Zornitza Stark gene: HNRNPC was added gene: HNRNPC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HNRNPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HNRNPC were set to 37541189 Phenotypes for gene: HNRNPC were set to Neurodevelopmental disorder (MONDO:0700092), HNRNPC-related Review for gene: HNRNPC was set to GREEN Added comment: 13 individuals with global developmental delay, intellectual disability, behavioral abnormalities, and subtle facial dysmorphology with heterozygous HNRNPC germline variants. Five had an identical in-frame deletion of nine amino acids in the extreme C terminus. Supportive functional data; haploinsufficiency is the mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5332 | PSMC3 | Zornitza Stark Mode of inheritance for gene: PSMC3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5331 | PSMC3 | Zornitza Stark Mode of inheritance for gene: PSMC3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5328 | PSMC3 | Zornitza Stark Mode of inheritance for gene: PSMC3 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5325 | EMC1 | Zornitza Stark Mode of inheritance for gene: EMC1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5324 | PSMC3 | Achchuthan Shanmugasundram reviewed gene: PSMC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 37256937; Phenotypes: neurodevelopmental disorder, MONDO:0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5324 | EMC1 | Chern Lim reviewed gene: EMC1: Rating: ; Mode of pathogenicity: None; Publications: 35234901, 26942288; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5317 | AQP4 |
Lucy Spencer gene: AQP4 was added gene: AQP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AQP4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AQP4 were set to 37143309 Phenotypes for gene: AQP4 were set to ?Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448 Review for gene: AQP4 was set to AMBER Added comment: PMID: 37143309 Cohort patients with an MRI based diagnosis of megalencephalic leukoencephalopathy with subcortical cysts (MLC). Missense variant in AQP4 seen homozygous in 2 siblings and het in the parents. Patients had macrocephaly, developmental delay, hypotonia, epilepsy, and cognitive deficit. Western blots on generated MDCK cell lines showed no detectable expression of AQP4 protein from the cells with the patients variant. Immunofluorescence also showed no membrane expression. Overexpression studies in HEK293T cells showed WT was seen as mainly monomers or dimers where as variant protein formed large aggregates- likely due to the saturation of protein degradation pathways because of the overexpression. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5317 | PHF5A |
Daniel Flanagan gene: PHF5A was added gene: PHF5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: PHF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHF5A were set to PMID: 37422718 Phenotypes for gene: PHF5A were set to Neurodevelopmental disorder (MONDO#0700092), PHF5A-related Review for gene: PHF5A was set to GREEN Added comment: Nine subjects with congenital malformations, including hypospadias, growth abnormalities, and developmental delay who had de novo PHF5A variants. Prenatally, six subjects had intrauterine growth retardation. All subjects had motor and speech delay and developmental delay. Congenital abnormalities comprised hypospadias in three of four male subjects, and heart defects (3/9), inguinal hernia (3/9), and sacral dimple (3/9). Six of the nine subjects had short stature. Craniofacial dysmorphism is variable in the nine subjects, high forehead and preauricular skin tag(s) in five subjects. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5316 | EZH1 | Dean Phelan reviewed gene: EZH1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 37433783; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), EZH1-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5315 | NAA30 | Zornitza Stark Mode of inheritance for gene: NAA30 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5313 | GPRC5B |
Lucy Spencer gene: GPRC5B was added gene: GPRC5B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GPRC5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GPRC5B were set to PMID: 37143309 Phenotypes for gene: GPRC5B were set to Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447 Review for gene: GPRC5B was set to GREEN Added comment: PMID: 37143309 Cohort of 5 patients with an MRI based diagnosis of megalencephalic leukoencephalopathy with subcortical cysts (MLC). 3 unrelated patients had variants in GPRC5B, 2 have the same inframe dup Ile175dup and the third has an in frame dup of Ala177. All 3 were de novo and unaffected siblings did not have the variants. All patients have macrocephaly, delayed motor development, spasticity, ataxia and dystonia, seizures, all had varying degrees of cognitive deficits. MRI showed MLC, abnormal and swollen cerebral white matter. Patient cell lines showed reduced regulatory volume decrease, and western blot showed a strong increase in GRPC5B levels in patient lymphoblasts. Together, these findings indicate disturbed volume regulation in lymphoblasts from patients with GPRC5B variants, potentially due to increased GPRC5B levels. Transfected cells caused increased volume-regulated anion channel activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5313 | SLC4A10 |
Krithika Murali gene: SLC4A10 was added gene: SLC4A10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC4A10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC4A10 were set to PMID: 37459438 Phenotypes for gene: SLC4A10 were set to Neurodevelopmental disorderMONDO:0700092, SLC4A10-related Review for gene: SLC4A10 was set to GREEN Added comment: PMID: 37459438 Fasham et al 2023 (Brain) report 10 affected individuals from 5 unrelated families with biallelic LoF variants in this gene with a novel neurodevelopmental disorder. Phenotypic features include hypotonia in infancy, delayed psychomotor development, typically severe ID, progressive postnatal microcephaly, ASD traits, corpus callosal abnormalities and 'slit-like' lateral ventricles. These phenotypic features were recapitulated in knockout mice with additional supportive functional studies. Isolated seizures was reported in 2/10 cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5312 | SLC4A10 |
Krithika Murali gene: SLC4A10 was added gene: SLC4A10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC4A10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC4A10 were set to PMID: 37459438 Phenotypes for gene: SLC4A10 were set to Neurodevelopmental disorderMONDO:0700092, SLC4A10-related Review for gene: SLC4A10 was set to GREEN Added comment: PMID: 37459438 Fasham et al 2023 (Brain) report 10 affected individuals from 5 unrelated families with biallelic LoF variants in this gene with a novel neurodevelopmental disorder. Phenotypic features include hypotonia in infancy, delayed psychomotor development, typically severe ID, progressive postnatal microcephaly, ASD traits, corpus callosal abnormalities and 'slit-like' lateral ventricles. These phenotypic features were recapitulated in knockout mice with additional supportive functional studies. Isolated seizures was reported in 2/10 cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5310 | KDM4B | Sarah Pantaleo reviewed gene: KDM4B: Rating: ; Mode of pathogenicity: None; Publications: PMID: 37526414; Phenotypes: Intellectual developmental disorder, autosomal dominant 65, MIM#619320; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5310 | EZH1 |
Dean Phelan gene: EZH1 was added gene: EZH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EZH1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5308 | TMEM63B |
Zornitza Stark gene: TMEM63B was added gene: TMEM63B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM63B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TMEM63B were set to 37421948 Phenotypes for gene: TMEM63B were set to developmental and epileptic encephalopathy, MONDO:0100062, TMEM63B-related Review for gene: TMEM63B was set to GREEN Added comment: 17 unrelated individuals with severe early-onset developmental and epileptic encephalopathy (DEE), intellectual disability, and severe motor and cortical visual impairment were identified with ten distinct heterozygous variants inTMEM63B. The variants occurred de novo in 16/17 individuals for whom parental DNA was available and either missense or in-frame. All individuals had global developmental delay, with moderate-to-profound intellectual disability and severe motor impairment. All individuals had early-onset drug-resistant epilepsy, whose onset ranged from birth to 3 years but occurred within the first year in 14/17 (82%) and in the first month of life in 6/17 (35%). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5306 | DHX9 |
Zornitza Stark gene: DHX9 was added gene: DHX9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DHX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DHX9 were set to 37467750 Phenotypes for gene: DHX9 were set to Neurodevelopmental disorder, MONDO:0700092, DHX9-related Review for gene: DHX9 was set to GREEN Added comment: PMID:37467750 - 17 unrelated individuals were identified with de novo, ultra-rare, heterozygous missense or loss-of-function DHX9 variants, of which 14 individuals were reported with a neurodevelopmental disorder (NDD) and three were reported with Charcot-Marie-Tooth disease (CMT). All 14 cases with NDD had developmental delay, of which eight were reported with intellectual disability (4 severe, 1 moderate, 3 mild). Two cases did not have ID, one had borderline ID and three cases were too young (0-5 years old). The three cases with CMT presented with adult-onset axonal neuropathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5298 | TEFM |
Zornitza Stark gene: TEFM was added gene: TEFM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TEFM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TEFM were set to 36823193 Phenotypes for gene: TEFM were set to Combined oxidative phosphorylation deficiency 58, MIM# 620451 Review for gene: TEFM was set to GREEN Added comment: Seven individuals from 5 families reported. Presentation predominantly with encephalopathy, seizures and ID, in addition to lactic acidosis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5295 | TSPOAP1 | Zornitza Stark reviewed gene: TSPOAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dystonia 22, MIM# 620453; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5295 | TAF4 | Zornitza Stark Phenotypes for gene: TAF4 were changed from Neurodevelopmental disorder, MONDO:0700092, TAF4-related to Intellectual developmental disorder, autosomal dominant 73, MIM# 620450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5294 | TAF4 | Zornitza Stark edited their review of gene: TAF4: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 73, MIM# 620450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5290 | DENND5B | Zornitza Stark Phenotypes for gene: DENND5B were changed from Neurodevelopmental disorder with white matter anomalies to Neurodevelopmental disorder with white matter anomalies, MONDO:0700092, DENND5B-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5286 | TTI1 | Zornitza Stark Phenotypes for gene: TTI1 were changed from Neurodevelopmental disorder, MONDO:0700092, TTI1-related to Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5282 | WBP4 |
chirag patel gene: WBP4 was added gene: WBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: WBP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WBP4 were set to Neurodevelopmental disorder Review for gene: WBP4 was set to GREEN gene: WBP4 was marked as current diagnostic Added comment: ESHG 2023: 11 individuals from 8 families with homozygous LOF variants in WBP4 gene (4 different variants). Presentation of severe DD and ID, hypotonia, abnormal outer ears, and varying congenital anomalies. WBP4 is spliceosome protein which binds/interacts with SNRNP200. In vivo and in vitro studies previously showed WBP4 enhances splicing and regulates alternative splicing. Patient fibroblasts showed loss of expression of WBP4. RNA sequencing analysis showed abnormal splicing patterns. Proposed spliceosomopathy. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5280 | KDM2A |
chirag patel gene: KDM2A was added gene: KDM2A was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: KDM2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KDM2A were set to Neurodevelopmental disorder Review for gene: KDM2A was set to GREEN gene: KDM2A was marked as current diagnostic Added comment: ESHG 2023: 14 patients with de novo HTZ variants in KDM2A (5 x truncating, 9 x missense) Presentation with DD, ID (mild), seizures, growth retardation, and dysmorphism. Functional studies: -patient blood showed aberrant genome wide methylation profile - potential episignature -HEK293T cells showed altered subcellular localisation of KDM2A -Drosophila models showed variants caused neurotoxicity Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5278 | PIP5K1C |
chirag patel gene: PIP5K1C was added gene: PIP5K1C was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: PIP5K1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PIP5K1C were set to Neurodevelopmental disorder and microcephaly Review for gene: PIP5K1C was set to GREEN gene: PIP5K1C was marked as current diagnostic Added comment: ESHG 2023: 9 unrelated patients with de novo missense variants in PIP5K1C (3 x recurrent variants). Presentation with DD/ID (mod-profound), microcephaly, seizures, visual impairment, and dysmorphism. PIP5K1C is one of the phosphoinositolides, which control membrane composition of organelles and varying cellular processes. Patient fibroblasts showed increased PI(4,5)P2 levels, altered PI(4,5)P2 composition of early endosomes, and impaired endocytosis trafficking. Drosophila models showed microcephaly and ocular phenotype. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5275 | INTS13 |
chirag patel gene: INTS13 was added gene: INTS13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: INTS13 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: INTS13 were set to PMID: 36229431 Phenotypes for gene: INTS13 were set to Oral-facial-digital syndrome Review for gene: INTS13 was set to GREEN Added comment: 2 families with 4 affected individuals with Oral-facial-digital (OFD) phenotype. Homozygosity mapping and WES found 2 homozygous variants in INTS13 gene. This is a subunit of the Integrator complex, which associates with RNA Polymerase II and cleaves nascent RNA to modulate gene expression. Variants segregated with disease. Depletion of INTS13 disrupts ciliogenesis in human cultured cells and causes dysregulation of a broad collection of ciliary genes. Knockdown in Xenopus embryos leads to motile cilia anomalies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5273 | DCAF15 |
chirag patel gene: DCAF15 was added gene: DCAF15 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: DCAF15 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DCAF15 were set to Cornelia de Lange syndrome Review for gene: DCAF15 was set to AMBER Added comment: ESHG 2023: 3 unrelated cases with CdLS (1 x TOP with MCA, 1 x death @20mths, 1 x living child) Features suggestive of CdLS - DD, microcephaly, CHD, dysmorphism, visual/hearing impairment. WES identified recurrent de novo variant (p.Ser470Phe) in DCAF15 gene. This mediates ubiquitination and degradation of target proteins, and interacts with cohesin complex members (SMC1/SMC3). Protein analysis from individuals showed increased accumulation of ubiquitination-modified proteins and SM3 (GOF mechanism). EpiSign analysis showed same DNA methylation pattern as other CdLS cases/genes. Zebrafish model showed reduced body length, reduced head size, reduced oligodendrocytes, heart defect, aberrant motor neurons, and abnormal response to visual/auditory stimuli. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5271 | CYHR1 |
chirag patel gene: CYHR1 was added gene: CYHR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CYHR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYHR1 were set to Neurodevelopmental disorder and microcephaly Review for gene: CYHR1 was set to AMBER gene: CYHR1 was marked as current diagnostic Added comment: ESHG 2023: 5 individuals from 3 families with biallelic LOF variants in CYHR1 (aka ZTRAF1). Presentation with microcephaly, hypotonia, DD, and ID. Expression studies showed mislocalisation of CYHR1. Mutant fibroblasts showed increased lysosomal markers and upregulated lysosomal proteins, leading to impaired autophagy. Zebrafish KO however did not show a phenotype. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5270 | GPATCH11 |
chirag patel gene: GPATCH11 was added gene: GPATCH11 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: GPATCH11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPATCH11 were set to Leber congenital amaurosis and developmental delay Review for gene: GPATCH11 was set to GREEN gene: GPATCH11 was marked as current diagnostic Added comment: ESHG 2023: 3 families with 8 individuals with leber congenital amaurosis, developmental delay, language disorder, and behavioural issues. GPATCH11 localises to nucleus and basal body of primary cilium (similar to other LCA genes). Biallelic variants found in GPATCH11 - 1 splice variant common to all 3 families (1 other variant in 3rd family). Splice variant leads to loss of exon 4 (mRNA studies). Mouse models showed i) abnormal rod/cone responses on ERG; ii) decreased outer nuclear layer in retina, and iii) abnormal associate/episodic memory Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5267 | KCNA3 |
chirag patel gene: KCNA3 was added gene: KCNA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: KCNA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNA3 were set to Neurodevelopmental disorder Review for gene: KCNA3 was set to GREEN gene: KCNA3 was marked as current diagnostic Added comment: ESHG 2023: 10 individuals with de novo missense variants in KCNA3 (K+ channel) Variable electrophysiology studies of effect of variants (5 x LOF, 4 x GOF, 1 no change) Presentation: abnormal speech development (8/8), ID (6/8), epilepsy (5/8), and ASD (7/8) Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5265 | FSD1L |
chirag patel gene: FSD1L was added gene: FSD1L was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: FSD1L was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FSD1L were set to Neurodevelopmental disorder Review for gene: FSD1L was set to GREEN gene: FSD1L was marked as current diagnostic Added comment: ESHG 2023: 8 families with biallelic missense/nonsense variants Presentation only described 1 family/2 affecteds with DD, ID, spastic paraparesis, epilepsy, corpus callosum hypoplasia, and optic nerve hypoplasia Functional assays: -reduced expression of FSD1L in mature neurons (RNA studies) -very low % mature neurons (neuronal differentiation) -reduced neuronal migration Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5263 | DENND5B |
chirag patel gene: DENND5B was added gene: DENND5B was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: DENND5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DENND5B were set to Neurodevelopmental disorder with white matter anomalies Review for gene: DENND5B was set to GREEN gene: DENND5B was marked as current diagnostic Added comment: ESHG 2023: 7 patients/7 families with de novo DENND5B variants (6 missense, 1 splice) DD/ID (mod/profound)(7/7), white matter anomalies (6/7) hypotonia, epilepsy (3/7) DENND5B acts as: -GEF for activation of RAB proteins which are involved in membrane trafficking and neurotransmitter release -regulator of lipid absorption and homeostasis Functional studies showed loss of expression of DENND5B in fibroblasts, abnormal vesicle trafficking, and impaired lipid uptake and intracellular distribution Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5260 | DMAP1 |
chirag patel gene: DMAP1 was added gene: DMAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: DMAP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DMAP1 were set to Neurodevelopmental disorder Review for gene: DMAP1 was set to GREEN gene: DMAP1 was marked as current diagnostic Added comment: ESHG 2023: 9 patients/8 families with bilallelic variants in DMAP1 (3 missense, 7 LOF) All with DD, speech delay, hypotonia, and ID Some with epilepsy (4/6), FTT (4/5), and brain malformations (3/5) Drosophila showed abnormal behaviour pattern and bang sensitivity Specific methylation episignature also seen Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5258 | ITFG2 | chirag patel reviewed gene: ITFG2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5258 | HCN2 |
Elena Savva gene: HCN2 was added gene: HCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: HCN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: HCN2 were set to Febrile seizures, familial, 2 MIM#602477; Generalized epilepsy with febrile seizures plus, type 11 MIM#602477; {Epilepsy, idiopathic generalized, susceptibility to, 17} MIM#602477; Neurodevelopmental disorder (MONDO#0700092), HCN2-related Review for gene: HCN2 was set to AMBER Added comment: ICG 2023 conference - cohort of 20 individuals where >80% had a form of intellectual disability (half were severe) and/or seizures. Some had isolated intellectual disability, especially those with a recurring de novo p.E478del. - Patients were both mono- and biallelic. - Monoallelic individuals had de novo missense and an inframe deletion. Biallelic individuals had a mix of missense and PTC Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5256 | ZMYM3 | Zornitza Stark reviewed gene: ZMYM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 112, MIM# 301111; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5252 | SART3 |
Daniel Flanagan gene: SART3 was added gene: SART3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: SART3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SART3 were set to PMID: 37296101 Phenotypes for gene: SART3 were set to Neurodevelopmental disorder (MONDO#0700092), SART3-related, with 46,XY gonadal dysgenesis Review for gene: SART3 was set to GREEN Added comment: Nine individuals from six families presenting with intellectual disability, global developmental delay, a subset of brain anomalies, together with gonadal dysgenesis in 46,XY individuals. Additionally, two individuals had seizures and two had epileptiform activity reported on EEG. Human induced pluripotent stem cells carrying patient variants in SART3 show disruption to multiple signalling pathways, upregulation of spliceosome components and demonstrate aberrant gonadal and neuronal differentiation in vitro. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5251 | ERI1 |
Elena Savva gene: ERI1 was added gene: ERI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ERI1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERI1 were set to 37352860 Phenotypes for gene: ERI1 were set to Intellectual disability (MONDO#0001071), ERI1-related Review for gene: ERI1 was set to GREEN Added comment: PMID: 37352860 - 8 individuals from 7 unrelated families - Patients with biallelic missense show a MORE severe spondyloepimetaphyseal dysplasia, syndactyly, brachydactyly/clinodactyly/camptodactyly - Patients with biallelic null/whole gene deletion had mild ID and digit anomalies including brachydactyly/clinodactyly/camptodactyly - Patient chet for a missense and PTC variant has a blended phenotype with short stature, syndactyly, brachydactyly/clinodactyly/camptodactyly, mild ID and failure to thrive - Missense variants were functionally shown to not be able to rescue 5.8S rRNA processing in KO HeLa cells - K/O mice had neonatal lethality with growth defects, brachydactyly. Skeletal-specific K/O had mild platyspondyly, had more in keeping with patients with null variants than missense More severe phenotype hypothesised due to "exonuclease-dead proteins may compete for the target RNA molecules with other exonucleases that have functional redundancy with ERI1, staying bound to those RNA molecules" Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5250 | RPH3A |
Lucy Spencer gene: RPH3A was added gene: RPH3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RPH3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RPH3A were set to 37403762; 29441694 Phenotypes for gene: RPH3A were set to Neurodevelopmental disorder (MONDO#0700092), RPH3A-related Review for gene: RPH3A was set to GREEN Added comment: PMID: 37403762- 6 patients with RPH3A variant. All 6 have ID, 4 have epilepsy, 2 with obesity, 1 with dysmorphic features. All 6 have missense variants, 3 shown to be de novo, the other 3 parents were not available for testing. I patient also had language and motor impairment, breathing issues and mixed hypo/hypertonia- he also had variants in CUL4B, PRKAG2, SCN4A, none of these genes cause seizures (which he had). Patch clamp studies on 2 of the missense showed they increased either the number of NMDA receptors on neuron membrane surface or increased their conductance. Study suggests that the variants interrupt the normal role of RPH3A activity at the synaptic NMDAR complex which is needed for the induction of synaptic plasticity and NMDAR-dependant behaviours Also previously 1 biallelic patient was reported, PMID: 29441694- 1 girl with learning disabilities, tremors, ataxia, hyperglycemia and muscle fatigability. Chet for 2 RPH3A missense. Functional analysis showed strong and marginal impairment of protein binding for each variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5250 | DRG1 |
Dean Phelan gene: DRG1 was added gene: DRG1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DRG1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DRG1 were set to PMID: 37179472 Phenotypes for gene: DRG1 were set to Neurodevelopmental disorder (MONDO:0700092), DRG1-related Review for gene: DRG1 was set to GREEN Added comment: PMID: 37179472 - Biallelic variants were identified in four affected individuals from three distinct families with neurodevelopmental disorder with global developmental delay, primary microcephaly, short stature and craniofacial anomalies. Functional studies show the variants result in a loss of function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5250 | INTS11 | Zornitza Stark Phenotypes for gene: INTS11 were changed from intellectual disability, MONDO:0001071 to Neurodevelopmental disorder with motor and language delay, ocular defects, and brain abnormalities, MIM# 620428 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5248 | SRRM2 | Zornitza Stark Phenotypes for gene: SRRM2 were changed from neurodevelopmental disorder MONDO:0700092 SRRM2-related to Intellectual developmental disorder, autosomal dominant 72, MIM# 620439 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5245 | RHOBTB2 | Zornitza Stark Mode of inheritance for gene: RHOBTB2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5244 | RHOBTB2 |
Zornitza Stark edited their review of gene: RHOBTB2: Added comment: PMID 37165955: 16 individuals with de novo heterozygous missense variants in the BTB domain region and a severe DEE as previously reported. In addition, 6 individuals with de novo missense variants in the GTPase domain and a more variable neurodevelopmental phenotypes with or without epilepsy. In contrast to variants in the BTB domain region, variants in the GTPase domain do not impair proteasomal degradation of RHOBTB2 in vitro, indicating different functional consequences. In addition, 9 families with observed bi-allelic splice-site and truncating variants with variable neurodevelopmental phenotypes, indicating that complete loss of RHOBTB2 is pathogenic as well.; Changed publications: 29768694, 29276004, 37165955; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5239 | NSUN6 |
Michelle Torres gene: NSUN6 was added gene: NSUN6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NSUN6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NSUN6 were set to 37226891 Phenotypes for gene: NSUN6 were set to neurodevelopmental disorder MONDO:0700092, NSUN6-related Review for gene: NSUN6 was set to AMBER Added comment: Three unrelated consanguineous families with developmental delay, intellectual disability, motor delay, and behavioral anomalies. WES detected homozygous variants: - p.(Leu9Glufs*3): even though authors say is is predicted to cause NMD, it actually is NMD escape. No further studies were performed. A deceased affected sibling and parents were NOT tested. - p.(Asp323Asn): Shown to result in a misfolded protein. Methylation assay showed mutant could not catalyze m5C deposition in transcribed tRNACys and tRNAThr substrates in vitro. One of the parents and both unaffected siblings were shown to be carriers. - p.(Glu441Profs*15): truncation (full protein is 470aa) which would result in loss of residues involved in recognition and methylation. Shown to result in a misfolded protein. Parents were shown carriers. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5239 | UNC79 |
Krithika Murali gene: UNC79 was added gene: UNC79 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UNC79 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UNC79 were set to PMID:37183800 Phenotypes for gene: UNC79 were set to Complex neurodevelopmental disorder - MONDO:0100038 Review for gene: UNC79 was set to AMBER Added comment: PMID:37183800 Bayat et al 2023 report 6 unrelated patients with heterozygous NMD-predicted LoF variants in UNC79 - x1 canonical splice site variant, x5 nonsense/frameshift. 5 were confirmed de novo, 1 not identified in mother - father unavailable for testing. All variants absent in gnomAD and v2 pLI score for UNC79 is 1. Patients with UNC79 variants were identified through GeneMatcher or an international network of Epilepsy and Genetics departments. x1 patient underwent duo exome sequencing, remaining had trio exome sequencing - no other causative variants identified. Phenotypic features included: - 4/6 autistic features - 5/6 patients mild-moderate ID - 4/6 behavioural issues (aggression, stereotypies) - 4/6 epilepsy (focal to bilateral tonic-clonic seizures) - 5/6 hypotonia unc79 knockdown drosophila flies exhibited significantly higher rate of seizure-like behaviour than controls. unc79 haploinsufficiency shown to lead to significant reduction in protein levels of both unc79 and unc80 in mouse brains. Unc79 haploinsufficiency associated with deficiency in hippocampal-dependent learning and memory in mice. Authors have reviewed their own evidence in relation to the gene-disease criteria detailed by Strande et al 2017 and note that their clinical and experimental data provides moderate-level evidence supporting the association between UNC79 and a neurodevelopment disorder including ASD. Amber association favoured due to clinical phenotypic range reported between affected individuals and their lack of specificity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5234 | ACBD6 |
Lucy Spencer gene: ACBD6 was added gene: ACBD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ACBD6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ACBD6 were set to 36457943; 21937992; 35446914 Phenotypes for gene: ACBD6 were set to Neurodevelopmental disorder (MONDO#0700092), ACBD6-related Review for gene: ACBD6 was set to GREEN Added comment: PMID: 36457943 2 siblings with a neurodevelopmental disorder: severely delayed development, obesity, pancytopenia, diabetes, liver cirrhosis, intravertebral disc herniation, mild brain atrophy. Consanguineous family both siblings found to have a homozygous frameshift. This paper also mentioned 3 other reported variants in 6 individuals (only 3 unrelated) all homozygous, 2 frameshift, 1 canonical splice. All reported to have a neurodevelopmental disorder, some with limited information but one family also has obesity, spasticity, and dysmorphism. PMIDs: 21937992, 35446914 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5234 | POU3F2 |
Sarah Pantaleo gene: POU3F2 was added gene: POU3F2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POU3F2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: POU3F2 were set to PMID: 37207645 Phenotypes for gene: POU3F2 were set to Autism spectrum disorder, NDD, and adolescent-onset obesity Penetrance for gene: POU3F2 were set to unknown Mode of pathogenicity for gene: POU3F2 was set to Other Review for gene: POU3F2 was set to GREEN Added comment: We associate ultra-rare variants in POU3F2, encoding a central nervous system transcription factor, with syndromic obesity and neurodevelopment delay in 12 individuals. Demonstrate variant pathogenicity through in vitro analysis. Used exome sequencing, GeneMatcher and Genomics England 100,000 Genomes Project rare disease database. Both truncating and missense variants in over 10 individuals sharing autism spectrum disorder, NDD, and adolescent-onset obesity (may have had other features eg. CAKUT in 2 individuals, diabetes in two) . Affected individuals presented with low-to-normal birth weight and infantile feeding difficulties but developed insulin resistance and hyperplasia during childhood. With the exception of an early truncating variant, the variants showed adequate nuclear translocation but overall disturbed DNA-binding ability and promoter activation. Variants absent from population and clinical databases. Almost all constituted putatively non-inherited de novo variants (8/10). Functional studies provide evidence for loss of function in eight and gain of function in one obesity-associated POU3F2 variant. One variant did not impact POU3F2-promoter activation, leaving the possibility for further path-mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5234 | U2AF2 | Paul De Fazio edited their review of gene: U2AF2: Changed rating: GREEN; Changed phenotypes: Neurodevelopmental disorder, U2AF2-related (MONDO:0700092); Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5233 | MAP4K4 | Zornitza Stark Mode of inheritance for gene: MAP4K4 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5233 | MAP4K4 | Zornitza Stark Mode of inheritance for gene: MAP4K4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5230 | MAP4K4 | Zornitza Stark commented on gene: MAP4K4: 26 individuals from 21 families reported with Rasopathy-like phenotype, comprising ID/DD, dysmorphic features and congenital anomalies. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5230 | MAP4K4 | Zornitza Stark edited their review of gene: MAP4K4: Changed rating: GREEN; Changed publications: 37126546; Changed phenotypes: RASopathy, MONDO:0021060, MAP4K4-related; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5230 | MCM6 |
Suliman Khan gene: MCM6 was added gene: MCM6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MCM6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MCM6 were set to PMID: 37198333 Phenotypes for gene: MCM6 were set to Neurodevelopmental disorder, MONDO:0700092, MCM6-related Review for gene: MCM6 was set to GREEN Added comment: PMID: 37198333 reported 5 unrelated families with de novo variants in MCM6 gene. Two patients with the same missense variant p.(Cys158Tyr) in zinc finger domain presented with intra-uterine growth retardation, short stature, congenital microcephaly, endocrine features, developmental delay and urogenital anomalies. In other three unrelated individuals different de novo missense variants were identified in the oligo nucleotide binding (OB)-fold domain. These patients had variable neurodevelopmental features including autism spectrum disorder, developmental delay, and epilepsy. The clinical features and functional defects related to the zinc binding residue resembled those observed in syndromes related to other MCM components and DNA replication factors (Meier–Gorlin syndrome and Seckel syndrome), while de novo OB-fold domain missense variants were associated with more variable neurodevelopmental phenotypes (PMID: 37198333). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5230 | TPR | Zornitza Stark Phenotypes for gene: TPR were changed from Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, TPR-related to Intellectual developmental disorder, autosomal recessive 79, MIM# 620393 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5229 | TPR | Zornitza Stark edited their review of gene: TPR: Changed phenotypes: Intellectual developmental disorder, autosomal recessive 79, MIM# 620393 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5228 | UNC13A | Ain Roesley reviewed gene: UNC13A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder MONDO#0700092, UNC13A-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5228 | ZNF292 | Michelle Torres reviewed gene: ZNF292: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 64, MIM#619188; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5227 | ESAM | Zornitza Stark reviewed gene: ESAM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5226 | SLITRK2 | Zornitza Stark reviewed gene: SLITRK2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 111, MIM# 301107; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5222 | CNOT9 | Zornitza Stark Mode of inheritance for gene: CNOT9 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5220 | LHX2 | Manny Jacobs reviewed gene: LHX2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 37057675; Phenotypes: Neurodevelopmental disorder (MONDO: 0700092); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5220 | CNOT9 | Karina Sandoval edited their review of gene: CNOT9: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5219 | LHX2 |
Manny Jacobs gene: LHX2 was added gene: LHX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LHX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LHX2 were set to PMID: |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5219 | CNOT9 |
Karina Sandoval gene: CNOT9 was added gene: CNOT9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CNOT9 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: CNOT9 were set to PMID: 37092538 Phenotypes for gene: CNOT9 were set to neurodevelopmental disorder, MONDO:0700092 Review for gene: CNOT9 was set to GREEN Added comment: 7 individuals with de novo variants. In silico predictions of functional relevance. All affected persons have DD/ID, with five of them showing seizures. Other symptoms include. Symptoms: Neuro dev disorder. ID, Epilepsy. All affected persons have DD/ID, with five of them showing seizures. Other symptoms include muscular hypotonia, facial dysmorphism, and behavioral abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5219 | CBX1 |
Daniel Flanagan gene: CBX1 was added gene: CBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CBX1 were set to PMID: 37087635 Phenotypes for gene: CBX1 were set to Neurodevelopmental disorder (MONDO#0700092), CBX1-related Review for gene: CBX1 was set to GREEN Added comment: Three different de novo missense variants identified in three unrelated individuals with developmental delay, hypotonia, autistic features, and variable dysmorphic features such as broad forehead and head circumference above average. Mutant mice displayed increased latency-to-peak response, suggesting the possibility of synaptic delay or myelination deficits. Functional studies confirmed the reduction of mutant HP1β binding to heterochromatin. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5216 | INTS11 |
Melanie Marty gene: INTS11 was added gene: INTS11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: INTS11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: INTS11 were set to PMID: 37054711 Phenotypes for gene: INTS11 were set to Global developmental delay; launguage delay; intellectual disability; impaired motor development; brain atrophy Review for gene: INTS11 was set to GREEN Added comment: PMID: 37054711 - 15 individuals from 10 unrelated families with bi-allelic variants in INTS11 with global developmental and language delay, intellectual disability, impaired motor development, and brain atrophy. Functional studies in Drosophila showed that dIntS11 (fly ortholog of INTS11) is essential and expressed in the central nervous systems in a subset of neurons and most glia in larval and adult stages. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5216 | SRSF1 | Paul De Fazio edited their review of gene: SRSF1: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5216 | SRSF1 |
Paul De Fazio gene: SRSF1 was added gene: SRSF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRSF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SRSF1 were set to 37071997 Phenotypes for gene: SRSF1 were set to Neurodevelopmental disorder, SRSF1-related MONDO:0700092 Review for gene: SRSF1 was set to GREEN gene: SRSF1 was marked as current diagnostic Added comment: 17 individuals from 16 families reported with mostly de novo variants. Variants were a mixture of missense, nonsense/frameshift (both NMD-predicted and not NMD-predicted) and microdeletions. In one family, only one parent was available for testing. In another family, 2 affected siblings had the variant but the variant was not identified in either parent suggesting germline mosaicism. Functional testing of a subset of variants in Drosophila supported pathogenicity in most, but 2 missense variants showed no functional effect and were classified VUS. Episignature analysis (EpiSign) on patient DNA from blood showed a specific DNA methylation signature in patients with the variants classified pathogenic but not those classified VUS. Phenotypes included mainly neurological abnormalities (mild to moderate ID/dev delay, motor delay, speech delay, and behavioural disorders) and facial dysmorphisms. Other features included hypotonia (11/16), variable brain abnormalities on MRI (6/12), variable cardiac malformations (6/14). urogenital malformations e.g. hypospadias, cryptorchidism (6/13), scoliosis (5/17) and/or variable other skeletal abnormalities (10/17). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5216 | POLR1A |
Elena Savva gene: POLR1A was added gene: POLR1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POLR1A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: POLR1A were set to PMID: 37075751 Phenotypes for gene: POLR1A were set to Acrofacial dysostosis, Cincinnati type MIM#616462 Review for gene: POLR1A was set to GREEN Added comment: PMID: 37075751 - >10 patients with developmental delay Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5215 | SLC30A9 |
Lucy Spencer gene: SLC30A9 was added gene: SLC30A9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC30A9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC30A9 were set to 37041080 Phenotypes for gene: SLC30A9 were set to Birk-Landau-Perez syndrome (MIM#617595) Review for gene: SLC30A9 was set to GREEN Added comment: PMID:37041080 - 2 families previously reported and this paper describes 4 more with biallelic SLC30A9 variants. Original 2 families: 6 affected members all hom for Ala350del, and 1 affected member chet for 2 frameshifts. 4 families from this paper: 2 families have the same homozygous missense (Gly418Val), family 3 has 4 affected sibs hom for Ala350del, family 4 1 affected chet for a frameshift and a synonymous. So 2 fams homs for Ala350del and 2 fams hom for Gly418Val. All have Brik-Landau-Perez syndrome: all with ID, movement disorder and dystonia, and many with oculomotor apraxia, renal abnormalitie, ptosis, some had hearing impairment. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5214 | GATAD2A |
Bryony Thompson gene: GATAD2A was added gene: GATAD2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GATAD2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GATAD2A were set to https://doi.org/10.1016/j.xhgg.2023.100198; 17565372 Phenotypes for gene: GATAD2A were set to Neurodevelopmental disorder, MONDO:0700092, GATAD2A-related Review for gene: GATAD2A was set to GREEN Added comment: https://doi.org/10.1016/j.xhgg.2023.100198 - Five unrelated individuals with a neurodevelopmental disorder identified with 3 missense & 2 LoF (4 de novo & 1 unknown inheritance). The shared clinical features with variable expressivity include global developmental delay (4/4), craniofacial dysmorphism (3/5), structural brain defects (2/3), musculoskeletal anomalies (3/5), vision/hearing defects (2/3), gastrointestinal/renal defects (2/3). Loss of function is the expected mechanism of disease. In vitro assays of one of the missense variants (p.Cys420Tyr) demonstrates disruption of GATAD2A integration with CHD3, CHD4, and CHD5 PMID: 17565372 - null mouse model is embryonic lethal. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5212 | KDM5A |
Zornitza Stark gene: KDM5A was added gene: KDM5A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KDM5A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: KDM5A were set to 21937992; 33350388 Phenotypes for gene: KDM5A were set to Neurodevelopmental disorder MONDO:0700092, KDM5A-related Review for gene: KDM5A was set to GREEN Added comment: PMID:21937992 reported a family with recessive missense KDM5A variant presenting with an undefined developmental disorder characterised with intellectual disability and facial dysmorphisms. PMID:33350388 reported nine patients from seven unrelated families identified with variants in KDM5A, of which three unrelated patients harboured heterozygous variants, while six patients from four unrelated families had homozygous variants. These patients presented with autism spectrum disorder (ASD) and a spectrum of neurodevelopmental phenotypes including intellectual disability, lack of speech, developmental delay and motor impairment. In addition, loss of KDM5A has resulted in repetitive behaviors, sociability deficits, cognitive dysfunction, and abnormal dendritic morphogenesis in mice. This gene has already been associated with phenotype in Gene2Phenotype (biallelic inheritance with 'limited' rating), but not in OMIM. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5210 | DNM1 | Zornitza Stark Phenotypes for gene: DNM1 were changed from Developmental and epileptic encephalopathy 31, OMIM:616346 to Developmental and epileptic encephalopathy 31A, autosomal dominant, MIM# 616346; Developmental and epileptic encephalopathy 31B, autosomal recessive, MIM# 620352 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5209 | DNM1 | Zornitza Stark edited their review of gene: DNM1: Changed phenotypes: Developmental and epileptic encephalopathy 31A, autosomal dominant, MIM# 616346, Developmental and epileptic encephalopathy 31B, autosomal recessive, MIM# 620352 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5208 | DNAH14 | Elena Savva reviewed gene: DNAH14: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5208 | RFX7 | Zornitza Stark Phenotypes for gene: RFX7 were changed from ID, ASD, ADHD to Intellectual developmental disorder, autosomal dominant 71, with behavioral abnormalities, MIM# 620330 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5207 | MED11 | Zornitza Stark Phenotypes for gene: MED11 were changed from neurodevelopmental disorder MONDO#0700092, MED11-related to Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5206 | MED11 | Zornitza Stark reviewed gene: MED11: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5206 | WARS | Zornitza Stark Phenotypes for gene: WARS were changed from Neurodevelopmental disorder (MONDO:0700092), WARS-related to Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5205 | WARS | Zornitza Stark reviewed gene: WARS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5204 | C16orf62 | chirag patel reviewed gene: C16orf62: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 36113987; Phenotypes: Ritscher-Schinzel syndrome-3 (RTSC3), MIM#619135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5203 | ROBO1 | Zornitza Stark reviewed gene: ROBO1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurooculorenal syndrome, MIM# 620305; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5202 | CAMSAP1 | Zornitza Stark Phenotypes for gene: CAMSAP1 were changed from lissencephaly spectrum disorders (MONDO:0018838), CAMSAP1-related to Cortical dysplasia, complex, with other brain malformations 12, MIM# 620316 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5201 | CAMSAP1 | Zornitza Stark reviewed gene: CAMSAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cortical dysplasia, complex, with other brain malformations 12, MIM# 620316; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5201 | YWHAE |
Yetong Chen gene: YWHAE was added gene: YWHAE was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YWHAE was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: YWHAE were set to 36999555 Phenotypes for gene: YWHAE were set to Neurodevelopmental disorder, MONDO:0700092 Review for gene: YWHAE was set to GREEN Added comment: PMID 36999555 reports 6 patients with YWHAE variants (1 intragenic deletion and 5 large deletions encompassing YWHEA but not PAFAH1B1) who have mild to severe intellectual disability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5199 | RNH1 | Zornitza Stark reviewed gene: RNH1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNH1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5198 | CRIPT |
Karina Sandoval commented on gene: CRIPT: PMID: 37013901 identified 6 individuals with Rothmund-Thomson syndrome characterised by poikiloderma, sparse hair, small stature, skeletal defects, cancer, cataracts, resembling features of premature aging. Two new variants identified and 4 were already published. 5 were hom, 1 was chet, all with different variants. All CRIPT individuals fulfilled the diagnostic criteria for RTS, and additionally had neurodevelopmental delay and seizures. CRIPT-deficient fibroblasts showed an unremarkable mitotic progression and unremarkable number of mitotic errors, c.132del p.(Ala45Glyfs*82), hom c.227G>A, p.(Cys76Tyr), hom c.133_134insGG,p.(Ala45Glyfs*82),hom c.141del p.(Phe47Leufs*84), hom c.8G>A p.(Cys3Tyr), 1,331 bp del exon 1, chet c.7_8del; p.(Cys3Argfs*4), hom |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5198 | CRIPT |
Karina Sandoval gene: CRIPT was added gene: CRIPT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRIPT were set to PMID: 37013901 Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789) : Rothmund-Thomson syndrome MONDO:0010002 Review for gene: CRIPT was set to GREEN Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5195 | SNAPC4 |
Ee Ming Wong gene: SNAPC4 was added gene: SNAPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNAPC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNAPC4 were set to 36965478 Phenotypes for gene: SNAPC4 were set to Neurodevelopmental disorder (MONDO#0700092), SNAPC4-related Review for gene: SNAPC4 was set to GREEN gene: SNAPC4 was marked as current diagnostic Added comment: - Ten individuals from eight families with neurodevelopmental disorder found to be compound heterozygous for variants in SNAPC4 - Identified variants included 6x missense, 1x nonsense, 1x frameshift and 6x splice - Depletion of SNAPC4 levels in HeLa cell lines via genomic editing led to decreased snRNA expression and global dysregulation of alternative splicing, similarly observed in patient fibroblasts Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5195 | MKL2 |
Dean Phelan gene: MKL2 was added gene: MKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MKL2 were set to PMID: 37013900 Phenotypes for gene: MKL2 were set to Neurodevelopmental disorder (MONDO:0700092), MKL2-related Mode of pathogenicity for gene: MKL2 was set to Other Review for gene: MKL2 was set to AMBER Added comment: PMID: 37013900 - de novo missense variants in MKL2 (now known as MRTFB) were identified in two patients with mild dysmorphic features, intellectual disability, global developmental delay, speech apraxia, and impulse control issues. Functional studies in a Drosophila model suggest a gain of function disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5195 | RNH1 |
Krithika Murali gene: RNH1 was added gene: RNH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNH1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNH1 were set to PMID: 36935417 Phenotypes for gene: RNH1 were set to RNH1-related disorder Review for gene: RNH1 was set to AMBER Added comment: PMID: 36935417 report two siblings from a consanguineous Somali family with homozygous RNH1 splice site variant (c.615-2A>C) with congenital cataracts, global developmental delay, hypotonia, seizures (focal and generalised) and regression in the context of infection. RT-PCR and RNASeq of skeletal muscle supported exon 7 skipping with an in-frame deletion involving 57 amino acids with reduced expression on Western blot analysis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5195 | ESAM |
Chern Lim gene: ESAM was added gene: ESAM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ESAM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ESAM were set to 36996813 Phenotypes for gene: ESAM were set to Neurodevelopmental disorder (MONDO#0700092), ESAM-related Review for gene: ESAM was set to GREEN gene: ESAM was marked as current diagnostic Added comment: PMID 36996813: - Thirteen affected individuals, including four fetuses, from eight unrelated families, with homozygous loss-of-function-type variants in ESAM – 2 of the variants are frameshifts, 1x nonsense, 1x canonical splice. - Affected individuals have profound global developmental delay/unspecified intellectual disability, epilepsy, absent or severely delayed speech, varying degrees of spasticity, ventriculomegaly, and ICH/cerebral calcifications, the latter being also observed in the fetuses. - One of the frameshift variant c.115del (p.Arg39Glyfs*33), was detected in six individuals from four unrelated families from the same geographic region in Turkey (southeastern Anatolia), suggesting a founder effect. - The c.451+1G>A variant was detected in three individuals from two independent families with the same ethnic origin (Arab Bedouin) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5194 | NCAPG2 | Zornitza Stark reviewed gene: NCAPG2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Khan-Khan-Katsanis syndrome, MIM# 618460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5193 | SCN1B | Sangavi Sivagnanasundram reviewed gene: SCN1B: Rating: AMBER; Mode of pathogenicity: None; Publications: 9697698, 17020904, 12011299; Phenotypes: Generalized epilepsy with febrile seizures plus, type 1 (MONDO:0018214, MIM 604233); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5193 | AGO1 | Zornitza Stark Phenotypes for gene: AGO1 were changed from Intellectual disability; autism to Neurodevelopmental disorder with language delay and behavioral abnormalities, with or without seizures, MIM# 620292 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5192 | AGO1 | Zornitza Stark edited their review of gene: AGO1: Changed phenotypes: Neurodevelopmental disorder with language delay and behavioral abnormalities, with or without seizures, MIM# 620292 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5192 | TAB2 |
Lucy Spencer gene: TAB2 was added gene: TAB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TAB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TAB2 were set to 35971781 Phenotypes for gene: TAB2 were set to Congenital heart defects, multiple types, 2 MONDO:0014000 Review for gene: TAB2 was set to GREEN Added comment: PMID: 35971781 - expansion of the phenotype, 14 patients with TAB2 variants 6 have dev delay and 4 are also listed as having ID along with other phenotype features associated with this gene. Note- there is a previous review of this paper in the mendeilome as amber Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5192 | UBE3C | Zornitza Stark Phenotypes for gene: UBE3C were changed from Neurodevelopmental disorder, MONDO:0700092, UBE3C-related to Neurodevelopmental disorder with absent speech and movement and behavioral abnormalities, MIM# 620270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5191 | UBE3C | Zornitza Stark edited their review of gene: UBE3C: Changed phenotypes: Neurodevelopmental disorder with absent speech and movement and behavioral abnormalities, MIM# 620270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5184 | YWHAZ |
