| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Intellectual disability syndromic and non-syndromic v2.116 | PIGB |
Zornitza Stark edited their review of gene: PIGB: Added comment: Association with AFFND1, PMID 34400385: two individuals from two Brazilian families reported with the same homozygous intronic variant c.795-19T>G and a distinctive phenotype comprising severe DD/ID, and marked dysmorphic features, including hypertelorism, broad nose with notched nasal tip, cleft lip/palate, and wide and protruding central upper incisors. Vision is impaired due to coloboma and other ocular anomalies, and hearing loss in later life has been reported. Skeletal abnormalities include mesomelic shortening of limbs, distal digital hypoplasia, fibular hypoplasia, and clubfeet. RED for this association as single, likely founder variant in the Brazilian population.; Changed publications: 34400385; Changed phenotypes: Developmental and epileptic encephalopathy 80, MIM# 618580, Acrofrontofacionasal dysplasia 1, MIM# 201180 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.91 | TUBB3 |
Zornitza Stark commented on gene: TUBB3: CFEOM: multiple families reported, some affected individuals show additional features, including developmental delay or learning disabilities associated with dysgenesis of the corpus callosum. Other variable features include facial weakness and peripheral axonal neuropathy, sometimes associated with wrist and finger contractures. OMIM have split into three disorders. Complex cortical dysplasia with other brain malformations (CDCBM), MIM#614039 is a disorder of aberrant neuronal migration and disturbed axonal guidance. Affected individuals have mild to severe DD/ID, strabismus, axial hypotonia, and spasticity. Brain imaging shows variable malformations of cortical development, including polymicrogyria, gyral disorganization, and fusion of the basal ganglia, as well as thin corpus callosum, hypoplastic brainstem, and dysplastic cerebellar vermis. Unclear if the four disorders are distinct or part of a spectrum of TUBB3-associated abnormalities. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.65 | ZIC1 |
chirag patel changed review comment from: 5 families with heterozygous mutations located in the final (third) exon of ZIC1 who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5-12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture. 2 sibs with BAIDCS, Vandervore et al. (2018) identified heterozygosity for a frameshift mutation in the ZIC1 gene. Neither parent had evidence of the mutation by whole-exome sequencing, suggesting that gonadal mosaicism for the mutation was present in one of the parents. Expression of the mutated allele was detected in patient fibroblasts by RT-PCR, evidence that the mutant mRNA did not undergo nonsense-mediated decay and probably generates an abnormal protein. Also heterozygous deletions of ZIC1 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum. Loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects. Sources: Expert list; to: Individuals with BAIDCS have microcephaly, brain anomalies (esp corpus callosum), intellectual disability (moderate to severe), and bicoronal synostosis. 5 families with heterozygous mutations located in the final (third) exon of ZIC1 who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5-12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture. 2 sibs with BAIDCS, Vandervore et al. (2018) identified heterozygosity for a frameshift mutation in the ZIC1 gene. Neither parent had evidence of the mutation by whole-exome sequencing, suggesting that gonadal mosaicism for the mutation was present in one of the parents. Expression of the mutated allele was detected in patient fibroblasts by RT-PCR, evidence that the mutant mRNA did not undergo nonsense-mediated decay and probably generates an abnormal protein. Also heterozygous deletions of ZIC1 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum. Loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NIN | Gene migrated from ENSG00000100503 to ENSG00000100503 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.831 | CLUAP1 |
Sarah Milton changed review comment from: CLUAP1 encodes Clusterin-associated protein 1 which localizes to the base and tip of cilia and associates with the intraflagellar transport (IFT) complex B group of proteins. Leber congenital amaurosis (LCA) PMID: 26820066 and 34209753 report biallelic variants in CLUAP1 in individuals with Leber congenital amaurosis including severe visual dysfunction from birth and nystagmus. Missense and splice variants were reported with functional studies to support a deleterious nature (Cell models/Zebrafish transfection and minigene splice assays). Other causative LCA genes are known to be involved in intraflagellar transport. Biallelic zebrafish and mouse result in lethality in utero, zebrafish embryos at 5 days