Achchuthan Shanmugasundram gene: YWHAZ was added gene: YWHAZ was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YWHAZ was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: YWHAZ were set to 36001342 Phenotypes for gene: YWHAZ were set to Intellectual disability, MONDO:0001071 Review for gene: YWHAZ was set to RED Added comment: PMID:36001342 reported one large three-generation family with intellectual disability and global developmental delay, where all affected members were identified with a heterozygous missense variant (c.147A>T/ p.Lys49Asn) in YWHAZ gene. Although there were 10 other rare variants located in 10 genes (ARHGAP4, AGPS, APOL3, CES3, DACT2, ECH1, FAM71E2, KREMEN1, YWHAZ, ZFYVE26) that co-segregated with the ID/GDD phenotype were identified in the family, they were either not present in all affected members or present in unaffected members. In addition, computational modeling and knockdown/ knockin studies with Drosophila also confirmed the role of this YWHAZ variant in intellectual disability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5183 | RRAS2 |
Elena Savva gene: RRAS2 was added gene: RRAS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RRAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: RRAS2 were set to PMID: 31130282; 31130285 Phenotypes for gene: RRAS2 were set to Noonan syndrome 12 MIM#618624 Mode of pathogenicity for gene: RRAS2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: RRAS2 was set to AMBER Added comment: Gene has an established GOF mechanism PMID: 31130282 - 3/9 individuals had mild learning difficulties or mild GDD PMID: 31130285 - 1/3 individuals had mild ID, 1/3 had severe ID, 1/3 normal Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5182 | RBSN |
Achchuthan Shanmugasundram gene: RBSN was added gene: RBSN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RBSN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RBSN were set to 25233840; 29784638; 35652444 Phenotypes for gene: RBSN were set to intellectual disability, MONDO:0001071 Review for gene: RBSN was set to GREEN Added comment: This gene should be rated GREEN as bi-allelic variants in RBSN has been associated with a phenotype encompassing developmental delay and intellectual disability from four unrelated families. PMID:25233840 reported a 6.5 year old female patient with a homozygous missense variant c.1273G > A (p.Gly425Arg) and her clinical presentation included intractable seizures, developmental delay, microcephaly, dysostosis, osteopenia, craniofacial dysmorphism, macrocytosis and megaloblastoid erythropoiesis. PMID:29784638 reported three siblings with homozygous variant c.289G>C (p.Gly97Arg) in RBSN. The proband presented global developmental delay, had complete 46,XY male-to-female sex reversal and died at age 20 months after multiple infections. The other 2 affected siblings underwent unrelated-donor bone marrow or stem cell transplantation at 8 and 6.5 months of age, respectively. Both have severe intellectual disability and are nonambulatory and nonverbal. PMID:35652444 reported two unrelated families (three siblings from a family of Iranian descent identified with homozygous variant c.547G>A (p.Gly183Arg) and four members from a family of indigenous Cree descent identified with homozygous variant c.538C>G (p.Arg180Gly)) with overlapping phenotypes including developmental delay, intellectual disability, distal motor axonal neuropathy and facial dysmorphism. This gene has not yet been associated with any phenotypes either in OMIM or in Gene2Phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5182 | CTR9 | Achchuthan Shanmugasundram changed review comment from: PMID:35717577 reported two additional unrelated cases with non-synonymous heterozygous CTR9 variants (p.Glu15Asp and p.Pro25Arg) and they presented with macrocephaly, motor delay, and intellectual disability. In addition, functional studies in also showed that knockout/ over-expression of CTR9 variants caused motor defects and enlargement of telencephalon (homologous to the mammalian cerebrum).; to: PMID:35717577 reported two additional unrelated cases with non-synonymous heterozygous CTR9 variants (p.Glu15Asp and p.Pro25Arg) and they presented with macrocephaly, motor delay, and intellectual disability. In addition, functional studies in zebrafish also showed that knockout/ over-expression of CTR9 variants caused motor defects and enlargement of telencephalon (homologous to the mammalian cerebrum). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5182 | DPYSL2 |
Achchuthan Shanmugasundram gene: DPYSL2 was added gene: DPYSL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DPYSL2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DPYSL2 were set to 27249678; 35861646 Phenotypes for gene: DPYSL2 were set to intellectual disability, MONDO:0001071; Aplasia/Hypoplasia of the corpus callosum, HP:0007370 Review for gene: DPYSL2 was set to AMBER Added comment: This gene should be rated AMBER, as it has been associated with intellectual disability (ID) from two unrelated cases displaying monoallelic variants in DPYSL2/ CRMP2, and supported by functional studies. However, the evidence is not sufficient for green rating as there are variants reported in other (but different) genes in the two patients. PMID:35861646 reported two cases identified with heterozygous variants (patient1: c.1693C>T (p.Arg565Cys); patient 2: c.42C>A (p.Ser14Arg). These patients had overlapping phenotypes including dysmorphic features, severe global developmental delay and hypoplasia of the corpus callosum. In addition, patient 2 was bed-ridden and could not roll out and had a history of myoclonic seizures and status epilepticus. It should be noted that patient 1 is compound heterozygous for 2 missense variants in the EFCAB5 gene and was hemizygous for a maternally inherited missense variant in the GPKOW gene and patient 2 had 1 de novo missense variant in the COBLL1 gene and was compound heterozygous for 2 missense variants in the POTEF gene. The severity of the phenotypes between the two cases differs significantly and the additional variants may have possibly contributed to this phenotype. Brain-specific Crmp2 knockout mice display neuronal development deficits and behavioural impairments associated with hypoplasia of the corpus callosum. In addition, functional studies performed in zebrafish and cell lines that the CRMP2 variants lead to the loss-of-function of CRMP2 protein and can cause intellectual disability. This gene has not yet been associated with relevant phenotypes either in OMIM or in Gene2Phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5181 | AMOTL1 |
Lucy Spencer gene: AMOTL1 was added gene: AMOTL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AMOTL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: AMOTL1 were set to 36751037 Phenotypes for gene: AMOTL1 were set to Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related Review for gene: AMOTL1 was set to GREEN Added comment: PMID: 36751037- 16 individuals from 12 families with orofacial clefting syndrome and het variants in AMOTL1. Many in 1 hotspot: 5 individuals from 3 families have R157C, 6 individuals from another 4 families have R157H, 1 has P160L, and another has Q161R. Out of this hostpaot- 1 with P368A, 1 with E507K, 1 with E579K. 7 are de novo. All but 2 have clefting, 7 are dysmorphic, 5 have hearing loss, 9 have CHD, 7 have tall stature, 6 have dev delay. Other features include liver disease, myopia, scoliosis and immune involvement. Another 2 families have been previously reported (described in the panelapp review in mendeliome) with variants in this hotspot 1 has 2 individuals with R157C, the other has 1 individual with P160L. All hotspot are absent from gnomad v2. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5180 | SLC35B2 |
Zornitza Stark gene: SLC35B2 was added gene: SLC35B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC35B2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC35B2 were set to 35325049 Phenotypes for gene: SLC35B2 were set to Leukodystrophy, hypomyelinating, 26, with chondrodysplasia, MIM# 620269 Review for gene: SLC35B2 was set to AMBER Added comment: 2 x individuals with homozygous variants (c.1218_1220del and c.1224_1225del) in SLC35B2. Phenotypes included pre- and postnatal growth retardation, scoliosis, severe motor and intellectual disabilities and hypomyelinating leukodystrophy. Functional analysis on patient cells showed that the variants result in a decreased expression of mRNA and affect protein subcellular localization leading to functional impairment of the protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5179 | EMC1 | Achchuthan Shanmugasundram reviewed gene: EMC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 35234901; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5179 | ATG4D | Zornitza Stark Phenotypes for gene: ATG4D were changed from neurodevelopmental disorder; Abnormal facial shape to Neurodevelopmental disorder, MONDO:0700092, ATG4D-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5177 | ATG4D | Zornitza Stark reviewed gene: ATG4D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, ATG4D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5177 | ROBO1 |
Achchuthan Shanmugasundram gene: ROBO1 was added gene: ROBO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ROBO1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ROBO1 were set to 28286008; 30692597; 35227688; 35348658 Phenotypes for gene: ROBO1 were set to intellectual disability, MONDO:0001071 Review for gene: ROBO1 was set to GREEN Added comment: Comment on gene classification: This gene should be rated green as this gene has been associated with intellectual disability from six unrelated cases. However, the MOI should be set as "BIALLELIC, autosomal or pseudoautosomal" as five of these cases were reported with biallelic variants and only one case was reported with monoallelic variant. PMID:28286008 reported a boy with compound heterozygous variants that was presented with developmental delay in 13 months and had severe intellectual disability and hyperactivity at nine years of age. He was nonverbal and wheelchair dependent because of spastic diplegia and ataxia. PMID:30692597 reported a five year old boy identified with a homozygous ROBO1 variant who had combined pituitary hormone deficiency, psychomotor developmental delay, severe intellectual disability, sensorineural hearing loss, strabismus and characteristic facial features. PMID:35227688 reported eight patients including the boy reported in PMID:30692597. Of the other seven patients, three were presented with intellectual disability. Of these three patients, two harboured compound heterozygous and one harboured homozygous variants. PMID:35348658 reported a patient identified with monoallelic de novo variant (p.D422G) who presented with early-onset epileptic encephalopathy and had severe developmental delay. This gene has not yet been associated with any phenotypes in OMIM or Gene2Phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5177 | ATG4D |
Suliman Khan gene: ATG4D was added gene: ATG4D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATG4D was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATG4D were set to PMID: 36765070 Phenotypes for gene: ATG4D were set to neurodevelopmental disorder; Abnormal facial shape Penetrance for gene: ATG4D were set to unknown Review for gene: ATG4D was set to GREEN Added comment: PMID: 36765070 reported three individuals from two unrelated families with a neurodevelopmental disorder characterized by speech and motor impairment with a similar facial gestalt comprising almond-shaped eyes, depressed nasal bridge, and a prominent Cupid’s bow with variable disease severity and progression. NGS analysis revealed bi-allelic loss-of-function variants in ATG4D gene. Based on the clinical, bioinformatic, and functional data, the author concluded that bi-allelic loss-of-function variants in ATG4D contribute to the pathogenesis of syndromic neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5173 | RAB39B | Zornitza Stark Mode of inheritance for gene: RAB39B was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5170 | JPH3 | Zornitza Stark Mode of inheritance for gene: JPH3 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5168 | JPH3 | Zornitza Stark reviewed gene: JPH3: Rating: AMBER; Mode of pathogenicity: None; Publications: 36273396; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, JPH3-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5168 | ATP9A | Zornitza Stark Phenotypes for gene: ATP9A were changed from Neurodevelopmental delay; Postnatal microcephaly; Failure to thrive; Gastrointestinal symptoms to Neurodevelopmental disorder with poor growth and behavioural abnormalities, MIM# 620242 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5167 | ATP9A | Zornitza Stark edited their review of gene: ATP9A: Changed phenotypes: Neurodevelopmental disorder with poor growth and behavioural abnormalities, MIM# 620242 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5167 | GOLGA2 | Zornitza Stark Phenotypes for gene: GOLGA2 were changed from Neuromuscular disorder to Developmental delay with hypotonia, myopathy, and brain abnormalities, MIM 620240 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5165 | GOLGA2 | Zornitza Stark edited their review of gene: GOLGA2: Added comment: Third family reported.; Changed publications: 34424553; Changed phenotypes: Developmental delay with hypotonia, myopathy, and brain abnormalities, MIM 620240; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5165 | RAB39B | Achchuthan Shanmugasundram reviewed gene: RAB39B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20159109, 25434005, 11050621, 29152164, 32873259, 34761259; Phenotypes: Intellectual developmental disorder, X-linked 72, OMIM:300271, Waisman syndrome, OMIM:311510; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5165 | WDR11 | Zornitza Stark reviewed gene: WDR11: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 78, MIM# 620237; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5165 | TRPM3 | Zornitza Stark Phenotypes for gene: TRPM3 were changed from Neurodevelopmental disorder, MONDO:0700092, TRPM3-related to Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5164 | TRPM3 | Zornitza Stark edited their review of gene: TRPM3: Changed phenotypes: Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5160 | FICD |
Elena Savva gene: FICD was added gene: FICD was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FICD was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FICD were set to 36704923 Phenotypes for gene: FICD were set to Neurodevelopmental disorder, FICD-related (MONDO#0700092) Review for gene: FICD was set to AMBER Added comment: PMID: 36704923: - five individuals (3 families) w/ infancy onset diabetes mellitus (5/5) and severe neurodevelopmental delay (4/5) - all homozygous for p.R371S - variant expression in E. coli showed loss of affinity, deregulates BiP-AMP and affects secretion Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5159 | OGDH |
Zornitza Stark gene: OGDH was added gene: OGDH was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: OGDH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OGDH were set to 36520152; 32383294 Phenotypes for gene: OGDH were set to Oxoglutarate dehydrogenase deficiency, MIM# 203740 Review for gene: OGDH was set to GREEN Added comment: 6 individuals reported with bi-allelic variants in this gene and DD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5158 | CCDC84 |
Lucy Spencer gene: CCDC84 was added gene: CCDC84 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC84 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC84 were set to 34009673 Phenotypes for gene: CCDC84 were set to Mosaic variegated aneuploidy syndrome 4 (MIM#620153) Review for gene: CCDC84 was set to AMBER Added comment: PMID: 34009673- patients with constitutional mosaic aneuploidy were found to have biallelic mutations in CENATAC(CCDC84). 2 adult siblings with mosaic aneuploidies, microcephaly, dev delay, and maculopathy. Both chet for a missense and a splice site deletion- but the paper days these both result in the creation of a novel splice site that leads to frameshifts and loss of the c-terminal 64 amino acids. Gene is shown to be part of a spliceosome. CENATAC depletion or expression of disease mutants resulted in retention of introns in ~100 genes enriched for nucleocytoplasmic transport and cell cycle regulation, and caused chromosome segregation errors. Functional analysis in CENATAC-depleted HeLa cells demonstrated chromosome congression defects and subsequent mitotic arrest, which could be fully rescued by wildtype but not mutant CENATAC. Expression of the MVA-associated mutants exacerbated the phenotype, suggesting that the mutant proteins dominantly repress the function of any residual wildtype protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5158 | TTI1 | Ee Ming Wong reviewed gene: TTI1: Rating: GREEN; Mode of pathogenicity: None; Publications: DOI:https://doi.org/10.1016/j.ajhg.2023.01.006; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TTI1-related to; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5157 | TCEAL1 | Zornitza Stark Phenotypes for gene: TCEAL1 were changed from Neurodevelopmental disorder, MONDO:0700092, TCEAL1-related; hypotonia; abnormal gait; developmental delay; intellectual disability; autism; dysmorphic facial features to Neurodevelopmental disorder with gait disturbance, dysmorphic facies and behavioral abnormalities, X-linked, MIM# 301094 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5156 | TCEAL1 | Zornitza Stark reviewed gene: TCEAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with gait disturbance, dysmorphic facies and behavioral abnormalities, X-linked, MIM# 301094; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5154 | ZNF668 | Zornitza Stark Phenotypes for gene: ZNF668 were changed from DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism to Neurodevelopmental disorder with poor growth, large ears, and dysmorphic facies, MIM# 620194 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5153 | SMC5 | Zornitza Stark Phenotypes for gene: SMC5 were changed from Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID to Atelis syndrome 2, MIM# 620185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5152 | SLF2 | Zornitza Stark Phenotypes for gene: SLF2 were changed from Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID to Atelis syndrome 1, MIM# 620184 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5150 | NAE1 |
Zornitza Stark gene: NAE1 was added gene: NAE1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAE1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAE1 were set to 36608681 Phenotypes for gene: NAE1 were set to Neurodevelopmental disorder, MONDO:0700092, NAE1-related Review for gene: NAE1 was set to GREEN Added comment: Four individuals reported with bi-allelic variants and intellectual disability, ischiopubic hypoplasia, stress-mediated lymphopenia and neurodegeneration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5148 | TRPC5 |
Zornitza Stark gene: TRPC5 was added gene: TRPC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRPC5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890 Phenotypes for gene: TRPC5 were set to Neurodevelopmental disorder, MONDO:0700092, TRPC5-related Review for gene: TRPC5 was set to AMBER Added comment: PMID: 36323681; Leitão E. et al. (2022) Nat Commun.13(1):6570: Missense variant NM_012471.2:c.523C>T, p.(Arg175Cys in three brothers with intellectual disability (ID) and autistic spectrum disorder (ASD), inherited from an asymptomatic mother and absent in the maternal grandparents. Whole cell patch clamp studies of HEK293 created by site-directed mutagenesis showed increased current of this calcium channel (constitutively opened). (This variant is absent in gnomAD v2.1.1). Also, the nonsense variant, c.965G> A, p.(Trp322*) was found in a high functioning ASD male (maternally inherited), NMD-predicted. Other papers and TRPC5 variants that were cited to associate this gene with X-linked ID and/or ASD include: PMID: 24817631; Mignon-Ravix, C. et al. (2014) Am. J.Med. Genet. A 164A: 1991–1997: A hemizygous 47-kb deletion in Xq23 including exon 1 of the TRPC5 gene. He had macrocephaly, delayed psychomotor development, speech delay, behavioural problems, and autistic features. Maternally inherited, and a family history compatible with X-linked inheritance (i.e., maternal great uncle was also affected, although not tested). In addition, PMID: 36323681; Leitão E. et al. (2022) cites papers with the variants p.(Pro667Thr), p.(Arg71Gln) and p.(Trp225*). NB. p.(Pro667Thr) is absent in gnomAD (v2.1.1), p.(Arg71Gln) is also absent (the alternative variant p.(Arg71Trp) is present once as heterozygous only). p.(Trp225*) is absent, and it should be noted that PTCs / LoF variants are very rare (pLI = 1). However, looking further into the three references, the evidence is not as clear or as accurate as was stated. The missense variant c.1999C>A, p.(Pro667Thr), was stated as de novo, but was actually maternally inherited but was still considered a candidate for severe intellectual disability (shown in the Appendix, Patient 93, with severe speech delay, autism spectrum disorder and Gilles de la Tourette). This patient also has a de novo MTF1 variant. Reference: PMID: 23033978; de Ligt, J. et al. (2012) N. Engl. J. Med. 367: 1921–1929). Missense variant (de novo): c.212G>A, p.(Arg71Gln), was found as part of the Deciphering Developmental Disorders (DDD) study and is shown in individual 164 in Supplementary Table 2 of PMID: 33504798; Martin, HC. et al. (2021) Nat. Commun.12: 627. Also displayed in DECIPHER (DDD research variant) with several phenotype traits, but ID and ASD are not specifically mentioned. Nonsense variant: c.674G>A. p.(Trp225*) was stated as de novo but was inherited (reference PMID: 28191890; Kosmicki, JA. et al. (2017) Nat. Genet. 49: 504–510. Supplement Table 7). This was a study of severe intellectual delay, developmental delay / autism. (NB. The de novo p.(Arg71Gln) variant from the DDD study is also listed (subject DDD 342 in Supplement 4 / Table 2). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5145 | SLC31A1 | Zornitza Stark reviewed gene: SLC31A1: Rating: RED; Mode of pathogenicity: None; Publications: 36562171; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5144 | ZMYM3 | Zornitza Stark Mode of inheritance for gene: ZMYM3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5139 | CDK16 |
Belinda Chong changed review comment from: Total of 3 families with ID 1 with ASD. PMID 36323681: Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity. A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance. PMID 31981491: In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD. PMID 25644381: Single family described in this manuscript describing multiple candidate genes for XLID.; to: 3 families with ID 1 with ASD. PMID 36323681: Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity. A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance. PMID 31981491: In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD. PMID 25644381: Single family described in this manuscript describing multiple candidate genes for XLID. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5139 | CDK16 |
Belinda Chong changed review comment from: Total of 3 families with ID i with ASD. PMID 36323681: Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity. A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance. PMID 31981491: In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD. PMID 25644381: Single family described in this manuscript describing multiple candidate genes for XLID.; to: Total of 3 families with ID 1 with ASD. PMID 36323681: Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity. A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance. PMID 31981491: In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD. PMID 25644381: Single family described in this manuscript describing multiple candidate genes for XLID. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5138 | CDK16 |
Belinda Chong commented on gene: CDK16: Total of 3 families with ID i with ASD. PMID 36323681: Identified a nonsense variant (c.961 G > T, p.(Glu321*)) in a 42-year-old patient with ID and spasticity. A missense variant (c.1039G > T, p.(Gly347Cys)) affecting a highly conserved amino acid of the kinase domain (CADD PHRED score: 32) was identified by genome sequencing in a male patient with ID, ASD, and epilepsy, whose family history was compatible with X-linked inheritance. PMID 31981491: In addition, a nonsense variant (c.46C > T, p.(Arg16*)) was recently reported in a patient with ASD. PMID 25644381: Single family described in this manuscript describing multiple candidate genes for XLID. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5138 | CDK16 | Belinda Chong reviewed gene: CDK16: Rating: GREEN; Mode of pathogenicity: None; Publications: 36323681, 31981491, 25644381; Phenotypes: Neurodevelopmental disorder (MONDO#0700092) CDK16-related; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5134 | EIF4A2 |
Dean Phelan gene: EIF4A2 was added gene: EIF4A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF4A2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: EIF4A2 were set to PMID: 36528028 Phenotypes for gene: EIF4A2 were set to Neurodevelopmental disorder (MONDO:0700092), EIF4A2-related Mode of pathogenicity for gene: EIF4A2 was set to Other Review for gene: EIF4A2 was set to GREEN Added comment: PMID: 36528028 - EIF4A2 variants were observed in 15 individuals from 14 families. Affected individuals had a range of symptoms including global developmental delay (9/15), ID (7/15), epilepsy (11/15) and structural brain alterations (10/15). Monoallelic and biallelic variants were reported and functional studies showed both LOF and GOF disease mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5134 | TRA2B |
Elena Savva gene: TRA2B was added gene: TRA2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRA2B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TRA2B were set to PMID: 36549593 Phenotypes for gene: TRA2B were set to Neurodevelopmental disorder, TRA2B-related (MONDO#0700092) Review for gene: TRA2B was set to GREEN Added comment: PMID: 36549593 - 12 individuals with ID and dev delay. Additional features include infantile spams 6/12, hypotonia 12/12, dilated brain ventricles 6/12, microcephaly 5/12 - All variants result in the loss of 1/2 transcripts (start-losses or PTCs upstream of a second translation start position). Shorter transcript expression is increased, longer transcript expression is decreased. - Apparently het mice K/O are normal, but complete K/O cannot develop embryonically. - DN mechanism suggested Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5133 | ZMYM3 | Belinda Chong reviewed gene: ZMYM3: Rating: GREEN; Mode of pathogenicity: None; Publications: 36586412, 24721225; Phenotypes: Neurodevelopmental disorders (NDDs); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5132 | BUB1 | Zornitza Stark reviewed gene: BUB1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Primary microcephaly-30 (MCPH30), MIM#620183; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5129 | CLDN5 | Zornitza Stark reviewed gene: CLDN5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Syndromic disorder, MONDO:0002254, CLDN5-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5129 | SETD2 | Zornitza Stark Phenotypes for gene: SETD2 were changed from Luscan-Lumish syndrome, MIM#616831 to Luscan-Lumish syndrome, MIM#616831; Rabin-Pappas syndrome,MIM# 620155; Intellectual developmental disorder, autosomal dominant 70, MIM# 620157 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5127 | SETD2 |
Zornitza Stark edited their review of gene: SETD2: Added comment: PMID 32710489: 12 unrelated patients, ranging from 1 month to 12 years of age, with a multisystemic neurodevelopmental disorder associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740W). Key clinical features: severely impaired global development apparent from infancy, feeding difficulties with failure to thrive, small head circumference, and dysmorphic facial features. Affected individuals have impaired intellectual development and hypotonia; they do not achieve walking or meaningful speech. Other neurologic findings may include seizures, hearing loss, ophthalmologic defects, and brain imaging abnormalities. There is variable involvement of other organ systems, including skeletal, genitourinary, cardiac, and possibly endocrine. Further 3 unrelated patients identified with mild to moderately impaired intellectual development associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740Q). These are distinct clinically from Luscan-Lumish syndrome, which is characterised by overgrowth.; Changed publications: 29681085, 32710489; Changed phenotypes: Luscan-Lumish syndrome, MIM#616831, Rabin-Pappas syndrome,MIM# 620155, Intellectual developmental disorder, autosomal dominant 70, MIM# 620157 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5127 | CLDN5 |
Suliman Khan gene: CLDN5 was added gene: CLDN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLDN5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CLDN5 were set to PMID: 36477332 Phenotypes for gene: CLDN5 were set to seizures; developmental delay; microcephaly; brain calcifications Penetrance for gene: CLDN5 were set to Complete Mode of pathogenicity for gene: CLDN5 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: CLDN5 was set to GREEN Added comment: PMID: 36477332 identified de novo heterozygous missense variants in CLDN5 in fifteen unrelated patients who presented with a shared constellation of features including developmental delay, seizures (primarily infantile onset focal epilepsy), microcephaly and a recognizable pattern of pontine atrophy and brain calcifications. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5125 | BUB1B | Zornitza Stark Mode of inheritance for gene: BUB1B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5124 | BUB1B | Zornitza Stark reviewed gene: BUB1B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mosaic variegated aneuploidy syndrome 1, MIM# 257300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5124 | KIF26A | Zornitza Stark Phenotypes for gene: KIF26A were changed from Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156 to Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5124 | KIF26A | Zornitza Stark Phenotypes for gene: KIF26A were changed from Cerebral malformation MONDO:0016054, KIF26-related to Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5123 | KIF26A | Zornitza Stark edited their review of gene: KIF26A: Changed phenotypes: Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5122 | CACNA2D1 | Zornitza Stark reviewed gene: CACNA2D1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 110, MIM# 620149; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5121 | FZR1 |
Zornitza Stark gene: FZR1 was added gene: FZR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: FZR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FZR1 were set to 34788397 Phenotypes for gene: FZR1 were set to Developmental and epileptic encephalopathy 109, MIM# 620145 Review for gene: FZR1 was set to GREEN Added comment: Four unrelated individuals reported with de novo missense variants in this gene. Affected individuals had developmental delay before and concurrent with the onset of seizures. Features included impaired intellectual development with poor speech, ataxic gait, coordination problems, and behavioral abnormalities. Drosophila model supports gene-disease association. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5120 | ELP2 | Zornitza Stark Phenotypes for gene: ELP2 were changed from to intellectual disability, autosomal recessive 58 MONDO:0014996 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5118 | ELP2 | Zornitza Stark Mode of inheritance for gene: ELP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5117 | ELP2 | Zornitza Stark reviewed gene: ELP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual disability, autosomal recessive 58 MONDO:0014996; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5115 | AMER1 | Zornitza Stark Mode of inheritance for gene: AMER1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5112 | DLD | Zornitza Stark Mode of inheritance for gene: DLD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5111 | DLD | Zornitza Stark reviewed gene: DLD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dihydrolipoamide dehydrogenase deficiency MIM#246900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5109 | DHCR24 | Zornitza Stark Mode of inheritance for gene: DHCR24 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5108 | DOCK8 | Zornitza Stark Phenotypes for gene: DOCK8 were changed from to intellectual developmental disorder, autosomal dominant 2, MIM#614113 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5106 | DOCK8 | Zornitza Stark Mode of inheritance for gene: DOCK8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5103 | CDC42 | Zornitza Stark Mode of inheritance for gene: CDC42 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5100 | ALMS1 | Zornitza Stark Mode of inheritance for gene: ALMS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5099 | ALMS1 | Zornitza Stark reviewed gene: ALMS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alstrom syndrome, MIM# 203800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5098 | BLM | Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5096 | B3GLCT | Zornitza Stark Phenotypes for gene: B3GLCT were changed from to Peters Plus Syndrome (MIM 261540); Peters anomaly; Growth retardation; Brachydactyly; ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5094 | B3GLCT | Zornitza Stark Mode of inheritance for gene: B3GLCT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5090 | AP1S1 | Zornitza Stark Mode of inheritance for gene: AP1S1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5087 | ASAH1 | Zornitza Stark Mode of inheritance for gene: ASAH1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5084 | DPM1 | Zornitza Stark Mode of inheritance for gene: DPM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5081 | CENPF | Zornitza Stark Mode of inheritance for gene: CENPF was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | NLGN4X | Krithika Murali reviewed gene: NLGN4X: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:26350204, PMID:14963808, PMID:12669065, PMID:23352163, PMID:28263302, PMID:16648374; Phenotypes: Intellectual developmental disorder, X-linked - MIM#300495; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | CENPF | Mark Williams reviewed gene: CENPF: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35488810, 31953238, 26820108; Phenotypes: Stromme syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | ELP2 | Renee Crooks reviewed gene: ELP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33510603: 33976153: 33393008: 34653680: 25847581; Phenotypes: Intellectual Diability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | AMER1 | Deepak Subramanian reviewed gene: AMER1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 19079258, 22987541, 23401208, 28497491, 32879452, 35186393, 20950377, 22043478; Phenotypes: Osteopathia striata with cranial sclerosis, OMIM:300373, Osteopathia striata-cranial sclerosis syndrome, ORPHA:2780, Intellectual disability, HP:0001249; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | DLD | Philip Adam Harraka reviewed gene: DLD: Rating: GREEN; Mode of pathogenicity: None; Publications: 34745891, 33092611, 8968745; Phenotypes: Dihydrolipoamide dehydrogenase deficiency, hepatic and neurological disease; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | DHCR24 | Nicolle Hua reviewed gene: DHCR24: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: PMID: 11519011, 24961299, 29175559, 21559050, 12457401, 21671375; Phenotypes: Desmosterolosis, MIM# 602398; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | DOCK8 | Shannon Nicolson reviewed gene: DOCK8: Rating: RED; Mode of pathogenicity: None; Publications: 18060736, 29930340, 29191242, 33455084, 32978894, 25435912; Phenotypes: MIM#614113 intellectual developmental disorder, autosomal dominant 2; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | CDC42 | Lorraine Skalicka reviewed gene: CDC42: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29925821, 26708094, 26386261, 29394990; Phenotypes: Takenouchi-Kosaki syndrome, Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | ALMS1 | Christa Whelan reviewed gene: ALMS1: Rating: RED; Mode of pathogenicity: None; Publications: MIM # 203800, 27142762, 25846608, 18154657, 25296579, 17146208, 17940554, 22043170, 31889847, 2231654, 8418611, 8181924, 8556827, 9663233, 25864795, 8556827, 11941369.; Phenotypes: Alström Syndrome (multisystemic), characterized by progressive cone-rod dystrophy leading to blindness, sensorineural hearing loss, childhood obesity associated with hyperinsulinemia, and type 2 diabetes mellitus, Dilated cardiomyopathy occurs in approximately 70% of patients during infancy or adolescence, Renal failure, pulmonary, hepatic, and urologic dysfunction are often observed, and systemic fibrosis develops with age MIM# 203800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | B3GLCT | Jessica Wright reviewed gene: B3GLCT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 20301637, 16909395, 17032646, 18199743, 25544610; Phenotypes: Peters Plus Syndrome (MIM 261540), Peters anomaly, Growth retardation, Brachydactyly, ID; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | AP1S1 | Gemma O'Farrell reviewed gene: AP1S1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30244301, 24754424, 19057675, 23423674; Phenotypes: MENDIK syndrome, mental retardation, enteropathy, deafness, peripheral neuropathy, ichthyosis and keratoderma; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | ASAH1 | Jacqueline Montgomery reviewed gene: ASAH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32875576; Phenotypes: Farber lipogranulomatosis MIM #228000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5079 | DPM1 | Sindhu V reviewed gene: DPM1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10642602, 23856421, 16641202, 15669674, 10642597; Phenotypes: Acquired microcephaly, developmental delay, epilepsy, strabismus, hypotonia, cortical vision impairment, elevated creatine kinase, growth failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5077 | BCKDK | Zornitza Stark Mode of inheritance for gene: BCKDK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5076 | BCKDK | Zornitza Stark reviewed gene: BCKDK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Branched-chain ketoacid dehydrogenase kinase deficiency MIM#614923; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5074 | AHI1 | Zornitza Stark Mode of inheritance for gene: AHI1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5071 | CEP41 | Zornitza Stark Mode of inheritance for gene: CEP41 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5070 | DAG1 | Zornitza Stark Phenotypes for gene: DAG1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5068 | DAG1 | Zornitza Stark Mode of inheritance for gene: DAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5067 | DAG1 | Zornitza Stark reviewed gene: DAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5067 | BCKDK | Savige Judy reviewed gene: BCKDK: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:16875466, PMID: 22956686; Phenotypes: Intellectual disability, autism, epilepsy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5067 | AHI1 | Caleb Cartagena reviewed gene: AHI1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 15322546, 16453322, 21937992; Phenotypes: Joubert Syndrome 3 OMIM #608629; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5067 | CEP41 | Mitchell O'Brien reviewed gene: CEP41: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22246503; Phenotypes: Joubert syndrome 15, MIM# 614464; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5067 | DAG1 | Nicholas Clark reviewed gene: DAG1: Rating: AMBER; Mode of pathogenicity: None; Publications: (PMID: 25934851, 29337005, 24052401, 21388311, 25503980, 30450679, 12140559, 21388311); Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5065 | BOLA3 | Zornitza Stark Mode of inheritance for gene: BOLA3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5064 | BOLA3 | Zornitza Stark reviewed gene: BOLA3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia (MMDS2, OMIM #614299); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5064 | BOLA3 | Layla Zhu reviewed gene: BOLA3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24334290, PMID: 29654549, PMID: 21944046, PMID: 22562699, PMID: 26741492, PMID: 24334290; Phenotypes: multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia (MMDS2, OMIM #614299); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5063 | CBS | Zornitza Stark Mode of inheritance for gene: CBS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5062 | CBS | Zornitza Stark reviewed gene: CBS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Homocystinuria (MIM# 236200); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5062 | BOLA3 | Layla Zhu reviewed gene: BOLA3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29654549; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5062 | TCEAL1 | Zornitza Stark Phenotypes for gene: TCEAL1 were changed from hypotonia; abnormal gait; developmental delay; intellectual disability; autism; dysmorphic facial features. to Neurodevelopmental disorder, MONDO:0700092, TCEAL1-related; hypotonia; abnormal gait; developmental delay; intellectual disability; autism; dysmorphic facial features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5060 | TCEAL1 | Melanie Marty edited their review of gene: TCEAL1: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, TCEAL1-related, hypotonia, abnormal gait, developmental delay, intellectual disability, autism, dysmorphic facial features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5060 | CBS | Lloyd Pereira reviewed gene: CBS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Homocysteinuria B6-responsive and nonresponsive types, Thrombosis hyperhomocysteinemic.; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5058 | ARF3 | Zornitza Stark Phenotypes for gene: ARF3 were changed from Neurodevelopmental disorder (MONDO:0700092), ARF3-related; Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system to Neurodevelopmental disorder (MONDO:0700092), ARF3-related; Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5057 | ARF3 | Zornitza Stark Phenotypes for gene: ARF3 were changed from Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system to Neurodevelopmental disorder (MONDO:0700092), ARF3-related; Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5053 | TCEAL1 |
Melanie Marty gene: TCEAL1 was added gene: TCEAL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TCEAL1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: TCEAL1 were set to PMID: 36368327 Phenotypes for gene: TCEAL1 were set to hypotonia; abnormal gait; developmental delay; intellectual disability; autism; dysmorphic facial features. Review for gene: TCEAL1 was set to GREEN Added comment: 7 individuals (males and females) with de novo variants involving TCEAL1 with an X-linked dominant neurodevelopmental syndrome. Individuals had hypotonia, abnormal gait, developmental delay/intellectual disability especially affecting expressive language, autistic-like behavior, and mildly dysmorphic facial features. Additional features included strabismus, refractive errors, variable nystagmus, gastroesophageal reflux, constipation, dysmotility, recurrent infections, seizures, and structural brain anomalies. 1 additional male individual with a maternally inherited missense variant (unaffected mother), which was considered a VUS. This individual had hypertonia and spasticity without syndromic features. 4 PTCs, 2 CNVs, 2 missense reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5053 | ARF3 | Dean Phelan reviewed gene: ARF3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 36369169, 34346499; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), ARF3-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5053 | EPRS |
Lucy Spencer gene: EPRS was added gene: EPRS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EPRS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EPRS were set to 29576217, 36411955 Phenotypes for gene: EPRS were set to Leukodystrophy, hypomyelinating, 15 (MIM#617951) Review for gene: EPRS was set to GREEN Added comment: 5 patients across 2 papers, with delayed development (3/5) and/or regression, ataxia, dystonia, hypomyelinating leukodystrophy or periventricular white matter, 2 with epilepsy, 3 with optic atrophy, 2 with deafness, 2 with micrcephaly, 1 noted to have some facial dysmorphism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5053 | GABRA3 |
Sarah Pantaleo gene: GABRA3 was added gene: GABRA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABRA3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: GABRA3 were set to PMID: 29053855 Phenotypes for gene: GABRA3 were set to Epilepsy, intellectual disability, dysmorphic features, Penetrance for gene: GABRA3 were set to Incomplete Review for gene: GABRA3 was set to GREEN Added comment: Six variants in GABRA3 encoding the alpha3-subunit of the GABA(A) receptor. Five missense variants and one micro duplication were detected in four families and two sporadic cases presenting with a range of epileptic seizure types, a varying degree of intellectual disability and developmental delay, sometimes with dysmorphic features or nystagmus. The variants co-segregated mostly but not completely with the phenotype in the families, indicating in some cases incomplete penetrance, involvement of other genes, or presence of phenocopies. Overall, males were more severely affected and there were three asymptomatic female mutation carriers compared to only one male without a clinical phenotype. Mechanism suggested - three detected missense variants are localised in the extracellular GABA-binding NH2-terminus, one in the M2-M3 linker and one in the M4 transmembrane segment of the alpha3-subunit. Functional studies in Xenopus leaves oocytes revealed a variable but significant reduction of GABA-evoked anion currents for all mutants compared to wild-type receptors. The degree of current reduction correlated partially with the phenotype. Results reveal that rare loss-of-function variants in GABRA3 increase the risk for a varying combination of epilepsy, intellectual disability/developmental delay and dysmorphic features, presenting in some pedigrees with an X-linked inheritance pattern. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5052 | FEM1C |
Paul De Fazio gene: FEM1C was added gene: FEM1C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FEM1C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FEM1C were set to 36336956; 28135719; 33398170; 33398168 Phenotypes for gene: FEM1C were set to Neurodevelopmental disorder, FEM1C-related MONDO:0700092 Review for gene: FEM1C was set to GREEN gene: FEM1C was marked as current diagnostic Added comment: PMID:36336956 describes a 9-year-old boy with severe DD, lack of speech, pyramidal signs, and limb ataxia who had a de novo missense variant Asp126His in FEM1C ascertained by WES. The equivalent variant introduced into the nematode C.elegans resulted in disabled locomotion caused by synaptic abnormalities and not muscle dysfunction. An alternate change Asp126Val was reported in the DDD study de novo in a patient with uncharacterised developmental delay (PMID:28135719). The Asp126 residue (but not either of the variants above specifically) was shown to be functionally important by in vitro studies (PMID:33398170;33398168). The residue is highly conserved and located in a region of missense constraint. Borderline green, 2 patients and an animal model. Note all evidence points to the Asp126 residue being of specific importance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5050 | KDM2B |
Ain Roesley gene: KDM2B was added gene: KDM2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KDM2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KDM2B were set to 36322151 Phenotypes for gene: KDM2B were set to neurodevelopmental disorder MONDO#070009, KDM2B-related Review for gene: KDM2B was set to GREEN gene: KDM2B was marked as current diagnostic Added comment: 27 individuals from 22 families were recruited 13 SNV classified LP/P, all de novo except 2 familial cases 5 variants were classified as VUS if more than 1 het is present in gnomAD or does result in a KDM2B-specific episignature (therefore suggesting normal function) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5049 | MAN2A2 |
Zornitza Stark gene: MAN2A2 was added gene: MAN2A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAN2A2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAN2A2 were set to 36357165 Phenotypes for gene: MAN2A2 were set to Congenital disorder of glycosylation, MONDO:0015286, MAN2A2-reated Review for gene: MAN2A2 was set to RED Added comment: Single consanguineous family reported with homozygous truncating variant in two brothers with ID. Supportive biochemical data only Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5046 | CDK10 | Zornitza Stark Mode of inheritance for gene: CDK10 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5045 | CDK10 | Zornitza Stark reviewed gene: CDK10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Al Kaissi syndrome MIM#617694; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5043 | EXOSC3 | Zornitza Stark Mode of inheritance for gene: EXOSC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5042 | EXOSC3 | Zornitza Stark reviewed gene: EXOSC3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pontocerebellar hypoplasia, type 1B, MIM# 614678; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5041 | ARPC4 |
Zornitza Stark gene: ARPC4 was added gene: ARPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARPC4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARPC4 were set to 35047857 Phenotypes for gene: ARPC4 were set to Developmental delay, language impairment, and ocular abnormalities, MIM# 620141 Review for gene: ARPC4 was set to GREEN Added comment: 7 affected individuals from 6 families (gonadal mosaicism was confirmed in the mother of the 2 affected siblings) with a recurrent missense variant (NM_005718.4:c.472C>T; p.R158C). 6/7 affected individuals had microcephaly. The variant was associated with a decreased amount of F-actin in cells from two affected individuals. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5040 | EXOSC3 | Michelle Dang reviewed gene: EXOSC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 22544365, 23975261, 25149867, 23284067; Phenotypes: 23284067, 25149867; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5040 | CDK10 | Lyndon Gallacher reviewed gene: CDK10: Rating: ; Mode of pathogenicity: None; Publications: 28886341; Phenotypes: Severe growth retardation, spine malformation, facial dysmorphisms, developmental delay, intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5038 | HECTD4 | Zornitza Stark reviewed gene: HECTD4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, HECTD4-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5037 | UBE3C | Zornitza Stark reviewed gene: UBE3C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, UBE3C-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5037 | KIF26A | Zornitza Stark Phenotypes for gene: KIF26A were changed from Congenital brain malformations, no OMIM # to Cerebral malformation MONDO:0016054, KIF26-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5036 | KIF26A | Zornitza Stark reviewed gene: KIF26A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral malformation MONDO:0016054, KIF26-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5035 | UBE3C |
chirag patel gene: UBE3C was added gene: UBE3C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBE3C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UBE3C were set to PMID: 36401616 Phenotypes for gene: UBE3C were set to Neurodevelopmental disorder overlapping Angelman syndrome, no OMIM# Review for gene: UBE3C was set to GREEN Added comment: 3 patients/2 families with syndromic neurodevelopmental, seizure, and movement disorders and neurobehavioral phenotypes. WES found bi-allelic variants in UBE3C. The RNA studies in some patients with LoF variants provided evidence for the LoF effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5033 | HECTD4 |
chirag patel gene: HECTD4 was added gene: HECTD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HECTD4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HECTD4 were set to PMID: 36401616 Phenotypes for gene: HECTD4 were set to Neurodevelopmental disorder overlapping Angelman syndrome, no OMIM# Review for gene: HECTD4 was set to GREEN Added comment: 7 patients/5 families with syndromic neurodevelopmental, seizure, and movement disorders and neurobehavioral phenotypes. WES found bi-allelic variants in HECTD4. The RNA studies in some patients with LoF variants provided evidence for the LoF effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5031 | KIF26A |
chirag patel gene: KIF26A was added gene: KIF26A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIF26A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF26A were set to PMID: 36228617 Phenotypes for gene: KIF26A were set to Congenital brain malformations, no OMIM # Review for gene: KIF26A was set to GREEN Added comment: 5 unrelated patients with biallelic loss-of-function variants in KIF26A (found through WES), exhibiting a spectrum of congenital brain malformations (schizencephaly, corpus callosum anomalies, polymicrgyria, and ventriculomegaly). Combining mice and human iPSC-derived organoid models, they discovered that loss of KIF26A causes excitatory neuron-specific defects in radial migration, localization, dendritic and axonal growth, and apoptosis, offering a convincing explanation of the disease etiology in patients. Single-cell RNA sequencing in KIF26A knockout organoids revealed transcriptional changes in MAPK, MYC, and E2F pathways. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5028 | TBC1D2B | chirag patel reviewed gene: TBC1D2B: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 36029130; Phenotypes: Neurodevelopmental disorder with seizures and gingival overgrowth, OMIM #619323; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5025 | MTSS1 | Zornitza Stark reviewed gene: MTSS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 36067766; Phenotypes: Intellectual disability, MTSS1-related (MONDO#0001071); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5025 | TPR |
Zornitza Stark gene: TPR was added gene: TPR was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TPR was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TPR were set to 34494102 Phenotypes for gene: TPR were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, TPR-related Review for gene: TPR was set to RED Added comment: Two siblings harbouring variants c.6625C>T/ p.Arg2209Ter (identified in heterozygous state in both siblings and father) and c.2610 + 5G > A (identified in heterozygous state in both siblings and mother) were reported with ataxia, microcephaly and severe intellectual disability. Functional analyses in patient fibroblasts provide evidence that the variants affect TPR splicing, reduce steady-state TPR levels, abnormal nuclear pore composition and density, and altered global RNA distribution. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5023 | SMC5 |
Zornitza Stark gene: SMC5 was added gene: SMC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SMC5 were set to 36333305 Phenotypes for gene: SMC5 were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID Review for gene: SMC5 was set to GREEN Added comment: Four individuals from three families with a chromosome breakage disorder and bi-allelic variants in this gene. However, three of the individuals had the same homozygous missense variant. Evidence for functional impact of the variant was limited. However, zebrafish model recapitulated the phenotype and was not rescued by the introduction of this variant, arguing for functional effect. Borderline Amber/Green. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5021 | SLF2 |
Zornitza Stark gene: SLF2 was added gene: SLF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLF2 were set to 36333305 Phenotypes for gene: SLF2 were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID Review for gene: SLF2 was set to GREEN Added comment: Seven individuals from 6 families with a chromosome breakage disorder and bi-allelic variants in this gene (LoF). Functional data including zebrafish model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5020 | SPTBN5 | Chern Lim reviewed gene: SPTBN5: Rating: ; Mode of pathogenicity: Other; Publications: 36117916, 36238261; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5018 | FRA10AC1 | Zornitza Stark Phenotypes for gene: FRA10AC1 were changed from Neurodevelopmental disorder, MONDO:0700092, FRA10AC1-related to Neurodevelopmental disorder with growth retardation, dysmorphic facies, and corpus callosum abnormalities, MIM# 620113 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5017 | FRA10AC1 | Zornitza Stark edited their review of gene: FRA10AC1: Changed phenotypes: Neurodevelopmental disorder with growth retardation, dysmorphic facies, and corpus callosum abnormalities, MIM# 620113 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5016 | WDR5 |
Bryony Thompson gene: WDR5 was added gene: WDR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WDR5 were set to DOI:https://doi.org/10.1016/j.xhgg.2022.100157 Phenotypes for gene: WDR5 were set to Neurodevelopmental disorder MONDO:0700092, WDR5-related Mode of pathogenicity for gene: WDR5 was set to Other Review for gene: WDR5 was set to GREEN Added comment: Six different missense variants were identified (de novo) in 11 affected individuals with neurodevelopmental disorders, with a broad spectrum of additional features, including epilepsy, aberrant growth parameters, skeletal and cardiac abnormalities. 9/11 probands have ID. In vivo and in vitro functional suggest that loss-of-function is not the mechanism of disease. The mechanism of disease is yet to be established. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5013 | PI4K2A |
Seb Lunke gene: PI4K2A was added gene: PI4K2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PI4K2A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PI4K2A were set to 30564627; 35880319; 19581584 Phenotypes for gene: PI4K2A were set to complex neurodevelopmental disorder with motor features, PI4K2A-related, MONDO:0100516 Review for gene: PI4K2A was set to GREEN Added comment: Two reportedly unrelated, consanguine families with the same hom stop mutation in PI4K2A, p.(Arg309Ter). Probands with seizures, developmental delay, hypotonia/dystonia, myoclonus and developmental delay. MRI showed extensive brain abnormalities including dysgenesis of the corpus callosum, ventriculomegaly, and white matter volume loss. Functional studies showed cellular mislocalisation of the Arg309Ter truncated protein construct compared to WT and an missense control. An earlier paper from 2018 described two additional probands with a different stop mutation, p.(Ser22Ter), and overlapping phenotypic presentation. in 2011, a Pi4k2a knock-out mouse model was described. "Knock-out animals initially appeared normal but later develop a progressive neurological dis-ease characterized by tremor, limb weakness, urinary incontinence and premature mortality. Histological analysis revealed massive axonal degeneration in the spinal cord in the descending corticospinal tracts." Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5011 | CAMSAP1 |
Naomi Baker gene: CAMSAP1 was added gene: CAMSAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CAMSAP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CAMSAP1 were set to 36283405 Phenotypes for gene: CAMSAP1 were set to lissencephaly spectrum disorders (MONDO:0018838), CAMSAP1-related Review for gene: CAMSAP1 was set to GREEN Added comment: Five unrelated families with bi-allelic loss-of-function variants. Clinical features of the syndrome include a characteristic craniofacial appearance, primary microcephaly, lissencephaly, agenesis or severe hypogenesis of the corpus callosum, severe neurodevelopmental delay, cortical visual impairment, and seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5010 | MYCBP2 | Zornitza Stark Phenotypes for gene: MYCBP2 were changed from neurodevelopmental spectrum disorder with corpus callosum defects to Neurodevelopmental disorder, MONDO:0700092, MYCBP2-related; corpus callosum abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5008 | MYCBP2 | Suliman Khan edited their review of gene: MYCBP2: Changed phenotypes: intellectual disability, epilepsy, autistic features and callosum abnormalities, | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5008 | MYCBP2 | Zornitza Stark edited their review of gene: MYCBP2: Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, MYCBP2-related, corpus callosum abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5008 | MYCBP2 | Zornitza Stark reviewed gene: MYCBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 36200388; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, MYCBP2-related, corpus callosum abnormalitie; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5008 | KLHL20 |
Dean Phelan gene: KLHL20 was added gene: KLHL20 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KLHL20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KLHL20 were set to PMID: 36214804 Phenotypes for gene: KLHL20 were set to Neurodevelopmental disorder (MONDO:0700092), KLHL20-related Review for gene: KLHL20 was set to GREEN Added comment: PMID: 36214804 - 14 patients with de novo missense variants in KLHL20. The patients had mild to severe ID, febrile seizures or epilepsy, autism spectrum disorder, hyperactivity and subtle dysmorphic facial features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5008 | MYCBP2 |
Suliman Khan gene: MYCBP2 was added gene: MYCBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MYCBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MYCBP2 were set to PMID: 36200388 Phenotypes for gene: MYCBP2 were set to neurodevelopmental spectrum disorder with corpus callosum defects Penetrance for gene: MYCBP2 were set to Complete Review for gene: MYCBP2 was set to GREEN Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5008 | FRMD5 | Zornitza Stark Phenotypes for gene: FRMD5 were changed from Neurodevelopmental disorder MONDO:0700092, FRMD5-related to Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5007 | FRMD5 | Zornitza Stark edited their review of gene: FRMD5: Changed phenotypes: Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5006 | OTC | Zornitza Stark Mode of inheritance for gene: OTC was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5005 | OTC | Zornitza Stark reviewed gene: OTC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ornithine transcarbamylase deficiency, MIM#311250; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5004 | LETM1 | Zornitza Stark reviewed gene: LETM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5003 | HNRNPH1 | Zornitza Stark reviewed gene: HNRNPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with craniofacial dysmorphism and skeletal defects, MIM# 620083; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5001 | AKT3 | Zornitza Stark Mode of inheritance for gene: AKT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5000 | AKT3 | Zornitza Stark reviewed gene: AKT3: Rating: GREEN; Mode of pathogenicity: None; Publications: 22729224, 22729223, 35665751, 34354878, 32446860, 31441589; Phenotypes: Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2, MIM# 615937; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5000 | TMEM147 | Zornitza Stark Phenotypes for gene: TMEM147 were changed from Neurodevelopmental disorder (MONDO:0700092), TMEM147-related to Neurodevelopmental disorder with facial dysmorphism, absent language, and pseudo-Pelger-Huet anomaly, MIM# 620075 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4999 | TMEM147 | Zornitza Stark reviewed gene: TMEM147: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with facial dysmorphism, absent language, and pseudo-Pelger-Huet anomaly, MIM# 620075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4998 | PSMC1 | Zornitza Stark reviewed gene: PSMC1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, spastic tetraplegia, and hearing loss , MIM# 620071; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4998 | HNRNPR | Zornitza Stark Phenotypes for gene: HNRNPR were changed from Intellectual disability; seizures; dysmorphic features to Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4997 | HNRNPR | Zornitza Stark edited their review of gene: HNRNPR: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4996 | FGF14 | Zornitza Stark Mode of inheritance for gene: FGF14 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4994 | HEATR3 | Zornitza Stark reviewed gene: HEATR3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Diamond-Blackfan anaemia 21, MIM# 620072; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4991 | FRMD5 |
Zornitza Stark gene: FRMD5 was added gene: FRMD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FRMD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Review for gene: FRMD5 was set to GREEN Added comment: Eight individuals reported with missense variants in this gene, de novo in 6 where parents were available. Clinical presentation was with ID, seizures, ataxia. Fly model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4988 | GIGYF1 | Elena Savva reviewed gene: GIGYF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35917186; Phenotypes: Autism, Intellectual disability, GIGYF1-related (MONDO#0001071); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4988 | HECW2 | Zornitza Stark Mode of inheritance for gene: HECW2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4987 | HECW2 |
Zornitza Stark changed review comment from: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease) PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease. PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head.; to: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease) PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease. PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head. Association with bi-allelic variants is AMBER. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4987 | HECW2 |
Zornitza Stark edited their review of gene: HECW2: Added comment: Two probands reported with biallelic variants and putative loss of function mechanism of disease (compared to the established gain of function monoallelic disease) PMID: 35753050 - Caucasian girl who presented a severe neurodevelopmental disorder with drug-resistant epilepsy, hypotonia, severe gastro-esophageal reflux and brain magnetic resonance imaging anomalies with a homozygous splice variant that causes in-frame elimination of exon 22 (c.3917+2_3917+12delinsG r.3766_3917+1del p.Leu1256_Trp1306del). Protein expression level was reduced by 60%, suggesting a partial loss-of-function mechanism of disease. PMID: 35487419 - homozygous nonsense variant (c.736C>T; p.Arg246*) identified in a proband from a Moroccan consanguineous family, with developmental delay, intellectual disability, hypotonia, generalized tonico-clonic seizures and a persistent tilted head.; Changed publications: 29807643, 29395664, 27334371, 27389779, 35753050, 35487419; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4986 | DPH5 |
Zornitza Stark gene: DPH5 was added gene: DPH5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DPH5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DPH5 were set to Neurodevelopmental disorder with short stature, prominent forehead, and feeding difficulties 620070 Review for gene: DPH5 was set to GREEN Added comment: 5 individuals from 3 unrelated families reported with severe ID, feeding difficulties, dysmorphic features and congenital anomalies, though there was no consistent pattern to these. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4985 | ADGRL1 | Zornitza Stark Phenotypes for gene: ADGRL1 were changed from Neurodevelopmental disorder, ADGRL1-related (MONDO#0700092) to Developmental delay, behavioral abnormalities, and neuropsychiatric disorders, MIM# 620065 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4984 | ADGRL1 | Zornitza Stark Mode of inheritance for gene: ADGRL1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4983 | ADGRL1 | Zornitza Stark reviewed gene: ADGRL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay, behavioral abnormalities, and neuropsychiatric disorders, MIM# 620065; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4982 | BRIP1 | Zornitza Stark Mode of inheritance for gene: BRIP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4978 | GABRG1 | Zornitza Stark Mode of inheritance for gene: GABRG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4976 | DEPDC5 | Dean Phelan reviewed gene: DEPDC5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 36067010, 32848577; Phenotypes: Neurodevelopmental disorder, DEPDC5-related, MONDO:0700092; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4975 | GABBR1 |
Zornitza Stark gene: GABBR1 was added gene: GABBR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABBR1 were set to 36103875 Phenotypes for gene: GABBR1 were set to Neurodevelopmental disorder, GABBR1-related, MONDO:0700092 Review for gene: GABBR1 was set to GREEN Added comment: Four individuals with de novo variants in this gene and varying severity of DD/ID, seizures and hypotonia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4974 | LETM1 |
Ee Ming Wong gene: LETM1 was added gene: LETM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LETM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LETM1 were set to 36055214 Phenotypes for gene: LETM1 were set to Mitochondrial disease MONDO#0044970, LETM1-related Review for gene: LETM1 was set to GREEN gene: LETM1 was marked as current diagnostic Added comment: -18 affected individuals from 11 unrelated families harbouring ultra-rare bi-allelic missense and loss-of-function LETM1 variants -Most of the affected individuals (14/18, 78%) had an infantile-onset disease manifestation, and 4/18 (22%) presented first symptoms between the ages of 1.5 and 2 years -Variant types included missense, frameshift, stop loss, in-frame deletion and splice defect -From biochemical and morphological studies, bi-allelic LETM1 variants are associated with defective mitochondrial K efflux, swollen mitochondrial matrix structures, and loss of important mitochondrial oxidative phosphorylation protein components Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4973 | MED11 |
Ain Roesley gene: MED11 was added gene: MED11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MED11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MED11 were set to 36001086 Phenotypes for gene: MED11 were set to neurodevelopmental disorder MONDO#0700092, MED11-related Review for gene: MED11 was set to GREEN gene: MED11 was marked as current diagnostic Added comment: 7 affected from 5 families (3x consang) with the same recurrent variant of p.(Arg109*). Protein truncating, NOT NMD as proven by RT-PCR and western blot. Zebrafish knockout model recapitulates key clinical phenotypes NO evidence of founder effect from haplotype analysis 7/7 cerebral dysgyria, cortical atrophy 5/7 limb contracture 4/7 epilepsy 3/7 families with IUGR 3/7 GDD 3/7 hearing loss 3/7 undescended testis 2/7 nystagmus 1/7 congenital cataract Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4973 | MED11 |
Ain Roesley gene: MED11 was added gene: MED11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MED11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MED11 were set to 36001086 Phenotypes for gene: MED11 were set to neurodevelopmental disorder MONDO#0700092, MED11-related Review for gene: MED11 was set to GREEN gene: MED11 was marked as current diagnostic Added comment: 7 affected from 5 families (3x consang) with the same recurrent variant of p.(Arg109*). Protein truncating, NOT NMD as proven by RT-PCR and western blot. Zebrafish knockout model recapitulates key clinical phenotypes NO evidence of founder effect from haplotype analysis 7/7 cerebral dysgyria, cortical atrophy 5/7 limb contracture 4/7 epilepsy 3/7 families with IUGR 3/7 GDD 3/7 hearing loss 3/7 undescended testis 2/7 nystagmus 1/7 congenital cataract Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4970 | GABRG1 | Anna Ritchie reviewed gene: GABRG1: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 36121006; Phenotypes: Developmental and epileptic encephalopathy MONDO:0100062; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4969 | ATP6V0C | Naomi Baker reviewed gene: ATP6V0C: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:36074901; Phenotypes: neurodevelopmental disorder (MONDO:0700092), ATP6V0C-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4968 | SLC32A1 |
Lucy Spencer gene: SLC32A1 was added gene: SLC32A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SLC32A1 were set to 36073542 Phenotypes for gene: SLC32A1 were set to developmental and epileptic encephalopathy MONDO:0100062, SLC32A1-related Review for gene: SLC32A1 was set to GREEN Added comment: PMID: 36073542- 4 patients with de novo missense. All have moderate to severe ID or developmental delay and seizures. 3 have a movement disorder. Developmental delay appears to be a new association for this gene described in this paper. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4966 | GCSH | Ain Roesley Mode of inheritance for gene: GCSH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4965 | GCSH | Ain Roesley reviewed gene: GCSH: Rating: GREEN; Mode of pathogenicity: None; Publications: 36190515; Phenotypes: Glycine encephalopathy MIM#605899, neurodevelopmental disorder MONDO#0700092, GCHS-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4965 | MTSS1 |
Elena Savva gene: MTSS1 was added gene: MTSS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MTSS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MTSS1 were set to PMID: 36067766 Phenotypes for gene: MTSS1 were set to Intellectual disability, MTSS1-related (MONDO#0001071) Review for gene: MTSS1 was set to GREEN Added comment: Alt gene name: MTSS2 Huang (2022): recurring de novo missense variant (p.R671W) causing syndromic intellectual disability in 5 unrelated individuals. - Individuals present with GDD, mild ID (5/5), nystagmus (3/5), optic atrophy (1/5), ptosis (2/5), sensorineural hearing loss (2/4), microcephaly or relative microcephaly (5/5), and shared mild facial dysmorphisms. - Overexpression supports a DN mechanism Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4964 | MTSS1L |
Elena Savva gene: MTSS1L was added gene: MTSS1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MTSS1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MTSS1L were set to PMID: 36067766 Phenotypes for gene: MTSS1L were set to Intellectual disability, MTSS2-related (MONDO#0001071) Review for gene: MTSS1L was set to GREEN Added comment: Alt gene name: MTSS2 Huang (2022): recurring de novo missense variant (p.R671W) causing syndromic intellectual disability in 5 unrelated individuals. - Individuals present with GDD, mild ID (5/5), nystagmus (3/5), optic atrophy (1/5), ptosis (2/5), sensorineural hearing loss (2/4), microcephaly or relative microcephaly (5/5), and shared mild facial dysmorphisms. - Overexpression supports a DN mechanism Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4963 | NAPB |
Paul De Fazio gene: NAPB was added gene: NAPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAPB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAPB were set to 26235277; 28097321; 33189936 Phenotypes for gene: NAPB were set to Developmental and epileptic encephalopathy 107 MIM#620033 Review for gene: NAPB was set to GREEN gene: NAPB was marked as current diagnostic Added comment: PMID 26235277: homozygous nonsense variant identified in a 6 year old girl by trio WES with early-onset epileptic encephalopathy characterised by multifocal seizures and profound GDD PMID 28097321: exome sequencing in 152 consanguineous families with at least one member affected with ID. Homozygous nonsense variant identified in a patient with profound ID, seizures, feeding difficulties in infancy, muscularhypotonia, microcephaly, and impaired vision PMID 33189936: homozygous canonical splice variant identified by trio exome sequencing in two siblings with seizures, intellectual disability and global developmental delay, microcephaly (<-3SD), and muscular hypotonia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4962 | RABGAP1 |
Zornitza Stark gene: RABGAP1 was added gene: RABGAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RABGAP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RABGAP1 were set to 36083289 Phenotypes for gene: RABGAP1 were set to Neurodevelopmental disorder, RABGAP1-related,MONDO:0700092 Review for gene: RABGAP1 was set to GREEN Added comment: 5 individuals from three families reported with ID, microcephaly, SNHL and seizures. Mouse model recapitulated the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4959 | NSD2 | Zornitza Stark edited their review of gene: NSD2: Added comment: PMID 36189577: two individuals reported with a GoF variant, p.Glu1099Lys, and a distinct phenotype: intellectual disability, coarse/ square facial gestalt, abnormalities of the hands, and organomegaly.; Changed publications: 30345613, 31171569, 36189577; Changed phenotypes: Rauch-Steindl syndrome, MIM# 619695, Microcephaly, intellectual disability, Neurodevelopmental disorder, NSD2-associated, GoF, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4959 | FOSL2 |
Krithika Murali gene: FOSL2 was added gene: FOSL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FOSL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOSL2 were set to 36197437 Phenotypes for gene: FOSL2 were set to Neurodevelopmental disorder, MONDO:0700092, FOSL2-related Review for gene: FOSL2 was set to GREEN Added comment: PMID 36197437 Cospain et al 2022 report 11 individuals from 10 families with heterozygous PTC variants in exon 4/4 of the FOSL2 gene. All variants were predicted to escape NMD resulting in a truncated protein, with the truncation occurring proximal to the C-terminal domain (supportive functional studies). In 10/11 families the variant occurred de novo in a single affected proband. In one family with 2 affected siblings, the variant was present in the siblings but absent in the unaffected parent likely due to gonadal mosaicism. Clinical features included: - Cutis aplasia congenital of the scalp (10/11) - Tooth enamel hypoplasia and discolouration (8/9) - Multiple other ectodermal features also noted e.g. small brittle nails, hypotrichosis/hypertrichosis, lichen sclerosis - 5 individuals had cataracts (mostly bilateral, congenital/early childhood onset) - 6/9 IUGR - 5/9 postnatal growth restriction - 7/9 developmental delay/ID (mild to severe) - 5/7 ADHD/ASD - 2/9 seizures Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4959 | KCNK3 | Krithika Murali reviewed gene: KCNK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 36195757; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, KCNK3-related, developmental delay with sleep apnoea (DDSA); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4958 | DOHH | Zornitza Stark reviewed gene: DOHH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, cerebral atrophy, and visual impairment, MIM# 620066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4957 | DPH2 | Zornitza Stark reviewed gene: DPH2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay with short stature, dysmorphic facial features, and sparse hair 2, MIM# 620062; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4956 | ARG1 | Zornitza Stark Mode of inheritance for gene: ARG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4955 | ARG1 | Zornitza Stark reviewed gene: ARG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Argininaemia MIM#207800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4954 | PAH | Zornitza Stark Mode of inheritance for gene: PAH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4953 | PAH | Zornitza Stark reviewed gene: PAH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Phenylketonuria, MIM#261600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4953 | MMACHC | Zornitza Stark Phenotypes for gene: MMACHC were changed from to Methylmalonic aciduria and homocystinuria, cblC type, MIM#277400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4952 | MMACHC | Zornitza Stark Mode of inheritance for gene: MMACHC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4951 | MMACHC | Zornitza Stark reviewed gene: MMACHC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Methylmalonic aciduria and homocystinuria, cblC type, MIM#277400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4950 | DBT | Zornitza Stark Mode of inheritance for gene: DBT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4949 | DBT | Zornitza Stark reviewed gene: DBT: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Maple syrup urine disease, type II (MIM#248600); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4948 | ATP7A | Zornitza Stark Mode of inheritance for gene: ATP7A was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4947 | ATP7A | Zornitza Stark reviewed gene: ATP7A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Menkes disease MIM#309400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4947 | PDCD6IP | Zornitza Stark Phenotypes for gene: PDCD6IP were changed from Primary microcephaly to Microcephaly 29, primary, autosomal recessive, MIM# 620047 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4946 | PDCD6IP | Zornitza Stark reviewed gene: PDCD6IP: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Microcephaly 29, primary, autosomal recessive, MIM# 620047; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4945 | ARSA | Zornitza Stark Mode of inheritance for gene: ARSA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4944 | ARSA | Zornitza Stark reviewed gene: ARSA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Metachromatic leukodystrophy, MIM# 250100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4942 | ALDH7A1 | Zornitza Stark Mode of inheritance for gene: ALDH7A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4941 | ALDH7A1 | Zornitza Stark reviewed gene: ALDH7A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33200442; Phenotypes: Epilepsy, pyridoxine-dependent, MIM# 266100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4939 | PTPA |
Konstantinos Varvagiannis changed review comment from: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature; to: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp UK or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4939 | PTPA |
Konstantinos Varvagiannis gene: PTPA was added gene: PTPA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTPA were set to 36073231 Phenotypes for gene: PTPA were set to Intellectual disability; Parkinsonism Penetrance for gene: PTPA were set to Complete Review for gene: PTPA was set to AMBER Added comment: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4936 | PPP2R5C | Teresa Zhao reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 25972378; Phenotypes: Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4935 | CACNA1C | Zornitza Stark reviewed gene: CACNA1C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia, language delay, and skeletal defects with or without seizures, MIM# 620029; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4935 | UFSP2 | Zornitza Stark Phenotypes for gene: UFSP2 were changed from Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus to Developmental and epileptic encephalopathy 106, MIM# 620028; Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4934 | UFSP2 | Zornitza Stark edited their review of gene: UFSP2: Changed phenotypes: Developmental and epileptic encephalopathy 106, MIM# 620028, Abnormal muscle tone, Seizures, Global developmental delay, Delayed speech and language development, Intellectual disability, Strabismus | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4933 | TRAPPC10 | Zornitza Stark reviewed gene: TRAPPC10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, short stature, and speech delay, MIM# 620027; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4932 | UBAP2L | Zornitza Stark Phenotypes for gene: UBAP2L were changed from Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system to Neurodevelopmental disorder, MONDO:0700092, UBAP2L-related; Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4931 | UBAP2L | Zornitza Stark Mode of inheritance for gene: UBAP2L was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4929 | UBAP2L | Zornitza Stark reviewed gene: UBAP2L: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, UBAP2L-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4929 | CHKA | Zornitza Stark Phenotypes for gene: CHKA were changed from Neurodevelopmental disorder, MONDO:0700092; Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature to Neurodevelopmental disorder with microcephaly, movement abnormalities, and seizures, MIM#620023 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4928 | CHKA | Zornitza Stark reviewed gene: CHKA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, movement abnormalities, and seizures, MIM#620023; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4928 | CAPRIN1 | Konstantinos Varvagiannis reviewed gene: CAPRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 35979925, 35977029, 28135719, 31398340, https://doi.org/10.1101/2021.12.20.21267194; Phenotypes: Global developmental delay, Delayed speech and language development, Intellectual disability, Autistic behavior, Seizures; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4928 | UBAP2L |
Konstantinos Varvagiannis gene: UBAP2L was added gene: UBAP2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBAP2L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: UBAP2L were set to 35977029 Phenotypes for gene: UBAP2L were set to Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system Penetrance for gene: UBAP2L were set to unknown Review for gene: UBAP2L was set to GREEN Added comment: Based on Jia et al (2022 - PMID: 35977029) speech, motor delay as well as ID are observed in individuals harboring de novo pLoF variants in UBAP2L. The gene encodes a regulator of the stress granule (SG) assembly. Extensive evidence is provided on the effect of variants as well as the role of UBAP2L and other genes for components and/or regulation of SG in pathogenesis of NDDs. Among others a Ubap2l htz deletion mouse model (behavioral and cognitive impairment, abnormal cortical development due to impaired SG assembly, etc). Data from 26 previous studies, aggregating 40,853 probands with NDDs (mostly DD/ID, also ASD) suggest enrichment for DNMs in UBAP2L or other genes previously known and further shown to be important for SG formation (incl. G3BP1/G3BP2, CAPRIN1). Details provided below. Not associated with any phenotype in OMIM, G2P or SysNDD. -------- Jia et al (2022 - PMID: 35977029) describe 12 affected individuals with heterozygous de novo pLoF variants in UBAP2L. Phenotype: Features included hypotonia, speech (11/11) and motor delay (8/12), ID (8/10 with formal evaluation), variable behavioral concerns (ADHD 5/11, ASD in 4/10, etc). Seizures were reported in 7/12 with 3/10 having a formal diagnosis of epilepsy. Few had microcephaly (3/10). Facial dysmorphisms were common (9/9) and included abnormal palpebral fissures, deep prominent concha, high broad forehead, hypertelorism, thin upper lip and mild synophrys (each in 4 or less individuals). Short stature or skeletal alterations were described in some (4/10 each). Role of the gene: UBAP2L encodes an essential regulator of stress granule assembly. Stress granules are membraneless cytoplasmic compartments in eukaryotic cells, induced upon a variety of stressors and playing a role in regulation of gene expression. Variants identified : 9 nonsense/frameshift UBAP2L variants and 3 splicing ones were reported, in all cases as de novo events, upon trio/quad exome sequencing. All were absent from gnomAD. There were no other causative variants. Variant effect/studies (NM_014847.4 / NP_055662.3) : - Minigene assays revealed that the 3 splice variants all resulted in out-of-frame exon skipping. - In patient fibroblasts one of these splice variants was demonstrated to result to reduced protein levels. - 8 of the 9 nonsense/frameshift variants were predicted to result to NMD. - 1 nonsense variant (c.88C>T/p.Q30*) was shown to result to decreased protein expression in patient fibroblasts, with detection of the protein using an antibody for the C terminus but not the N terminus. Protein N-terminal sequencing confirmed that the protein lacked the N terminus, with utilization of an alternative start site (11 codons downstream). - Generation of HeLa UBAP2L KO cell lines resulted in significant reduction of SG numbers which was also the case for 4 variants studied, under stress conditions. - The protein has a DUF domain (aa 495-526) known to mediate interaction of UBAP2L with G3BP1 (a stress granule marker) with deletions of this domain leading to shuttling of UBAP2L from the cytoplasm to the nucleus. Truncating variants upstream of the DUF domain were shown to result in nuclear localization. Mouse model : - The authors generated Ubap2l KO model with hmz deletion of Ubap2l resulting in a lethal phenotype (2.6% survived) and htz deletion leading to behavioral issues (low preference for social novelty, anxious-like behaviors) and cognitive impairment. - Ubap2l haploinsufficiency resulted in abnormal cortical development and lamination with reduction of neural progenitor proliferation. - Ubap2l deficiency was shown to impair SG assembly during cortical development both under physiological stress conditions or upon utilization of an oxidative stress inducer. Additional evidence of UBAP2L and SG overall in pathogenesis of NDDs: - Based on DNMs from 40,853 individuals with NDDs from 26 studies (9,228 with ASD, 31,625 with DD/ID) the authors demonstrate significant excess of DNM in 31 genes encoding SG components, regulators or both, the latter being the case for UBAP2L and 2 further genes (G3BP1 and G3BP2 - both with crucial roles in SG assembly). - Excess dn splice-site (N=3) and missense (N=5) variants in G3BP1 were observed in the above cohort [c.95+1G>A, c.353+1G>T, c.539+1G>A / p.S208C, R320C, V366M]. - Excess dn missense (N=7) variants in G3BP2 were observed in the above cohort [p.R13W, D151N, E158K, L209P, E399D, K408E, R438C]. - Generation of G3BP1 or G3BP2 KO HeLa cell lines and immunofluorescence upon use of oxidative stress inducer revealed significant reduction of stress granules. - Generation of HeLa cell lines for 5 G3BP1 mutants (R78C*, R132I*, S208C*, R320C*, V366M) and 7 G3BP2 mutants (p.R13W*, D151N*, E158K, L209P*, E399D, K408E, R438C) revealed that several (those in asterisk) resulted in significantly fewer SG formation under oxidative stress compared to WT while the subcellular distribution of the proteins under stress was identical to WT. - Among the identified genes for SG enriched for DNMs, CAPRIN1 was implicated in previous publications as a NDD risk gene with 3 dn missense SNVs reported (p.I373K, p.Q446H, p.L484P). CAPRIN1 binding to G3BP1/2 has been shown to promote SG formation. Significant reduction of SG was observed in CAPRIN1 KO HeLa lines. p.I373K abolished interaction with G3BP1/2 and disrupted SG formation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4927 | PPFIBP1 | Zornitza Stark Phenotypes for gene: PPFIBP1 were changed from Neurodevelopmental disorder, MONDO:0700092, PPFIBP1-related to Neurodevelopmental disorder with seizures, microcephaly, and brain abnormalities, MIM# 620024 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4926 | PPFIBP1 | Zornitza Stark edited their review of gene: PPFIBP1: Changed phenotypes: Neurodevelopmental disorder with seizures, microcephaly, and brain abnormalities, MIM# 620024 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4925 | PDZD8 |
Zornitza Stark gene: PDZD8 was added gene: PDZD8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PDZD8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDZD8 were set to 35227461 Phenotypes for gene: PDZD8 were set to Intellectual developmental disorder with autism and dysmorphic facies, MIM# 620021 Review for gene: PDZD8 was set to GREEN Added comment: Four individuals from two unrelated families, Drosophila and mouse models support gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4924 | SLC31A1 |
Daniel Flanagan gene: SLC31A1 was added gene: SLC31A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: SLC31A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC31A1 were set to PMID: 35913762 Phenotypes for gene: SLC31A1 were set to Neurodevelopmental disorder, SLC31A1-related (MONDO#0700092) Review for gene: SLC31A1 was set to RED Added comment: SLC31A1 is also referred to as CTR1. Monozygotic twins with hypotonia, global developmental delay, seizures, and rapid brain atrophy, consistent with profound central nervous system copper deficiency. Homozygous for a novel missense variant (p.(Arg95His)) in copper transporter CTR1, both parents heterozygous. A mouse knock-out model of CTR1 deficiency resulted in prenatal lethality. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4915 | LGI3 | Zornitza Stark reviewed gene: LGI3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, LGI3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4915 | TMEM147 |
Naomi Baker gene: TMEM147 was added gene: TMEM147 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM147 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM147 were set to PMID: 36044892 Phenotypes for gene: TMEM147 were set to Neurodevelopmental disorder (MONDO:0700092), TMEM147-related Review for gene: TMEM147 was set to GREEN Added comment: PMID: 36044892; Twelve different variants reported in 23 affected individuals from 15 unrelated families with biallelic variants. All individuals had global developmental delay and intellectual disability. Consistent facial dysmorphisms included coarse facies, prominent forehead, board depressed nasal root, tented mouth, long smooth philtrum, and low-set ears. In vitro studies of missense variants demonstrated accelerated protein degradation via the autophagy-lysosomal pathway, while analysis of primary fibroblasts and granulocytes provided functional evidence of ER and nuclear envelope dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4915 | SARS | Ee Ming Wong reviewed gene: SARS: Rating: RED; Mode of pathogenicity: Other; Publications: 36041817; Phenotypes: neurodevelopmental disorder MONDO#070009, SARS1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4915 | COX11 |
Chern Lim gene: COX11 was added gene: COX11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COX11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COX11 were set to 36030551 Phenotypes for gene: COX11 were set to Mitochondrial disease (MONDO:0044970), COX11-related Review for gene: COX11 was set to GREEN gene: COX11 was marked as current diagnostic Added comment: PMID: 36030551 - Biallelic variants in COX11 associated with infantile-onset mitochondrial encephalopathies in two unrelated consanguineous families, one with homozygous missense variant, another with homozygous frameshift variant. - Functional studies supported pathogenicity of the missense variant, and showed that mutant COX11 fibroblasts had decreased ATP levels which could be rescued by CoQ10. - RNA studies suggested the mutant transcript with p.(Val12Glyfs*21) is not degraded by nonsense mediated decay. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4915 | TMEM163 |
Teresa Zhao gene: TMEM163 was added gene: TMEM163 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM163 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TMEM163 were set to PMID: 35953447 Phenotypes for gene: TMEM163 were set to Hypomyelinating leukodystrophy Review for gene: TMEM163 was set to GREEN Added comment: Four unrelated families with a hypomyelinating leukodystrophy phenotype. Genomic testing identified three distinct heterozygous missense variants in TMEM163 with two unrelated individuals sharing the same de novo variant. All have global developmental delay, three of them have seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4913 | GRIN2A | Zornitza Stark Mode of inheritance for gene: GRIN2A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | NOTCH1 |
Chern Lim changed review comment from: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Missense and small inframe insertion variants in the negative regulatory region. Sources: Literature; to: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Other clinical features include intellectual disability, spasticity and etc. Childhood onset in most individuals however 15y and 40y reported in two individuals. - Missense and small inframe insertion variants in the negative regulatory region. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | CEP104 | Belinda Chong reviewed gene: CEP104: Rating: GREEN; Mode of pathogenicity: None; Publications: 34196201, 35359234; Phenotypes: CEP104 Neurodevelopmental disorder, MONDO:0014770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | NOTCH1 |
Chern Lim gene: NOTCH1 was added gene: NOTCH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NOTCH1 were set to 35947102 Phenotypes for gene: NOTCH1 were set to Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related Mode of pathogenicity for gene: NOTCH1 was set to Other Review for gene: NOTCH1 was set to GREEN gene: NOTCH1 was marked as current diagnostic Added comment: PMID: 35947102: - Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1. - Missense and small inframe insertion variants in the negative regulatory region. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | LGI3 |
Melanie Marty gene: LGI3 was added gene: LGI3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LGI3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LGI3 were set to PMID: 35948005 Phenotypes for gene: LGI3 were set to Global developmental delay; Intellectual disability; Distal deformities; Diminished reflexes; Facial myokymia; Hyporeflexia/areflexi Review for gene: LGI3 was set to GREEN Added comment: Six individuals from eight unrelated families with loss-of-function (LoF) bi-allelic variants in LGI3. Lgi3-null mice showed reduced and mis-local-ized Kv1 channel complexes in myelinated peripheral axons. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | GRIN2A | Teresa Zhao reviewed gene: GRIN2A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35983985; Phenotypes: Epilepsy, focal, with speech disorder and with or without mental retardation (MIM#245570); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4912 | CAPRIN1 |
Paul De Fazio gene: CAPRIN1 was added gene: CAPRIN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CAPRIN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CAPRIN1 were set to 35979925 Phenotypes for gene: CAPRIN1 were set to Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092 Review for gene: CAPRIN1 was set to GREEN gene: CAPRIN1 was marked as current diagnostic Added comment: 12 individuals reported with ID and language impairment. Other features included seizures (4 individuals), hands and feet malformations (5 individuals), breathing problems (6 individuals), ocular problems (4 individuals) and hearing problems (3 individuals). All of the variants were nonsense (NMD-predicted) or splicing variants. 10 were de novo, 1 was inherited from an affected father. Functional studies supported pathogenicity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4906 | CCDC82 | Zornitza Stark reviewed gene: CCDC82: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CCDC82-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4905 | LNPK | chirag patel reviewed gene: LNPK: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35599435; Phenotypes: Neurodevelopmental disorder with epilepsy and hypoplasia of the corpus callosum, MIM# 618090; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4904 | CCDC82 |
chirag patel gene: CCDC82 was added gene: CCDC82 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC82 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC82 were set to PMID: 35373332, 35118659, 27457812 Phenotypes for gene: CCDC82 were set to Intellectual disability and spastic paraparesis, no OMIM # Review for gene: CCDC82 was set to GREEN Added comment: 4 consanguineous families with 9 affected individuals with developmental delay/intellectual disability, and 2 families had spasticity and 1 had epilepsy. WES identified 3 homozgyous truncating variants, segregating with disease and parents as carriers. No functional studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4901 | ACADS | Zornitza Stark changed review comment from: Definitive by ClinGen. Metabolic decompensation. DD/ID is a feature.; to: Definitive by ClinGen. However, largely just causes a biochemical abnormality, and association with clinical disease is debated. DD/ID reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4898 | ZMYND8 | Zornitza Stark Phenotypes for gene: ZMYND8 were changed from Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures to Neurodevelopmental disorder, MONDO:0700092, ZMYND8-related; Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4897 | ZMYND8 | Zornitza Stark Mode of inheritance for gene: ZMYND8 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4895 | TAF4 | Konstantinos Varvagiannis reviewed gene: TAF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 35904126; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4895 | ZMYND8 |
Konstantinos Varvagiannis gene: ZMYND8 was added gene: ZMYND8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZMYND8 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ZMYND8 were set to 35916866; 32530565 Phenotypes for gene: ZMYND8 were set to Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures Penetrance for gene: ZMYND8 were set to unknown Review for gene: ZMYND8 was set to GREEN Added comment: Dias et al (2022 - PMID: 35916866) describe the phenotype of 11 unrelated individuals with monoallelic de novo (or suspected de novo) missense (N=9) or truncating (N=2) ZMYND8 variants. One of these subjects was previously reported by Suzuki et al (2020 - PMID: 32530565). Features included speech delay/language difficulties (9/11), motor delay (9/11), ID (in 10/11 - profound in 1, moderate in 2), CHD (7/11 - PDA, VSD, ASD, pulmonary stenosis, etc), hearing or vision impairment (7/11). Seizures were reported in few (in text 5/11, table 2/11). Variable non-familial facial features were present in (9/11). As the authors discuss, ZMYND8 encodes a multidomain protein playing a role in transcription regulation, chromatin remodeling, regulation of super enhancers, DNA damage response/tumor suppression. The protein is broadly expressed in brain and shows highest expression in early development. Molecular modeling and/or a yeast two-hybrid system were suggestive of disrupted interaction of ZMYND8 with Drebrin (missense variants in PWWP domain) or GATAD2A (variants in MYND domain). Neuronal Zmynd8 knockdown in Drosophila resulted in deficits in habituation learning. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4894 | ADAR | Zornitza Stark Mode of inheritance for gene: ADAR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4893 | ADAR | Zornitza Stark reviewed gene: ADAR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 6, MIM# 615010; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4892 | ACTG1 | Zornitza Stark Mode of inheritance for gene: ACTG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4891 | ACTG1 | Zornitza Stark reviewed gene: ACTG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Baraitser-Winter syndrome 2, MIM#614583; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4889 | ACTB | Zornitza Stark Mode of inheritance for gene: ACTB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4888 | ACTB | Zornitza Stark reviewed gene: ACTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 29220674; Phenotypes: Baraitser-Winter syndrome 1 243310, ACTB-related neurodevelopment disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4886 | ACO2 | Zornitza Stark Mode of inheritance for gene: ACO2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4885 | ACO2 | Zornitza Stark reviewed gene: ACO2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22405087, 25351951, 30689204, 32519519, 25351951; Phenotypes: Infantile cerebellar-retinal degeneration, MIM#614559; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4884 | ABCD1 | Zornitza Stark Mode of inheritance for gene: ABCD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4883 | ABCD1 | Zornitza Stark reviewed gene: ABCD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Adrenoleukodystrophy, MIM# 300100; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4882 | ACADS | Zornitza Stark Mode of inheritance for gene: ACADS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4881 | ACADS | Zornitza Stark reviewed gene: ACADS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Acyl-CoA dehydrogenase, short-chain, deficiency of, MIM# 201470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4880 | ACADM | Zornitza Stark Mode of inheritance for gene: ACADM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4879 | ACADM | Zornitza Stark reviewed gene: ACADM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Acyl-CoA dehydrogenase, medium chain, deficiency of, MIM# 201450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4877 | PAX5 | Zornitza Stark Mode of inheritance for gene: PAX5 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4876 | PAX5 | Zornitza Stark reviewed gene: PAX5: Rating: AMBER; Mode of pathogenicity: None; Publications: 35947077; Phenotypes: Neurodevelopmental disorder MONDO:0700092, PAX5-related, Hypogammaglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4876 | SMG9 | Zornitza Stark Phenotypes for gene: SMG9 were changed from Heart and brain malformation syndrome, MIM# 616920 to Heart and brain malformation syndrome, MIM# 616920; Neurodevelopmental disorder with intention tremor, pyramidal signs, dyspraxia, and ocular anomalies, MIM# 619995 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4874 | SMG9 | Zornitza Stark edited their review of gene: SMG9: Added comment: PMID 35087184: 5 individuals from 3 unrelated Finnish families reported with same homozygous missense variant (founder effect) and predominantly neurological phenotype. Uncertain if this is a distinct disorder or part of a spectrum with the previously reported cases.; Changed publications: 27018474, 31390136, 35087184; Changed phenotypes: Heart and brain malformation syndrome, MIM# 616920, Neurodevelopmental disorder with intention tremor, pyramidal signs, dyspraxia, and ocular anomalies, MIM# 619995 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4874 | THUMPD1 | Zornitza Stark edited their review of gene: THUMPD1: Changed phenotypes: Neurodevelopmental disorder with speech delay and variable ocular anomalies, MIM# 619989; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4874 | TAF4 | Ee Ming Wong reviewed gene: TAF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 33875846, 28191890, 35904126; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TAF4-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4873 | SPTBN5 |
Ee Ming Wong gene: SPTBN5 was added gene: SPTBN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPTBN5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SPTBN5 were set to 35782384 Phenotypes for gene: SPTBN5 were set to Neurodevelopmental disorder, MONDO:0700092, SPTBN5-related Review for gene: SPTBN5 was set to GREEN gene: SPTBN5 was marked as current diagnostic Added comment: - Four probands from unrelated families (1x Pakistani and 3x Italian) with de novo heterozygous SPTBN5 variants - 3x missense variants and 1x LoF variant were reported - Phenotypes include intellectual disability (mild to severe), aggressive tendencies and variable features such as craniofacial and physical dysmorphisms, autistic behavior, and gastroesophageal reflux Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4872 | PSMC1 |
Hazel Phillimore gene: PSMC1 was added gene: PSMC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSMC1 were set to PMID: 35861243 Phenotypes for gene: PSMC1 were set to spastic paraplegia; severe developmental delay; severe intellectual disability; hearing loss; micropenis; undescended testes; Syndromic disease MONDO:0002254, PSMC1-related Review for gene: PSMC1 was set to RED Added comment: Homozygosity mapping on one large consanguineous Bedouin kindred showed three affected children (out of the ten) to be homozygous for NM_002802.3:c.983T>C; p.(Ile328Thr). Drosophila rescue experiments were carried out. Transgenic studies using drosophila with the silenced ortholog Rpt2 gene were rescued by the human wild-type PSMC1. Three of the ten offspring of healthy consanguineous parents of Bedouin Israeli ancestry were affected with a similar phenotype of failure to thrive, developmental delay and severe intellectual disability, spastic tetraplegia with central hypotonia, chorea, as well as hearing loss. None of the three achieved verbal communication or ambulation (sitting / standing) at any age. They had mild dysmorphism of borderline dolichocephaly and microcephaly, prominent bushy eyebrows, flat midface, long nasal bridge and micrognathia. All three had micropenis with undescended testes. One of the affected (as a toddler) underwent thorough endocrinological analysis: testosterone and gonadotropin levels were low. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4871 | SARS | Ain Roesley reviewed gene: SARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 35790048; Phenotypes: neurodevelopmental disorder MONDO#070009, SARS1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4870 | BICD2 | Lucy Spencer reviewed gene: BICD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 35896821; Phenotypes: Neurodevelopmental disorder (MONDO#0700092), BICD2-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4868 | C18orf32 |
Naomi Baker gene: C18orf32 was added gene: C18orf32 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: C18orf32 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C18orf32 were set to PMID:35107634 Phenotypes for gene: C18orf32 were set to Neurodevelopmental disorder (MONDO:0700092), C18orf32-related Review for gene: C18orf32 was set to RED Added comment: Two siblings reported as affected, although sequencing only performed in one sibling, with homozygous loss-of-function variant identified. Clinical presentation included developmental delay, recurrent lower respiratory tract infections, sparse rough hair, roving eye movements, hypotonia, bilateral ankle contractures and inverted nipples. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4867 | WARS |
Anna Ritchie gene: WARS was added gene: WARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WARS were set to PMID: 35815345; 35790048 Phenotypes for gene: WARS were set to Neurodevelopmental disorder (MONDO:0700092), WARS-related Review for gene: WARS was set to GREEN Added comment: At least seven affected individuals from four families with biallelic variants, showing varying severities of developmental delay, intellectual disability and microcephaly. Hearing impairment and, as well as brain anomalies, skeletal system, movement/gait, and behaviour were variable features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4867 | PPFIBP1 | Ee Ming Wong reviewed gene: PPFIBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35830857; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, PPFIBP1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4867 | SLITRK2 |