post fertilisation demonstrate lack of photoreceptor cells. Amber for this association. Ciliopathy PMID 28679688 reports one individual with biallelic variants in CLUAP1 with a syndromic phenotype reminiscent of Joubert/orofaciodigital syndrome including dysmorphic features, rhizomelic limb shortening, polydactyly, molar tooth sign, midline teeth, oculomotor apraxia. One missense and one nonsense variant were noted with functional studies to support the deleterious nature. Red for this association. It is plausible the LCA and ciliopathy phenotypes are a spectrum of disease however there is insufficient evidence to indicate this currently. Sources: Literature; to: CLUAP1 encodes Clusterin-associated protein 1 which localizes to the base and tip of cilia and associates with the intraflagellar transport (IFT) complex B group of proteins. Leber congenital amaurosis (LCA) PMID: 26820066 and 34209753 report biallelic variants in CLUAP1 in 2 individuals with Leber congenital amaurosis including severe visual dysfunction from birth and nystagmus. Missense and splice variants were reported with functional studies to support a deleterious nature (Cell models/Zebrafish transfection and minigene splice assays). Other causative LCA genes are known to be involved in intraflagellar transport. Biallelic zebrafish and mouse result in lethality in utero, zebrafish embryos at 5 days post fertilisation demonstrate lack of photoreceptor cells. Amber for this association. Ciliopathy PMID 28679688 reports one individual with biallelic variants in CLUAP1 with a syndromic phenotype reminiscent of Joubert/orofaciodigital syndrome including dysmorphic features, rhizomelic limb shortening, polydactyly, molar tooth sign, midline teeth, oculomotor apraxia. One missense and one nonsense variant were noted with functional studies to support the deleterious nature. Red for this association. It is plausible the LCA and ciliopathy phenotypes are a spectrum of disease however there is insufficient evidence to indicate this currently. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.690 | JKAMP |
Zornitza Stark gene: JKAMP was added gene: JKAMP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: JKAMP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: JKAMP were set to 41643666 Phenotypes for gene: JKAMP were set to Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM# 621533 Review for gene: JKAMP was set to GREEN Added comment: 14 individuals from 10 families reported. All had moderate to profound neurodevelopmental delay, intellectual disability, and infantile-onset epilepsy. Six were nonverbal, and the remaining individuals spoke only a few words. Five individuals had neurodevelopmental regression. Three individuals died suddenly; death was associated with seizures or status epilepticus in two. Thirteen individuals had hypotonia, 5 had visual impairment, 5 had microcephaly, and 1 had hearing loss. Brain MRIs showed cortical or cerebral atrophy in 11, delayed myelination in 6, and diffuse demyelinating disease in 1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.656 | CTNND2 |
Zornitza Stark edited their review of gene: CTNND2: Added comment: PMID 41502569 (preprint) reports phenotypic and molecular information for 57 individuals, 42 previously unpublished, with heterozygous CTNND2 variants. The 41 CTNND2 variants included 12 previously reported loss-of-function- and one missense variant, and 28 novel variants comprising 10 missense and 18 predicted loss-of-function changes. Eight of the novel variants occurred de novo, and 12 were inherited from a parent with a neurodevelopmental phenotype. The most common clinical features were developmental delay (90%), intellectual disability (74%), and behavioral abnormalities (79%). Functional studies revealed impaired early neurogenesis in one patient-derived line, characterized by aberrant neural rosette formation. Transcriptome analysis showed dysregulated WNT signaling, and partial rescue of these defects was achieved by modulating the WNT pathway, highlighting δ-catenin's role in early neural development. Note several of the reported missense variants in this gene have high gnomAD counts so these should be interpreted with caution. Nevertheless, large number of individuals reported now with LoF variants and NDD phenotype.; Changed rating: GREEN; Changed publications: 25839933, 29127138, 25807484, 41502569; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CTNND2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.638 | TMPRSS7 |