Paul De Fazio gene: SLITRK2 was added gene: SLITRK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLITRK2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: SLITRK2 were set to 35840571 Phenotypes for gene: SLITRK2 were set to Neurodevelopmental disorder, SLITRK2-related MONDO:0700092 Review for gene: SLITRK2 was set to GREEN gene: SLITRK2 was marked as current diagnostic Added comment: 6 missense variants and 1 nonsense variant (NOT NMD-predicted, single-exon gene) reported in 7 males and 1 female with neurodevelopmental disorders. Phenotypes included dev delay, mild to severe ID, delayed or absent speech, seizures and brain MRI anomalies (in some patients). The nonsense variant was identified in two affected brothers but not in the mother, suggesting it was de novo in the maternal germline. The variant in the one affected female was de novo. All other variants in hemizygous males were inherited from an unaffected mother. In one case, the variant was also identified in the unaffected grandmother. Functional studies showed some but not all variants displayed impaired membrane transport and impaired excitatory synapse-promoting effects. Conditional knockout mice exhibited impaired long-term memory and abnormal gait. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4865 | DOHH |
Daniel Flanagan gene: DOHH was added gene: DOHH was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: DOHH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DOHH were set to PMID: 35858628 Phenotypes for gene: DOHH were set to Neurodevelopmental disorder, DOHH-related (MONDO#0700092) Review for gene: DOHH was set to GREEN Added comment: Bi-allelic missense and truncating DOHH variants segregating with disease in five affected individuals from four unrelated families. Clinical features were developmental delay and/or intellectual disability (5/5), microcephaly (5/5), visual impairment (nystagmus (3/5), strabismus (3/5), and cortical visual impairment (1/5)) and congenital heart malformations (3/5 individuals). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4865 | ADGRL1 |
Elena Savva gene: ADGRL1 was added gene: ADGRL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADGRL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ADGRL1 were set to PMID: 35907405 Phenotypes for gene: ADGRL1 were set to Neurodevelopmental disorder, ADGRL1-related (MONDO#0700092) Review for gene: ADGRL1 was set to GREEN Added comment: PMID: 35907405 - 9 patients w/ ADHD (3/9), autism (4/9), mild-moderate ID (5/9) and epilepsy (2/9) and facial dysmorphism (7/9). Variants include missense (4) and PTCs (5), and were either de novo (7/9) or inherited from parents with learning difficulties/ID (2/9). Functional studies on both PTCs and missense variants show significant reductions in calcium signalling and surface protein. Het null mouse model shows neurological and developmental abnormalities, with hom null mice non-viable. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4861 | POU3F3 | Zornitza Stark reviewed gene: POU3F3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Snijders Blok-Fisher syndrome MIM#618604; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4861 | TMEM63C | Zornitza Stark Phenotypes for gene: TMEM63C were changed from Hereditary spastic paraplegia, MONDO:0019064, TMEM63C-related to Spastic paraplegia 87, autosomal recessive, MIM# 619966 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4860 | TMEM63C | Zornitza Stark reviewed gene: TMEM63C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 87, autosomal recessive, MIM# 619966; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4860 | ARFGEF1 | Zornitza Stark Phenotypes for gene: ARFGEF1 were changed from Intellectual disability; Epilepsy to Developmental delay, impaired speech, and behavioral abnormalities, MIM# 619964 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4859 | ARFGEF1 | Zornitza Stark edited their review of gene: ARFGEF1: Changed phenotypes: Developmental delay, impaired speech, and behavioral abnormalities, MIM# 619964 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4859 | C20orf24 |
Zornitza Stark gene: C20orf24 was added gene: C20orf24 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: C20orf24. Mode of inheritance for gene: C20orf24 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C20orf24 were set to 35614220; 24194475 Phenotypes for gene: C20orf24 were set to Craniofacial dysmorphism, skeletal anomalies, and impaired intellectual development syndrome 2, MIM# 616994 Review for gene: C20orf24 was set to RED Added comment: Bi-allelic LoF variant identified in patient originally reported in PMID 24194475. HGNC approved name is RAB5IF. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4857 | HIST1H4E | Zornitza Stark Mode of inheritance for gene: HIST1H4E was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4856 | HIST1H4E | Zornitza Stark reviewed gene: HIST1H4E: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Tessadori-van Haaften neurodevelopmental syndrome 3, MIM# 619950; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4856 | KMT2B | Zornitza Stark Phenotypes for gene: KMT2B were changed from Dystonia 28, childhood-onset, MIM#617284 to Dystonia 28, childhood-onset 617284; MONDO:0015004; Intellectual developmental disorder, autosomal dominant 68, MIM# 619934 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4854 | KMT2B | Zornitza Stark edited their review of gene: KMT2B: Added comment: Nine individuals reported in PMID 33150406 with heterozygous variants in this gene and intellectual disability, speech delay, microcephaly, growth delay, feeding problems, and dysmorphic features, including epicanthic folds, posteriorly rotated ears, syndactyly/clinodactyly of toes, and fifth finger clinodactyly, normal MRIs and NO dystonia.; Changed publications: 33150406; Changed phenotypes: Dystonia 28, childhood-onset 617284, MONDO:0015004, Intellectual developmental disorder, autosomal dominant 68, MIM# 619934 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4854 | LMAN2L | Zornitza Stark Phenotypes for gene: LMAN2L were changed from ?Mental retardation, autosomal recessive, 52; OMIM #616887 to Mental retardation, autosomal recessive, 52 OMIM #616887; Intellectual developmental disorder, autosomal dominant 69 , MIM# 617863 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4853 | LMAN2L | Zornitza Stark reviewed gene: LMAN2L: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal recessive, 52 OMIM #616887, Intellectual developmental disorder, autosomal dominant 69 , MIM# 617863; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4853 | PLXNA1 | Zornitza Stark reviewed gene: PLXNA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4853 | PLXNA1 | Zornitza Stark Phenotypes for gene: PLXNA1 were changed from Neurodevelopmental disorder with cerebral and eye anomalies to Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4849 | PABPC1 |
Elena Savva gene: PABPC1 was added gene: PABPC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PABPC1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PABPC1 were set to PMID: 35511136 Phenotypes for gene: PABPC1 were set to Neurodevelopmental disorder, PABPC1-related (MONDO#0700092) Review for gene: PABPC1 was set to GREEN Added comment: PMID: 35511136 - 4 probands with an overlapping phenotype of DD, expressive speech delay, and autistic features and heterozygous de novo variants that cluster in the PABP domain of PABPC1. Electroporation of mouse embryo brains showed that Pabpc1 knockdown decreases the proliferation of neural progenitor cells. Wild-type Pabpc1 could rescue this disturbance, whereas 3 of the 4 variants did not. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4847 | ACOX1 | Alison Yeung Phenotypes for gene: ACOX1 were changed from Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960 to Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4847 | ACOX1 | Alison Yeung Phenotypes for gene: ACOX1 were changed from Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960 to Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4846 | ACOX1 | Alison Yeung Phenotypes for gene: ACOX1 were changed from Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960 to Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4846 | CHMP3 |
Chern Lim gene: CHMP3 was added gene: CHMP3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHMP3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHMP3 were set to PMID: 35710109 Phenotypes for gene: CHMP3 were set to Hereditary spastic paraplegia (MONDO:0019064), CHMP3-related Review for gene: CHMP3 was set to AMBER gene: CHMP3 was marked as current diagnostic Added comment: PMID: 35710109 - Single large family with consanguinity, homozygous missense variant in 5 affected individuals with intellectual and progressive motor disabilities, seizures and spastic quadriplegia. - Functional studies showed reduced CHMP3 protein in patient's fibroblasts, lenti-rescue study showed improved cellular phenotypes associated with impaired autophagy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4845 | ACOX1 | Alison Yeung Phenotypes for gene: ACOX1 were changed from to Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470; Mitchell syndrome, MIM# 618960 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4844 | ACOX1 | Alison Yeung Mode of inheritance for gene: ACOX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4843 | ACOX1 | Alison Yeung reviewed gene: ACOX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32169171, 17458872; Phenotypes: Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470, Mitchell syndrome, MIM# 618960; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4843 | WNK3 |
Lucy Spencer gene: WNK3 was added gene: WNK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WNK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: WNK3 were set to 35678782 Phenotypes for gene: WNK3 were set to Neurodevelopmental disorder, WNK3-related (MONDO#0700092) Review for gene: WNK3 was set to GREEN Added comment: 6 maternally inherited hemizygous variants, 3 missense, 2 canonical splice, and a nonsense. Seen in 14 individuals from 6 families, all 14 are male who inherited hemizygous variants from their unaffected heterozygous mothers. The variants cosegregated with disease in 3 families with multiple affected individuals. All 14 patients have ID, 11 have speech delay, 10 have facial abnormalities, 5 have seizures, 6 with microcephaly and 7 with anomalies in brain imaging. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4843 | MAL | Zornitza Stark Marked gene: MAL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4843 | MAL | Zornitza Stark Gene: mal has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4843 | MAL | Zornitza Stark Classified gene: MAL as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4843 | MAL | Zornitza Stark Gene: mal has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4841 | TMEM63C |
Elena Savva gene: TMEM63C was added gene: TMEM63C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM63C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM63C were set to PMID: 35718349 Phenotypes for gene: TMEM63C were set to Hereditary spastic paraplegia, MONDO:0019064, TMEM63C-related Review for gene: TMEM63C was set to GREEN Added comment: PMID: 35718349 - Four NMD PTCs observed in at least 3 unrelated patients. Two segregated strongly in highly consanguineous families. Common clinical details include mild ID, spastic paraplegia, hypereflexia, spasticity, delayed motor development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4840 | MAL |
Zornitza Stark gene: MAL was added gene: MAL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAL were set to 35217805 Phenotypes for gene: MAL were set to Leukodystrophy MONDO:0019046, MAL-related Review for gene: MAL was set to AMBER Added comment: Single family with two affected siblings reported, with homozygous missense variant, some functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4835 | TAF8 | Zornitza Stark reviewed gene: TAF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, TAF8-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4831 | GRIA1 | Zornitza Stark Mode of inheritance for gene: GRIA1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4830 | GRIA1 | Zornitza Stark Phenotypes for gene: GRIA1 were changed from Intellectual developmental disorder, autosomal dominant 67, MIM# 619927 to Intellectual developmental disorder, autosomal dominant 67, MIM# 619927; Intellectual developmental disorder, autosomal recessive 76, MIM# 619931 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4829 | GRIA1 | Zornitza Stark edited their review of gene: GRIA1: Added comment: Single individual reported with bi-allelic LoF variant.; Changed publications: 35675825; Changed phenotypes: Intellectual developmental disorder, autosomal recessive 76, MIM# 619931 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4829 | GRIA1 | Zornitza Stark Phenotypes for gene: GRIA1 were changed from Intellectual disability; autism to Intellectual developmental disorder, autosomal dominant 67, MIM# 619927 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4828 | GRIA1 | Zornitza Stark edited their review of gene: GRIA1: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 67, MIM# 619927 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4826 | KCNC2 |
Zornitza Stark gene: KCNC2 was added gene: KCNC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: KCNC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNC2 were set to 32392612; 31972370; 35314505 Phenotypes for gene: KCNC2 were set to Developmental and epileptic encephalopathy 103, MIM# 619913 Review for gene: KCNC2 was set to GREEN Added comment: More than 10 unrelated families reported. ID ranges from mild to severe. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4825 | ATP2B1 | Zornitza Stark Phenotypes for gene: ATP2B1 were changed from Neurodevelopmental disorder, MONDO:0700092, ATP2B1-related to Intellectual developmental disorder, autosomal dominant 66, MIM# 619910 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4824 | ATP2B1 | Zornitza Stark reviewed gene: ATP2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 66, MIM# 619910; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4819 | RMND1 | Belinda Chong reviewed gene: RMND1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26395190; Phenotypes: Combined oxidative phosphorylation deficiency 11 MIM#614922; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4818 | PAN2 |
Naomi Baker gene: PAN2 was added gene: PAN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PAN2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PAN2 were set to PMID:35304602; 29620724 Phenotypes for gene: PAN2 were set to Syndromic disease MONDO:0002254 Review for gene: PAN2 was set to GREEN Added comment: PMID:35304602 reports five individuals from 3 families with biallelic (homozygous) loss-of-function variants. Clinical presentation incudes mild-moderate intellectual disability, hypotonia, sensorineural hearing loss, EEG abnormalities, congenital heart defects (tetralogy of Fallot, septal defects, dilated aortic root), urinary tract malformations, ophthalmological anomalies, short stature with other skeletal anomalies, and craniofacial features including flat occiput, ptosis, long philtrum, and short neck. PMID:29620724 reports one individual with biallelic (homozygous) loss-of-function variant who presented with global developmental delay, mild hypotonia, craniosynostosis, severe early-onset scoliosis, imperforate anus, and double urinary collecting system. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4814 | PRPF8 |
Krithika Murali gene: PRPF8 was added gene: PRPF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRPF8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRPF8 were set to 35543142 Phenotypes for gene: PRPF8 were set to Intellectual disability; epilepsy; Retinitis pigmentosa 13 - MIM#600059 Review for gene: PRPF8 was set to GREEN Added comment: PMID 35543142 O'Grady et al 2022 report 14 unrelated individuals with heterozygous PRPF8 variants and ID, dymorphic features and epilepsy (7/14). Short stature, abnormal gait and cardiac anomalies also reported. 11 variants identified were de novo, 1 variant - maternal mosaicism, 1 variant - duo sequencing (not identified in mother, father could not be sequenced). 1 individual did not have parental testing. Cardiac anomalies varied and included benign cardiac tumour, dilated cardiomyopathy, dilated aortic root (COL5A2 VUS also identified), bicuspid aortic valve, cardiac arrest, self-resolving ASD/VSD. Heterozygous PRPF8 variants previously associated with retinitis pigmentosa. 1 out of the 14 individuals in this cohort had a diagnosis of RP. RP variants noted to cluster in the C'terminal MPN domain. The individual with RP in this paper had a variant in the preceding RNAase H homology domain near the C-terminus. Not all of the individuals in this paper had formal ophthalmological examination Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4814 | BUB1 |
Paul De Fazio gene: BUB1 was added gene: BUB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BUB1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BUB1 were set to 35044816; 19772675; 19117986; 23209306 Phenotypes for gene: BUB1 were set to Neurodevelopmental disorder, BUB1-related MONDO:0700092; Intellectual disability and microcephaly Review for gene: BUB1 was set to GREEN gene: BUB1 was marked as current diagnostic Added comment: 2 unrelated patients with ID, microcephaly, short stature, dysmorphic features reported with biallelic variants: P1 (3yo male): homozygous start-loss variant (2 hets and 0 hom in gnomAD). Functional testing showed a small amount of full-length protein was translated, and BUB1 recruitment to kinetochores was nearly undetectable. P2 (16yo female): compound heterozygous for a canonical splice variant (1 het and no hom in gnomAD) and an NMD-predicted frameshift variant (absent from gnomAD). The splice variant was shown to result in an in-frame deletion of 54 amino acids in the kinase domain. P2 cells have reduced protein levels but essentially no kinase activity. BUB1 patient cells have impaired mitotic fidelity. Homozygous Bub1 disruption in mice is embryonic lethal (PMID:19772675). A hypomorphic mouse is viable with increased tumourigenesis with ageing and aneuploidy (PMID:19117986). A kinase-dead mouse does not show increased tumourigenesis but does have a high frequency of aneuploid cells (PMID:23209306) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4814 | SEMA6B |
Dean Phelan gene: SEMA6B was added gene: SEMA6B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SEMA6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SEMA6B were set to PMID: 35604360 Phenotypes for gene: SEMA6B were set to Intellectual disability, MONDO:0001071, SEMA6B related Penetrance for gene: SEMA6B were set to Complete Review for gene: SEMA6B was set to GREEN Added comment: PMID: 35604360 - 14 heterozygous variants were observed in 16 unrelated individuals referred for intellectual disability. Majority of the variants 9/14 were PTCs in the last exon and predicted to escape NMD. Functional studies of selected variants and shRNA knock down studies showed mislocalisation and abnormal protein function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4813 | HEATR3 |
Chern Lim gene: HEATR3 was added gene: HEATR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HEATR3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HEATR3 were set to PMID: 35213692 Phenotypes for gene: HEATR3 were set to Bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability; Diamond Blackfan anaemia MONDO:0015253, HEATR3 related Review for gene: HEATR3 was set to AMBER gene: HEATR3 was marked as current diagnostic Added comment: PMID: 35213692: - 4 unrelated individuals with biallelic HEATR3 variants (missense and splice site variants), exhibiting bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability. - Functional analysis showed HEATR3 variants destabilised the protein, resulting in a reduction of nuclear uL18 and impaired ribosome biogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4811 | SRRM2 | Michelle Torres reviewed gene: SRRM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 35567594; Phenotypes: neurodevelopmental disorder MONDO:0700092 SRRM2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4809 | TCTN2 | Zornitza Stark Mode of inheritance for gene: TCTN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4808 | TCTN2 | Zornitza Stark reviewed gene: TCTN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21565611, 25118024; Phenotypes: Joubert syndrome 24, MIM# 616654 MONDO:0014724; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4807 | PRDM13 | Zornitza Stark reviewed gene: PRDM13: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebellar dysfunction, impaired intellectual development, and hypogonadotropic hypogonadism, MIM# 619761; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4806 | HIST1H4J | Zornitza Stark reviewed gene: HIST1H4J: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Tessadori-van Haaften neurodevelopmental syndrome 2 , MIM# 619759; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4802 | LRP2 | Zornitza Stark Mode of inheritance for gene: LRP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4799 | PLCH1 | Zornitza Stark Phenotypes for gene: PLCH1 were changed from Holoprosencephaly spectrum; Severe developmental delay; Brain malformations to Holoprosencephaly 14, MIM# 619895 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4797 | SLC38A3 | Zornitza Stark reviewed gene: SLC38A3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental and epileptic encephalopathy 102, MIM# 619881; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4795 | PROSER1 | Zornitza Stark Phenotypes for gene: PROSER1 were changed from Developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, and genitourinary malformations, no OMIM # to Syndromic disease MONDO:0002254, PROSER1-related; Developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, and genitourinary malformations, no OMIM # | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4794 | PCDHGC4 | Zornitza Stark Phenotypes for gene: PCDHGC4 were changed from Intellectual disability; Seizures to Neurodevelopmental disorder with poor growth and skeletal anomalies, MIM# 619880 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4793 | PCDHGC4 | Zornitza Stark edited their review of gene: PCDHGC4: Changed phenotypes: Neurodevelopmental disorder with poor growth and skeletal anomalies, MIM# 619880 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4792 | LRP2 | chirag patel reviewed gene: LRP2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 17632512; Phenotypes: Donnai-Barrow syndrome, MIM#222448; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4791 | GEMIN4 | chirag patel reviewed gene: GEMIN4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 25558065, 30237576, 27878435; Phenotypes: Neurodevelopmental disorder with microcephaly, cataracts, and renal abnormalities, MIM# 617913; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4790 | GFM2 |
chirag patel gene: GFM2 was added gene: GFM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: GFM2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GFM2 were set to PMID: 22700954, 26016410, 29075935 Phenotypes for gene: GFM2 were set to Combined oxidative phosphorylation deficiency 39, OMIM #618397 Review for gene: GFM2 was set to GREEN Added comment: Combined oxidative phosphorylation deficiency-39 (COXPD39) is an autosomal recessive multisystem disorder resulting from a defect in mitochondrial energy metabolism. Affected individuals show global developmental delay, sometimes with regression after normal early development, axial hypotonia with limb spasticity or abnormal involuntary movements, and impaired intellectual development with poor speech. More variable features may include hypotonia, seizures, and features of Leigh syndrome on brain imaging. There are variable deficiencies of the mitochondrial respiratory chain enzyme complexes in patient tissues. 4 families reported with biallelic variants with functional evidence in 1 family. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4788 | MOCS3 |
Zornitza Stark gene: MOCS3 was added gene: MOCS3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: MOCS3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MOCS3 were set to 33897766; 28544736 Phenotypes for gene: MOCS3 were set to Molybdenum cofactor deficiency MONDO:0020480 Review for gene: MOCS3 was set to AMBER Added comment: Two unrelated families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4786 | CPSF3 | Zornitza Stark reviewed gene: CPSF3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4786 | MFF | Zornitza Stark Phenotypes for gene: MFF were changed from to Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4784 | MFF | Zornitza Stark Mode of inheritance for gene: MFF was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4783 | MFF | Zornitza Stark reviewed gene: MFF: Rating: GREEN; Mode of pathogenicity: None; Publications: 22499341, 26783368, 32181496; Phenotypes: Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4781 | OPHN1 | Zornitza Stark Mode of inheritance for gene: OPHN1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4780 | OPHN1 | Zornitza Stark reviewed gene: OPHN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20528889, 9582072, 12807966, 16221952; Phenotypes: Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, MIM#300486; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4780 | GRIA4 | Ain Roesley Phenotypes for gene: GRIA4 were changed from Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864 to Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4780 | GRIA4 | Ain Roesley Mode of inheritance for gene: GRIA4 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4779 | GRIA4 | Ain Roesley Phenotypes for gene: GRIA4 were changed from to Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4779 | GRIA4 | Ain Roesley Mode of inheritance for gene: GRIA4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4778 | GRIA4 | Ain Roesley reviewed gene: GRIA4: Rating: GREEN; Mode of pathogenicity: None; Publications: 35518358, 29220673; Phenotypes: Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4778 | GRID2 | Ain Roesley Phenotypes for gene: GRID2 were changed from to Spinocerebellar ataxia, autosomal recessive 18 MIM#616204 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4778 | GRID2 | Ain Roesley Mode of inheritance for gene: GRID2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4777 | GRID2 | Ain Roesley reviewed gene: GRID2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32622959, 32170608; Phenotypes: Spinocerebellar ataxia, autosomal recessive 18 MIM#616204; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4776 | ADD1 |
chirag patel gene: ADD1 was added gene: ADD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADD1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: ADD1 were set to PMID: 34906466 Phenotypes for gene: ADD1 were set to Intellectual disability, corpus callosum dysgenesis, and ventriculomegaly; no OMIM # Review for gene: ADD1 was set to GREEN Added comment: 4 unrelated individuals affected by ID and/or complete or partial agenesis of corpus callosum, and enlarged lateral ventricles. WES found loss-of-function variants - 1 recessive missense variant and 3 de novo variants. The recessive variant is associated with ACC and enlarged lateral ventricles, and the de novo variants were associated with complete or partial agenesis of corpus callosum, mild ID and attention deficit. Human variants impair ADD1 protein expression and/or dimerization with ADD2. Add1 knockout mice recapitulate corpus callosum dysgenesis and ventriculomegaly phenotypes. Three adducin genes (ADD1, ADD2, and ADD3) encode cytoskeleton proteins that are critical for osmotic rigidity and cell shape. ADD1, ADD2, and ADD3 form heterodimers (ADD1/ADD2, ADD1/ADD3), which further form heterotetramers. Adducins interconnect spectrin and actin filaments to form polygonal scaffolds beneath the cell membranes and form ring-like structures in neuronal axons. Adducins regulate mouse neural development, but their function in the human brain is unknown. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4775 | PROSER1 |
chirag patel gene: PROSER1 was added gene: PROSER1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PROSER1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PROSER1 were set to PMID: 35229282 Phenotypes for gene: PROSER1 were set to Developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, and genitourinary malformations, no OMIM # Review for gene: PROSER1 was set to RED Added comment: 4 children from 3 related families with developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, genitourinary malformations, and common facial features (arched eyebrows, prominent eyes, broad nasal bridge, low-hanging columella, open mouth, thick lower lip, protruding tongue, large low-set ears, and parietal bossing). WES revealed a homozygous frame-shift variant (p.Thr612Glnfs*22) in PROSER1. This encodes the proline and serine rich protein 1, part of the histone methyltransferases KMT2C/KMT2D complexes. PROSER1 stabilizes TET2, a member of the TET family of DNA demethylases which is involved in recruiting the enhancer-associated KMT2C/KMT2D complexes and mediating DNA demethylation, activating gene expression. Therefore, PROSER1 may play vital and potentially general roles in gene regulation. No functional assays and 3 related families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4774 | MTOR | Zornitza Stark Phenotypes for gene: MTOR were changed from to Smith-Kingsmore syndrome, MIM# 616638; Focal cortical dysplasia, type II, somatic, MIM# 607341; Overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes, MONDO:0100283 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4771 | MTOR | Zornitza Stark Mode of inheritance for gene: MTOR was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4770 | MTOR | Zornitza Stark reviewed gene: MTOR: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28892148, 25878179, 26018084; Phenotypes: Smith-Kingsmore syndrome, MIM# 616638, Focal cortical dysplasia, type II, somatic, MIM# 607341, Overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes, MONDO:0100283; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4768 | WASF1 | Zornitza Stark reviewed gene: WASF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29961568, 34845217, 34478686, 34356165; Phenotypes: Neurodevelopmental disorder with absent language and variable seizures , MIM#618707; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4766 | FTO | Bryony Thompson reviewed gene: FTO: Rating: GREEN; Mode of pathogenicity: None; Publications: 19559399, 26378117, 26697951, 26378117, 26740239; Phenotypes: Growth retardation, developmental delay, facial dysmorphism MIM#612938; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4760 | DEPDC5 | Zornitza Stark Mode of inheritance for gene: DEPDC5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4759 | DEPDC5 | Zornitza Stark reviewed gene: DEPDC5: Rating: GREEN; Mode of pathogenicity: None; Publications: 31444548, 23542697, 23542701; Phenotypes: Epilepsy, familial focal, with variable foci 1, MIM#604364; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4759 | DCHS1 | Zornitza Stark Phenotypes for gene: DCHS1 were changed from to Van Maldergem syndrome 1, MIM# 601390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4757 | DCHS1 | Zornitza Stark Mode of inheritance for gene: DCHS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4756 | DCHS1 | Zornitza Stark reviewed gene: DCHS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27262615, 22473091, 24056717, 29046692; Phenotypes: Van Maldergem syndrome 1, MIM# 601390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4756 | ACTL6B | Zornitza Stark Mode of inheritance for gene: ACTL6B was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4755 | ACTL6B | Zornitza Stark edited their review of gene: ACTL6B: Changed phenotypes: Epileptic encephalopathy, early infantile, 76, MIM# 618468, Intellectual developmental disorder with severe speech and ambulation defects, MIM# 618470; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4755 | MAPKAPK5 | Zornitza Stark Phenotypes for gene: MAPKAPK5 were changed from Developmental delay, variable brain anomalies, congenital heart defects, dysmorphic to Neurocardiofaciodigital syndrome, MIM# 619869 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4754 | MAPKAPK5 | Zornitza Stark reviewed gene: MAPKAPK5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurocardiofaciodigital syndrome, MIM# 619869; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4752 | DCAF17 | Zornitza Stark Mode of inheritance for gene: DCAF17 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4751 | DCAF17 | Zornitza Stark reviewed gene: DCAF17: Rating: GREEN; Mode of pathogenicity: None; Publications: 19026396, 20507343, 35002959, 34877714, 34732557, 34590781; Phenotypes: Woodhouse-Sakati syndrome, MIM# 241080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4750 | CYC1 | Ain Roesley Mode of inheritance for gene: CYC1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4749 | CYC1 | Ain Roesley Mode of inheritance for gene: CYC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4748 | CYC1 | Ain Roesley reviewed gene: CYC1: Rating: RED; Mode of pathogenicity: None; Publications: 23910460, 34252606; Phenotypes: Mitochondrial complex III deficiency, nuclear type 6 MIM#615453; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4741 | CTR9 |
Dean Phelan gene: CTR9 was added gene: CTR9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CTR9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CTR9 were set to PMID: 35499524 Phenotypes for gene: CTR9 were set to Neurodevelopmental disorder (MONDO:0700092), CTR9-related; Intellectual disability (MONDO:0001071); hypotonia (HP:0001252); joint hyperlaxity (HP:0001388); speech delay; coordination problems; tremor (HP:0001337); autism spectrum disorder (MONDO:0005258) Review for gene: CTR9 was set to GREEN Added comment: PMID: 35499524 - Thirteen individuals with variables degrees of intellectual disability, hypotonia, joint hyperlaxity, speech delay, coordination problems, tremor, autism spectrum disorder. Mild dysmorphism and cardiac anomalies were less frequent. Eleven of the variants were shown to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4741 | PRDM13 | Dean Phelan reviewed gene: PRDM13: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35390279; Phenotypes: Pontocerebellar hypoplasia (MONDO:0020135), PRDM13 related, Intellectual disability (MONDO:0001071); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4741 | DNAH14 |
Chern Lim gene: DNAH14 was added gene: DNAH14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DNAH14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAH14 were set to PMID: 35438214 Phenotypes for gene: DNAH14 were set to Neurodevelopmental disorder, DNAH14-related (MONDO#0700092) Review for gene: DNAH14 was set to GREEN gene: DNAH14 was marked as current diagnostic Added comment: PMID: 35438214: - Three previously unreported patients with compound heterozygous DNAH14 variants, including one nonsense, one frameshift, and four missense variants. A spectrum of neurological and developmental phenotypes was observed, including seizures, global developmental delay, microcephaly, and hypotonia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4740 | DROSHA |
Lucy Spencer gene: DROSHA was added gene: DROSHA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DROSHA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DROSHA were set to 35405010 Phenotypes for gene: DROSHA were set to Neurodevelopmental disorder (MONDO#0700092), DROSHA-related Review for gene: DROSHA was set to AMBER Added comment: 2 individuals with profound intellectual disability, epilepsy, white matter atrophy, microcephaly, and dysmorphic features, who carry damaging de novo heterozygous variants in DROSHA. Both variants are missense, absent from gnomad. Both individuals noted to have Rett-like features. Functional studies in patient fibroblasts showed one of the missense altered the expression of mature miRNA. Fruit fly models with homozygous LOF variants die during larval stages. introduction of the missense seen in the patients was able to partially rescue this phenotype suggesting LOF is not the mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4736 | KCNH5 |
Elena Savva gene: KCNH5 was added gene: KCNH5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNH5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KCNH5 were set to https://www.medrxiv.org/content/10.1101/2022.04.26.22274147v1 Phenotypes for gene: KCNH5 were set to Neurodevelopmental disorder MONDO#0700092, KCNH5-related Mode of pathogenicity for gene: KCNH5 was set to Other Review for gene: KCNH5 was set to GREEN Added comment: Happ (2022), preprint: Screen of 893 patients with DEE found 17 patients with missense variants (16/17 de novo, 1/17 inherited). GOF mechanism suggested. Patient phenotypes included focal/generalized seizures, Cognitive outcome for the ten individuals >5 years ranged from normal (3/10) to mild (3/10), moderate (2/10), severe (1/10) and profound (1/10) intellectual disability (ID) p.Arg327His (7 probands), p.Arg333His (4 probands) were recurring Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4733 | STX1A |
Ain Roesley gene: STX1A was added gene: STX1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: STX1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Phenotypes for gene: STX1A were set to neurodevelopmental disorder MONDO#0700092, STX1A-related Review for gene: STX1A was set to GREEN gene: STX1A was marked as current diagnostic Added comment: Preprint: https://www.medrxiv.org/content/10.1101/2022.04.20.22274073v1 8 individuals - 2x hom (related) and 6x hets (all de novo except 1x unknown) 7 unrelated since the 2 siblings share similar features: 7/7 ID, 7/7 motor delay, 4/7 epilepsy, 5/7 neonatal hypotonia 2/7 regression, 2/7 ASD excluding 1 with features but did not meet criteria Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4732 | PPFIBP1 |
Zornitza Stark gene: PPFIBP1 was added gene: PPFIBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: PPFIBP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PPFIBP1 were set to https://www.medrxiv.org/content/10.1101/2022.04.04.22273309v1 Phenotypes for gene: PPFIBP1 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIBP1-related Review for gene: PPFIBP1 was set to GREEN Added comment: 16 individuals from 10 unrelated families reported with moderate to profound developmental delay, often refractory early-onset epilepsy and progressive microcephaly. Drosophila model. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4731 | DTYMK | Daniel Flanagan reviewed gene: DTYMK: Rating: GREEN; Mode of pathogenicity: None; Publications: 34918187; Phenotypes: Neurodegeneration, childhood-onset, with progressive microcephaly (MIM# 619847); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4730 | CPS1 | Ain Roesley Mode of inheritance for gene: CPS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4729 | CPS1 | Ain Roesley reviewed gene: CPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8486760, 17310273, 21120950, 31268178; Phenotypes: Carbamoylphosphate synthetase I deficiency MIM#237300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4729 | GNAI1 | Zornitza Stark Phenotypes for gene: GNAI1 were changed from Intellectual disability; seizures; hypotonia to Neurodevelopmental disorder with hypotonia, impaired speech, and behavioral abnormalities, MIM# 619854 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4728 | GNAI1 | Zornitza Stark edited their review of gene: GNAI1: Changed phenotypes: Neurodevelopmental disorder with hypotonia, impaired speech, and behavioral abnormalities, MIM# 619854 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4726 | MCCC2 | Zornitza Stark Mode of inheritance for gene: MCCC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4724 | MCCC2 | Zornitza Stark reviewed gene: MCCC2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-Methylcrotonyl-CoA carboxylase 2 deficiency (MIM#210210); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4722 | SIK1 | Zornitza Stark Mode of inheritance for gene: SIK1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4721 | SIK1 | Zornitza Stark reviewed gene: SIK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25839329, 27966542, 35267137; Phenotypes: Developmental and epileptic encephalopathy 30, MIM#616341, developmental and epileptic encephalopathy, MONDO#0100062; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4718 | HERC1 | Zornitza Stark Mode of inheritance for gene: HERC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4717 | HERC1 | Zornitza Stark reviewed gene: HERC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28323226, 27108999, 26153217, 26138117, 20041218; Phenotypes: Macrocephaly, dysmorphic facies, and psychomotor retardation, MIM# 617011; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4717 | LINS1 | Alison Yeung Phenotypes for gene: LINS1 were changed from Intellectual developmental disorder, autosomal recessive 27, MIM# 614340 to Intellectual developmental disorder, autosomal recessive 27, MIM# 614340 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4716 | LINS1 | Alison Yeung Phenotypes for gene: LINS1 were changed from to Intellectual developmental disorder, autosomal recessive 27, MIM# 614340 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4714 | LINS1 | Alison Yeung Mode of inheritance for gene: LINS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4713 | LINS1 | Alison Yeung reviewed gene: LINS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32802957, 34450347, 32499722, 31922598; Phenotypes: ntellectual developmental disorder, autosomal recessive 27, MIM# 614340; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4711 | HCN1 | Zornitza Stark Mode of inheritance for gene: HCN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4710 | HCN1 | Zornitza Stark reviewed gene: HCN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24747641, 30351409, 30351409; Phenotypes: Developmental and epileptic encephalopathy 24, MIM# 615871, Generalized epilepsy with febrile seizures plus, type 10, MIM# 618482; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4710 | MCCC2 | Teresa Zhao reviewed gene: MCCC2: Rating: AMBER; Mode of pathogenicity: None; Publications: 34899149; Phenotypes: 3-Methylcrotonyl-CoA carboxylase 2 deficiency (MIM#210210); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4708 | AP1S2 | Zornitza Stark Mode of inheritance for gene: AP1S2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4707 | AP1S2 | Zornitza Stark reviewed gene: AP1S2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17186471, 17617514, 19377476, 30714330, 23756445; Phenotypes: Pettigrew syndrome, MIM# 304340; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4706 | ENTPD1 |
Zornitza Stark gene: ENTPD1 was added gene: ENTPD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ENTPD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ENTPD1 were set to 35471564 Phenotypes for gene: ENTPD1 were set to Spastic paraplegia 64, autosomal recessive, MIM# 615683 Review for gene: ENTPD1 was set to GREEN Added comment: 27 individuals from 17 families published, expanding the phenotype to a complex neurodevelopmental disorder characterised by ID, white matter abnormalities and spastic paraplegia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4705 | NRCAM | Zornitza Stark Phenotypes for gene: NRCAM were changed from Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833 to Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4705 | NRCAM | Zornitza Stark Phenotypes for gene: NRCAM were changed from neurodevelopmental disorder, MONDO:0700092 to Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4704 | NRCAM | Zornitza Stark reviewed gene: NRCAM: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4704 | CDC42BPB | Zornitza Stark Phenotypes for gene: CDC42BPB were changed from Central hypotonia; Global developmental delay; Intellectual disability; Seizures; Autistic behavior; Behavioral abnormality to Chilton-Okur-Chung neurodevelopmental syndrome, MIM# 619841 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4703 | CDC42BPB | Zornitza Stark reviewed gene: CDC42BPB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Chilton-Okur-Chung neurodevelopmental syndrome, MIM# 619841; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4703 | CNNM2 | Ain Roesley Mode of inheritance for gene: CNNM2 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4702 | CNNM2 | Ain Roesley reviewed gene: CNNM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34604137, 35170241; Phenotypes: Hypomagnesemia 6, renal MIM#613882, Hypomagnesemia, seizures, and mental retardation MIM#616418; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4699 | PIGW | Zornitza Stark Mode of inheritance for gene: PIGW was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4698 | PIGW | Zornitza Stark reviewed gene: PIGW: Rating: GREEN; Mode of pathogenicity: None; Publications: 24367057, 27626616, 30813920, 32198969; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 11, MIM# 616025; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4698 | CIT | Zornitza Stark Phenotypes for gene: CIT were changed from to Microcephaly 17, primary, autosomal recessive (MIM#617090) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4696 | CIT | Zornitza Stark Mode of inheritance for gene: CIT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4695 | CIT | Zornitza Stark reviewed gene: CIT: Rating: GREEN; Mode of pathogenicity: None; Publications: 27453578, 27503289, 27453579; Phenotypes: Microcephaly 17, primary, autosomal recessive (MIM#617090); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4695 | CIC | Ain Roesley Phenotypes for gene: CIC were changed from to Intellectual developmental disorder, autosomal dominant 45 MIM#617600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4695 | CIC | Ain Roesley Mode of inheritance for gene: CIC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4694 | CIC | Ain Roesley reviewed gene: CIC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28288114, 21076407; Phenotypes: Intellectual developmental disorder, autosomal dominant 45 MIM#617600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4692 | PDE4D | Zornitza Stark Mode of inheritance for gene: PDE4D was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4691 | PDE4D | Zornitza Stark reviewed gene: PDE4D: Rating: GREEN; Mode of pathogenicity: None; Publications: 22464250, 22464252, 23033274, 24203977; Phenotypes: Acrodysostosis 2, with or without hormone resistance, MIM# 614613; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4690 | ATP11A | Zornitza Stark reviewed gene: ATP11A: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 24 , MIM# 619851; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4690 | PIDD1 | Zornitza Stark Phenotypes for gene: PIDD1 were changed from Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum to Intellectual developmental disorder, autosomal recessive 75, with neuropsychiatric features and variant lissencephaly, MIM# 619827 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4689 | PIDD1 | Zornitza Stark reviewed gene: PIDD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal recessive 75, with neuropsychiatric features and variant lissencephaly, MIM# 619827; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4689 | CLPB | Zornitza Stark Phenotypes for gene: CLPB were changed from 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271 to 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271; 3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4688 | CLPB | Zornitza Stark edited their review of gene: CLPB: Changed phenotypes: 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271, 3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4687 | GLRA2 |
Zornitza Stark gene: GLRA2 was added gene: GLRA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: GLRA2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: GLRA2 were set to 26370147; 20479760; 35294868 Phenotypes for gene: GLRA2 were set to Intellectual developmental disorder, X-linked, syndromic, Pilorge type, MIM# 301076 Review for gene: GLRA2 was set to GREEN Added comment: More than 10 unrelated families reported. Both males and females affected, though some mothers are asymptomatic or mild. Zebrafish model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4684 | FASTKD2 | Bryony Thompson reviewed gene: FASTKD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 18771761, 28499982, 31944455, 34234304; Phenotypes: FASTKD2-related infantile mitochondrial encephalomyopathy MONDO:0015632; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4684 | PDE4D | Krithika Murali reviewed gene: PDE4D: Rating: GREEN; Mode of pathogenicity: None; Publications: 24203977, 22464250; Phenotypes: Acrodysostosis 2, with or without hormone resistance - MIM#614613; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4682 | PPP1R15B | Zornitza Stark Mode of inheritance for gene: PPP1R15B was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4682 | PPP1R15B | Zornitza Stark Mode of inheritance for gene: PPP1R15B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4680 | PPP1R15B | Zornitza Stark reviewed gene: PPP1R15B: Rating: AMBER; Mode of pathogenicity: None; Publications: 26159176, 26307080, 27640355; Phenotypes: Microcephaly, short stature, and impaired glucose metabolism 2, MIM# 616817; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4678 | PRMT7 | Zornitza Stark Mode of inheritance for gene: PRMT7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4677 | PRMT7 | Zornitza Stark reviewed gene: PRMT7: Rating: GREEN; Mode of pathogenicity: None; Publications: 26437029, 27718516, 30513135; Phenotypes: Short stature, brachydactyly, intellectual developmental disability, and seizures, MIM# 617157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4675 | PRSS12 | Zornitza Stark Mode of inheritance for gene: PRSS12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4673 | PRSS12 | Zornitza Stark reviewed gene: PRSS12: Rating: AMBER; Mode of pathogenicity: None; Publications: 12459588; Phenotypes: Intellectual disability, PRSS12 related MIM#249500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4671 | PSMD12 | Zornitza Stark Mode of inheritance for gene: PSMD12 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4670 | PSMD12 | Zornitza Stark reviewed gene: PSMD12: Rating: GREEN; Mode of pathogenicity: None; Publications: 28132691, 34906456; Phenotypes: Stankiewicz-Isidor syndrome, MIM# 617516; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4668 | PYCR2 | Zornitza Stark Mode of inheritance for gene: PYCR2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4667 | PYCR2 | Zornitza Stark reviewed gene: PYCR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25865492, 27130255; Phenotypes: Leukodystrophy, hypomyelinating, 10, MIM# 616420; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4667 | SET | Zornitza Stark Phenotypes for gene: SET were changed from to Intellectual developmental disorder, autosomal dominant 58, MIM#618106; intellectual disability, autosomal dominant 58, MONDO:0020847 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4665 | SET | Zornitza Stark Mode of inheritance for gene: SET was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4664 | SET | Zornitza Stark reviewed gene: SET: Rating: GREEN; Mode of pathogenicity: None; Publications: 29688601, 29907757, 25356899; Phenotypes: Intellectual developmental disorder, autosomal dominant 58, MIM#618106, intellectual disability, autosomal dominant 58, MONDO:0020847; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4664 | PIGA | Zornitza Stark Phenotypes for gene: PIGA were changed from Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM#300868 to Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466; Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4662 | PIGA | Zornitza Stark edited their review of gene: PIGA: Added comment: PMID 34875027: variants in PIGA causing a neurodevelopment disorder and a juvenile form of hereditary hemochromatosis reported in > three unrelated patients. All patients had increased serum iron, ferritin and transferrin saturation levels, high ALP and low hepcidin. All patients had generalised seizures and intellectual disability. A subpopulation of patient blood cells showed a slight reduction of GPI-anchored proteins, suggesting that the mutations were hypomorphic and retained some residual activity. CRISPR/Cas12a-mediated knockdown of PIGA in Hep3B liver cells eliminated the cell surface expression of GPI-anchored proteins CD59 and hemojuvelin (HJV; 608374), as well as caused decreased expression of hepcidin (606464) compared to controls. These hypomorphic alleles could explain the milder neurologic phenotype, which allowed for sufficiently long survival for the iron overload phenotype to manifest.; Changed publications: 22305531, 24357517, 24706016, 26545172, 33333793, 32694024, 34875027; Changed phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466, Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4658 | CACNA2D1 |
Michelle Torres gene: CACNA2D1 was added gene: CACNA2D1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACNA2D1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CACNA2D1 were set to 35293990 Phenotypes for gene: CACNA2D1 were set to developmental and epileptic encephalopathy disorder MONDO:0100062 CACNA2D1-related Review for gene: CACNA2D1 was set to GREEN Added comment: PMID 35293990: WES of 2x unrelated individuals with early-onset developmental epileptic encephalopathy, microcephaly, severe hypotonia, absent speech, spasticity, choreiform movements, orofacial dyskinesia, and 2 cortical visual impairment, corpus callosum hypoplasia and progressive volume loss. Patient 2 also had a tiny patent foramen ovale. Patient 1 is homozygous for p.(Ser275Asnfs*13). mRNA and protein expression were reduced to ~10% of WT in fibroblasts Patient 2 is cHet for p.(Leu9Alafs*5) and p.(Gly209Asp). mRNA expression in patients fibroblasts was similar to controls, and protein expression reduced to 31-38%. Functional of the p.(Gly209Asp) showed impaired localization and mutagenesis showed complete loss of channel function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4658 | ATP2B1 |
Daniel Flanagan changed review comment from: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense. Sources: Expert list; to: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), dissimilar forms of seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4658 | TRAPPC10 |
Naomi Baker gene: TRAPPC10 was added gene: TRAPPC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRAPPC10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC10 were set to PMID: 35298461; 30167849 Phenotypes for gene: TRAPPC10 were set to neurodevelopmental disorder (MONDO:0700092), TRAPPC10-related Review for gene: TRAPPC10 was set to GREEN Added comment: PMID: 35298461 – two Pakistani families reported with homozygous variants. Family 1 has frameshift variant in 8 affected individual and family 2 has missense variant in 2 affected individuals. Patients present with microcephaly, short stature, hypotonia, severe ID and behavioural abnormalities. Seizures also reported in 4/10 individuals. Paper also reported brain abnormalities in null mouse model and other functional in transfected cell lines. PMID: 30167849 – initial report of family 2 above. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4658 | ATP2B1 |
Daniel Flanagan gene: ATP2B1 was added gene: ATP2B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ATP2B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP2B1 were set to PMID: 35358416 Phenotypes for gene: ATP2B1 were set to Neurodevelopmental disorder, MONDO:0700092, ATP2B1-related Review for gene: ATP2B1 was set to GREEN Added comment: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4656 | ADAM22 | Lucy Spencer reviewed gene: ADAM22: Rating: GREEN; Mode of pathogenicity: None; Publications: 35373813; Phenotypes: Developmental and epileptic encephalopathy 61 (MIM#617933); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4656 | AHSG |
Elena Savva gene: AHSG was added gene: AHSG was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AHSG was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AHSG were set to PMID: 28054173; 9395485; 31288248; 17389622 Phenotypes for gene: AHSG were set to ?Alopecia-intellectual disability syndrome 1 MIM#203650; infantile cortical hyperostosis Review for gene: AHSG was set to RED Added comment: PMID: 28054173 - 7 relatives within a large consanguinous fam w/ alopecia and ID, and a hom missense (p.Arg317His). Modelling predicts this variant to be a phosphorylation site, functional studies show a difference in protein size. Unclear biological significance. Alt change with stronger GS (p.(Arg317Cys)) is a common poly with 19 homozygotes in gnomAD. No hom PTCs in gnomAD PMID: 9395485 - K/O mouse model shows no gross anatomical abnormalities, were fertile and "healthy". No mentioned of ID, alopecia PMID: 17389622 - K/O mouse model on the calcification resistant genetic background C57BL/6, shows uraemia and phosphate challenge. No mentioned of ID, alopecia PMID: 31288248 - 1 hom infant (p.K2*, within 5' NMD escape region) with infantile cortical hyperostosis, loss of enzyme in patient serum shown by ELISA. No mentioned of ID, alopecia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4654 | VPS16 |
Ain Roesley gene: VPS16 was added gene: VPS16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VPS16 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS16 were set to 33938619; 34013567; 34901436 Phenotypes for gene: VPS16 were set to mucopolysaccharidosis-like disorder, VPS16-related MONDO#0100365 Review for gene: VPS16 was set to GREEN gene: VPS16 was marked as current diagnostic Added comment: for AR MPS - developmental delay reported 3 unrelated families - 2x hom c.2272‐18C>A and 1x hom p.Trp180Cys RNA and functional studies done on the splice variant also associated with AD dystonia PMID:34901436 suggests dystonia is transcript specific Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4653 | SPATA5 | Zornitza Stark Phenotypes for gene: SPATA5 were changed from Epilepsy, hearing loss, and mental retardation syndrome MIM#616577 to Neurodevelopmental disorder with hearing loss, seizures, and brain abnormalities MIM#616577 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4652 | SPATA5 | Zornitza Stark edited their review of gene: SPATA5: Changed phenotypes: Neurodevelopmental disorder with hearing loss, seizures, and brain abnormalities 616577 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4650 | TSPAN7 | Zornitza Stark Mode of inheritance for gene: TSPAN7 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4649 | TSPAN7 | Zornitza Stark Mode of inheritance for gene: TSPAN7 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4647 | TSPAN7 | Zornitza Stark reviewed gene: TSPAN7: Rating: AMBER; Mode of pathogenicity: None; Publications: 10449641, 12070254, 10655063, 25081361; Phenotypes: Intellectual developmental disorder, X-linked 58, MIM #300210, MONDO:0010266; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4647 | SLC6A17 | Zornitza Stark Phenotypes for gene: SLC6A17 were changed from to Mental retardation, autosomal recessive 48, MIM# 616269 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4645 | SLC6A17 | Zornitza Stark Mode of inheritance for gene: SLC6A17 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4643 | SLC6A17 | Zornitza Stark reviewed gene: SLC6A17: Rating: AMBER; Mode of pathogenicity: None; Publications: 25704603, 23672601; Phenotypes: Mental retardation, autosomal recessive 48, MIM# 616269; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4642 | RBMX |
Zornitza Stark gene: RBMX was added gene: RBMX was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: RBMX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: RBMX were set to 25256757; 34260915 Phenotypes for gene: RBMX were set to Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238 Review for gene: RBMX was set to AMBER Added comment: Hemizygous truncating variant reported segregating in multiple affected individuals in a single family. Some supportive functional data. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4639 | WDR11 | Elena Savva Mode of inheritance for gene: WDR11 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4638 | WDR11 | Elena Savva reviewed gene: WDR11: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, WDR11-related; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4636 | RAB3GAP2 | Zornitza Stark Mode of inheritance for gene: RAB3GAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4635 | RAB3GAP2 | Teresa Zhao reviewed gene: RAB3GAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23420520, 32376645; Phenotypes: Martsolf syndrome (MIM212720), Warburg micro syndrome 2 (MIM#614225); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4632 | NUBPL | Zornitza Stark Mode of inheritance for gene: NUBPL was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4629 | NTRK1 | Zornitza Stark Mode of inheritance for gene: NTRK1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4628 | NTRK1 | Zornitza Stark Mode of inheritance for gene: NTRK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4627 | NSUN2 | Zornitza Stark Phenotypes for gene: NSUN2 were changed from to Mental retardation, autosomal recessive 5 - MIM#611091 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4625 | NSUN2 | Zornitza Stark Mode of inheritance for gene: NSUN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4624 | NSUN2 | Zornitza Stark reviewed gene: NSUN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 35126837; Phenotypes: Mental retardation, autosomal recessive 5 - MIM#611091; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4622 | NRXN1 | Zornitza Stark Mode of inheritance for gene: NRXN1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4621 | NUBPL | Krithika Murali reviewed gene: NUBPL: Rating: GREEN; Mode of pathogenicity: None; Publications: 20818383, 32518176, 23553477, 31917109, 32518176, 31787496, 30897263, 22826544; Phenotypes: Mitochondrial complex I deficiency, nuclear type 21 - MIM#618242; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4621 | NTRK1 | Krithika Murali reviewed gene: NTRK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10233776, 19250380, 10861667, 10982191, 20301726, 20089052; Phenotypes: Insensitivity to pain, congenital, with anhidrosis - MIM#256800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4621 | NSUN2 | Krithika Murali reviewed gene: NSUN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22541559, 22541562, 21063731, 22577224; Phenotypes: Mental retardation, autosomal recessive 5 - MIM#611091; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4621 | NRXN1 | Krithika Murali reviewed gene: NRXN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25486015, 19896112, 21964664, 30873608, 35101781, 22337556, 22670139; Phenotypes: Pitt-Hopkins-like syndrome 2 - MIM#614325; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4619 | SMARCE1 | Zornitza Stark Mode of inheritance for gene: SMARCE1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4618 | SMARCE1 | Zornitza Stark reviewed gene: SMARCE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22426308, 23906836, 23929686, 32732226, 32436246, 32410215, 34205270; Phenotypes: Coffin-Siris syndrome 5, MIM# 616938; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4618 | SNX14 | Zornitza Stark Phenotypes for gene: SNX14 were changed from to Spinocerebellar ataxia, autosomal recessive 20 (MIM#616354) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4616 | SNX14 | Zornitza Stark Mode of inheritance for gene: SNX14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4615 | SNX14 | Zornitza Stark reviewed gene: SNX14: Rating: GREEN; Mode of pathogenicity: None; Publications: 25439728, 25848753, 27913285; Phenotypes: Spinocerebellar ataxia, autosomal recessive 20 (MIM#616354); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4613 | SMS | Zornitza Stark Mode of inheritance for gene: SMS was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4612 | SMS | Zornitza Stark reviewed gene: SMS: Rating: GREEN; Mode of pathogenicity: None; Publications: 30237987, 34177437, 32838743, 23805436; Phenotypes: Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583, Syndromic X-linked intellectual disability Snyder type, MONDO:0010664; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4612 | GRIN1 | Zornitza Stark Phenotypes for gene: GRIN1 were changed from Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 to Developmental and epileptic encephalopathy 101 , MIM#619814; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4610 | GRIN1 | Zornitza Stark edited their review of gene: GRIN1: Changed publications: 29365063, 27164704, 27164704, 28051072, 34611970; Changed phenotypes: Developmental and epileptic encephalopathy 101 , MIM#619814, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4610 | TBL1XR1 | Zornitza Stark Phenotypes for gene: TBL1XR1 were changed from to Mental retardation, autosomal dominant 41, MIM# 616944; Pierpont syndrome, MIM# 602342 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4608 | TBL1XR1 | Zornitza Stark Mode of inheritance for gene: TBL1XR1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4607 | TBL1XR1 | Zornitza Stark reviewed gene: TBL1XR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26769062, 30365874, 25425123, 9450851, 23160955, 28687524, 23176139, 16007632; Phenotypes: Mental retardation, autosomal dominant 41, MIM# 616944, Pierpont syndrome, MIM# 602342; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4605 | TBCK | Zornitza Stark Mode of inheritance for gene: TBCK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4604 | TBCK | Zornitza Stark reviewed gene: TBCK: Rating: GREEN; Mode of pathogenicity: None; Publications: 27040692, 30103036, 27040691; Phenotypes: Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, MIM# 616900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4602 | TBC1D23 | Zornitza Stark Mode of inheritance for gene: TBC1D23 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4601 | TBC1D23 | Zornitza Stark reviewed gene: TBC1D23: Rating: GREEN; Mode of pathogenicity: None; Publications: 28823707, 28823706; Phenotypes: Pontocerebellar hypoplasia, type 11, MIM# 617695; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4599 | NONO | Zornitza Stark Mode of inheritance for gene: NONO was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4595 | NONO | Krithika Murali reviewed gene: NONO: Rating: GREEN; Mode of pathogenicity: None; Publications: 26571461, 27329731, 27550220; Phenotypes: Intellectual developmental disorder, X-linked syndromic 34 - MIM#300967; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4595 | STAG1 | Zornitza Stark Phenotypes for gene: STAG1 were changed from to Mental retardation, autosomal dominant 47, MIM# 617635 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4593 | STAG1 | Zornitza Stark Mode of inheritance for gene: STAG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4592 | STAG1 | Zornitza Stark reviewed gene: STAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28119487, 34440290; Phenotypes: Mental retardation, autosomal dominant 47, MIM# 617635; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4592 | NLGN3 | Zornitza Stark Mode of inheritance for gene: NLGN3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4587 | NHS | Zornitza Stark Mode of inheritance for gene: NHS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4586 | NFIA | Zornitza Stark Phenotypes for gene: NFIA were changed from to Brain malformations with or without urinary tract defects - MIM#613735 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4584 | NFIA | Zornitza Stark Mode of inheritance for gene: NFIA was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4584 | NFIA | Zornitza Stark Mode of inheritance for gene: NFIA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4581 | STX1B | Zornitza Stark Mode of inheritance for gene: STX1B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4580 | STX1B | Zornitza Stark reviewed gene: STX1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 25362483, 33677401; Phenotypes: Generalized epilepsy with febrile seizures plus, type 9, MIM# 616172; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4580 | NLGN3 | Krithika Murali reviewed gene: NLGN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28584888, 12669065, 25167861; Phenotypes: {Asperger syndrome susceptibility, X-linked 1} - MIM#300494, {Autism susceptibility, X-linked 1} - MIM#300425; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4580 | KCND3 | Elena Savva reviewed gene: KCND3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 35021282, 32823520, 34067185, 34361012; Phenotypes: Spinocerebellar ataxia 19 MIM#607346; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4580 | NHS | Krithika Murali reviewed gene: NHS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31755796, 25266737; Phenotypes: Nance-Horan syndrome - MIM#302350, Cataract 40, X-linked - MIM#302200; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4580 | NFIA | Krithika Murali reviewed gene: NFIA: Rating: GREEN; Mode of pathogenicity: None; Publications: 35018717, 33973697, 32926563; Phenotypes: Brain malformations with or without urinary tract defects - MIM#613735; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4578 | SYNJ1 | Zornitza Stark Mode of inheritance for gene: SYNJ1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4577 | SYNJ1 | Zornitza Stark reviewed gene: SYNJ1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32435303, 27435091; Phenotypes: Developmental and epileptic encephalopathy 53, MIM# 617389; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4576 | SZT2 | Zornitza Stark Mode of inheritance for gene: SZT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4575 | SZT2 | Zornitza Stark reviewed gene: SZT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23932106, 30560016, 30359774, 28556953, 32402703; Phenotypes: Developmental and epileptic encephalopathy 18, OMIM #615476; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4575 | NDST1 | Zornitza Stark Phenotypes for gene: NDST1 were changed from to Mental retardation, autosomal recessive 46 - MIM#616116 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4573 | NDST1 | Zornitza Stark Mode of inheritance for gene: NDST1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4572 | NDST1 | Krithika Murali reviewed gene: NDST1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25125150, 21937992, 32878022, 28211985; Phenotypes: Mental retardation, autosomal recessive 46 - MIM#616116; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4571 | ITCH | Zornitza Stark edited their review of gene: ITCH: Added comment: Unrelated individual reported in PMID 31091003 had normal intellect.; Changed publications: 20170897, 31091003 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4569 | ITPA | Zornitza Stark Mode of inheritance for gene: ITPA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4568 | ITPA | Zornitza Stark reviewed gene: ITPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 26224535, 19498443, 35234647, 35098521; Phenotypes: Developmental and epileptic encephalopathy 35, MIM# 616647; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4568 | C12orf57 | Ain Roesley Mode of inheritance for gene: C12orf57 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4567 | C12orf4 | Ain Roesley Phenotypes for gene: C12orf4 were changed from to Intellectual developmental disorder, autosomal recessive 66 MIM#618221 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4564 | C12orf4 | Ain Roesley Mode of inheritance for gene: C12orf4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4563 | C12orf4 | Ain Roesley reviewed gene: C12orf4: Rating: GREEN; Mode of pathogenicity: None; Publications: 34967075, 31334606, 27311568, 25558065, 28097321; Phenotypes: Intellectual developmental disorder, autosomal recessive 66 MIM#618221; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4561 | KCND3 | Zornitza Stark changed review comment from: Progressive neurological condition; ID only reported in some, most however reported as having normal cognition.; to: Progressive neurological condition; ID only reported in some. Recent review of all published patients, PMID 32823520 defined a group with early onset of disease, where DD/ID are the predominant presenting symptoms, with ataxia developing later. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4559 | KCNJ10 | Zornitza Stark Mode of inheritance for gene: KCNJ10 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4558 | KCNJ10 | Zornitza Stark reviewed gene: KCNJ10: Rating: GREEN; Mode of pathogenicity: None; Publications: 19289823, 19420365, 21849804, 11466414; Phenotypes: SESAME syndrome, MIM# 612780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4557 | KCNK3 |
Zornitza Stark gene: KCNK3 was added gene: KCNK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: KCNK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNK3 were set to 33057194 Phenotypes for gene: KCNK3 were set to Neurodevelopmental disorder, MONDO:0700092, KCNK3-related Review for gene: KCNK3 was set to AMBER Added comment: Established pulmonary hypertension gene. PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 8 de novo variants (7 missense, 1 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4550 | ARHGAP35 | Ain Roesley reviewed gene: ARHGAP35: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: neurodevelopmental disorder, ARHGAP35-related MONDO#0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4548 | KIAA1109 | Zornitza Stark Mode of inheritance for gene: KIAA1109 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4547 | KIAA1109 | Zornitza Stark reviewed gene: KIAA1109: Rating: GREEN; Mode of pathogenicity: None; Publications: 29290337, 30906834; Phenotypes: Alkuraya-Kucinskas syndrome, MIM# 617822; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4546 | NAT8L |
Krithika Murali gene: NAT8L was added gene: NAT8L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAT8L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAT8L were set to 11310630; 19807691; 32275776 Phenotypes for gene: NAT8L were set to ?N-acetylaspartate deficiency - MIM#614063 Review for gene: NAT8L was set to AMBER Added comment: Absence of brain N-acetylaspartate, has been described in only one patient, with truncal ataxia, marked developmental delay, seizures and secondary microcephaly (first described by - PMID: 11310630 Martin et al 2001). PMID: 19807691 - Wiame et al 2009 identified in this patient a homozygous 19 bp NAT8L gene deletion, resulting in a change in reading frame and the absence of production of a functional protein. The affected individual is adopted and testing of the biological parents was not possible. The authors provide supportive functional studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4544 | NANS | Zornitza Stark Mode of inheritance for gene: NANS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4541 | NACC1 | Zornitza Stark Mode of inheritance for gene: NACC1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4540 | NACC1 | Zornitza Stark reviewed gene: NACC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28132692; Phenotypes: Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination - MIM#617393; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4540 | NAA15 | Zornitza Stark Phenotypes for gene: NAA15 were changed from to Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4538 | NAA15 | Zornitza Stark Mode of inheritance for gene: NAA15 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4537 | NAA15 | Zornitza Stark reviewed gene: NAA15: Rating: GREEN; Mode of pathogenicity: None; Publications: 33103328, 29656860, 31127942, 28191889, 33557580, 28990276; Phenotypes: Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4537 | NANS | Krithika Murali reviewed gene: NANS: Rating: GREEN; Mode of pathogenicity: None; Publications: 8152878, 15726110, 8723082, 27213289, 7551156; Phenotypes: Spondyloepimetaphyseal dysplasia, Camera-Genevieve type - MIM#610442; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4533 | MAN2C1 | Zornitza Stark reviewed gene: MAN2C1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of deglycosylation 2, MIM# 619775; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4533 | NFE2L1 |
Zornitza Stark gene: NFE2L1 was added gene: NFE2L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NFE2L1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NFE2L1 were set to 35112409 Phenotypes for gene: NFE2L1 were set to Syndromic disease, MONDO:0002254 Review for gene: NFE2L1 was set to RED Added comment: A single patient with developmental delay, hypotonia, hypospadias, bifid scrotum, and failure to thrive, with a heterozygous nonsense variant in the last exon. In vitro functional assays suggest a dominant-negative effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4530 | QDPR | Zornitza Stark Mode of inheritance for gene: QDPR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4529 | QDPR | Zornitza Stark reviewed gene: QDPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 11153907; Phenotypes: Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4524 | HIST1H4D |
Paul De Fazio changed review comment from: Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD). A zebrafish model has developmental defects. Sources: Literature; to: HGNC recognised gene name: H4C4 Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD). A zebrafish model has developmental defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4520 | CPSF3 |
Belinda Chong gene: CPSF3 was added gene: CPSF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CPSF3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CPSF3 were set to 35121750 Phenotypes for gene: CPSF3 were set to Intellectual disability syndrome Review for gene: CPSF3 was set to GREEN gene: CPSF3 was marked as current diagnostic Added comment: Study of a deficit of observed homozygous carriers of missense variants, versus an expected number in a set of 153,054 chip-genotyped Icelanders, to identify potentially pathogenic genotypes Six homozygous carriers of missense variants in CPSF3 show severe intellectual disability, seizures, microcephaly, and abnormal muscle tone. - Four identified through Icelandic geneology (p.Gly468Glu), three carrier couples total of four children who had died prematurely. Tested archival samples for two of these children, and confirm a homozygous genotype. - Two of Mexican descent (p.Ile354Thr), first-degree cousins Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | HIST1H4E |
Paul De Fazio gene: HIST1H4E was added gene: HIST1H4E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HIST1H4E was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HIST1H4E were set to 35202563 Phenotypes for gene: HIST1H4E were set to Neurodevelopmental disorder, HIST1H4E-related MONDO:0700092 Review for gene: HIST1H4E was set to GREEN gene: HIST1H4E was marked as current diagnostic Added comment: 17 patients identified with de novo missense variants affecting Lys31, Pro32, Arg35, Leu37, Arg40 (recurrent), Arg45 (recurrent), Tyr98 (recurrent). All individuals had ID/dev delay. Additional phenotypes in some but not all individuals included epilepsy, hypotonia, facial dysmorphism. Most had reduced birth length, OFC, weight (-1 to -3SD). A zebrafish model has developmental defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | NRCAM |
Ee Ming Wong gene: NRCAM was added gene: NRCAM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NRCAM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NRCAM were set to PMID: 35108495 Phenotypes for gene: NRCAM were set to neurodevelopmental disorder, MONDO:0700092 Penetrance for gene: NRCAM were set to unknown Review for gene: NRCAM was set to GREEN gene: NRCAM was marked as current diagnostic Added comment: -Ten individuals from 8 families with developmental delay/intellectual disability, hypotonia, peripheral neuropathy, and/or spasticity - Affected individuals are biallelic for missense and/or LoF variants which are mainly in the fibronectin type III (Fn-III) domain - Zebrafish mutants lacking the third Fn-III domain displayed significantly altered swimming behavior compared to wild-type larvae (p < 0.03) and a trend toward increased amounts of alpha-tubulin fibers in the dorsal telencephalon, demonstrating an alteration in white matter tracts and projections Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | HIST1H4D |
Paul De Fazio gene: HIST1H4D was added gene: HIST1H4D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HIST1H4D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HIST1H4D were set to 35202563 Phenotypes for gene: HIST1H4D were set to Neurodevelopmental disorder, HIST1H4D-related MONDO:0700092 Review for gene: HIST1H4D was set to AMBER gene: HIST1H4D was marked as current diagnostic Added comment: Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD). A zebrafish model has developmental defects. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | CRLS1 |
Michelle Torres gene: CRLS1 was added gene: CRLS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CRLS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRLS1 were set to 35147173 Phenotypes for gene: CRLS1 were set to Mitochondrial disease MONDO:0044970 CRLS1-related Added comment: - Three families (4 individuals) with cardiolipin deficiency. - Two families (one consanguineous with 2 affected siblings) with homozygous the p.(Ile109Asn) had infantile progressive encephalopathy, bull’s eye maculopathy, auditory neuropathy, diabetes insipidus, autonomic instability, cardiac defects and early death. - The fourth individual cHet p.(Ala172Asp) and p.(Leu217Phe) presented with chronic encephalopathy with neurodevelopmental regression, congenital nystagmus with decreased vision, sensorineural hearing loss, failure to thrive and acquired microcephaly. - Functional studies on patient cells showed increased levels of the substrate of CRLS1 and impaired mitochondrial morphology and biogenesis Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | ZBTB7A |
Daniel Flanagan gene: ZBTB7A was added gene: ZBTB7A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ZBTB7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZBTB7A were set to 34515416; 31645653 Phenotypes for gene: ZBTB7A were set to Macrocephaly, neurodevelopmental delay, lymphoid hyperplasia, and persistent fetal hemoglobin (MIM#619769) Review for gene: ZBTB7A was set to GREEN Added comment: PMID: 34515416. Monoallelic ZBTB7A variants identified in 12 individuals from 11 families, with macrocephaly (11/12), some degree of ID (12/12), autistic features (7/12) and hypertrophy of pharyngeal lymphoid tissue (12/12). Variants included LoF variants and missense, 8 variants were de novo. PMID: 31645653. De novo ZBTB7A missense identified in a boy with macrocephaly, intellectual disability, and sleep apnea. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4519 | HIST1H4C | Paul De Fazio reviewed gene: HIST1H4C: Rating: GREEN; Mode of pathogenicity: None; Publications: 35202563; Phenotypes: Tessadori-van Haaften neurodevelopmental syndrome 1 MIM#619758, Neurodevelopmental disorder, HIST1H4C-related MONDO:0700092; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4517 | ZBTB11 | Chern Lim reviewed gene: ZBTB11: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:35104841; Phenotypes: Intellectual developmental disorder, autosomal recessive 69 (MIM#618383), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4517 | HIST1H4F |
Elena Savva gene: HIST1H4F was added gene: HIST1H4F was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HIST1H4F was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HIST1H4F were set to PMID: 35202563 Phenotypes for gene: HIST1H4F were set to Neurodevelopmental disorders Review for gene: HIST1H4F was set to GREEN Added comment: PMID: 35202563 - single de novo missense in a patient with neurodevelopmental features of intellectual disability and motor and/or gross developmental delay. - zebrafish studies show a significant increase in all of mild dev delay, necrosis, defective organogenesis and pre-gastrulation failure Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4515 | HIST1H4I |
Elena Savva gene: HIST1H4I was added gene: HIST1H4I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HIST1H4I was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HIST1H4I were set to PMID: 35202563 Phenotypes for gene: HIST1H4I were set to Neurodevelopmental syndrome Review for gene: HIST1H4I was set to GREEN Added comment: PMID: 35202563 - 3 unrelated de novo patients, p.His75Arg was recurring and observed in 2/3 probands. - Zebrafish study shows both variants resulted in a significant increases in developmental issues such as in mild dev delay, necrosis and defective organogenesis. - All patients had intellectual disability and motor and/or gross developmental delay and dysmorphisms. - 2/3 patients showed bilateral conductive hearing loss Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4512 | ATP6V0A1 | Zornitza Stark Mode of inheritance for gene: ATP6V0A1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4511 | TIAM1 |
Alison Yeung gene: TIAM1 was added gene: TIAM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TIAM1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TIAM1 were set to Neurodevelopmental disorder, TIAM1-related, MONDO:0700092 Review for gene: TIAM1 was set to GREEN Added comment: Reported in 4 unrelated individuals. Phenotype of developmental delay/intellectual disability and seizures. Loss of ortholog in Drosophila reduces the survival rate, and the surviving adults exhibit climbing defects, are prone to severe seizures, and have a short lifespan. Functional studies in 3 variants from two probands showed loss of function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4510 | ATP6V0A1 | Chern Lim reviewed gene: ATP6V0A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:34909687; Phenotypes: Early-onset progressive myoclonus epilepsy with ataxia, AR, severe developmental and epileptic encephalopathy, AD.; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4510 | HIST1H4J | Elena Savva reviewed gene: HIST1H4J: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 35202563, 31804630; Phenotypes: Neurodevelopmental syndrome, microcephaly, intellectual disability, dysmorphic features; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4509 | CHKA | Zornitza Stark Phenotypes for gene: CHKA were changed from Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature to Neurodevelopmental disorder, MONDO:0700092; Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4507 | CHKA |
Konstantinos Varvagiannis gene: CHKA was added gene: CHKA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHKA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHKA were set to 35202461 Phenotypes for gene: CHKA were set to Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature Penetrance for gene: CHKA were set to Complete Review for gene: CHKA was set to GREEN Added comment: Klöckner (2022 - PMID: 35202461) describe the phenotype of 6 individuals (from 5 unrelated families) harboring biallelic CHKA variants. Shared features incl. abnormal muscle tone(6/6 - hypertonia or hypotonia, 3/6 each), DD/ID (6/6,severe in 4, severe/profound in 2), epilepsy (6/6 - onset: infancy - 3y2m | epileptic spasms or GS at onset), microcephaly (6/6), movement disorders (3/6 - incl. dyskinesia, rigidity, choreoatetotic movements). 2/5 individuals exhibited MRI abnormalities, notably hypomyelination. Short stature was observed in 4/6. Eventual previous genetic testing was not discussed. Exome sequencing (quattro ES for 2 sibs, trio ES for 1 individual, singleton for 3 probands) revealed biallelic CHKA variants in all affected individuals. Sanger sequencing was performed for confirmation and segregation studies. Other variants (in suppl.) were not deemed to be causative for the neurodevelopmental phenotype. 3 different missense, 1 start-loss and 1 truncating variant were identified, namely (NM_0012772.2): - c.421C>T/p.(Arg141Trp) [3 hmz subjects from 2 consanguineous families], - c.580C>T/p.Pro194Ser [1 hmz individual born to consanguineous parents], - c.2T>C/p.(Met1?) [1 hmz individual born to related parents], - c.14dup/p.(Cys6Leufs*19) in trans with c.1021T>C/p.(Phe341Leu) in 1 individual. CHKA encodes choline kinase alpha, an enzyme catalyzing the first step of phospholipid synthesis in the Kennedy pathway. The pathway is involved in de novo synthesis of glycerophospholipids, phosphatidylcholine and phosphatidylethanolamine being the most abundant in eukaryotic membranes. CHKA with its paralog (CHKB) phosphorylates either choline or ethanolamine to phosphocholine or phosphoethanolamine respectively with conversion of ATP to ADP. As the authors comment, biallelic pathogenic variants in CHKB cause a NDD with muscular dystrophy, hypotonia, ID, microcephaly and structural mitochondrial anomalies (MIM 602541). [Prominent mitochondrial patterning was observed in a single muscle biopsy available from an individual with biallelic CHKA variants]. Other disorders of the Kennedy pathway (due to biallelic PCYT2, SELENOI, PCYT1A variants) present with overlapping features incl. variable DD/ID (no-severe), microcephaly, seizures, visual impairment etc. CHKA variants were either absent or observed once in gnomAD, affected highly conserved AAs with multiple in silico predictions in favor of a deleterious effect. In silico modeling suggests structural effects for several of the missense variants (Arg141Trp, Pro194Ser presumably affect ADP binding, Phe341 lying close to the binding site of phosphocholine). Each of the missense variants was expressed in yeast cells and W. Blot suggested expression at the expected molecular weight at comparative levels. The 3 aforementioned variants exhibited reduced catalytic activity (20%, 15%, 50% respectively). NMD is thought to underly the deleterious effect of the frameshift one (not studied). The start-loss variant is expected to result in significantly impaired expression and protein function as eventual utilization of the next possible start codon - occurring at position 123 - would remove 26% of the protein. Chka(-/-) is embryonically lethal in mice, suggesting that complete loss is not compatible with life. Reduction of choline kinase activity by 30% in heterozygous mice did not appear to result in behavioral abnormalities although this was not studied in detail (PMID cited: 18029352). Finally, screening of 1566 mouse lines identified 198 genes whose disruption yields neuroanatomical phenotypes, Chka(+/-) mice being among these (PMID cited: 31371714). There is no associated phenotype in OMIM, Gene2Phenotype or SysID. Overall this gene can be considered for inclusion in the ID and epilepsy panes with green or amber rating (>3 individuals, >3 variants, variant studies, overlapping phenotype of disorders belonging to the same pathway, etc). Consider also inclusion in the microcephaly panel (where available this seemed to be of postnatal onset). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4504 | THOC6 | Zornitza Stark Mode of inheritance for gene: THOC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4503 | THOC6 | Zornitza Stark reviewed gene: THOC6: Rating: GREEN; Mode of pathogenicity: None; Publications: 23621916, 26739162, 27102954, 30238602, 30476144; Phenotypes: Beaulieu-Boycott-Innes syndrome, MIM# 613680; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4501 | SYP | Zornitza Stark Mode of inheritance for gene: SYP was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4500 | SYP | Zornitza Stark reviewed gene: SYP: Rating: GREEN; Mode of pathogenicity: None; Publications: 23966691, 19377476; Phenotypes: Mental retardation, X-linked 96 MIM#300802; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4500 | SPRED2 | Zornitza Stark Phenotypes for gene: SPRED2 were changed from Rasopathy; developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt to Noonan syndrome 14, MIM# 619745 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4499 | SPRED2 | Zornitza Stark reviewed gene: SPRED2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Noonan syndrome 14, MIM# 619745; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4498 | ABHD16A | Zornitza Stark Phenotypes for gene: ABHD16A were changed from Spastic paraplegia; Intellectual Disability; Callosome to Spastic paraplegia 86, autosomal recessive, MIM# 619735; Intellectual Disability; Corpus callosum abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4497 | ABHD16A | Zornitza Stark edited their review of gene: ABHD16A: Changed phenotypes: Spastic paraplegia 86, autosomal recessive, MIM# 619735, Intellectual Disability, Corpus callosum abnormalities; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4497 | THUMPD1 | Zornitza Stark Phenotypes for gene: THUMPD1 were changed from Syndromic form of intellectual disability associated with developmental delay, behavioral abnormalities, hearing loss and facial dysmorphism, AR to Syndromic disease, MONDO:0002254, THUMPD1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4495 | THUMPD1 |
Chern Lim changed review comment from: Broly, M. et al. (2022), AJHG: - 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other; to: Broly, M. et al. (2022), AJHG: - 13 individuals from 8 families, biallelic loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4495 | THUMPD1 |
Chern Lim changed review comment from: Broly, M. et al. (2022) manuscript accepted in AJHG: - 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other; to: Broly, M. et al. (2022), AJHG: - 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4495 | THUMPD1 |
Chern Lim gene: THUMPD1 was added gene: THUMPD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: THUMPD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: THUMPD1 were set to Syndromic form of intellectual disability associated with developmental delay, behavioral abnormalities, hearing loss and facial dysmorphism, AR gene: THUMPD1 was marked as current diagnostic Added comment: Broly, M. et al. (2022) manuscript accepted in AJHG: - 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del). - Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4494 | PAX5 |
Bryony Thompson gene: PAX5 was added gene: PAX5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PAX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PAX5 were set to 35094443; 31452935; 28263302; 25418537; 8001127; 27626380 Phenotypes for gene: PAX5 were set to neurodevelopmental disorder MONDO:0700092 Review for gene: PAX5 was set to GREEN Added comment: 5 individuals from 4 families with large deletions involving PAX5 and 11 individuals from 9 families with frameshift/stopgain/missense variants and neurodevelopmental phenotypes that included delayed developmental milestones (DD), intellectual disability (ID), and/or ASD. 6 of the variants are de novo. Null mouse have retarded growth and altered patterning of the posterior midbrain. Pax5+/− mice of both sexes are hyperactive and have abnormal auditory brainstem responses. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4490 | EEF1B2 | Bryony Thompson reviewed gene: EEF1B2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31845318, 21937992, 35015920; Phenotypes: neurodevelopmental disorder MONDO:0700092, non-syndromic ID and seizures; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4486 | ATP5E |
Ain Roesley gene: ATP5E was added gene: ATP5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP5E was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATP5E were set to 34954817; 20566710; 27626380; 20026007 Phenotypes for gene: ATP5E were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 3 MIM#614053 Penetrance for gene: ATP5E were set to Complete Review for gene: ATP5E was set to AMBER gene: ATP5E was marked as current diagnostic Added comment: 3 unrelated with the same Tyr12Cys avriant 3/3 with dev delay. 2/3 with ID (the other NA) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4485 | BAP1 |
Anna Ritchie gene: BAP1 was added gene: BAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BAP1 were set to PMID: 35051358 Phenotypes for gene: BAP1 were set to syndromic intellectual disability MONDO:0000508 Penetrance for gene: BAP1 were set to unknown Review for gene: BAP1 was set to GREEN Added comment: 11 de novo germline heterozygous missense BAP1 variants associated with a rare syndromic neurodevelopmental disorder. Functional analysis showed that most of the variants cannot rescue the consequences of BAP1 inactivation, suggesting a loss-of-function mechanism. All affected individuals harboring a de novo BAP1 variant had DD or ID (11/11) characterized notably by speech (11/ 11) and motor delay (6/11). Most of them had hypotonia (7/11), seizures (6/11), and abnormal behavior (8/10), including autism spectrum disorder, attention deficit hyperactivity disorder, and hypersensitivity. Almost all individuals showed dysmorphic facial features (10/11), and more than half (6/11) had skeletal malformations (involving the hands [4/11], feet [3/11], or spine [2/11]). Most of the individuals had growth failure (9/11), including four individuals with a very short stature. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4484 | SOD1 |
Naomi Baker gene: SOD1 was added gene: SOD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SOD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SOD1 were set to PMID: 31314961; 31332433; 34788402 Phenotypes for gene: SOD1 were set to Spastic tetraplegia and axial hypotonia, progressive, MIM#618598 Review for gene: SOD1 was set to GREEN Added comment: Phenotypes include one individual with axial hypotonia and loss of gross and fine motor function beginning at 6 months of age, after which severe, progressive spastic tetraparesis developed and Babinski’s sign was present in both feet. MRI of brain detected mild frontoparietal atrophy. The second individual had severe and marked by progressive loss of motor abilities from 9 months of age, tetraspasticity with predominance in the lower extremities, mild cerebellar atrophy, and hyperekplexia-like symptoms. Dysmorphic features such as low set, posteriorly rotated ears, and overlapping toes The third individual is an infant with severe global developmental delay, axial hypotonia and limb spasticity. No dysmorphic facial features were noted, but she had a high arched palate, bilateral 5th finger clinodactyly, partial toe syndactyly of the second and third toes, and a single hyperpigmented macule tongue fasciculations, axial hypotonia with limb spasticity (more pronounced in the lower limbs), ankle clonus, and brisk patellar deep tendon reflexes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4484 | ITSN1 |
Ee Ming Wong gene: ITSN1 was added gene: ITSN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ITSN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ITSN1 were set to PMID: 34707297 Phenotypes for gene: ITSN1 were set to neurodevelopmental disorder MONDO:0700092 ITSN1-related Penetrance for gene: ITSN1 were set to unknown gene: ITSN1 was marked as current diagnostic Added comment: -10 individuals from eight unrelated with neurodevelopmental disorder spectrum including ASD, ID, major behavioral difficulties and/or verbal impairment. -variants included heterozygous premature truncating and missense variants -Majority of variants were de novo; in two patients the reported variant was inherited from paucisymptomatic father Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4482 | MAN2C1 |
Michelle Torres gene: MAN2C1 was added gene: MAN2C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAN2C1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAN2C1 were set to 35045343 Phenotypes for gene: MAN2C1 were set to neurodevelopmental disorder MONDO:0700092 MAN2C1-related Review for gene: MAN2C1 was set to GREEN Added comment: Six individuals from four different families, including two fetuses, exhibiting dysmorphic facial features, congenital anomalies such as tongue hamartoma, variable degrees of intellectual disability, and brain anomalies including polymicrogyria, interhemispheric cysts, hypothalamic hamartoma, callosal anomalies, and hypoplasia of brainstem and cerebellar vermis. Variants include PTC and missense. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4482 | RBL2 | Elena Savva reviewed gene: RBL2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33980986, 32105419, 9806916; Phenotypes: Severe motor and cognitive impairment, Intellectual disability, Brunet-Wagner neurodevelopmental syndrome MIM#619690; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4482 | SLC38A3 |
Ain Roesley gene: SLC38A3 was added gene: SLC38A3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC38A3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC38A3 were set to 34605855 Phenotypes for gene: SLC38A3 were set to developmental epileptic encephalopathy, SLC38A3-related MONDO:0100062 Penetrance for gene: SLC38A3 were set to Complete Review for gene: SLC38A3 was set to GREEN gene: SLC38A3 was marked as current diagnostic Added comment: 7 families 6 of whom are consanguineous but unique variants in all of them 10/10 with GDD/ID Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4481 | FRA10AC1 |
Zornitza Stark gene: FRA10AC1 was added gene: FRA10AC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FRA10AC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FRA10AC1 were set to 34694367 Phenotypes for gene: FRA10AC1 were set to Neurodevelopmental disorder, MONDO:0700092, FRA10AC1-related Review for gene: FRA10AC1 was set to GREEN Added comment: PMID 34694367: 5 individuals from 3 unrelated families reported. Variable ID, possibly related to variant type with LoF variants associated with more severe ID. All individuals had microcephaly, hypoplasia or agenesis of the corpus callosum, growth retardation, and craniofacial dysmorphism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4480 | PLAA | Zornitza Stark Phenotypes for gene: PLAA were changed from to Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4478 | PLAA | Zornitza Stark Mode of inheritance for gene: PLAA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4477 | PLAA | Zornitza Stark reviewed gene: PLAA: Rating: GREEN; Mode of pathogenicity: None; Publications: 28007986, 28413018, 31322726; Phenotypes: Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4477 | PGAP1 | Zornitza Stark Phenotypes for gene: PGAP1 were changed from to Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4475 | PGAP1 | Zornitza Stark Mode of inheritance for gene: PGAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4474 | PGAP1 | Zornitza Stark reviewed gene: PGAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24784135, 25823418, 25804403, 26050939; Phenotypes: Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4474 | KCNN2 | Zornitza Stark Phenotypes for gene: KCNN2 were changed from Neurodevelopmental movement disorders; Developmental Delay; Seizures to Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4473 | KCNN2 | Zornitza Stark Mode of inheritance for gene: KCNN2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4472 | KCNN2 | Zornitza Stark reviewed gene: KCNN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4472 | NAA20 | Zornitza Stark Phenotypes for gene: NAA20 were changed from Autosomal recessive developmental delay, intellectual disability, and microcephaly to Intellectual developmental disorder, autosomal recessive 73, MIM# 619717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4471 | NAA20 | Zornitza Stark edited their review of gene: NAA20: Changed phenotypes: Intellectual developmental disorder, autosomal recessive 73, MIM# 619717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4470 | SHANK1 | Zornitza Stark reviewed gene: SHANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, SHANK1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4469 | ABCC9 | Zornitza Stark Mode of inheritance for gene: ABCC9 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4468 | ABCC9 | Zornitza Stark reviewed gene: ABCC9: Rating: GREEN; Mode of pathogenicity: None; Publications: 31575858, 22610116, 22608503; Phenotypes: Intellectual disability and myopathy syndrome, MIM# 619719, Hypertrichotic osteochondrodysplasia, MIM# 239850 Cantu syndrome; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4467 | CAMK2G | Zornitza Stark Phenotypes for gene: CAMK2G were changed from Intellectual disability to Mental retardation, autosomal dominant 59, MIM# 618522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4465 | CAMK2G |
Zornitza Stark gene: CAMK2G was added gene: CAMK2G was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CAMK2G was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CAMK2G were set to 30184290 Phenotypes for gene: CAMK2G were set to Intellectual disability Mode of pathogenicity for gene: CAMK2G was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: CAMK2G was set to AMBER Added comment: Two unrelated individuals reported with de novo (p.Arg292Pro) variant. Functional data suggests GoF. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4462 | CSNK2B | Zornitza Stark Mode of inheritance for gene: CSNK2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4461 | CSNK2B | Zornitza Stark reviewed gene: CSNK2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28585349, 28762608; Phenotypes: Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4459 | GDI1 | Zornitza Stark Mode of inheritance for gene: GDI1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4458 | GDI1 | Zornitza Stark reviewed gene: GDI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28863211, 22002931, 9620768, 9668174; Phenotypes: Intellectual developmental disorder, X-linked 41 MIM#300849; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4458 | STT3A | Zornitza Stark Phenotypes for gene: STT3A were changed from Congenital disorder of glycosylation, type Iw; OMIM #615596 to Congenital disorder of glycosylation, type Iw, AR, OMIM #615596; Congenital disorder of glycosylation, type Iw, autosomal dominant, MIM# 619714 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4457 | FMN2 | Zornitza Stark Phenotypes for gene: FMN2 were changed from to Intellectual developmental disorder, autosomal recessive 47, MIM#616193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4455 | FMN2 | Zornitza Stark Mode of inheritance for gene: FMN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4454 | FMN2 | Zornitza Stark reviewed gene: FMN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480035, 32162566, 24161494; Phenotypes: Intellectual developmental disorder, autosomal recessive 47, MIM#616193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4452 | MDH2 | Zornitza Stark Mode of inheritance for gene: MDH2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4451 | MDH2 | Zornitza Stark reviewed gene: MDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27989324, 34766628; Phenotypes: Developmental and epileptic encephalopathy 51 MIM#617339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4449 | SIN3A | Zornitza Stark Mode of inheritance for gene: SIN3A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4448 | SIN3A | Zornitza Stark Mode of inheritance for gene: SIN3A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4445 | SOX11 | Zornitza Stark Mode of inheritance for gene: SOX11 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4444 | OTUD6B | Zornitza Stark Phenotypes for gene: OTUD6B were changed from to Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, OMIM #617452 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4442 | OTUD6B | Zornitza Stark Mode of inheritance for gene: OTUD6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4441 | LMBRD2 | Zornitza Stark Phenotypes for gene: LMBRD2 were changed from Global developmental delay; Intellectual disability; Microcephaly; Seizures; Abnormality of nervous system morphology; Abnormality of the eye to Developmental delay with variable neurologic and brain abnormalities, MIM# 619694; Global developmental delay; Intellectual disability; Microcephaly; Seizures; Abnormality of nervous system morphology; Abnormality of the eye | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4440 | LMBRD2 | Zornitza Stark edited their review of gene: LMBRD2: Changed phenotypes: Developmental delay with variable neurologic and brain abnormalities, MIM# 619694, Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4439 | OGDHL | Zornitza Stark reviewed gene: OGDHL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Yoon-Bellen neurodevelopmental syndrome, MIM# 619701; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4438 | ANAPC7 |
Zornitza Stark gene: ANAPC7 was added gene: ANAPC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ANAPC7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ANAPC7 were set to 34942119 Phenotypes for gene: ANAPC7 were set to Ferguson-Bonni neurodevelopmental syndrome, MIM# 619699 Review for gene: ANAPC7 was set to AMBER Added comment: 11 individuals of Amish heritage reported homozygous for an intragenic deletion. Clinical features included ID, hypotonia, deafness in 5, relatively small head size (but microcephaly only in 1), and occasional congenital anomalies. Supportive mouse model. Amber rating in light of this being a founder variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4435 | SIN3A | chirag patel changed review comment from: 9 patients from 5 unrelated families reported with heterozygous truncating mutations in the SIN3A gene. Features include intellectual disability, ASD, seizures, dysmorphism, short stature, microcephaly, joint hypermotility, and small hands and feet. Brain imaging showed dilated ventricles, thin corpus callosum and, in some cases, dysgyria or polymicrogyria. Suitable for fetal anomalies panel.; to: 9 patients from 5 unrelated families reported with heterozygous truncating mutations in the SIN3A gene. Features include intellectual disability, ASD, seizures, dysmorphism, short stature, microcephaly, joint hypermotility, and small hands and feet. Brain imaging showed dilated ventricles, thin corpus callosum and, in some cases, dysgyria or polymicrogyria. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4435 | SIN3A | chirag patel reviewed gene: SIN3A: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 27399968; Phenotypes: Witteveen-Kolk syndrome, OMIM # 613406; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4435 | SOX11 | chirag patel reviewed gene: SOX11: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 24886874, 33785884, 33430815, 33086258, 31530938; Phenotypes: Coffin-Siris syndrome 9, OMIM # 615866; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4435 | OTUD6B | chirag patel reviewed gene: OTUD6B: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 28343629, 32924626, 31147255; Phenotypes: Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, OMIM #617452; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4435 | RNF220 | Zornitza Stark Phenotypes for gene: RNF220 were changed from Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum to Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688; Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4434 | RNF220 | Zornitza Stark reviewed gene: RNF220: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688, Leukodystrophy, CNS hypomyelination, Ataxia, Intellectual disability, Sensorineural hearing impairment, Elevated hepatic transaminases, Hepatic fibrosis, Dilated cardiomyopathy, Spastic paraplegia, Dysarthria, Abnormality of the corpus callosum; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4430 | HNRNPH2 | Zornitza Stark Mode of inheritance for gene: HNRNPH2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4429 | HNRNPH2 | Zornitza Stark reviewed gene: HNRNPH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34907471, 33728377, 31670473, 31236915, 30887513; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, Bain type MIM#300986; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4429 | TCTN1 |
Ain Roesley gene: TCTN1 was added gene: TCTN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TCTN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TCTN1 were set to 31302911; 28631893; 21725307; 26477546; 34980503 Phenotypes for gene: TCTN1 were set to Joubert syndrome 13, MIM# 614173; MONDO:0013608 Penetrance for gene: TCTN1 were set to Complete Review for gene: TCTN1 was set to GREEN gene: TCTN1 was marked as current diagnostic Added comment: Rare cause of JBS, at least 6 families reported, mouse model. ID/developmental delay described in at least 3 of them Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4429 | PRKAR1B | Zornitza Stark Phenotypes for gene: PRKAR1B were changed from Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Aggressive behavior; Abnormality of movement; Upslanted palpebral fissure to Marbach-Schaaf neurodevelopmental syndrome MIM#619680; Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Aggressive behavior; Abnormality of movement; Upslanted palpebral fissure | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4427 | PRKAR1B | Zornitza Stark Mode of inheritance for gene: PRKAR1B was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4424 | NAA10 | Zornitza Stark Mode of inheritance for gene: NAA10 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4423 | NAA10 | Zornitza Stark reviewed gene: NAA10: Rating: GREEN; Mode of pathogenicity: None; Publications: 30842225, 34075687, 21700266; Phenotypes: Microphthalmia, syndromic 1, MIM# 309800, Ogden syndrome MIM#300855; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4423 | SLC35F1 |
Zornitza Stark gene: SLC35F1 was added gene: SLC35F1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC35F1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SLC35F1 were set to 33821533 Phenotypes for gene: SLC35F1 were set to Neruodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome Review for gene: SLC35F1 was set to RED Added comment: WES found a de novo heterozygous c.1037T>C; p.(I346T) (absent in gnomad v2 and v3) in a female described to have Rett-like syndrome. Global developmental delay, generalized tonic andtonic–clonic seizure, never acquired independent walking and developed spastictetraplegia in adulthood and limited speech No functional data Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4422 | VPS50 | Zornitza Stark Phenotypes for gene: VPS50 were changed from Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum to Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis , MIM#619685; Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4421 | VPS50 | Zornitza Stark reviewed gene: VPS50: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis , MIM#619685; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4420 | CCND2 |
Alison Yeung Added comment: Comment on phenotypes: Distal variants associated with Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 Proximal variants associated with reciprocal phenotype of mild neurodevelopment disorder with microcephaly and short stature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4419 | CCND2 | Alison Yeung Mode of inheritance for gene: CCND2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4418 | PRKAR1B | Paul De Fazio reviewed gene: PRKAR1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33833410; Phenotypes: Marbach-Schaaf neurodevelopmental syndrome MIM#619680; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4418 | NAA10 | Ain Roesley reviewed gene: NAA10: Rating: GREEN; Mode of pathogenicity: None; Publications: 34075687; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4418 | PRKAR1B | Paul De Fazio reviewed gene: PRKAR1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 33833410; Phenotypes: Marbach-Schaaf neurodevelopmental syndrome MIM#619680; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4416 | PRDM13 |
Seb Lunke gene: PRDM13 was added gene: PRDM13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature founder tags were added to gene: PRDM13. Mode of inheritance for gene: PRDM13 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PRDM13 were set to 34730112 Phenotypes for gene: PRDM13 were set to intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia Review for gene: PRDM13 was set to AMBER Added comment: Recessive disease causing ID and DSD described in three supposedly unrelated families (2 consanguine), but all are from Malta, and all share the same 13bp deletion spanning an exon-intron boundary. Mouse KO is embryonically lethal, and tissue specific KO failed to replicate many of the patients phenotypes, other than hypoplasia of the cerebellar vermis and hemispheres at P21. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4415 | NAA20 | Zornitza Stark reviewed gene: NAA20: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Autosomal recessive developmental delay, intellectual disability, and microcephaly; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4413 | RAB23 | Zornitza Stark Mode of inheritance for gene: RAB23 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4412 | RAB23 | Zornitza Stark reviewed gene: RAB23: Rating: GREEN; Mode of pathogenicity: None; Publications: 17503333, 21412941, 23599695, 25168863; Phenotypes: Carpenter syndrome (MIM#201000); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4410 | DPF2 | Zornitza Stark Mode of inheritance for gene: DPF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4408 | NAA20 |
chirag patel gene: NAA20 was added gene: NAA20 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NAA20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAA20 were set to PMID: 34230638 Phenotypes for gene: NAA20 were set to Autosomal recessive developmental delay, intellectual disability, and microcephaly Added comment: 2 consanguineous families with 5 affected individuals with developmental delay, intellectual disability, and microcephaly (-2-4SD). Exome and genome sequencing identified 2 different homozygous variants in NAA20 gene (p.Met54Val and p.Ala80Val), and segregated with affected individuals. N-terminal acetyltransferases modify proteins by adding an acetyl moiety to the first amino acid and are vital for protein and cell function. The NatB complex acetylates 20% of the human proteome and is composed of the catalytic subunit NAA20 and the auxiliary subunit NAA25. Both NAA20-M54V and NAA20-A80V were impaired in their capacity to form a NatB complex with NAA25, and in vitro acetylation assays revealed reduced catalytic activities toward different NatB substrates. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4405 | KCNC1 | Zornitza Stark Mode of inheritance for gene: KCNC1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4404 | KCNC1 | Zornitza Stark reviewed gene: KCNC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28145425, 31353862, 25401298; Phenotypes: Intellectual disability, Movement disorders, Epilepsy, progressive myoclonic 7 (MIM#616187); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4404 | DPF2 | Belinda Chong reviewed gene: DPF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29429572, 31706665; Phenotypes: Coffin-Siris syndrome 7 MIM#618027; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4402 | SGPL1 | Seb Lunke Mode of inheritance for gene: SGPL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4401 | SGPL1 | Seb Lunke reviewed gene: SGPL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33074640; Phenotypes: Sphingosine Phosphate Lyase Insufficiency Syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4401 | COX15 | Zornitza Stark Mode of inheritance for gene: COX15 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4400 | COX15 | Zornitza Stark Mode of inheritance for gene: COX15 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4399 | COX15 | Zornitza Stark reviewed gene: COX15: Rating: GREEN; Mode of pathogenicity: None; Publications: 33746038, 32232962, 26959537, 21412973, 12474143, 15235026; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4397 | BRWD3 | Zornitza Stark Mode of inheritance for gene: BRWD3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4396 | BRWD3 | Zornitza Stark reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: 17668385, 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, MIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4396 | AUTS2 | Zornitza Stark Phenotypes for gene: AUTS2 were changed from Mental retardation, autosomal dominant 26, MIM#615834 to Intellectual developmental disorder, autosomal dominant 26, MIM# 615834 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4395 | AUTS2 | Zornitza Stark edited their review of gene: AUTS2: Changed phenotypes: Intellectual developmental disorder, autosomal dominant 26, MIM# 615834 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4393 | ALDH4A1 | Zornitza Stark Mode of inheritance for gene: ALDH4A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4392 | ALDH4A1 | Zornitza Stark reviewed gene: ALDH4A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9700195, 34037900, 31884946; Phenotypes: Hyperprolinemia, type II MIM#239510, disorders of ornithine or proline metabolism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4391 | CSTF2 |
Zornitza Stark gene: CSTF2 was added gene: CSTF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSTF2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: CSTF2 were set to 32816001 Phenotypes for gene: CSTF2 were set to Intellectual disability Review for gene: CSTF2 was set to AMBER Added comment: Four individuals from a single family, spanning two generations, segregating a missense variant. Functional data, including a mouse model and a gene reporter assay. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4388 | FLVCR2 | Zornitza Stark Mode of inheritance for gene: FLVCR2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4387 | FLVCR2 | Zornitza Stark reviewed gene: FLVCR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30712878, 20206334, 20518025, 20690116, 25677735; Phenotypes: Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4385 | VPS53 | Zornitza Stark Mode of inheritance for gene: VPS53 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4384 | VPS53 | Zornitza Stark reviewed gene: VPS53: Rating: GREEN; Mode of pathogenicity: None; Publications: 24577744, 12920088; Phenotypes: Pontocerebellar hypoplasia, type 2E, OMIM #615851; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4382 | YY1 | Zornitza Stark Mode of inheritance for gene: YY1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4381 | YY1 | Zornitza Stark reviewed gene: YY1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Gabriele-de Vries syndrome, OMIM #617557; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4380 | COL4A3BP | Zornitza Stark Phenotypes for gene: COL4A3BP were changed from to Mental retardation, autosomal dominant 34, MIM# 616351 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4378 | COL4A3BP | Zornitza Stark Mode of inheritance for gene: COL4A3BP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4377 | COL4A3BP | Zornitza Stark reviewed gene: COL4A3BP: Rating: GREEN; Mode of pathogenicity: None; Publications: 25533962; Phenotypes: Mental retardation, autosomal dominant 34, MIM# 616351; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4377 | ZBTB18 | Zornitza Stark Phenotypes for gene: ZBTB18 were changed from to Mental retardation, autosomal dominant 22, MIM# 612337; Intellectual disability; microcephaly; corpus callosum abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4375 | ZBTB18 | Zornitza Stark Mode of inheritance for gene: ZBTB18 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4374 | ZBTB18 | Zornitza Stark reviewed gene: ZBTB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 29573576; Phenotypes: Mental retardation, autosomal dominant 22, MIM# 612337, Intellectual disability, microcephaly, corpus callosum abnormalities; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4372 | ZBTB20 | Zornitza Stark Mode of inheritance for gene: ZBTB20 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4371 | ZBTB20 | Zornitza Stark reviewed gene: ZBTB20: Rating: GREEN; Mode of pathogenicity: None; Publications: 25017102, 27061120, 30256248; Phenotypes: Primrose syndrome, MIM# 259050; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4370 | KCND2 |
Zornitza Stark gene: KCND2 was added gene: KCND2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCND2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCND2 were set to 24501278; 16934482; 29581270; 34245260 Phenotypes for gene: KCND2 were set to Neurodevelopmental disorder MONDO:0700092; global developmental delay, HP:0001263; seizure, HP:0001250 Review for gene: KCND2 was set to GREEN Added comment: 6 new unrelated cases with developmental delay reported in PMID: 34245260 (Zhang et al 2021), 3 of whom had seizures. All had heterozygous missense variants of KCND2 in sites known to be critical for channel gating (E323K, P403A, two individuals, V404L, two individuals and V404M). Functional studies suggest that these missense changes cause both a partial loss-of-function (LOF) and gain-of-function (GOF). The V404 change appears to increase epileptic seizure susceptibility with the 3 patients with a V404 change showing this phenotype. PMID:24501278 - Lee et al, 2014 - reports pair of monozygotic twin boys with infantile onset severe refractory epilepsy and autism. A de novo heterozygous missense variant was identified by WES - V404M. PMID: 29581270 - Lin et al, 2018 - performed functional work that shows V404M enhances inactivation of channels that have not yet opened and dramatically impairs the inactivation of channels that have opened. PMID:16934482 - Singh et al, 2006 - reports a patient with cognative impairment who also went on to have seizures starting from age 13 with a 5 bp deletion in KCND2 leading to premature stop codon. The proband's asymptomatic father also shared this variant. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4368 | UBE4A | Zornitza Stark reviewed gene: UBE4A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and gross motor and seech delay, MIM# 619639; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4366 | CHD8 | Zornitza Stark Mode of inheritance for gene: CHD8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4365 | CHD8 | Zornitza Stark reviewed gene: CHD8: Rating: GREEN; Mode of pathogenicity: None; Publications: 31980904; Phenotypes: {Autism, susceptibility to, 18} 615032, CHD8-related neurodevelopmental syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4363 | CCDC22 | Zornitza Stark Mode of inheritance for gene: CCDC22 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4362 | CCDC22 | Zornitza Stark reviewed gene: CCDC22: Rating: GREEN; Mode of pathogenicity: None; Publications: 21826058, 24916641, 34020006, 33059814, 31971710; Phenotypes: Ritscher-Schinzel syndrome 2, MIM# 300963; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4360 | ADCY5 | Zornitza Stark Mode of inheritance for gene: ADCY5 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4358 | ADCY5 | Zornitza Stark edited their review of gene: ADCY5: Added comment: Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD) is an autosomal recessive complex neurologic disorder characterized by severe global developmental delay with axial hypotonia, impaired intellectual development, poor overall growth, and abnormal involuntary hyperkinetic movements, including dystonia, myoclonus, spasticity, and orofacial dyskinesia. It is the most severe manifestation of ADCY5-related dyskinetic disorders. Five individuals from 2 families reported.; Changed rating: AMBER; Changed publications: 22782511, 24700542, 33051786, 32647899, 33704598, 34631954, 28971144, 30975617; Changed phenotypes: Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4358 | CAMK2A | Zornitza Stark Phenotypes for gene: CAMK2A were changed from to Mental retardation, autosomal recessive 63 MIM#618095; Mental retardation, autosomal dominant 53 MIM#617798 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4356 | CAMK2A | Zornitza Stark Mode of inheritance for gene: CAMK2A was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4355 | CAMK2A | Zornitza Stark reviewed gene: CAMK2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 32600977, 29784083, 29560374; Phenotypes: Mental retardation, autosomal recessive 63 MIM#618095, Mental retardation, autosomal dominant 53 MIM#617798; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4354 | BCAS3 | Zornitza Stark reviewed gene: BCAS3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hengel-Maroofian-Schols syndrome, MIM# 619641; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4352 | ASXL2 | Zornitza Stark Mode of inheritance for gene: ASXL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4351 | ASXL2 | Zornitza Stark reviewed gene: ASXL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27693232, 33751773; Phenotypes: Shashi-Pena syndrome, MIM# 617190; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4349 | ARFGEF2 | Zornitza Stark Mode of inheritance for gene: ARFGEF2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4348 | ARFGEF2 | Zornitza Stark reviewed gene: ARFGEF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25160555, 26126837, 23812912; Phenotypes: Periventricular heterotopia with microcephaly (MIM#608097); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4347 | BLOC1S1 |
Zornitza Stark gene: BLOC1S1 was added gene: BLOC1S1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BLOC1S1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BLOC1S1 were set to 33875846 Phenotypes for gene: BLOC1S1 were set to severe intellectual disability; severe global developmental delay; epilepsy Review for gene: BLOC1S1 was set to GREEN Added comment: 4 individuals reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4345 | CLCN7 |
Zornitza Stark gene: CLCN7 was added gene: CLCN7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLCN7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CLCN7 were set to 31155284 Phenotypes for gene: CLCN7 were set to Hypopigmentation, organomegaly, and delayed myelination and development, MIM# 618541 Mode of pathogenicity for gene: CLCN7 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: CLCN7 was set to AMBER Added comment: Two individuals reported with same missense variant and hypopigmentation, organomegaly, and delayed myelination and development. Variant is GoF. No osteopetrosis, biopsy findings from skin and other organs are consistent with a lysosomal storage disorder. IUGR, prematurity and polyhydramnios are features. Bi-allelic variants in this gene are associated with osteopetrosis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4342 | TAF4 |
Zornitza Stark gene: TAF4 was added gene: TAF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TAF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TAF4 were set to 33875846; 28191890 Phenotypes for gene: TAF4 were set to Neurodevelopmental disorder Review for gene: TAF4 was set to AMBER Added comment: Three individuals reported with de novo LoF variants as part of large cohorts, limited phenotypic information available. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4338 | PLK1 |
Zornitza Stark gene: PLK1 was added gene: PLK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLK1 were set to 33875846 Phenotypes for gene: PLK1 were set to Epilepsy; microcephaly; intellectual disability Review for gene: PLK1 was set to GREEN Added comment: More than 5 individuals reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4334 | TMEM218 |
Zornitza Stark gene: TMEM218 was added gene: TMEM218 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: TMEM218 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM218 were set to 33791682; 25161209 Phenotypes for gene: TMEM218 were set to Joubert syndrome 39, MIM#619562 Review for gene: TMEM218 was set to GREEN Added comment: 11 cases in 6 families with homozygous or compound heterozygous missense and nonsense (1) variants, with a Joubert/Meckel syndrome phenotype. Clinical features included the molar tooth sign (N=2), occipital encephalocele (N=5, all fetuses), retinal dystrophy (N=4, all living individuals), polycystic kidneys (N=2), and polydactyly (N=2), without liver involvement. A null mouse model had nephronophthisis and retinal degeneration. No OMIM entry. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4329 | CNKSR2 | Zornitza Stark Mode of inheritance for gene: CNKSR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4328 | CNKSR2 | Zornitza Stark edited their review of gene: CNKSR2: Changed mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4328 | ANK3 | Zornitza Stark Phenotypes for gene: ANK3 were changed from Mental retardation, autosomal recessive, 37 615493 to Mental retardation, autosomal recessive, 37 615493; Intellectual disability, autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty gene: OGDHL was added gene: OGDHL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: OGDHL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OGDHL were set to PMID: 34800363 Phenotypes for gene: OGDHL were set to Neurodevelopmental disorder featuring epilepsy, hearing loss and visual impairment Added comment: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | FOXR2 |
Paul De Fazio changed review comment from: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype. In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation). A mouse knockout has comparable phenotypes, and a severe survival deficit. Rated amber (1 patient, functional evidence, mouse model). Sources: Literature; to: Geme added incorrectly. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | FOXR1 |
Paul De Fazio gene: FOXR1 was added gene: FOXR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FOXR1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FOXR1 were set to 34723967 Phenotypes for gene: FOXR1 were set to Postnatal microcephaly, progressive brain atrophy and global developmental delay Mode of pathogenicity for gene: FOXR1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: FOXR1 was set to AMBER gene: FOXR1 was marked as current diagnostic Added comment: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype. In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation). A mouse knockout has comparable phenotypes, and a severe survival deficit. Rated amber (1 patient, functional evidence, mouse model). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | FOXR2 |
Paul De Fazio gene: FOXR2 was added gene: FOXR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FOXR2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FOXR2 were set to 34723967 Phenotypes for gene: FOXR2 were set to Postnatal microcephaly, progressive brain atrophy and global developmental delay Review for gene: FOXR2 was set to AMBER gene: FOXR2 was marked as current diagnostic Added comment: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype. In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation). A mouse knockout has comparable phenotypes, and a severe survival deficit. Rated amber (1 patient, functional evidence, mouse model). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4320 | RNF125 | Zornitza Stark Mode of inheritance for gene: RNF125 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4319 | RNF125 | Zornitza Stark reviewed gene: RNF125: Rating: GREEN; Mode of pathogenicity: None; Publications: 25196541; Phenotypes: Tenorio syndrome - MIM# 616260; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4317 | GTPBP3 | Zornitza Stark Mode of inheritance for gene: GTPBP3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4316 | GTPBP3 | Zornitza Stark reviewed gene: GTPBP3: Rating: GREEN; Mode of pathogenicity: None; Publications: 34276756, 25434004; Phenotypes: Combined oxidative phosphorylation deficiency 23 MIM#616198; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4316 | CWC27 | Zornitza Stark Phenotypes for gene: CWC27 were changed from to Retinitis pigmentosa with or without skeletal anomalies, MIM# 250410 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4314 | CWC27 | Zornitza Stark Mode of inheritance for gene: CWC27 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4313 | CWC27 | Zornitza Stark reviewed gene: CWC27: Rating: GREEN; Mode of pathogenicity: None; Publications: 28285769, 31481716; Phenotypes: Retinitis pigmentosa with or without skeletal anomalies, MIM# 250410; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4311 | ELAC2 | Zornitza Stark Mode of inheritance for gene: ELAC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4310 | ELAC2 | Zornitza Stark reviewed gene: ELAC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23849775, 31045291; Phenotypes: Combined oxidative phosphorylation deficiency 17, MIM#615440; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4308 | CUL4B | Zornitza Stark Mode of inheritance for gene: CUL4B was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4307 | CUL4B | Zornitza Stark reviewed gene: CUL4B: Rating: GREEN; Mode of pathogenicity: None; Publications: 17236139, 19377476; Phenotypes: Mental retardation, X-linked, syndromic 15 (Cabezas type), MIM# 300354; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4305 | CTNNB1 | Zornitza Stark Mode of inheritance for gene: CTNNB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4304 | CTNNB1 | Zornitza Stark reviewed gene: CTNNB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23033978, 24614104, 25326669, 27915094; Phenotypes: Neurodevelopmental disorder with spastic diplegia and visual defects , MIM#615075; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4302 | CSNK2A1 | Zornitza Stark Mode of inheritance for gene: CSNK2A1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4301 | CSNK2A1 | Zornitza Stark reviewed gene: CSNK2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27048600, 29240241, 29383814; Phenotypes: Okur-Chung neurodevelopmental syndrome, MIM# 617062; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4299 | MAF | Zornitza Stark Mode of inheritance for gene: MAF was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4298 | MAF | Zornitza Stark reviewed gene: MAF: Rating: GREEN; Mode of pathogenicity: None; Publications: 30160832, 34643041; Phenotypes: Ayme-Gripp syndrome (MIM#601088); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4296 | CRB2 | Zornitza Stark Mode of inheritance for gene: CRB2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4295 | CRB2 | Zornitza Stark reviewed gene: CRB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25557780, 33687977, 32051522, 30212996, 33575434, 31438467, 30593785; Phenotypes: Ventriculomegaly with cystic kidney disease, MIM# 219730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4293 | COLEC11 | Zornitza Stark Mode of inheritance for gene: COLEC11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4292 | COLEC11 | Zornitza Stark reviewed gene: COLEC11: Rating: GREEN; Mode of pathogenicity: None; Publications: 21258343, 26789649, 28301481; Phenotypes: 3MC syndrome 2, MIM# 265050; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4291 | SPATA5L1 | Zornitza Stark reviewed gene: SPATA5L1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4289 | MEIS2 | Zornitza Stark Mode of inheritance for gene: MEIS2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4288 | MEIS2 | Zornitza Stark reviewed gene: MEIS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33427397, 25712757; Phenotypes: Cleft palate, cardiac defects, and mental retardation (MIM#600987); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4285 | CNTNAP2 | Zornitza Stark Mode of inheritance for gene: CNTNAP2 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4285 | CNTNAP2 | Zornitza Stark Mode of inheritance for gene: CNTNAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4284 | CNTNAP2 | Zornitza Stark reviewed gene: CNTNAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16571880, 19896112, 27439707; Phenotypes: Cortical dysplasia-focal epilepsy syndrome, MIM# 610042; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4282 | CKAP2L | Zornitza Stark Mode of inheritance for gene: CKAP2L was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4281 | CKAP2L | Zornitza Stark reviewed gene: CKAP2L: Rating: GREEN; Mode of pathogenicity: None; Publications: 25439729, 33913579, 29473684; Phenotypes: Filippi syndrome, MIM# 272440; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4279 | IL1RAPL1 | Zornitza Stark Mode of inheritance for gene: IL1RAPL1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4278 | IL1RAPL1 | Ain Roesley reviewed gene: IL1RAPL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34452636, 27470653, 21484992, 18801879, 18801879; Phenotypes: Intellectual developmental disorder, X-linked 21 MIM#300143; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4276 | CHKB | Zornitza Stark Mode of inheritance for gene: CHKB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4275 | CHKB | Zornitza Stark reviewed gene: CHKB: Rating: GREEN; Mode of pathogenicity: None; Publications: 21665002, 23692895, 24997086; Phenotypes: Muscular dystrophy, congenital, megaconial type, MIM# 602541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4275 | CHAMP1 | Zornitza Stark Phenotypes for gene: CHAMP1 were changed from to Mental retardation, autosomal dominant 40 (MIM#616579) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4273 | CHAMP1 | Zornitza Stark Mode of inheritance for gene: CHAMP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4272 | CHAMP1 | Zornitza Stark reviewed gene: CHAMP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27148580, 26340335; Phenotypes: Mental retardation, autosomal dominant 40 (MIM#616579); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4270 | CEP290 | Zornitza Stark Mode of inheritance for gene: CEP290 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4269 | CEP290 | Zornitza Stark reviewed gene: CEP290: Rating: GREEN; Mode of pathogenicity: None; Publications: 16682973, 16682970, 17705300, 33370260, 32600475; Phenotypes: Joubert syndrome 5, MIM# 610188, Meckel syndrome 4, MIM# 611134, Bardet-Biedl syndrome 14, MIM# 615991; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4269 | CENPJ | Zornitza Stark Phenotypes for gene: CENPJ were changed from to Microcephaly 6, primary, autosomal recessive, MIM# 608393, MONDO:0012029; Seckel syndrome 4, MIM# 613676, MONDO:0013358 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4267 | CENPJ | Zornitza Stark Mode of inheritance for gene: CENPJ was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4266 | CENPJ | Zornitza Stark reviewed gene: CENPJ: Rating: GREEN; Mode of pathogenicity: None; Publications: 20522431, 23166506, 15793586, 20978018, 22775483, 32677750, 32549991; Phenotypes: Microcephaly 6, primary, autosomal recessive, MIM# 608393, MONDO:0012029, Seckel syndrome 4, MIM# 613676, MONDO:0013358; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4264 | CDKL5 | Zornitza Stark Mode of inheritance for gene: CDKL5 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4263 | CDKL5 | Zornitza Stark reviewed gene: CDKL5: Rating: GREEN; Mode of pathogenicity: None; Publications: 19793311; Phenotypes: Developmental and epileptic encephalopathy 2, MIM# 300672; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4263 | SRCAP | Zornitza Stark Phenotypes for gene: SRCAP were changed from Floating-Harbor syndrome MIM#136140; Neurodevelopmental disorder, non-Floating Harbor to Floating-Harbor syndrome MIM#136140; Developmental delay, hypotonia, musculoskeletal defects, and behavioral abnormalities, MIM# 619595 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4262 | SRCAP | Zornitza Stark edited their review of gene: SRCAP: Changed phenotypes: Developmental delay, hypotonia, musculoskeletal defects, and behavioral abnormalities, MIM# 619595 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4260 | DDX3X | Zornitza Stark Mode of inheritance for gene: DDX3X was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4260 | DDX3X | Zornitza Stark Mode of inheritance for gene: DDX3X was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4259 | DDX3X | Zornitza Stark reviewed gene: DDX3X: Rating: GREEN; Mode of pathogenicity: None; Publications: 30266093, 26235985, 25533962, 33528536, 30936465, 31274575, 30817323; Phenotypes: Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4256 | ASXL1 | Zornitza Stark Mode of inheritance for gene: ASXL1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4255 | ASXL1 | Zornitza Stark reviewed gene: ASXL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29446906, 21706002; Phenotypes: Bohring-Opitz syndrome , MIM#605039; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4255 | MYH10 |
Krithika Murali gene: MYH10 was added gene: MYH10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list,Literature Mode of inheritance for gene: MYH10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MYH10 were set to 24825879; 24901346; 25356899; 22495309; 25003005 Phenotypes for gene: MYH10 were set to Microcephaly; Intellectual Disability Review for gene: MYH10 was set to GREEN Added comment: De novo variants were identified in 5 unrelated individuals with moderate-severe ID and developmental delay. Other reported phenotypic features include microcephaly (4/5), IUGR/failure to thrive (4/5), cerebral atrophy (3/5), hydrocephalus (2/5), congenital bilateral hip dysplasia (2/5), cerebellar atrophy (1/5), congenital diaphragmatic hernia (1/5), cranial nerve palsy (1/5), nystagmus (1/5), dysplastic kidney (1/5). Defects in heart development, body wall closure and other birth defects noted in mouse models. Sources: Expert list, Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4254 | CSF1R |
Zornitza Stark gene: CSF1R was added gene: CSF1R was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSF1R was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSF1R were set to 30982609; 33749994; 34135456 Phenotypes for gene: CSF1R were set to Brain abnormalities, neurodegeneration, and dysosteosclerosis, MIM# 618476; BANDDOS Review for gene: CSF1R was set to AMBER Added comment: Brain abnormalities, neurodegeneration, and dysosteosclerosis (BANDDOS) is an autosomal recessive disorder characterized by brain abnormalities, progressive neurologic deterioration, and sclerotic bone dysplasia similar to dysosteosclerosis (DOS). The age at onset is highly variable: some patients may present in infancy with hydrocephalus, global developmental delay, and hypotonia, whereas others may have onset of symptoms in the late teens or early twenties after normal development. Neurologic features include loss of previous motor and language skills, cognitive impairment, spasticity, and focal seizures. Brain imaging shows periventricular white matter abnormalities and calcifications, large cisterna magna or Dandy-Walker malformation, and sometimes agenesis of the corpus callosum. Four unrelated families reported. Note mono-allelic variants cause an adult-onset disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4252 | RNPC3 |
Zornitza Stark gene: RNPC3 was added gene: RNPC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNPC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNPC3 were set to 29866761; 32462814; 33650182 Phenotypes for gene: RNPC3 were set to Growth hormone deficiency; Intellectual disability Review for gene: RNPC3 was set to AMBER Added comment: Three families reported, ID in two. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4249 | KCNQ2 | Zornitza Stark Mode of inheritance for gene: KCNQ2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4248 | KCNQ2 | Zornitza Stark reviewed gene: KCNQ2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33659638, 33754465; Phenotypes: Developmental and epileptic encephalopathy 7, MIM# 613720, Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4244 | NUP85 |
Zornitza Stark gene: NUP85 was added gene: NUP85 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NUP85 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NUP85 were set to 34170319; 30179222 Phenotypes for gene: NUP85 were set to Intellectual disability Review for gene: NUP85 was set to AMBER Added comment: Bi-allelic variants in this gene are associated with nephrotic syndrome in 3 families. Phenotype expansion: PMID: 34170319 - Ravindran et al 2021 report two pedigrees with an MCPH-SCKS phenotype spectrum without SRNS. In the first family, a 9 yo female, with consanguineous parents, is reported to have a missense variant in NUP85 (c.932G > A; p.R311Q). Intrauterine growth restriction was noticed. At birth microcephaly was observed (OFC < 3rd centile, < −3.6 SD) as well as hypotrophy [weight −2.8 SD), length 45 cm (−2.7 SD), both <3rd centile], facial dysmorphism, syndactyly, long and thin fingers, and bilateral pes adductus. She has severe developmental delay with strongly delayed motor milestones and absent speech. Drug-resistant, genetic epilepsy with focal-onset seizures started in the first year of life. She had no clinical, laboratory or radiological findings indicative of kidney dysfunction. In the second family, compound heterozygous missense variants in NUP85 were detected (c.1109A > G, c.1589 T > C;p.N370S, p.M530T ) in a fetus. MRI of the fetal brain at 24 + 2 GW indicated complete agenesis of the corpus callosum, abnormal sulcation in the left frontal lobe, nodularity of the frontal horn and trigone with focal puckering of the left lateral ventricle. PMID: 30179222 - Braun et al 2018 - 2 individuals from 1 of the families reported with steroid-resistant nephrotic syndrome were also reported to have intellectual disability but showed no structural brain defects. The degree of intellectual disability is not stated. They were found to have 2 compound heterozygous alleles (c.405+1G>A and c.1741G>C, p.Ala581Pro) in NUP85. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4241 | ALG1 | Zornitza Stark Mode of inheritance for gene: ALG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4240 | ALG1 | Zornitza Stark reviewed gene: ALG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26931382; Phenotypes: Congenital disorder of glycosylation, type Ik, MIM# 608540; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4239 | STT3A | Zornitza Stark Mode of inheritance for gene: STT3A was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4238 | KIAA0391 | Zornitza Stark reviewed gene: KIAA0391: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4236 | SPRED2 | Zornitza Stark Phenotypes for gene: SPRED2 were changed from developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt to Rasopathy; developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4234 | KIAA0391 |
Lucy Spencer gene: KIAA0391 was added gene: KIAA0391 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIAA0391 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIAA0391 were set to PMID: 34715011 Phenotypes for gene: KIAA0391 were set to Hearing loss, intellectual disability Review for gene: KIAA0391 was set to RED Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4233 | STT3A | Elena Savva reviewed gene: STT3A: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 34653363, 23842455, 30701557, 28424003; Phenotypes: Congenital disorder of glycosylation, type Iw MIM#615596; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4233 | SPRED2 |
Dean Phelan gene: SPRED2 was added gene: SPRED2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPRED2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPRED2 were set to PMID: 34626534 Phenotypes for gene: SPRED2 were set to developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt Review for gene: SPRED2 was set to GREEN Added comment: PMID: 34626534 Homozygosity for three different variants c.187C>T (p.Arg63∗), c.299T>C (p.Leu100Pro), and c.1142_1143delTT (p.Leu381Hisfs∗95) were identified in four subjects from three families. All variants severely affected protein stability, causing accelerated degradation, and variably perturbed SPRED2 functional behaviour. The clinical phenotype of the four affected individuals included developmental delay, intellectual disability, cardiac defects, short stature, skeletal anomalies, and a typical facial gestalt as major features, without the occurrence of the distinctive skin signs characterizing Legius syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4233 | SPATA5L1 |
Paul De Fazio changed review comment from: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly. In 25 patients for whom full phenotype datasets were available, all 25 had ID. Sources: Literature; to: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly. ~53% of patients had ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4233 | SPATA5L1 |
Paul De Fazio gene: SPATA5L1 was added gene: SPATA5L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPATA5L1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPATA5L1 were set to 34626583 Phenotypes for gene: SPATA5L1 were set to Intellectual disability; spastic-dystonic cerebral palsy; epilepsy; hearing loss Review for gene: SPATA5L1 was set to GREEN gene: SPATA5L1 was marked as current diagnostic Added comment: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly. In 25 patients for whom full phenotype datasets were available, all 25 had ID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4231 | PHF6 | Zornitza Stark Mode of inheritance for gene: PHF6 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4230 | PHF6 | Zornitza Stark reviewed gene: PHF6: Rating: GREEN; Mode of pathogenicity: None; Publications: 16912705; Phenotypes: Borjeson-Forssman-Lehmann syndrome, MIM# 301900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4230 | GRIK2 | Zornitza Stark Phenotypes for gene: GRIK2 were changed from Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD), autosomal dominant to Mental retardation, autosomal recessive, 6 MIM# 611092; Neurodevelopmental disorder with impaired language and ataxia and with or without seizures, MIM# 619580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4227 | AHDC1 | Zornitza Stark Mode of inheritance for gene: AHDC1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4226 | AHDC1 | Zornitza Stark reviewed gene: AHDC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24791903, 27148574, 30152016; Phenotypes: Xia-Gibbs syndrome, MIM# 615829, AHDC1-related intellectual disability, obstructive sleep apnoea, mild dysmorphism syndrome MONDO:0014358; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4224 | ACY1 | Zornitza Stark Mode of inheritance for gene: ACY1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4223 | ACY1 | Zornitza Stark reviewed gene: ACY1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16274666, 16465618, 17562838, 24117009; Phenotypes: Aminoacylase 1 deficiency, MIM# 609924; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4222 | ETHE1 | Zornitza Stark Phenotypes for gene: ETHE1 were changed from to Ethylmalonic encephalopathy , MIM#602473 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4220 | ETHE1 | Zornitza Stark Mode of inheritance for gene: ETHE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4219 | ETHE1 | Zornitza Stark reviewed gene: ETHE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14732903, 28933811; Phenotypes: Ethylmalonic encephalopathy , MIM#602473; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4218 | TAOK1 | Zornitza Stark Phenotypes for gene: TAOK1 were changed from Intellectual disability; hypotonia; macrocephaly to Developmental delay with or without intellectual impairment or behavioural abnormalities, MIM#619575; Intellectual disability; hypotonia; macrocephaly | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4217 | TAOK1 | Zornitza Stark reviewed gene: TAOK1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Developmental delay with or without intellectual impairment or behavioural abnormalities, MIM#619575; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4214 | ZNHIT3 |
Zornitza Stark gene: ZNHIT3 was added gene: ZNHIT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNHIT3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNHIT3 were set to 28335020; 28335020; 31048081 Phenotypes for gene: ZNHIT3 were set to PEHO syndrome, MIM# 260565 Review for gene: ZNHIT3 was set to GREEN Added comment: PEHO is a severe autosomal recessive neurodevelopmental disorder characterized by extreme cerebellar atrophy due to almost total loss of granule neurons. Affected individuals present in early infancy with hypotonia, profoundly delayed psychomotor development, optic atrophy, progressive atrophy of the cerebellum and brainstem, and dysmyelination. Most patients also develop infantile seizures that are often associated with hypsarrhythmia on EEG, and many have peripheral oedema. More than 20 affected individuals reported of Finnish origin, p.Ser31Leu is a founder variant. One compound het reported and supportive animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4213 | KIAA0556 |
Paul De Fazio gene: KIAA0556 was added gene: KIAA0556 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIAA0556 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIAA0556 were set to 26714646; 27245168 Phenotypes for gene: KIAA0556 were set to Joubert syndrome 26, MIM# 616784 Review for gene: KIAA0556 was set to GREEN gene: KIAA0556 was marked as current diagnostic Added comment: 5 individuals from two families reported, supportive mouse model. Individuals were reported to have (global) developmental delay. New HGNC approved name is KATNIP. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4211 | FGF12 | Zornitza Stark Mode of inheritance for gene: FGF12 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4210 | FGF12 | Zornitza Stark reviewed gene: FGF12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32645220, 27164707, 27830185, 27872899; Phenotypes: Developmental and epileptic encephalopathy 47, MIM# 617166; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4209 | KCTD13 | Zornitza Stark Mode of inheritance for gene: KCTD13 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4207 | NDUFA8 |
Krithika Murali gene: NDUFA8 was added gene: NDUFA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NDUFA8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA8 were set to 32385911; 33153867 Phenotypes for gene: NDUFA8 were set to Mitochondrial complex I deficiency, nuclear type 37- 619272; Epilepsy; Microcephaly; Developmental Delay Review for gene: NDUFA8 was set to AMBER Added comment: 3 individuals from 2 unrelated families reported with phenotypic features including microcephaly (1/3), seizures (2/3), developmental delay (3/3) and MRI-B changes (3/3). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4205 | MAGEL2 | Zornitza Stark Mode of inheritance for gene: MAGEL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4204 | MAGEL2 | Zornitza Stark reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, MIM# 615547; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4203 | NSRP1 | Zornitza Stark reviewed gene: NSRP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4203 | NSRP1 |
Krithika Murali gene: NSRP1 was added gene: NSRP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NSRP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NSRP1 were set to 34385670 Phenotypes for gene: NSRP1 were set to Epilepsy; Cerebral palsy; microcephaly; Intellectual disability Review for gene: NSRP1 was set to AMBER Added comment: Novel gene regulating splicing. Biallelic LoF pathogenic variants reported in 6 individuals from 3 unrelated families associated with a phenotype characterized by developmental delay, epilepsy, microcephaly, and spastic cerebral palsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4202 | GABRD |
Zornitza Stark gene: GABRD was added gene: GABRD was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABRD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABRD were set to 15115768; 34633442 Phenotypes for gene: GABRD were set to Intellectual disability; Epilepsy; Susceptibility to epilepsy, MIM#613060 Review for gene: GABRD was set to GREEN Added comment: Susceptibility to epilepsy, MIM#613060: Limited reports. The variant originally reported in PMID 15115768 in association with epilepsy is present in >4,000 hets in gnomad and 55 homs which is not consistent with a Mendelian disorder. PMID 34633442: 10 individuals with 7 unique variants reported in individuals with neurodevelopmental disorders and epilepsy. Six of the variants were demonstrated to be GoF, and those individuals with neurodevelopmental disorders with behavioural issues, various degrees of intellectual disability, generalized epilepsy with atypical absences and generalized myoclonic and/or bilateral tonic-clonic seizures. In contrast, the one individual carrying a loss-of-function variant had normal intelligence, no seizure history but has a diagnosis of autism spectrum disorder and suffering from elevated internalizing psychiatric symptoms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4200 | KCTD3 | Zornitza Stark Phenotypes for gene: KCTD3 were changed from to Epilepsy; Intellectual disability; Posterior fossa abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4198 | KCTD3 | Zornitza Stark Mode of inheritance for gene: KCTD3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4197 | KCTD3 | Zornitza Stark reviewed gene: KCTD3: Rating: GREEN; Mode of pathogenicity: None; Publications: 29406573; Phenotypes: Epilepsy, Intellectual disability, Posterior fossa abnormalities; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4195 | TARS2 |
Krithika Murali gene: TARS2 was added gene: TARS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TARS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TARS2 were set to 33153448; 24827421; 34508595 Phenotypes for gene: TARS2 were set to Combined oxidative phosphorylation deficiency 21 - 615918; Epilepsy; Developmental Delay Review for gene: TARS2 was set to GREEN Added comment: 8 cases from 7 unrelated families are reported in the literature with a heterogenous phenotype characterised by either early-onset illness within the first months, of severe hypotonia, failure to thrive, epilepsy and early death, or onset after six months with a milder course and longer survival. Other phenotypic features include developmental delay (at least 3 out of 8 cases), MRI-B abnormalities and more rarely dystonia, regression, hyperhidrosis and hearing impairment. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4194 | THG1L |
Krithika Murali gene: THG1L was added gene: THG1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: THG1L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: THG1L were set to 33682303 Phenotypes for gene: THG1L were set to Spinocerebellar ataxia, autosomal recessive 28 - 618800; Epilepsy; Intellectual Disability Review for gene: THG1L was set to AMBER Added comment: 3 individuals from 2 unrelated families of Ashkenazi Jewish descent with compound heterozygous variants ( p.Cys51Trp and p.Val55Ala) presented with profound developmental delays, microcephaly, intractable epilepsy, and cerebellar hypoplasia. Homozygous variants associated with ataxia phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4193 | AP1G1 | Zornitza Stark Phenotypes for gene: AP1G1 were changed from Neurodevelopmental disorder (NDD); Intellectual Disability; Epilepsy to Usmani-Riazuddin syndrome, autosomal dominant, MIM# 619467; Usmani-Riazuddin syndrome, autosomal recessive, MIM# 619548; Neurodevelopmental disorder (NDD); Intellectual Disability; Epilepsy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4192 | AP1G1 | Zornitza Stark edited their review of gene: AP1G1: Changed phenotypes: Usmani-Riazuddin syndrome, autosomal dominant, MIM# 619467, Usmani-Riazuddin syndrome, autosomal recessive, MIM# 619548, Neurodevelopmental disorder (NDD), Intellectual Disability, Epilepsy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4191 | CACNA1C | Zornitza Stark Mode of inheritance for gene: CACNA1C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4188 | SHANK1 | Zornitza Stark Mode of inheritance for gene: SHANK1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4187 | CACNA1C | chirag patel reviewed gene: CACNA1C: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34163037; Phenotypes: Neurodevelopmental abnormalities and epilepsy, no OMIM#; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4185 | SHANK1 | chirag patel reviewed gene: SHANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34113010; Phenotypes: Neurodevelopmental disorder, no OMIM#; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4184 | PLXNA1 |
chirag patel gene: PLXNA1 was added gene: PLXNA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLXNA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: PLXNA1 were set to PMID: 34054129 Phenotypes for gene: PLXNA1 were set to Neurodevelopmental disorder with cerebral and eye anomalies Review for gene: PLXNA1 was set to GREEN Added comment: Dworschak et al. (2021) via WES reported 10 patients from 7 families with biallelic (n=7) or de novo (n=3) PLXNA1 variants. Shared phenotypic features include global developmental delay (9/10), brain anomalies (6/10), and eye anomalies (7/10). Seizures were predominantly reported in patients with monoallelic variants. Zebrafish studies showed an embryonic role of plxna1a in the development of the central nervous system and the eye. Biallelic variants in the extracellular Plexin-A1 domains lead to impaired dimerization or lack of receptor molecules, whereas monoallelic variants in the intracellular Plexin-A1 domains might impair downstream signaling through a dominant-negative effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4180 | HNRNPD | Ee Ming Wong reviewed gene: HNRNPD: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33874999; Phenotypes: Neurodevelopmental disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4179 | BPTF | Zornitza Stark commented on gene: BPTF: Over 30 unrelated individuals reported, mostly de novo, some inherited variants. Clinical features include intellectual disability, seizures, poor growth with small head size, dysmorphic facial features, and mild abnormalities of the hands and feet. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4177 | BCL11A | Zornitza Stark Mode of inheritance for gene: BCL11A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4176 | BCL11A | Zornitza Stark reviewed gene: BCL11A: Rating: GREEN; Mode of pathogenicity: None; Publications: 27453576, 32903878; Phenotypes: Dias-Logan syndrome, MIM# 617101; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4172 | LONP1 | Zornitza Stark Mode of inheritance for gene: LONP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4171 | LONP1 | Zornitza Stark reviewed gene: LONP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31636596; Phenotypes: CODAS syndrome, MIM#600373, Mitochondrial cytopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4171 | WIPI2 | Zornitza Stark Phenotypes for gene: WIPI2 were changed from Intellectual developmental disorder with short stature and variable skeletal anomalies 618453 to Intellectual developmental disorder with short stature and variable skeletal anomalies 618453; global developmental delay; intellectual disability; refractory infantile/childhood-onset epilepsy; progressive tetraplegia with joint contractures; dyskinesia; speech and visual impairment; autistic features; ataxic gait | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4167 | ZDHHC15 | Zornitza Stark Mode of inheritance for gene: ZDHHC15 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4166 | ZDHHC15 | Zornitza Stark reviewed gene: ZDHHC15: Rating: RED; Mode of pathogenicity: None; Publications: 34345675, 32989326; Phenotypes: Mental retardation, X-linked 91, 300577; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4164 | WIPI2 | Dean Phelan reviewed gene: WIPI2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30968111, 34557665; Phenotypes: global developmental delay, intellectual disability, refractory infantile/childhood-onset epilepsy, progressive tetraplegia with joint contractures, dyskinesia, speech and visual impairment, autistic features, ataxic gait; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4163 | ABHD16A |
Lucy Spencer gene: ABHD16A was added gene: ABHD16A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ABHD16A were set to PMID: 34587489 Phenotypes for gene: ABHD16A were set to Spastic paraplegia Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls. In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian. 4 missense variants, 1 frameshift, 1 nonsense. From PMID: 34587489 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4162 | ATP11A |
Elena Savva gene: ATP11A was added gene: ATP11A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ATP11A were set to PMID: 34403372 Phenotypes for gene: ATP11A were set to Neurological disorder Mode of pathogenicity for gene: ATP11A was set to Other Review for gene: ATP11A was set to AMBER Added comment: PMID: 34403372: - Single de novo missense variant reported in a patient with developmental delay and neurological deterioration. - Patient MRI showed severe cerebral atrophy, ventriculomegaly, hypomyelination leukodystrophy, thinned corpus callosum. Axonal neuropathy suggested. - K/I heterozygous mice died perinatally. - Functional studies on missense variant show plasma membrane lipid content impairment, reduced ATPase activity etc. gnomAD: some NMD PTCs present, good quality variants found with 4-5 hets. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4162 | ERBB4 |
Ain Roesley gene: ERBB4 was added gene: ERBB4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ERBB4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ERBB4 were set to 33603162 Penetrance for gene: ERBB4 were set to unknown Review for gene: ERBB4 was set to GREEN Added comment: CNVs reported only exonic deletions: 3x families with ID, speech delays, aggressive outbursts (including 1x de novo) 1x family with global dev delay inherited from unaffected parent exonic del with limited clinical info: 1x severe expressive language delay Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4161 | SARS |
Bryony Thompson gene: SARS was added gene: SARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SARS were set to 28236339; 34570399 Phenotypes for gene: SARS were set to Intellectual disability Review for gene: SARS was set to AMBER Added comment: Summary - 2 unrelated families with overlapping ID phenotype, and supporting in vitro and patient cell assays. PMID: 28236339 - an Iranian family (distantly related) segregating a homozygous missense (c.514G>A, p.Asp172Asn) with moderate ID, microcephaly, ataxia, speech impairment, and aggressive behaviour. Also, supporting in vitro functional assays demonstrating altered protein function. PMID: 34570399 - a consanguineous Turkish family segregating a homozygous missense (c.638G>T, p.(Arg213Leu)) with developmental delay, central deafness, cardiomyopathy, and metabolic decompensation during fever leading to death. Also, reduced protein level and enzymatic activity in patient cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4158 | ZNF407 | Zornitza Stark edited their review of gene: ZNF407: Changed rating: AMBER; Changed phenotypes: SIMHA syndrome, MIM# 619557; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4156 | RNF113A | Zornitza Stark reviewed gene: RNF113A: Rating: GREEN; Mode of pathogenicity: None; Publications: 31880405; Phenotypes: Trichothiodystrophy 5, nonphotosensitive, OMIM #300953; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4156 | RNF113A | Zornitza Stark Mode of inheritance for gene: RNF113A was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4154 | EIF3F | chirag patel reviewed gene: EIF3F: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33736665; Phenotypes: EIF3F-related neurodevelopmental disorder; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4154 | CDH15 | Zornitza Stark Phenotypes for gene: CDH15 were changed from to Mental retardation, autosomal dominant 3 MIM#612580 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4152 | CDH15 | Zornitza Stark Mode of inheritance for gene: CDH15 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4150 | CDH15 | Elena Savva reviewed gene: CDH15: Rating: RED; Mode of pathogenicity: Other; Publications: PMID: 19012874, 12052883, 28422132, 26506440; Phenotypes: Mental retardation, autosomal dominant 3 MIM#612580; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4148 | HCFC1 | Zornitza Stark Phenotypes for gene: HCFC1 were changed from to Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4146 | HCFC1 | Zornitza Stark Mode of inheritance for gene: HCFC1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4145 | HCFC1 | Zornitza Stark reviewed gene: HCFC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34164576, 24011988; Phenotypes: Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4143 | CSTB | Zornitza Stark Mode of inheritance for gene: CSTB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4141 | CSTB | Zornitza Stark reviewed gene: CSTB: Rating: RED; Mode of pathogenicity: None; Publications: 9012407, 9054946; Phenotypes: Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4140 | ATP6V0C |
Zornitza Stark gene: ATP6V0C was added gene: ATP6V0C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: ATP6V0C. Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP6V0C were set to 33190975; 33090716 Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly Review for gene: ATP6V0C was set to AMBER Added comment: 9 individuals reported with deletions and ID/seizures/microcephaly, minimum overlapping region implicates ATP6V0C as the causative gene. Single case report of de novo SNV and ID/seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4138 | ARFGEF1 |
Zornitza Stark gene: ARFGEF1 was added gene: ARFGEF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARFGEF1 were set to 34113008 Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy Review for gene: ARFGEF1 was set to GREEN Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4137 | PRR12 | Zornitza Stark Phenotypes for gene: PRR12 were changed from intellectual disability; iris abnormalities to Neuroocular syndrome, MIM#619539; Intellectual disability; Iris abnormalities; Complex microphthalmia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4136 | PRR12 | Zornitza Stark edited their review of gene: PRR12: Changed phenotypes: Neuroocular syndrome, MIM#619539, Intellectual disability, Iris abnormalities, Complex microphthalmia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4134 | ZC4H2 | Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4133 | ZC4H2 | Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4131 | KIF4A | Zornitza Stark edited their review of gene: KIF4A: Added comment: Further 11 families reported. Major structural brain abnormalities present in at least 3 (hydrocephalus), variable ID in several.; Changed rating: GREEN; Changed publications: 24812067, 34346154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4130 | FAM149B1 |
Michelle Torres gene: FAM149B1 was added gene: FAM149B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FAM149B1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FAM149B1 were set to 30905400 Phenotypes for gene: FAM149B1 were set to Joubert; Ciliopathy Review for gene: FAM149B1 was set to GREEN gene: FAM149B1 was marked as current diagnostic Added comment: Four unrelated, but consanguineous, families reported with 2 truncating variants. Developmental delay with hypotonia and intellectual disability are typical features, and many children have characteristic facies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4130 | ZMYM2 | Zornitza Stark Phenotypes for gene: ZMYM2 were changed from Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly to Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4129 | ZMYM2 | Zornitza Stark edited their review of gene: ZMYM2: Changed phenotypes: Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM# 619522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4127 | BCAP31 | Zornitza Stark Mode of inheritance for gene: BCAP31 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4126 | BCAP31 | Zornitza Stark reviewed gene: BCAP31: Rating: GREEN; Mode of pathogenicity: None; Publications: 24011989, 31330203, 33603160; Phenotypes: Deafness, dystonia, and cerebral hypomyelination, MIM# 300475; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4124 | AMPD2 | Zornitza Stark Mode of inheritance for gene: AMPD2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4123 | AMPD2 | Zornitza Stark reviewed gene: AMPD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23911318, 27066553; Phenotypes: Pontocerebellar hypoplasia, type 9, MIM#615809; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4119 | HMGB1 |
chirag patel gene: HMGB1 was added gene: HMGB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HMGB1 were set to PMID: 34164801 Phenotypes for gene: HMGB1 were set to Developmental delay and microcephaly, no OMIM # Review for gene: HMGB1 was set to GREEN Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4117 | TAF2 | chirag patel reviewed gene: TAF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34474177; Phenotypes: Mental retardation, autosomal recessive 40, OMIM # 615599; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4116 | DDX23 | chirag patel reviewed gene: DDX23: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34050707; Phenotypes: Neurodevelopmental disorder, no OMIM #; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4115 | COPB2 | Zornitza Stark reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4113 | MTRR | Zornitza Stark Mode of inheritance for gene: MTRR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4112 | MTRR | Zornitza Stark reviewed gene: MTRR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12555939, 15714522; Phenotypes: Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4110 | MTR | Zornitza Stark Mode of inheritance for gene: MTR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4109 | MTR | Zornitza Stark reviewed gene: MTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8968736, 8968737, 9683607, 12068375; Phenotypes: Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4107 | UMPS | Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | UMPS | Zornitza Stark reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4106 | MAGEL2 | Anna Le Fevre reviewed gene: MAGEL2: Rating: ; Mode of pathogenicity: None; Publications: 24076603, 30302899, 31397880; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | PRICKLE2 |
Hazel Phillimore gene: PRICKLE2 was added gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRICKLE2 were set to PMID: 34092786 Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms Review for gene: PRICKLE2 was set to GREEN Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | COPB2 |
Belinda Chong gene: COPB2 was added gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: COPB2 were set to PMID: 34450031 Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay Review for gene: COPB2 was set to AMBER Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis 3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | GRIK2 | Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD), autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4100 | GRIK2 | Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4099 | GRIK2 | Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 |
Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4098 | ZNF668 |
Paul De Fazio gene: ZNF668 was added gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF668 were set to 34313816; 26633546 Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism Review for gene: ZNF668 was set to GREEN gene: ZNF668 was marked as current diagnostic Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism. Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4097 | ARF1 |
Zornitza Stark gene: ARF1 was added gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARF1 were set to 28868155; 34353862 Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185 Review for gene: ARF1 was set to GREEN Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4096 | CLCN3 | Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4095 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4095 | CLCN3 | Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4093 | CHRM1 |
Bryony Thompson gene: CHRM1 was added gene: CHRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218 Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism Review for gene: CHRM1 was set to AMBER Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways. PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu) PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4090 | PI4KA |
chirag patel gene: PI4KA was added gene: PI4KA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PI4KA were set to PMID: 34415322 Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy Review for gene: PI4KA was set to GREEN Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4083 | WDR11 | Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4081 | WDR11 | Konstantinos Varvagiannis reviewed gene: WDR11: Rating: AMBER; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Microcephaly, Short stature; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4079 | FGD1 | Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4078 | FGD1 | Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4076 | RAD21 | Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4075 | RAD21 | Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4073 | BRD4 | Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4071 | BRD4 | Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4070 | ZNF699 |
Zornitza Stark gene: ZNF699 was added gene: ZNF699 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZNF699 were set to 33875846 Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488 Review for gene: ZNF699 was set to GREEN Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections. 12 unrelated families reported, 5 different homozygous frameshift variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4067 | NIPBL | Zornitza Stark Mode of inheritance for gene: NIPBL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4066 | NIPBL | Zornitza Stark reviewed gene: NIPBL: Rating: GREEN; Mode of pathogenicity: None; Publications: 16604071, 20358602, 16236812, 17661813; Phenotypes: Cornelia de Lange syndrome 1, MIM # 122470; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4064 | IGF1 | Zornitza Stark Mode of inheritance for gene: IGF1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4063 | IGF1 | Zornitza Stark reviewed gene: IGF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8857020, 15769976, 14684690, 31539878, 28768959, 34125705, 22832530; Phenotypes: Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4061 | TCN2 | Zornitza Stark Mode of inheritance for gene: TCN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4060 | TCN2 | Zornitza Stark reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 19373259, 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency, 275350; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4059 | RNF220 |
Konstantinos Varvagiannis changed review comment from: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Sources: Literature, Other; to: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Consider inclusion in panels for leukodystrophies, childhood onset ataxia, sensorineural hearing loss, corpus callosum anomalies, cardiomyopathies, hepatopathies, etc in all cases with green rating. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4059 | RNF220 |
Konstantinos Varvagiannis gene: RNF220 was added gene: RNF220 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNF220 were set to 33964137; 10881263 Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum Penetrance for gene: RNF220 were set to Complete Review for gene: RNF220 was set to GREEN Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4058 | ARF3 |
Konstantinos Varvagiannis gene: ARF3 was added gene: ARF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ARF3 were set to 34346499 Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system Penetrance for gene: ARF3 were set to unknown Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality. Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu. Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both. ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively. Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons. There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185). In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val). This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia. Evidence to support the effect of each variant include: Arg99Leu: Had identical Golgi localization to that of wt Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF) In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF). In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu) Asp67Val: Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant) Displayed decreased protein stability In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF) In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye. There is no associated phenotype in OMIM, G2P or SysID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4056 | CEP57 | Zornitza Stark Mode of inheritance for gene: CEP57 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4055 | CEP57 | Zornitza Stark reviewed gene: CEP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 24259107, 21552266, 32861809, 30147898; Phenotypes: Mosaic variegated aneuploidy syndrome 2, #MIM 614114; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4054 | SUPT16H | Zornitza Stark Phenotypes for gene: SUPT16H were changed from Intellectual disability; Abnormality of the corpus callosum to Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480; Intellectual disability; Abnormality of the corpus callosum | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4053 | SUPT16H | Zornitza Stark edited their review of gene: SUPT16H: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480, Intellectual disability, Abnormality of the corpus callosum | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4053 | PLXNA2 |
Konstantinos Varvagiannis gene: PLXNA2 was added gene: PLXNA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLXNA2 were set to 34327814 Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology Penetrance for gene: PLXNA2 were set to Incomplete Review for gene: PLXNA2 was set to AMBER Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants. The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members. Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)). Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed). The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed). Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved. Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele. As the authors discuss: *PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration. *Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch. *Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD. *Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus. Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg: - Cyanotic heart disease explaining discordance in cognitive outcome among sibs - Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or - Additional pathogenic variants possibly explaining the CHD in the first subject. There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4052 | HNMT | Zornitza Stark edited their review of gene: HNMT: Added comment: Verhoeven et al. 2020 (PMID: 33310825) report an adult male patient with severe intellectual disability and autism, born to second cousins, with a homozygous nonsense variant (c.88C>T; p.Gln30*). Treatment with antihistaminergic medication and a histamine-restricted diet resulted in significant general improvement, supporting an etiological role for HNMT deficiency. Taskiran et al. 2021 (PMID: 33739554) report an adult male patient with severe intellectual disability, pervasive developmental disorder and ADHD, born to consanguineous parents, with a homozygous nonsense variant (c.100G>T; p.Glu34*).; Changed publications: 26206890, 30744146, 33310825, 33739554 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4051 | VPS50 |
Konstantinos Varvagiannis gene: VPS50 was added gene: VPS50 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS50 were set to 34037727 Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum Penetrance for gene: VPS50 were set to Complete Review for gene: VPS50 was set to AMBER Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants. Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging. Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)). VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor. As discussed by Schneeberger et al (refs provided in text): - VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development. - Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality. Studies performed by Schneeberger et al included: - Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del). - Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels. - Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts. - Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function. As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders". There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes. Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4049 | ROGDI | Zornitza Stark Mode of inheritance for gene: ROGDI was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4048 | ROGDI | Zornitza Stark reviewed gene: ROGDI: Rating: GREEN; Mode of pathogenicity: None; Publications: 22424600, 23086778, 33866847; Phenotypes: Kohlschutter-Tonz syndrome, MIM# 226750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4048 | SPTBN1 | Zornitza Stark Phenotypes for gene: SPTBN1 were changed from Neurodevelopmental Syndrome to Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4047 | TMEM222 | Zornitza Stark Phenotypes for gene: TMEM222 were changed from Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality to Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4046 | TMEM222 | Zornitza Stark reviewed gene: TMEM222: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4046 | TCF7L2 | Zornitza Stark Phenotypes for gene: TCF7L2 were changed from Developmental disorders to Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Myopia; Abnormality of skeletal system | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4043 | TCF7L2 | Konstantinos Varvagiannis reviewed gene: TCF7L2: Rating: AMBER; Mode of pathogenicity: None; Publications: 34003604; Phenotypes: Global developmental delay, Intellectual disability, Autism, Attention deficit hyperactivity disorder, Myopia, Abnormality of skeletal system; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4041 | JAKMIP1 |
Seb Lunke gene: JAKMIP1 was added gene: JAKMIP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: JAKMIP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: JAKMIP1 were set to 29158550; 26627310; 27799067 Phenotypes for gene: JAKMIP1 were set to Intellectual disability; Seizures Review for gene: JAKMIP1 was set to AMBER Added comment: Identified in two independent patients in the literature with a mouse model. Patient 1 (27799067) with developmental delay, speech delay, and cognitive impairment; self-injurious and aggressive behaviour, seizures, dysmorphic features. De-novo missense JAKMIP1 (p.D586H). Patient 2 (29158550) with feeding difficulties, hypotonia, epilepsy, severe ID, no active speech, kyphoscoliosis, constipation, autism, short stature. Splice variant c.1432-2A>G, no segregation or RNA data available. KO mouse model (27799067) displays social deficits, stereotyped activity, abnormal postnatal vocalizations, and other autistic-like behaviors. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4040 | PIDD1 |
Konstantinos Varvagiannis gene: PIDD1 was added gene: PIDD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010 Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum Penetrance for gene: PIDD1 were set to Complete Review for gene: PIDD1 was set to GREEN Added comment: There is enough evidence to include this gene in the current panel with green rating. Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested. The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families]. Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants. Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder. PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage. There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation. Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants. Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26 Evidence so far provided includes: - Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern. - Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability. - Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp] - Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain. - Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD. Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects. There is currently no associated phenotype in OMIM, PanelApp Australia. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes. Overall the gene appears to be relevant for the epilepsy panel, panels for gyration and/or corpus callosum anomalies etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4037 | SHOC2 | Zornitza Stark Mode of inheritance for gene: SHOC2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4036 | SHOC2 | Zornitza Stark reviewed gene: SHOC2: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 19684605, 23918763, 20882035; Phenotypes: Noonan syndrome-like with loose anagen hair 1, MIM# 607721; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4034 | UBR1 | Zornitza Stark Mode of inheritance for gene: UBR1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4033 | UBR1 | Zornitza Stark changed review comment from: >50 unrelated families reported, reviewed in PMID: 24599544. Common clinical features include poor growth, mental retardation, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency.; to: >50 unrelated families reported, reviewed in PMID: 24599544. Common clinical features include poor growth, intellectual disability, and variable dysmorphic features, including aplasia or hypoplasia of the nasal alae, abnormal hair patterns or scalp defects, and oligodontia. Other features include hypothyroidism, sensorineural hearing loss, imperforate anus, and pancreatic exocrine insufficiency. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4033 | UBR1 | Zornitza Stark reviewed gene: UBR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24599544; Phenotypes: Johanson-Blizzard syndrome (MIM#243800); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4031 | SNRPB | Zornitza Stark Mode of inheritance for gene: SNRPB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4030 | SNRPB | Zornitza Stark reviewed gene: SNRPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25047197, 25504470, 26971886; Phenotypes: Cerebrocostomandibular syndrome, MIM# 117650; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4028 | MAST3 |
Zornitza Stark gene: MAST3 was added gene: MAST3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAST3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAST3 were set to 34185323 Phenotypes for gene: MAST3 were set to Developmental and epileptic encephalopathy Review for gene: MAST3 was set to GREEN Added comment: Eleven individuals reported with de novo missense variants in the STK domain, including two recurrent variants p.G510S (n = 5) and p.G515S (n = 3). All 11 individuals had developmental and epileptic encephalopathy, with 8 having normal development prior to seizure onset at <2 years of age. All patients developed multiple seizure types, 9 of 11 patients had seizures triggered by fever and 9 of 11 patients had drug-resistant seizures. Limited functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4023 | AP1G1 |
Zornitza Stark changed review comment from: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. Sources: Literature; to: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. GREEN for mono-allelic, AMBER for bi-allelic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4023 | AP1G1 |
Zornitza Stark gene: AP1G1 was added gene: AP1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AP1G1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: AP1G1 were set to 34102099 Phenotypes for gene: AP1G1 were set to Neurodevelopmental disorder (NDD); Intellectual Disability; Epilepsy Review for gene: AP1G1 was set to GREEN Added comment: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4020 | CLCN3 |
Zornitza Stark gene: CLCN3 was added gene: CLCN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLCN3 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: CLCN3 were set to 34186028 Phenotypes for gene: CLCN3 were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CLCN3 was set to Other Review for gene: CLCN3 was set to GREEN Added comment: 11 individuals reported, 9 that carried 8 different rare heterozygous missense variants in CLCN3, and 2 siblings that were homozygous for an NMD-predicted frameshift variant likely abolishing ClC-3 function. All missense variants were confirmed to be de novo in eight individuals for whom parental data was available. The 11 individuals in the cohort share clinical features of variable severity. All 11 have GDD or ID and dysmorphic features, and a majority has mood or behavioural disorders and structural brain abnormalities: - Structural brain abnormalities on MRI (9/11) included partial or full agenesis of the corpus callosum (6/9), disorganized cerebellar folia (4/9), delayed myelination (3/9), decreased white matter volume (3/9), pons hypoplasia (3/9), and dysmorphic dentate nuclei (3/9). Six of those with brain abnormalities also presented with seizures. - Nine have abnormal vision, including strabismus in four and inability to fix or follow in the two with homozygous loss-of-function variants. - Hypotonia ranging from mild to severe was reported in 7 of the 11 individuals. - Six have mood or behavioural disorders, particularly anxiety (3/6). - Consistent dysmorphic facial features included microcephaly, prominent forehead, hypertelorism, down-slanting palpebral fissures, full cheeks, and micrognathia. The severity of disease in the two siblings with homozygous disruption of ClC-3 is consistent with the drastic phenotype seen in Clcn3 KO mice. The disease was more severe in two siblings carrying homozygous loss-of-function variants with the presence of GDD, absent speech, seizures, and salt and pepper fundal pigmentation in both individuals, with one deceased at 14 months of age. The siblings also had significant neuroanatomical findings including diffusely decreased white matter volume, thin corpora callosa, small hippocampi, and disorganized cerebellar folia. Supporting biallelic inheritance for LoF variants, disruption of mouse Clcn3 results in drastic neurodegeneration with loss of the hippocampus a few months after birth and early retinal degeneration. Clcn3−/− mice display severe neurodegeneration, whereas heterozygous Clcn3+/− mice appear normal. Patch-clamp studies were used to investigate four of the missense variants. These suggested a gain of function in two variants with increased current in HEK cells, however they also showed reduced rectification of voltage and a loss of transient current, plus decreased current amplitude, glycosylation and surface expression when expressed in oocytes, and were suspected to interfere with channel gating and a negative feedback mechanism. These effects were also shown to vary depending on pH levels. The current of the remaining two variants did not differ from WT. For heterozygous missense variants, the disruption induced may be at least partially conferred to mutant/WT homodimers and mutant/ClC-4 heterodimers. Both loss and gain of function in this gene resulted in the same phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4017 | TNPO2 |
Elena Savva gene: TNPO2 was added gene: TNPO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TNPO2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TNPO2 were set to PMID: 34314705 Phenotypes for gene: TNPO2 were set to Developmental delays, neurologic deficits and dysmorphic features Mode of pathogenicity for gene: TNPO2 was set to Other Review for gene: TNPO2 was set to GREEN Added comment: PMID: 34314705 - all de novo missense variants with intellectual disability (9/9), speech impairment (15/15), motor impairment (15/15), ophthalmologic abnormalities (10/15), muscle tone abnormalities (11/15, primarily hypotonia), seizures (6/15, febrile to non-febrile), microcephaly (5/15) and MRI anomalies (7/13, 3/13 had cerebellar hypoplasia/dysplasia). Null fly model was homozygous lethal, no obvious phenotypes in heterozygotes. Upregulated gene expression also resulted in lethality. Overexpression of some human variants in fly models resulted in "toxicity" and phenotypic defects, authors speculate two variants are GOF, 1 variant is LOF. gnomAD: minimal PTCs present Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4016 | SPTBN1 |
Belinda Chong changed review comment from: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature; to: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures (9/29); behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4015 | SPTBN1 |
Belinda Chong gene: SPTBN1 was added gene: SPTBN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPTBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPTBN1 were set to PMID: 34211179 PMID: 33847457 Phenotypes for gene: SPTBN1 were set to Neurodevelopmental Syndrome Review for gene: SPTBN1 was set to GREEN Added comment: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4013 | EDEM3 |
Michelle Torres gene: EDEM3 was added gene: EDEM3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EDEM3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EDEM3 were set to 34143952 Phenotypes for gene: EDEM3 were set to EDEM3-congenital disorder of glycosylation Review for gene: EDEM3 was set to GREEN Added comment: PMID: 34143952: 7 families (11 individuals) with 6x PTV and 2x missense variants with neurodevelopmental delay and variable facial dysmorphisms. The unaffected parents were all heterozygous carriers. Functional show LoF of EDEM3 enzymatic activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4009 | ANK2 | Zornitza Stark reviewed gene: ANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22542183, 25363768, 27479843, 28554332, 30564305, 30755392, 31981491, 33004838, 33057194; Phenotypes: Complex neurodevelopmental disorder, MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4009 | ANK2 |
Anna Le Fevre gene: ANK2 was added gene: ANK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: ANK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANK2 were set to 22542183, 25363768, 27479843, 28554332, 30564305, 30755392, 31981491 Phenotypes for gene: ANK2 were set to intellectual disability Penetrance for gene: ANK2 were set to unknown Added comment: Curated by ClinGen 2020 as definitively associated ? consider taking gene off incidentalome gene list Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4009 | EIF4A3 | Zornitza Stark Phenotypes for gene: EIF4A3 were changed from to Robin sequence with cleft mandible and limb anomalies, MIM# 268305; Richieri-Costa-Pereira syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4007 | EIF4A3 | Zornitza Stark Mode of inheritance for gene: EIF4A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4006 | EIF4A3 | Zornitza Stark reviewed gene: EIF4A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360810; Phenotypes: Robin sequence with cleft mandible and limb anomalies, MIM# 268305, Richieri-Costa-Pereira syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4004 | HSD17B4 | Zornitza Stark Mode of inheritance for gene: HSD17B4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4003 | HSD17B4 | Zornitza Stark reviewed gene: HSD17B4: Rating: GREEN; Mode of pathogenicity: None; Publications: 27790638; Phenotypes: D-bifunctional protein deficiency, AR (MIM#261515), Perrault syndrome 1, AR (MIM#233400); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4002 | SYNCRIP |
Konstantinos Varvagiannis gene: SYNCRIP was added gene: SYNCRIP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SYNCRIP were set to 34157790; 30504930; 27479843; 23020937 Phenotypes for gene: SYNCRIP were set to Global developmental delay; Intellectual disability; Autism; Myoclonic atonic seizures; Abnormality of nervous system morphology Review for gene: SYNCRIP was set to AMBER Added comment: Semino et al (2021 - PMID: 34157790) provide clinical details on 3 unrelated individuals with de novo SYNCRIP variants and provide a review of 5 additional subjects previously identified within large cohorts in the literature and databases. Features included DD, ID (7/7 for whom this information was available), ASD or autistic features (4/7). MRI abnormalities were observed in 3 (widening of CSF spaces, periventricular nodular heterotopia, prominent lat. ventricles). Epilepsy (myoclonic-astatic epilepsy / Doose syndrome) was reported for 2(/8) individuals. The 3 patients here reported were identified following trio/singleton exome with Sanger confirmation of the variants and their de novo occurrence. Variants are in almost all cases de novo (7/7 for whom this was known) and in 5/8 cases were pLoF, in 2/8 missense SNVs while a case from DECIPHER had a 77.92 kb whole gene deletion not involving other genes with unknown inheritance. Overall the variants reported to date include [NM_006372.5]: 1 - c.858_859del p.(Gly287Leufs*5) 2 - c.854dupA p.(Asn285Lysfs*8) 3 - c.734T>C p.(Leu245Pro) 4 - chr6:85605276-85683190 deletion (GRCh38) 5 - c.629T>C p.(Phe210Ser) 6 - c.1573_1574delinsTT p.(Gln525Leu) 7 - c.1247_1250del p.(Arg416Lysfs*145) 8 - c.1518_1519insC p.(Ala507Argfs*14) [P1-3: this report, P4: DECIPHER 254774, P5-6: Guo et al 2019 - PMID: 30504930, P7: Lelieveld et al 2016 - PMID: 27479843, P8: Rauch et al 2012 - PMID: 23020937 / all other Refs not here reviewed, clinical details summarized by Semino et al in table 1] SYNCRIP (also known as HNRNPQ) encodes synaptotagmin‐binding cytoplasmic RNA‐interacting protein. As the authors note, this RNA-binding protein is involved in multiple pathways associated with neuronal/muscular developmental disorders. Several references are provided for its involvement in regulation of RNA metabolism, among others sequence recognition, pre-mRNA splicing, translation, transport and degradation. Mutations in other RNA-interacting proteins and hnRNP members (e.g. HNRNPU, HNRNPD) are associated with NDD. The missense variant (p.Leu245Pro) is within RRM2 one of the 3 RNA recognition motif (RRM) domains of the protein. These 3 domains, corresponding to the central part of the protein (aa 150-400), are relatively intolerant to variation (based on in silico predictions and/or variation in gnomAD). Leu245 localizes within an RNA binding pocket and in silico modeling suggests alteration of the tertiary structure and RNA-binding capacity of RRM2. There are no additional studies performed. Overall haploinsufficiency appears to be the underlying disease mechanism based on the truncating variants and the gene deletion. [pLI in gnomAD : 1, %HI : 2.48%] Animal models are not discussed. There is no associated phenotype in OMIM. This gene is included in the DD panel of G2P (monoallelic LoF variants / SYNCRIP-related developmental disorder). SysID also lists SYNCRIP within the current primary ID genes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4001 | CAMK4 |
Konstantinos Varvagiannis gene: CAMK4 was added gene: CAMK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: CAMK4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CAMK4 were set to 30262571; 33098801; 33211350 Phenotypes for gene: CAMK4 were set to Global developmental delay; Intellectual disability; Autism; Behavioral abnormality; Abnormality of movement; Dystonia; Ataxia; Chorea; Myoclonus Penetrance for gene: CAMK4 were set to Complete Review for gene: CAMK4 was set to GREEN Added comment: 3 publications by Zech et al (2018, 2020 - PMIDs : 30262571, 33098801, 33211350) provide clinical details on 3 individuals, each harboring a private de novo CAMK4 variant. Overlapping features included DD, ID, behavoral issues, autism and abnormal hyperkinetic movements. Dystonia and chorea in all 3 appeared 3-20 years after initial symptoms. CAMK4 encodes Calcium/Calmodulin-dependent protein kinase IV, an important mediator of calcium-mediated activity and dynamics, particularly in the brain. It is involved in neuronal transmission, synaptic plasticity, and neuronal gene expression required for brain development and neuronal homeostasis (summary by OMIM based on Zech et al, 2018). The 473 aa enzyme has a protein kinase domain (aa 46-300) and a C-terminal autoregulatory domain (aa 305-341) the latter comprising an autoinhibitory domain (AID / aa 305-321) and a calmodulin-binding domain (CBD / aa 322-341) [NP_001735.1 / NM_001744.4 - also used below]. Variants in all 3 subjects were identified following trio-WES and were in all cases protein-truncating, mapping to exon 10 or exon 10-intron 10 junction, expected to escape NMD and cause selective abrogation of the autoinhibitory domain (aa 305-321) leading overall to gain-of-function. Variation databases include pLoF CAMK4 variants albeit in all cases usptream or downstream of this region (pLI of this gene in gnomAD: 0.51). Variants leading to selective abrogation of the autoregulatory domain have not been reported. Extensive evidence for the GoF effect of the variant has been provided in the first publication. Several previous studies have demonstrated that abrogation of the AID domain leads to consitutive activation (details below). Mouse models - though corresponding to homozygous loss of function - support a role for CAMKIV in cognitive and motor symptoms. Null mice display tremulous and ataxic movements, deficiencies in balance and sensorimotor performance associated with reduced number of Purkinje neurons (Ribar et al 2000, PMID: 11069976 - not reviewed). Wei et al (2002, PMID: 12006982 - not reviewed) provided evidence for alteration in hippocampal physiology and memory function. Heterozygous mutations in other genes for calcium/calmodulin-dependent protein kinases (CAMKs) e.g. CAMK2A/CAMK2B (encoding subunits of CAMKII) have been reported in individuals with ID. --- The proband in the first publication (PMID: 30262571) was a male with DD, ID, behavioral difficulties (ASD, autoaggression, stereotypies) and hyperkinetic movement disorder (myoclonus, chorea, ataxia) with severe generalized dystonia (onset at the age of 13y). Brain MRI demonstrated cerebellar atrophy. Extensive work-up incl. karyotyping, CMA, DYT-TOR1A, THAP1, GCH1, SCA1/2/3/6/7/8/12/17, Friedreich's ataxia and FMR1 analysis was negative.F Trio WES identified a dn splice site variant (c.981+1G>A) in the last exon-intron junction. RT-PCR followed by gel electrophoresis and Sanger in fibroblasts from an affected and control subject revealed that the proband had - as predicted by the type/location of the variant - in equal amount 2 cDNA products, a normal as well as a truncated one. Sequencing of the shortest revealed utilization of a cryptic donor splice site upstream of the mutated donor leading to a 77bp out-of-frame deletion and introduction of a premature stop codon in the last codon (p.Lys303Serfs*28). Western blot in fibroblast cell lines revealed 2 bands corresponding to the normal protein product as well as to the p.Lys303Serfs*28 although expression of the latter was lower than that of the full length protein. Several previous studies have shown that mutant CAMKIV species that lack the autoinhibitory domain are consitutively active (several Refs provided). Among others Chatila et al (1996, PMID: 8702940) studied an in vitro-engineered truncation mutant (Δ1-317 - truncation at position 317 of the protein) with functionally validated gain-of-function effect. To prove enhanced activity of the splicing variant, Zech et al assessed phosphorylation of CREB (cyclic AMP-responsive element binding protein), a downstream substrate of CAMKIV. Immunobloting revealed significant increase of CREB phosphorylation in patient fibroblasts compared to controls. Overactivation of CAMKIV signaling was reversed when cells were treated with STO-609 an inhibitor of CAMKK, the ustream activator of CAMKIV. Overall the authors demonstrated that loss of CAMKIV autoregulatory domain due to this splice variant had a gain-of-function effect. ---- Following trio-WES, Zech et al (2020 - PMID: 33098801) identified another relevant subject within cohort of 764 individuals with dystonia. This 12-y.o. male, harboring a different variant affecting the same donor site (c.981+1G>T), presented DD, ID, dystonia (onset at 3y) and additional movement disorders (myoclonus, ataxia) as well as similar behavior (ASD, autoaggression, stereotypies). [Details in suppl. p20]. ---- Finally Zech et al (2020 - PMID: 33211350) reported on a 24-y.o. woman with adolescence onset choreodystonia. Other features included DD, moderate ID, absence seizures in infancy, OCD with anxiety and later diagnosis of ASD. Trio WES revealed a dn stopgain variant (c.940C>T; p.Gln314*). ---- There is no associated phenotype in OMIM, G2P. In SysID CAMK4 is listed among the current primary ID genes. ---- Please consider inclusion in other relevant panels. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4001 | DPYSL5 | Zornitza Stark Phenotypes for gene: DPYSL5 were changed from Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities to Ritscher-Schinzel syndrome 4, MIM# 619435; Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4000 | DPYSL5 | Zornitza Stark edited their review of gene: DPYSL5: Changed phenotypes: Ritscher-Schinzel syndrome 4, MIM# 619435, Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4000 | LTBP1 | Zornitza Stark Phenotypes for gene: LTBP1 were changed from cutis laxa syndrome to Cutis laxa, autosomal recessive, type IIE MIM#619451 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3997 | WDR26 | Zornitza Stark Mode of inheritance for gene: WDR26 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3995 | WDR26 | Paul De Fazio reviewed gene: WDR26: Rating: GREEN; Mode of pathogenicity: None; Publications: 28686853, 33506510, 33675273; Phenotypes: Skraban-Deardorff syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3995 | ABCD4 | Zornitza Stark Phenotypes for gene: ABCD4 were changed from to Methylmalonic aciduria and homocystinuria, cblJ type, MIM# 614857 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3993 | ABCD4 | Zornitza Stark Mode of inheritance for gene: ABCD4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3992 | ABCD4 | Zornitza Stark reviewed gene: ABCD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 22922874, 31113616, 30651581, 28572511, 33729671; Phenotypes: Methylmalonic aciduria and homocystinuria, cblJ type, MIM# 614857; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3992 | CCBE1 | Zornitza Stark Phenotypes for gene: CCBE1 were changed from to Hennekam lymphangiectasia- lymphoedema syndrome MIM# 235510; lymphangiectasia and lymphoedema; facial abnormalities; dysmorphic features; hypoalbuminaemia; intellectual disability; hypoglobulinaemia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3990 | CCBE1 | Zornitza Stark Mode of inheritance for gene: CCBE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3989 | CCBE1 | Zornitza Stark reviewed gene: CCBE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19935664, 19911200, 19287381, 25925991, 27345729, 21778431; Phenotypes: Hennekam lymphangiectasia- lymphoedema syndrome MIM# 235510, lymphangiectasia and lymphoedema, facial abnormalities, dysmorphic features, hypoalbuminaemia, intellectual disability, hypoglobulinaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3987 | SUFU | Zornitza Stark Mode of inheritance for gene: SUFU was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3985 | SUFU |
Zornitza Stark edited their review of gene: SUFU: Added comment: Heterozygous truncating variants in SUFU in 15 subjects from 6 unrelated families of various ethnic backgrounds (familial and de novo cases). Clinical features of early-onset (congenital) ocular ataxia and developmental delay, with some phenotypic variability. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign of Joubert syndrome. Paper reports that condition reported here and SUFU-associated Basal cell nevus syndrome (Gorlin) are likely allelic disorders, as there is currently no convincing evidence for a clinical overlap. Functional studies showed no differences in cilia occurrence, morphology, or localization of ciliary proteins, such as smoothened. However, analysis of expression of HH signaling target genes detected a significant increase in the general signaling activity in COMA patient–derived fibroblasts compared with control cells. We observed higher basal HH signaling activity resulting in increased basal expression levels of GLI1, GLI2, GLI3, and Patched1. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign. Knockout mice with SuFu deficiency demonstrated that SuFu is required for proper midhindbrain patterning and controls cerebellar patterning.; Changed rating: GREEN; Changed publications: 28965847, 33024317; Changed phenotypes: Joubert syndrome 32, MIM#617757, SUFU-related neurodevelopmental syndrome; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3984 | PCDHGC4 |
Zornitza Stark gene: PCDHGC4 was added gene: PCDHGC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PCDHGC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCDHGC4 were set to 34244665 Phenotypes for gene: PCDHGC4 were set to Intellectual disability; Seizures Review for gene: PCDHGC4 was set to GREEN Added comment: Eight variants reported in 19 members of nine unreleted families with a neurodevelopmental syndrome. Severe or moderate intellectual disabilty in eight families and seizures in four families. Four of the variants were LoF, in silico analysis of the remaining missense (n=3) and splice variants were predicted to be pathogenic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3982 | CEP85L |
Zornitza Stark gene: CEP85L was added gene: CEP85L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CEP85L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CEP85L were set to 32097630 Phenotypes for gene: CEP85L were set to Lissencephaly, posterior predominant Review for gene: CEP85L was set to GREEN Added comment: Thirteen individuals reported with mono allelic variants in this gene, inherited in two of the families. Mouse model had neuronal migration defects. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3980 | IMPDH2 | Zornitza Stark reviewed gene: IMPDH2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with dystonia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3978 | LINGO4 |
Laura Raiti gene: LINGO4 was added gene: LINGO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LINGO4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LINGO4 were set to PMID: 33098801 Phenotypes for gene: LINGO4 were set to Developmental Delay, Intellectual disability, speech disorder Review for gene: LINGO4 was set to GREEN Added comment: 3 unrelated individuals 1 x individual compound heterozygous for 2x missense variants: c.679C>A; c.1262G>A p.Leu227Met; p.Arg421Gln comp het. Phenotype: infancy-onset generalized dystonia; DD/hypo, ID, speech disorder (isolated plus non-MD symptoms) NDD 1 x individual homozygous for missense variant: c.679C>A p.Leu227Met Phenotype: DD/hypo, ID, speech disorder 1 x individual homozygous for missense variant: c.1673G>A p.Ser558Asn Phenotype: DD/hypo, ID, speech disorder Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3978 | IMPDH2 |
Laura Raiti gene: IMPDH2 was added gene: IMPDH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IMPDH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: IMPDH2 were set to PMID: 33098801 Added comment: 6 unrelated individuals 1x individual in a dystonia cohort index case with infancy-onset dystonia and other neurological manifestations with a de-novo missense variant, c.338G>A (p.Gly113Glu) in IMPDH2, predicted to disrupt an invariant residue within the cystathionine-β-synthase (CBS) domain pair of the encoded protein. IMPDH2 encodes IMPDH2, a key enzyme in the purine biosynthetic pathway, expressed throughout the brain and not linked previously to any human Mendelian condition. 1x individual with a de-novo substitution, c.337G>A (p.Gly113Arg), was found in in-house whole-exome sequencing data from 500 individuals with neurodevelopmental disorders. Through GeneMatcher, de novo variants identified: 3 x missense: c.729G>C (p.Gln243His), c.619G>C (p.Gly207Arg), and c.619G>A (p.Gly207Arg) 1 x deletion: c.478_480delTCC (p.Ser160del) The six variants were predicted to be deleterious and none of them seen in control databases. All affected conserved amino acids and resided in and around the cystathionine-β-synthase domain pair. The described variants are situated in and around the CBS domain pair, a regulatory element in which clustering of pathogenic missense variants has already been shown for the homologue of IMPDH2, IMPDH1. The variant carriers shared similar neurodevelopmental phenotypes. Apart from the dystonia cohort index case, one participant had evidence of dystonic posturing. Modelling of the variants on 3D protein structures revealed spatial clustering near specific functional sites, predicted to result in deregulation of IMPDH2 activity. Additionally, thermal-shift assays showed that the c.619G>A (p.Gly207Arg) variant, identified as within the CBS domain pair, and c.729G>C (p.Gln243His), which is in close vicinity, affected the stability or folding behaviour of IMPDH2. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3977 | ATG7 |
Zornitza Stark gene: ATG7 was added gene: ATG7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATG7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATG7 were set to 34161705 Phenotypes for gene: ATG7 were set to Spinocerebellar ataxia, SCAR31, MIM#619422 Review for gene: ATG7 was set to GREEN Added comment: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The ore severely affected individuals had spastic paraplegia and inability to walk. Functional data including mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3975 | C2orf69 |
Zornitza Stark gene: C2orf69 was added gene: C2orf69 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: C2orf69 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C2orf69 were set to 34038740; 33945503 Phenotypes for gene: C2orf69 were set to Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423 Review for gene: C2orf69 was set to GREEN Added comment: PMID 34038740: 20 affected children from 8 unrelated families reported, presenting with fatal syndrome consisting of severe autoinflammation and progredient leukoencephalopathy with recurrent seizures; 12 of these subjects, whose DNA was available, segregated homozygous loss-of-function C2orf69 variants. Endogenous C2ORF69 was found to be (1) loosely bound to mitochondria, (2) affects mitochondrial membrane potential and oxidative respiration in cultured neurons, and (3) controls the levels of the glycogen branching enzyme 1 (GBE1) consistent with a glycogen-storage-associated mitochondriopathy. Zebrafish model. PMID 33945503: 8 individuals from 5 families reported with muscle hypotonia, developmental delay, progressive microcephaly, and brain MRI abnormalities. Age at onset ranged from birth to 6 months of age. Six patients had vision impairment, liver abnormalities, inflammation/inflammatory arthritis, and 5 patients had seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3973 | KDM3B | Zornitza Stark reviewed gene: KDM3B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Diets-Jongmans syndrome, MIM# 618846, Intellectual disability, dysmorphic features, short stature, Intellectual disability, short stature, deafness; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3969 | ZC3H14 | Zornitza Stark reviewed gene: ZC3H14: Rating: AMBER; Mode of pathogenicity: None; Publications: 28666327; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3968 | RNF2 |
Zornitza Stark gene: RNF2 was added gene: RNF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNF2 were set to 33864376 Phenotypes for gene: RNF2 were set to epilepsy; intellectual disability; intrauterine growth retardation Review for gene: RNF2 was set to AMBER Added comment: Not associated with any phenotype in OMIM. PMID:33864376 (Luo et al 2021) report 2 cases of children with de novo missense variants (p.R70H and p.S82R) in RNF2 and a phenotype of intrauterine growth retardation, severe intellectual disabilities, behavioral problems, seizures, feeding difficulties and dysmorphic features. Seizures started in infancy. Both variants are absent from gnomad. Functional studies in Drosophila showed that the disease-linked variants (p.R70H and p.S82R) behave as LoF alleles. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3967 | RING1 |
Zornitza Stark gene: RING1 was added gene: RING1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RING1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RING1 were set to 29386386 Phenotypes for gene: RING1 were set to microcephaly; intellectual disability Review for gene: RING1 was set to RED Added comment: Not associated with any phenotype in OMIM. PMID: 29386386 - Pierce et al 2018 - report a 13 yo female with a de novo RING1 p.R95Q variant and syndromic neurodevelopmental disabilities. Early motor and language development were normal but were delayed after the first year of life. Cognitive testing showed a verbal IQ of 55 and a visual performance IQ of 63. Head circumference at birth was -4.9 SD, and -4.2 SD at age 13 which falls into the severe microcephaly category. C. elegans with either the missense mutation or complete knockout of spat-3 (the suggested RING1 ortholog) were defective in monoubiquitylation of histone H2A and had defects in neuronal migration and axon guidance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3964 | IRX5 | Zornitza Stark Mode of inheritance for gene: IRX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3962 | IRX5 | Zornitza Stark reviewed gene: IRX5: Rating: RED; Mode of pathogenicity: None; Publications: 22581230, 27453922; Phenotypes: Hamamy syndrome, MIM# 611174; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3960 | RAB3GAP1 | Zornitza Stark Mode of inheritance for gene: RAB3GAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3959 | RAB3GAP1 | Zornitza Stark reviewed gene: RAB3GAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15696165, 20512159, 23420520, 23420520, 30730599; Phenotypes: Warburg micro syndrome 1, MIM# 600118, Martsolf syndrome 2, MIM# 619420; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3957 | GNB2 | Zornitza Stark reviewed gene: GNB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31698099, 33971351, 34183358, 33057194; Phenotypes: Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3955 | HID1 |
Zornitza Stark gene: HID1 was added gene: HID1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HID1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HID1 were set to 33999436 Phenotypes for gene: HID1 were set to Syndromic infantile encephalopathy; Hypopituitarism Review for gene: HID1 was set to GREEN Added comment: 7 individuals from 6 unrelated families reported. Clinical features included: hypopituitarism in combination with brain atrophy, thin corpus callosum, severe developmental delay, visual impairment, and epilepsy Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3952 | ERGIC3 |
Seb Lunke gene: ERGIC3 was added gene: ERGIC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ERGIC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERGIC3 were set to ERGIC3 Phenotypes for gene: ERGIC3 were set to 33710394; 31585110 Review for gene: ERGIC3 was set to AMBER Added comment: PMID: 33710394 - two homozygous sibs with mild ID, a novel canonical splice (c.717+1G>A). Absent in gnomAD, no splice studies. Classed as a VUS. PMID: 31585110 - 1 hom (p.Gln233Argfs*10) in a male 8yo with Growth retardation, Microcephaly, Learning disability, Facial dysmorphism, Abnormal pigmentation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3951 | JPH3 |
Seb Lunke gene: JPH3 was added gene: JPH3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: JPH3 was set to Unknown Publications for gene: JPH3 were set to 33824468 Phenotypes for gene: JPH3 were set to Intellectual disability; dystonia Review for gene: JPH3 was set to RED Added comment: One homozygous truncating variant (NM_020655.4: c.1740dup; p.(Val581Argfs*137)) found in a female individual affected with genetically undetermined neurodevelopmental anomalies (including delayed motor milestones, abnormal social communication, language difficulties and borderline cognitive impairment) and paroxysmal attacks of dystonia since her early infancy. No functional work were performed. Only STRs disease causing, see separate STR list. No evidence for SNVs etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3947 | HEATR5B |
Seb Lunke gene: HEATR5B was added gene: HEATR5B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HEATR5B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HEATR5B were set to 33824466 Phenotypes for gene: HEATR5B were set to pontocerebellar hypoplasia; intellectual disability; seizures Review for gene: HEATR5B was set to AMBER Added comment: Four affected children from two families presenting with pontocerebellar hypoplasiawith neonatal seizures, severe ID and motor delay. Two homozygous splice variants were reported (c.5051–1G>A and c.5050+4A>G) in intron 31 of HEATR5B gene. Aberrant splicing was found in patient fibroblasts, which correlated with reduced levels of HEATR5B protein. Homozygous knockout mice were not viable. *NOTE: gene (and alias) not found in OMIM Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3938 | GNB2 | Arina Puzriakova reviewed gene: GNB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31698099, 33971351, 34183358; Phenotypes: Intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3937 | EPHA7 |
Zornitza Stark gene: EPHA7 was added gene: EPHA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: EPHA7. Mode of inheritance for gene: EPHA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPHA7 were set to 34176129 Phenotypes for gene: EPHA7 were set to Intellectual disability Review for gene: EPHA7 was set to AMBER Added comment: Lévy et al (2021 - PMID: 34176129) provide evidence that haploinssuficiency of EPHA7 results in a neurodevelopmental disorder. The authors report on 12 individuals belonging to 9 unrelated families, all harboring with 6q microdeletions spanning EPHA7. Overlapping features included DD (13/13), ID (10/10 - mild in most cases, individuals with larger CNVs/additional variants had more severe phenotype), speech delay and behavioral disorders. Variable other features incl. hypotonia (70%), non specific facial features, eye abnormalities (40%) and cardiac defects (25%). The CNVs ranged from 152 kb to few Mb in size but in 4 subjects (P5-8) were only minimal, involving only EPHA7. 9 out of 12 individuals had inherited the deletion (5 subjects paternal, 4 maternal), in 1 subject (P12) this occured de novo, while for 2 others inheritance was not specified. Most deletions were inherited from an unaffected parent (in 6/7 families), with unclear contribution in a further one. The authors discuss on previous studies suggesting an important role for EphA7 in brain development (modulation of cell-cell adhesion and repulsion, regulation of dendrite morphogenesis in early corticogenesis, role in dendritic spine formation later in development. EphA7 has also been proposed to drive neuronal maturation and synaptic function). Haploinsufficiency for other ephrins or ephrin receptors has been implicated in other NDDs. Overall Lévy et al promote incomplete penetrance and variable expressivity with haploinsufficiency of this gene being a risk factor for NDD. [The gene has also an %HI of 2.76% and a pLI of 1]. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3934 | DNM1 | Zornitza Stark Mode of inheritance for gene: DNM1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3933 | DNM1 | Zornitza Stark reviewed gene: DNM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25262651, 27066543, 33372033, 34172529; Phenotypes: Developmental and epileptic encephalopathy 31, OMIM:616346; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3931 | TTC8 | Zornitza Stark Mode of inheritance for gene: TTC8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3930 | TTC8 | Zornitza Stark reviewed gene: TTC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 14520415, 19797195; Phenotypes: Bardet-Biedl syndrome 8, MIM# 615985; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3930 | FTCD | Elena Savva reviewed gene: FTCD: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 29178637, 30740726; Phenotypes: Glutamate formiminotransferase deficiency MIM#229100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3929 | ATP9A |
Zornitza Stark gene: ATP9A was added gene: ATP9A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP9A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATP9A were set to http://dx.doi.org/10.1136/jmedgenet-2021-107843 Phenotypes for gene: ATP9A were set to Neurodevelopmental delay; Postnatal microcephaly; Failure to thrive; Gastrointestinal symptoms Review for gene: ATP9A was set to AMBER Added comment: Vogt et al. 2021 report on 3 individuals from 2 unrelated consanguineous families with different homozygous truncating variants in ATP9A, presenting with DD/ID of variable degree (2 mild, 1 severe), postnatal microcephaly (OFC range: −2.33 SD to −3.58 SD), failure to thrive, and gastrointestinal symptoms. Patient-derived fibroblasts showed reduced expression of ATP9A, and consistent with previous findings also overexpression of interacting partners, ARPC3 and SNX3. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3928 | ATP2C2 |
Zornitza Stark gene: ATP2C2 was added gene: ATP2C2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP2C2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP2C2 were set to 33864365; 28440294 Phenotypes for gene: ATP2C2 were set to language impairment, HP:0002463 Review for gene: ATP2C2 was set to RED Added comment: PMID: 33864365 - Martinelli et al 2021 - report a family with a missense variant NM_001286527.2:c.304G>A, p.(Val102Met) in ATP2C2 in a father and two siblings with specific language impairment. However two other affected siblings did not have this variant. This variant was also reported by Chen et al. They found that the variant had a higher frequency in language cases (1.8%, N = 360) compared with cohorts selected for dyslexia (0.8%, N = 520) and ADHD (0.7%, N = 150), which presented frequencies comparable to reference databases (0.9%, N = 24 046 gnomAD controls). They postulate that variant is not sufficient on its own to cause a disorder but is a susceptibility factor which increases the risk for language impairment. PMID: 28440294 - Chen et al 2017 - report 2 probands with severe learning impairment, and missense variants in ATP2C2 (NM_001286527: c.G304A:p.V102M and NM_001291454:exon21: c.C1936T:p.R646W). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3925 | TMEM67 | Zornitza Stark Mode of inheritance for gene: TMEM67 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3924 | TMEM67 | Zornitza Stark reviewed gene: TMEM67: Rating: GREEN; Mode of pathogenicity: None; Publications: 16415887, 17377820, 17160906, 19508969; Phenotypes: Joubert syndrome 6, MIM# 610688, Meckel syndrome 3, MIM# 607361, COACH syndrome 1, MIM# 216360; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3922 | SDCCAG8 | Zornitza Stark Mode of inheritance for gene: SDCCAG8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3921 | SDCCAG8 | Zornitza Stark reviewed gene: SDCCAG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 20835237, 22626039, 22626039, 32432520, 31534065, 26968886; Phenotypes: Bardet-Biedl syndrome 16, MIM# 615993, MONDO:0014444, Senior-Loken syndrome 7, MIM# 613615, MONDO:0013326, Nephronophthisis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3921 | KIF1B |
Paul De Fazio gene: KIF1B was added gene: KIF1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIF1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF1B were set to 33710394 Phenotypes for gene: KIF1B were set to Hypotonia; coloboma; hypoplasia of the corpus callosum; severe neurodevelopmental delay Review for gene: KIF1B was set to RED gene: KIF1B was marked as current diagnostic Added comment: Compound heterozygous missense variants reported in a woman with severe hypotonia, hypsarrhythmia, coloboma, hypoplasia of corpus callosum, severe neurodevelopmental delay. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3921 | MYT1 |
Paul De Fazio gene: MYT1 was added gene: MYT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MYT1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MYT1 were set to 33710394 Phenotypes for gene: MYT1 were set to Intellectual disability Review for gene: MYT1 was set to RED gene: MYT1 was marked as current diagnostic Added comment: Missense variant reported de novo in a patient with mild ID. Patient also had a COL9A2 variant and skeletal features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3921 | ZC3H14 | Elena Savva reviewed gene: ZC3H14: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 21734151, 33710394; Phenotypes: Mental retardation, autosomal recessive 56 MIM#617125; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3921 | SAMD9L |
Paul De Fazio gene: SAMD9L was added gene: SAMD9L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SAMD9L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for gene: SAMD9L were set to Intellectual disability Review for gene: SAMD9L was set to RED gene: SAMD9L was marked as current diagnostic Added comment: Missense variant reported de novo in a patient with moderate ID, in a large cohort study. Author described it as a phenotype expansion as ataxia-pancytopenia not found in that patient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3919 | ARHGEF9 | Zornitza Stark Mode of inheritance for gene: ARHGEF9 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3918 | ARHGEF9 | Zornitza Stark reviewed gene: ARHGEF9: Rating: GREEN; Mode of pathogenicity: None; Publications: 31942680, 30048823, 29130122, 28620718, 33600053, 32939676; Phenotypes: Developmental and epileptic encephalopathy 8, MIM# 300607; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3918 | DDX59 | Zornitza Stark Mode of inheritance for gene: DDX59 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3915 | CEP83 | Zornitza Stark Mode of inheritance for gene: CEP83 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3914 | CEP83 | Zornitza Stark reviewed gene: CEP83: Rating: GREEN; Mode of pathogenicity: None; Publications: 24882706, 33938610; Phenotypes: Nephronophthisis 18, MIM# 615862, MONDO:0014374, Retinal dystrophy, ID; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3913 | CEP164 |
Zornitza Stark gene: CEP164 was added gene: CEP164 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CEP164 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CEP164 were set to 34132027; 34013113; 32055034; 27708425; 22863007 Phenotypes for gene: CEP164 were set to Bardet-Biedl syndrome; Nephronophthisis 15, MIM# 614845; Oro-facio-digital syndrome Review for gene: CEP164 was set to GREEN Added comment: More than 10 unrelated families reported. Although this is labelled as a nephronophthisis gene in OMIM, some of the reported individuals have had features such as retinal involvement, ID and polydactyly to suggest a more BBS-like phenotype. Also note one individual reported with OFD-like phenotype. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3909 | C5orf42 | Zornitza Stark Mode of inheritance for gene: C5orf42 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3908 | C5orf42 | Zornitza Stark reviewed gene: C5orf42: Rating: GREEN; Mode of pathogenicity: None; Publications: 22425360, 24178751; Phenotypes: Joubert syndrome 17, MIM# 614615, MONDO:0013824, Orofaciodigital syndrome VI, MIM# 277170; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3905 | BBS9 | Zornitza Stark Mode of inheritance for gene: BBS9 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3904 | BBS9 | Zornitza Stark reviewed gene: BBS9: Rating: GREEN; Mode of pathogenicity: None; Publications: 16380913, 22353939, 32686083, 32037757; Phenotypes: Bardet-Biedl syndrome 9, MIM#615986, MONDO:0014437; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3902 | BBS7 | Zornitza Stark Mode of inheritance for gene: BBS7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3901 | BBS7 | Zornitza Stark reviewed gene: BBS7: Rating: GREEN; Mode of pathogenicity: None; Publications: 12567324, 21937992, 19797195; Phenotypes: Bardet-Biedl syndrome 7, MIM# 615984, MONDO:0014435; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3899 | BBS5 | Zornitza Stark Mode of inheritance for gene: BBS5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3898 | BBS5 | Zornitza Stark reviewed gene: BBS5: Rating: GREEN; Mode of pathogenicity: None; Publications: 19252258, 15137946, 10053027, 15637713; Phenotypes: Bardet-Biedl syndrome 5, MIM#615983, MONDO:0014434; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3896 | BBS4 | Zornitza Stark Mode of inheritance for gene: BBS4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3895 | BBS4 | Zornitza Stark reviewed gene: BBS4: Rating: GREEN; Mode of pathogenicity: None; Publications: 12016587, 11381270; Phenotypes: Bardet-Biedl syndrome 4, MIM#615982, MONDO:0014433; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3893 | ARL6 | Zornitza Stark Mode of inheritance for gene: ARL6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3892 | ARL6 | Zornitza Stark reviewed gene: ARL6: Rating: GREEN; Mode of pathogenicity: None; Publications: 15258860, 32361989, 31888296, 25402481; Phenotypes: Bardet-Biedl syndrome 3, MIM# 600151; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3892 | PPP2R1A | Zornitza Stark Phenotypes for gene: PPP2R1A were changed from to Mental retardation, autosomal dominant 36, MIM#616362; Microcephaly-corpus callosum hypoplasia-intellectual disability-facial dysmorphism syndrome, MONDO:0014605 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3890 | PPP2R1A | Zornitza Stark Mode of inheritance for gene: PPP2R1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3889 | PPP2R1A | Zornitza Stark reviewed gene: PPP2R1A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 36, MIM#616362, Microcephaly-corpus callosum hypoplasia-intellectual disability-facial dysmorphism syndrome, MONDO:0014605; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3887 | CLPB | Zornitza Stark Mode of inheritance for gene: CLPB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3886 | CLPB | Zornitza Stark reviewed gene: CLPB: Rating: GREEN; Mode of pathogenicity: None; Publications: 25597510, 34140661; Phenotypes: 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3883 | ARCN1 | Zornitza Stark Mode of inheritance for gene: ARCN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3882 | ARCN1 | Zornitza Stark reviewed gene: ARCN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27476655, 33154040; Phenotypes: Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3880 | SLC13A5 | Zornitza Stark Mode of inheritance for gene: SLC13A5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3879 | SLC13A5 | Zornitza Stark reviewed gene: SLC13A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 24995870, 26384929; Phenotypes: Developmental and epileptic encephalopathy 25, with amelogenesis imperfecta MIM#615905, MONDO:0014392; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3878 | CTC1 | Zornitza Stark Mode of inheritance for gene: CTC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3876 | CTC1 | Zornitza Stark reviewed gene: CTC1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3875 | IFT74 |
Zornitza Stark gene: IFT74 was added gene: IFT74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IFT74 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT74 were set to 27486776; 32144365; 33531668 Phenotypes for gene: IFT74 were set to Bardet-Biedl syndrome 20, MIM# 617119; Joubert syndrome Review for gene: IFT74 was set to GREEN Added comment: Two individuals reported with BBS phenotype. PMID 33531668: Identified IFT74 as a JBTS-associated gene in 3 unrelated families through WES. All the affected individuals carried truncated variants and shared one missense variant (p.Q179E) found only in East Asians. The expression of the human p.Q179E-IFT74 variant displayed compromised rescue effects in zebrafish ift74 morphants. Attenuated ciliogenesis; altered distribution of IFT proteins and ciliary membrane proteins, including ARL13B, INPP5E, and GPR161; and disrupted hedgehog signaling were observed in patient fibroblasts with IFT74 variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3864 | RFX4 |
chirag patel gene: RFX4 was added gene: RFX4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RFX4 were set to PMID: 33658631 Phenotypes for gene: RFX4 were set to ID, ASD, ADHD Review for gene: RFX4 was set to GREEN Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3864 | RFX3 |
chirag patel gene: RFX3 was added gene: RFX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RFX3 were set to PMID: 33658631 Phenotypes for gene: RFX3 were set to ID, ASD, ADHD Review for gene: RFX3 was set to GREEN Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3864 | RFX7 |
chirag patel gene: RFX7 was added gene: RFX7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RFX7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RFX7 were set to PMID: 33658631 Phenotypes for gene: RFX7 were set to ID, ASD, ADHD Review for gene: RFX7 was set to GREEN Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3863 | DLG4 | chirag patel reviewed gene: DLG4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33597769; Phenotypes: Intellectual developmental disorder 62; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3863 | GNAI1 | chirag patel reviewed gene: GNAI1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 33473207; Phenotypes: Developmental delay, seizures, and hypotonia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3862 | FARSA |
chirag patel gene: FARSA was added gene: FARSA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FARSA were set to PMID: 33598926 Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2 Review for gene: FARSA was set to GREEN gene: FARSA was marked as current diagnostic Added comment: FARSA is a subunit with FARSB to form FARS1 enzyme. Bi-allelic mutations in FARSB are well described. Schuch et al. (2021) report 3 unrelated individuals with bi-allelic variants in FARSA. Identified through WES and variants segregated with disease. Functional evidence was obtained with reduced FARS1 enzyme activity levels in fibroblasts or EBV-transformed lymphoblastoid cell lines (EBV-LCLs) of patients. Common to all was a chronic interstitial lung disease starting early in life and characterized by bilateral ground-glass opacification on HR-CT, and cholesterol pneumonitis in lung histology. Additional abnormalities in other organ systems include liver disease, neurological manifestations, and growth restriction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3859 | ZNF81 | Zornitza Stark Mode of inheritance for gene: ZNF81 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3857 | ZNF81 | Zornitza Stark reviewed gene: ZNF81: Rating: RED; Mode of pathogenicity: None; Publications: 15121780; Phenotypes: Intellectual disability; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3856 | FOXP1 | Zornitza Stark reviewed gene: FOXP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34109629; Phenotypes: Mental retardation with language impairment and with or without autistic features 613670; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3853 | SRCAP | Zornitza Stark Mode of inheritance for gene: SRCAP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3852 | SRCAP | Zornitza Stark reviewed gene: SRCAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, non-Floating Harbor; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3850 | PIGF | Zornitza Stark reviewed gene: PIGF: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Onychodystrophy, osteodystrophy, impaired intellectual development, and seizures syndrome, MIM# 619356; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3847 | LTBP1 |
Chern Lim gene: LTBP1 was added gene: LTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LTBP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LTBP1 were set to 33991472 Phenotypes for gene: LTBP1 were set to cutis laxa syndrome Review for gene: LTBP1 was set to GREEN gene: LTBP1 was marked as current diagnostic Added comment: PMID:33991472 - Premature truncating variants in multiple affected individuals from 4 unrelated consanguineous families. - Affected individuals present with connective tissue features (cutis laxa and inguinal hernia), craniofacial dysmorphology, variable heart defects, and prominent skeletal features (craniosynostosis, short stature, brachydactyly, and syndactyly). - Most of the affected individuals have developmental delay and other neurological features. - Functional studies done on patient fibroblasts and zebrafish models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3847 | PGM2L1 |
Chern Lim gene: PGM2L1 was added gene: PGM2L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PGM2L1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PGM2L1 were set to 33979636 Phenotypes for gene: PGM2L1 were set to Neurodevelopmental disorder Review for gene: PGM2L1 was set to GREEN gene: PGM2L1 was marked as current diagnostic Added comment: PMID: 33979636: - Hom/chet PTVs in 4 unrelated individuals. All four affected individuals had severe developmental and speech delay, dysmorphic facial features, ear anomalies, high arched palate, strabismus, hypotonia, and keratosis pilaris. Early obesity and seizures were present in three individuals. - Studies on patient fibroblasts and cell lines indicated that PGM2L1 deficiency causes a decrease, but not a disappearance, of the sugar bisphosphates needed for the formation of NDP-sugars and that there is no evidence that this leads to a glycosylation defect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3846 | ATXN2L |
Sue White gene: ATXN2L was added gene: ATXN2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATXN2L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATXN2L were set to 33283965; 33057194 Phenotypes for gene: ATXN2L were set to macrocephaly; intellectual disability Penetrance for gene: ATXN2L were set to Complete Review for gene: ATXN2L was set to AMBER Added comment: Combined data from three large exome groups identified several de novo variants, including frameshift and missense, in ATXN2L in patients with developmental delay (Kaplanis et al., 2020). pLI=1.0 Single case report of a novel de novo missense variant in a child with macrocephaly and developmental delay. No functional work. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3845 | BCAS3 |
Paul De Fazio gene: BCAS3 was added gene: BCAS3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BCAS3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BCAS3 were set to 34022130 Phenotypes for gene: BCAS3 were set to Syndromic neurodevelopmental disorder Review for gene: BCAS3 was set to GREEN gene: BCAS3 was marked as current diagnostic Added comment: 15 individuals from eight unrelated families with germline bi-allelic loss-of-function variants in BCAS3. All probands share a global developmental delay accompanied by pyramidal tract involvement, microcephaly, short stature, strabismus, dysmorphic facial features, and seizures. Patient fibroblasts confirmed absence of BCAS3 protein. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3845 | SRCAP |
Paul De Fazio changed review comment from: Truncating variants in exons 33 and 34 of the SNF2-related CREBBP activator protein (SRCAP) gene cause the neurodevelopmental disorder Floating-Harbor syndrome (FLHS). A cohort of 33 individuals with mostly de novo truncating variants both proximal and distal to the FLHS locus were found to have a distinct phenotype and DNA methylation pattern to FLHS.; to: Truncating variants in exons 33 and 34 of the SNF2-related CREBBP activator protein (SRCAP) gene cause the neurodevelopmental disorder (NDD) Floating-Harbor syndrome (FLHS). A cohort of 33 individuals with mostly de novo truncating variants both proximal and distal to the FLHS locus were found to have a distinct phenotype and DNA methylation pattern to FLHS, referred to by the authors as "non-FLHS SRCAP-related NDD". |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3845 | SRCAP | Paul De Fazio reviewed gene: SRCAP: Rating: GREEN; Mode of pathogenicity: None; Publications: 33909990; Phenotypes: Floating-Harbor syndrome MIM#136140; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3845 | SYT1 | Zornitza Stark reviewed gene: SYT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30107533; Phenotypes: Baker-Gordon syndrome, MIM# 618218, MONDO:0033864; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3842 | UBTF | Zornitza Stark Mode of inheritance for gene: UBTF was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3841 | UBTF | Zornitza Stark reviewed gene: UBTF: Rating: GREEN; Mode of pathogenicity: None; Publications: 28777933, 29300972; Phenotypes: Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672, MONDO:0044701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3838 | SLC9A6 | Zornitza Stark Mode of inheritance for gene: SLC9A6 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3837 | SLC9A6 | Zornitza Stark reviewed gene: SLC9A6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18342287, 19377476, 25044251, 33278113, 32569089, 31879735; Phenotypes: Mental retardation, X-linked syndromic, Christianson type, MIM# 300243, MONDO:0010278; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3835 | SHANK3 | Zornitza Stark Mode of inheritance for gene: SHANK3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3834 | SHANK3 | Zornitza Stark reviewed gene: SHANK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 16284256, 17173049, 20186804, 22892527; Phenotypes: Phelan-McDermid syndrome, MIM# 606232, MONDO:0011652; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3832 | SATB2 | Zornitza Stark Mode of inheritance for gene: SATB2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3831 | SATB2 | Zornitza Stark reviewed gene: SATB2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29023086, 28151491, 32446642; Phenotypes: Glass syndrome, MIM# 612313, MONDO:0100147; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3831 | MEF2C | Zornitza Stark Phenotypes for gene: MEF2C were changed from to Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM# 613443; MONDO:0013266 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3829 | MEF2C | Zornitza Stark Mode of inheritance for gene: MEF2C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3828 | MEF2C | Zornitza Stark reviewed gene: MEF2C: Rating: GREEN; Mode of pathogenicity: None; Publications: 19876902, 19471318, 19592390, 19592390, 20513142, 34055696, 34022131; Phenotypes: Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM# 613443, MONDO:0013266 Edit; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3828 | MBD5 | Zornitza Stark edited their review of gene: MBD5: Changed phenotypes: Mental retardation, autosomal dominant 1, MIM# 156200, MONDO:0007974 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3828 | MBD5 | Zornitza Stark Phenotypes for gene: MBD5 were changed from to Mental retardation, autosomal dominant 1, MIM# 156200; MONDO:0007974 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3826 | MBD5 | Zornitza Stark Mode of inheritance for gene: MBD5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3825 | MBD5 | Zornitza Stark reviewed gene: MBD5: Rating: GREEN; Mode of pathogenicity: None; Publications: 18812405, 21981781, 23708187, 22726846, 33912662; Phenotypes: 18812405, 21981781, 23708187, 22726846, 33912662; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3823 | IQSEC2 | Zornitza Stark Mode of inheritance for gene: IQSEC2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3820 | EHMT1 | Zornitza Stark commented on gene: EHMT1: Well established gene-disease association. Deletions are common. Key features includeID/seizures/microcephaly/dysmorphism/congenital anomalies. More than 100 individuals reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3820 | EEF1A2 | Zornitza Stark Phenotypes for gene: EEF1A2 were changed from Epileptic encephalopathy, early infantile, 33, MIM# 616409; Mental retardation, autosomal dominant 38, MIM# 616393 to Mental retardation, autosomal dominant 38, MIM# 616393; MONDO:0014617; Developmental and epileptic encephalopathy 33, MIM# 616409; MONDO:0014625 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3818 | EEF1A2 | Zornitza Stark edited their review of gene: EEF1A2: Changed phenotypes: Mental retardation, autosomal dominant 38, MIM# 616393, MONDO:0014617, Developmental and epileptic encephalopathy 33, MIM# 616409, MONDO:0014625 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3816 | MASP1 | Zornitza Stark Mode of inheritance for gene: MASP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3815 | MASP1 | Zornitza Stark reviewed gene: MASP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26789649, 21258343, 21035106; Phenotypes: 3MC syndrome 1, MIM# 257920, MONDO:0009770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3813 | BRPF1 | Zornitza Stark Mode of inheritance for gene: BRPF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3812 | BRPF1 | Zornitza Stark reviewed gene: BRPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27939640, 27939639, 32652122; Phenotypes: Intellectual developmental disorder with dysmorphic facies and ptosis, MIM# 617333, MONDO:0015022; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3810 | POGZ | Zornitza Stark Mode of inheritance for gene: POGZ was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3809 | POGZ | Zornitza Stark reviewed gene: POGZ: Rating: GREEN; Mode of pathogenicity: None; Publications: 33098347, 31782611, 26942287; Phenotypes: White-Sutton syndrome, MIM# 616364, MONDO:0014606; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3807 | UBE3B | Zornitza Stark Mode of inheritance for gene: UBE3B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3806 | UBE3B | Zornitza Stark reviewed gene: UBE3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 23200864, 23200864, 34012380, 32949109; Phenotypes: Kaufman oculocerebrofacial syndrome, MIM# 244450, MONDO:0009485; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3804 | TAF6 | Zornitza Stark Mode of inheritance for gene: TAF6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3803 | TAF6 | Zornitza Stark reviewed gene: TAF6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25558065, 25574841, 32030742; Phenotypes: Alazami-Yuan syndrome, MIM# 617126; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3802 | PSMC3 |
Zornitza Stark gene: PSMC3 was added gene: PSMC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSMC3 were set to 32500975 Phenotypes for gene: PSMC3 were set to Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354 Review for gene: PSMC3 was set to AMBER Added comment: Three affected individuals from a single consanguineous family reported with homozygous intronic variant. Animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3800 | GEMIN5 |
Zornitza Stark gene: GEMIN5 was added gene: GEMIN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GEMIN5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GEMIN5 were set to 33963192 Phenotypes for gene: GEMIN5 were set to Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, MIM# 619333 Review for gene: GEMIN5 was set to GREEN Added comment: Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction (NEDCAM) is an autosomal recessive disorder characterized by global developmental delay with prominent motor abnormalities, mainly axial hypotonia, gait ataxia, and appendicular spasticity. Affected individuals have cognitive impairment and speech delay; brain imaging shows cerebellar atrophy. 30 individuals from 22 unrelated families reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3796 | NFU1 | Zornitza Stark Mode of inheritance for gene: NFU1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3795 | NFU1 | Zornitza Stark reviewed gene: NFU1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21944046, 22077971, 32747156, 29441221; Phenotypes: Multiple mitochondrial dysfunctions syndrome 1, MIM# 605711; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3793 | RAB11B | Zornitza Stark Mode of inheritance for gene: RAB11B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3792 | RAB11B | Zornitza Stark reviewed gene: RAB11B: Rating: GREEN; Mode of pathogenicity: None; Publications: 29106825; Phenotypes: Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3791 | UFSP2 | Zornitza Stark edited their review of gene: UFSP2: Added comment: Additional cases identified in 100,000 Genomes project.; Changed rating: GREEN; Changed phenotypes: Abnormal muscle tone, Seizures, Global developmental delay, Delayed speech and language development, Intellectual disability, Strabismus; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3789 | ADNP | Zornitza Stark Mode of inheritance for gene: ADNP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3788 | ADNP | Zornitza Stark reviewed gene: ADNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 24531329, 25057125, 25533962, 29724491, 29911927; Phenotypes: Helsmoortel-van der Aa syndrome MIM#615873, MONDO:0014379; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3787 | PARP6 |
Zornitza Stark gene: PARP6 was added gene: PARP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PARP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PARP6 were set to Cells 2021, 10(6), 1289; https://doi.org/10.3390/cells10061289 Phenotypes for gene: PARP6 were set to Intellectual disability; Epilepsy; Microcephaly Review for gene: PARP6 was set to GREEN Added comment: Four unrelated individuals reported with de novo variants in this gene and a neurodevelopmental phenotype. Supportive functional data. One pair of siblings with a homozygous missense: limited evidence for bi-allelic variants causing disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3786 | UFSP2 |
Konstantinos Varvagiannis changed review comment from: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature; to: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. **Monoallelic** (correction to previous review) UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3785 | UFSP2 |
Konstantinos Varvagiannis gene: UFSP2 was added gene: UFSP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UFSP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UFSP2 were set to 33473208 Phenotypes for gene: UFSP2 were set to Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus Penetrance for gene: UFSP2 were set to Complete Review for gene: UFSP2 was set to AMBER Added comment: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3785 | FAR1 | Zornitza Stark Phenotypes for gene: FAR1 were changed from Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154; 33239752 to Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154; Cataracts, spastic paraparesis, and speech delay, MIM#619338 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3784 | FAR1 | Zornitza Stark edited their review of gene: FAR1: Changed phenotypes: Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154, Cataracts, spastic paraparesis, and speech delay, MIM#619338 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3784 | BICRA | Zornitza Stark Phenotypes for gene: BICRA were changed from Developmental delay, intellectual disability, autism spectrum disorder,behavioral abnormalities, dysmorphic features to Coffin-Siris syndrome-12, MIM#619325; Developmental delay, intellectual disability, autism spectrum disorder,behavioral abnormalities, dysmorphic features | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3783 | BICRA | Zornitza Stark reviewed gene: BICRA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Coffin-Siris syndrome-12, MIM#619325; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3782 | TBC1D2B | Zornitza Stark Phenotypes for gene: TBC1D2B were changed from Global developmental delay; Intellectual disability; Seizures; Gingival overgrowth; Behavioral abnormality; Abnormality of the mandible; Abnormality of brain morphology; Abnormality of the eye; Hearing abnormality to Neurodevelopmental disorder with seizures and gingival overgrowth (NEDSGO), MIM#619323; Global developmental delay; Intellectual disability; Seizures; Gingival overgrowth; Behavioral abnormality; Abnormality of the mandible; Abnormality of brain morphology; Abnormality of the eye; Hearing abnormality | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3781 | TBC1D2B | Zornitza Stark reviewed gene: TBC1D2B: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with seizures and gingival overgrowth (NEDSGO), MIM#619323; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3780 | SCN1A | Zornitza Stark reviewed gene: SCN1A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Epileptic encephalopathy, early infantile, 6 (Dravet syndrome) 607208 Developmental and epileptic encephalopathy 6B, non-Dravet, MIM# 619317; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3780 | KDM4B | Zornitza Stark Phenotypes for gene: KDM4B were changed from Global developmental delay, intellectual disability and neuroanatomical defects to Intellectual developmental disorder, autosomal dominant 65, MIM# 619320; Global developmental delay, intellectual disability and neuroanatomical defects | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3779 | KDM4B | Zornitza Stark reviewed gene: KDM4B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, autosomal dominant 65, MIM# 619320; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3777 | THOC2 | Zornitza Stark Mode of inheritance for gene: THOC2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3776 | THOC2 | Paul De Fazio reviewed gene: THOC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26166480, 32116545, 29851191, 32960281; Phenotypes: Mental retardation, X-linked 12/35 MIM#300957; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3775 | CPE |
Zornitza Stark gene: CPE was added gene: CPE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CPE was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CPE were set to 26120850; 32936766 Phenotypes for gene: CPE were set to Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326 Review for gene: CPE was set to AMBER Added comment: Four affected individuals from two unrelated families reported, bi-allelic LoF variants. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3774 | SIAH1 | Zornitza Stark Phenotypes for gene: SIAH1 were changed from Developmental delay; Infantile hypotonia; Dysmorphic features; Laryngomalacia to Buratti-Harel syndrome, MIM# 619314; Developmental delay; Infantile hypotonia; Dysmorphic features; Laryngomalacia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3773 | SIAH1 | Zornitza Stark edited their review of gene: SIAH1: Changed phenotypes: Buratti-Harel syndrome, MIM# 619314, Developmental delay, Infantile hypotonia, Dysmorphic features, Laryngomalacia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3771 | SMARCA5 |
Zornitza Stark gene: SMARCA5 was added gene: SMARCA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMARCA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMARCA5 were set to 33980485 Phenotypes for gene: SMARCA5 were set to Neurodevelopmental disorder; microcephaly; dysmorphic features Review for gene: SMARCA5 was set to GREEN Added comment: 12 individuals reported with either de novo or appropriately segregating variants in this gene and mild developmental delay, frequent postnatal short stature and microcephaly, and recurrent dysmorphic features. Functional data supports gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3770 | FBXW7 |
Zornitza Stark gene: FBXW7 was added gene: FBXW7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXW7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FBXW7 were set to 33057194 Phenotypes for gene: FBXW7 were set to FBXW7-related neurodevelopmental syndrome Review for gene: FBXW7 was set to GREEN Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio developmental disorder study. 12 de novo missense and 1 de novo synonymous variant identified in ~10,000 cases with developmental disorders (no other phenotype info provided). We are aware of additional cases pending publication. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3769 | SPG11 | Zornitza Stark Phenotypes for gene: SPG11 were changed from to Spastic paraplegia 11, autosomal recessive 604360 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3767 | SPG11 | Zornitza Stark Mode of inheritance for gene: SPG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3766 | SPG11 | Zornitza Stark reviewed gene: SPG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 33581793; Phenotypes: Spastic paraplegia 11, autosomal recessive 604360; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3764 | SPTAN1 | Zornitza Stark Mode of inheritance for gene: SPTAN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3763 | SPTAN1 | Zornitza Stark reviewed gene: SPTAN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20493457, 22258530, 32811770; Phenotypes: Developmental and epileptic encephalopathy 5, MIM# 613477; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3762 | SPEN | Zornitza Stark Phenotypes for gene: SPEN were changed from Intellectual disability; autism; congenital anomalies to Radio-Tartaglia syndrome, MIM# 619312; Intellectual disability; autism; congenital anomalies | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3759 | AFF3 | Zornitza Stark Mode of inheritance for gene: AFF3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3758 | AFF3 | Zornitza Stark reviewed gene: AFF3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31388108, 33961779; Phenotypes: KINSSHIP syndrome, MIM# 619297; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3756 | CAPN15 |
Zornitza Stark gene: CAPN15 was added gene: CAPN15 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CAPN15 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CAPN15 were set to 33410501; 32885237 Phenotypes for gene: CAPN15 were set to Oculogastrointestinal neurodevelopmental syndrome, MIM# 619318 Review for gene: CAPN15 was set to GREEN Added comment: 5 families reported, including DD/ID in 3. Profound in one family with bi-allelic LoF variant, PMID 33410501. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3755 | EXOC2 | Zornitza Stark Phenotypes for gene: EXOC2 were changed from Global developmental delay; Intellectual disability; Abnormality of the face; Abnormality of brain morphology to Neurodevelopmental disorder with dysmorphic facies and cerebellar hypoplasia, MIM# 619306; Global developmental delay; Intellectual disability; Abnormality of the face; Abnormality of brain morphology | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3754 | EXOC2 | Zornitza Stark reviewed gene: EXOC2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with dysmorphic facies and cerebellar hypoplasia, MIM# 619306; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3753 | TMEM222 |
Konstantinos Varvagiannis gene: TMEM222 was added gene: TMEM222 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM222 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM222 were set to 33824500 Phenotypes for gene: TMEM222 were set to Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality Penetrance for gene: TMEM222 were set to Complete Review for gene: TMEM222 was set to GREEN Added comment: Polla et al (2021 - PMID: 33824500) report 17 individuals from 9 unrelated families, with biallelic TMEM222 pathogenic variants. The phenotype included motor, speech delay and moderate to severe ID (as universal features). Other manifestations included hypotonia (10/15), broad gait (5/12), seizures (7/17 - belonging to 6/9 families), MRI abnormalities (5/8). Variable behavioral abnormalities were observed (aggressive behavior, shy character, stereotypic movements etc). Abnormal OFC was a feature in several with microcephaly in 7 subjects from 4 families (measurements not available for all 17). Nonspecific facial features were reported in 10/17. Rare features incl. body tremors, decreased lower extremity muscle mass or disorder of motor neurons. TMEM222 variants were identified following exome sequencing. Previous investigations incl. metabolic studies, FMR1, chromosomes by standard karyotype or CMA, SMA, CMT1A were reported to be normal (available for some individuals). TMEM222 variants missense and pLoF ones mostly found in homozygosity (7/9 families were consanguineous, compound heterozygosity reported in a single case from the 9 families). Sanger sequencing was used for confirmation of variants, parental carrier state as well as testing of sibs (unaffected sibs tested in 4 families). Few individuals had additional genetic findings in other genes, though classified as VUS (3 families). The gene encodes transmembrane protein 222 (208 residues) which however has unknown function. The protein comprises 3 transmembrane domains and a domain of unknown function. TMEMs are a group of transmembrane proteins spanning membranes with - most commonly - unclear function. The authors measured expression by qPCR mRNA analysis, demonstrating highest fetal and adult brain expression (incl. parietal and occipital cortex). Expression levels from GTEx data also support a role in neurodevelopment. Immunocytochemistry revealed highest levels in mature human iPSC-derived glutaminergic cortical neurons and moderate in immature ones. Additional studies supported that the gene is highly expressed in dendrites and might play a role in postsynaptic vesicles (colocalization with postsynaptic and early endosomal markers). A previous study by Riazuddin et al (2017 - PMID: 27457812) had identified TMEM222 as a candidate gene for ID. This family (PKMR213) however appears to be included as family 2 in the aforementioned publication (same pedigree, variant and phenotype in both articles). In OMIM there is currently no associated phenotype. The gene is listed among the primary ID genes in SysID. Please consider inclusion in the ID panel with green (or amber) rating. This gene may also be included in other panels e.g. for epilepsy, microcephaly, etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3752 | CHD5 |
Zornitza Stark gene: CHD5 was added gene: CHD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHD5 were set to 33944996 Phenotypes for gene: CHD5 were set to Intellectual disability; Epilepsy Review for gene: CHD5 was set to GREEN Added comment: 16 unrelated individuals reported with language deficits (81%), behavioral symptoms (69%), intellectual disability (64%), epilepsy (62%), and motor delay (56%). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3751 | FBXO31 | Zornitza Stark Phenotypes for gene: FBXO31 were changed from Mental retardation, autosomal recessive 45, MIM#615979; Cerebral palsy, intellectual disability, autosomal dominant to Mental retardation, autosomal recessive 45, MIM#615979; Spastic-dystonic cerebral palsy, de novo dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3749 | FBXO31 | Zornitza Stark Mode of inheritance for gene: FBXO31 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3747 | FBXO31 | Zornitza Stark edited their review of gene: FBXO31: Added comment: PMIDs 33675180; 32989326: three unrelated individuals with de novo missense variant, (p.Asp334Asn) and spastic-dystonic CP, including ID.; Changed rating: GREEN; Changed publications: 24623383, 33675180, 32989326; Changed phenotypes: Mental retardation, autosomal recessive 45, MIM#615979, Spastic-dystonic cerebral palsy, de novo dominant; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3746 | DPYSL5 |
Zornitza Stark gene: DPYSL5 was added gene: DPYSL5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DPYSL5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DPYSL5 were set to 33894126 Phenotypes for gene: DPYSL5 were set to Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities Review for gene: DPYSL5 was set to GREEN Added comment: Nine individuals with brain malformations, including corpus callosum agenesis and/or posterior fossa abnormalities, associated with variable degrees of intellectual disability. The recurrent de novo p.Glu41Lys was found in eight unrelated patients, and a p.Gly47Arg variant was identified in one individual from the first family reported with Ritscher-Schinzel syndrome. Both impaired DPYSL5 function on dendritic outgrowth regulation by preventing the formation of the ternary complex with MAP2 and βIII-tubulin, ultimately leading to abnormal brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3745 | SIN3B | Zornitza Stark Mode of inheritance for gene: SIN3B was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3738 | PTPN4 |
Bryony Thompson gene: PTPN4 was added gene: PTPN4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN4 were set to 17953619; 25424712; 30238967; DOI: https://doi.org/10.1016/j.xhgg.2021.100033 Phenotypes for gene: PTPN4 were set to Intellectual disability; developmental delay Review for gene: PTPN4 was set to GREEN Added comment: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3736 | YWHAG | Zornitza Stark Mode of inheritance for gene: YWHAG was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3735 | YWHAG | Zornitza Stark Mode of inheritance for gene: YWHAG was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3735 | YWHAG | Zornitza Stark Mode of inheritance for gene: YWHAG was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3734 | YWHAG | Zornitza Stark reviewed gene: YWHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 33393734, 33590706, 31926053, 33767733; Phenotypes: Developmental and epileptic encephalopathy 56, (MIMI#617665); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3731 | MED25 | Zornitza Stark Mode of inheritance for gene: MED25 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3730 | MED25 | Zornitza Stark changed review comment from: Basel-Vanagaite-Smirin-Yosef syndrome is an autosomal recessive multiple congenital anomaly disorder characterized by severely delayed psychomotor development resulting in mental retardation, as well as variable eye, brain, cardiac, and palatal abnormalities. 7 individuals from 4 families reported initially, founder variant p.Tyr39Cys. Over 20 individuals reported since, including other variants.; to: Basel-Vanagaite-Smirin-Yosef syndrome is an autosomal recessive multiple congenital anomaly disorder characterized by severely delayed psychomotor development resulting in intellectual disability, as well as variable eye, brain, cardiac, and palatal abnormalities. 7 individuals from 4 families reported initially, founder variant p.Tyr39Cys. Over 20 individuals reported since, including other variants. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3730 | MED25 | Zornitza Stark reviewed gene: MED25: Rating: GREEN; Mode of pathogenicity: None; Publications: 25792360, 32816121; Phenotypes: Basel-Vanagait-Smirin-Yosef syndrome, MIM# 616449, Congenital cataract-microcephaly-naevus flammeus syndrome MONDO:0014643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3730 | ANKRD17 | Paul De Fazio reviewed gene: ANKRD17: Rating: GREEN; Mode of pathogenicity: None; Publications: 33909992; Phenotypes: Intellectual disability, speech delay, and dysmorphism; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3730 | SIN3B |
Elena Savva gene: SIN3B was added gene: SIN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SIN3B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SIN3B were set to PMID: 33811806 Phenotypes for gene: SIN3B were set to Syndromic intellectual disability/autism spectrum disorder Review for gene: SIN3B was set to GREEN Added comment: PMID: 33811806 - 9 affected patients, all de novo (2 PTCs, 2 missense, multigenic CNVs) - syndrome hallmarked by intellectual disability, developmental delay, and dysmorphic facial features with variably penetrant ASD, congenital malformations, corpus callosum defects, and impaired growth. - All SNV carriers had mild/mod ID Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3728 | KCNQ5 | Zornitza Stark Phenotypes for gene: KCNQ5 were changed from to Mental retardation, autosomal dominant 46, MIM# 617601 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3726 | KCNQ5 | Zornitza Stark Mode of inheritance for gene: KCNQ5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3725 | KCNQ5 | Zornitza Stark reviewed gene: KCNQ5: Rating: GREEN; Mode of pathogenicity: None; Publications: 28669405, 30359776; Phenotypes: Mental retardation, autosomal dominant 46, MIM# 617601; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||