Zornitza Stark changed review comment from: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature; to: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder, presenting with fetal agenesis of the corpus callosum and ventriculomegaly. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.636 | ARCN1 | Zornitza Stark changed review comment from: PMID 35300924 reports 14 individuals (9 post‑natal, 5 fetuses) from 3 unrelated families with biallelic loss‑of‑function ARCN1 variants. Core phenotype includes intrauterine growth restriction, micrognathia, short stature, rhizomelic shortening, microcephaly, variable developmental delay/intellectual disability, genitourinary anomalies in males, cataracts, transient liver dysfunction/glycosylation abnormalities, and rare complications such as hepatoblastoma. Functional assays show defective type I collagen transport and abnormal N‑glycan profiles.; to: At least 14 individuals reported, summarised in PMID 35300924. Intrauterine growth restriction, micrognathia, and short stature were present in all patients. Other common features included prematurity (11/15, 73.3%), developmental delay (10/14, 71.4%), genitourinary malformations in males (6/8, 75%), and microcephaly (12/15, 80%). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.634 | ARCN1 | Zornitza Stark edited their review of gene: ARCN1: Added comment: PMID 35300924 reports 14 individuals (9 post‑natal, 5 fetuses) from 3 unrelated families with biallelic loss‑of‑function ARCN1 variants. Core phenotype includes intrauterine growth restriction, micrognathia, short stature, rhizomelic shortening, microcephaly, variable developmental delay/intellectual disability, genitourinary anomalies in males, cataracts, transient liver dysfunction/glycosylation abnormalities, and rare complications such as hepatoblastoma. Functional assays show defective type I collagen transport and abnormal N‑glycan profiles.; Changed publications: 27476655, 33154040, 35300924; Changed mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.552 | UNC13A |
Zornitza Stark edited their review of gene: UNC13A: Added comment: PMID 41125872 reports 48 individuals with neurodevelopmental disorders and UNC13A variants. Of these, 20 classified as pathogenic. Of these 6 individuals had biallelic variants and presented with severe-to-profound GDD or intellectual disability, hypotonia and seizures of different types (largely controllable with medication) or death in early childhood caused by respiratory failure after pneumonia in one case. Mechanism for this subgroup is LoF with carrier parents unaffected. A second group of 13 patients (21 months to 32 years old) harboured pathogenic, heterozygous de novo missense variants with multiple substitutions at amino acids 808, 811 and 814 (hinge region). They presented with variable degrees of GDD, hypotonia, seizures of different types (mainly refractory to treatment) and typically exhibited ataxia, tremor or dyskinetic movements rarely observed in other patients. Also a family identified with at least four affected members across two generations (4 years to 35 years old) harbouring a pathogenic heterozygous missense variant (C587F) that caused learning difficulties to mild–moderate intellectual disability as well as controlled seizures. Three different types of mechanism of pathogenicity proposed.; Changed phenotypes: neurodevelopmental disorder MONDO#0700092, UNC13A-related, Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.548 | FIBP | Zornitza Stark edited their review of gene: FIBP: Added comment: Beyond the two families previously reviewed (PMIDs 26660953; 27183861), four additional studies (PMIDs 36919607, 37218527, 37876348, 40099975) contribute four new unrelated families (total six unrelated families, nine patients) with a consistent autosomal‑recessive overgrowth syndrome. All six families have biallelic loss‑of‑function FIBP variants (nonsense or frameshift leading to NMD). Detailed clinical descriptions include overgrowth, macrocephaly, facial dysmorphism, developmental delay/intellectual disability, renal dysplasia and, in two families, early‑onset tumor predisposition. Segregation analyses confirm recessive inheritance in every case. Functional work (RT‑qPCR, fibroblast proliferation assays, mouse embryonic expression) demonstrates reduced FIBP expression and increased cell proliferation, supporting pathogenicity.; Changed publications: 40099975, 37876348, 36919607, 27183861, 26660953 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 |
Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity.; to: Additional cases: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 |
Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanisms and variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanism and variable expressivity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 |
Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have a loss of function mechanisms and variable expressivity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | CTNND2 |
Monica Petica changed review comment from: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel - first case). AD NDD/ID seems to have variable expressivity.; to: PMID: 38604781 - heterozygous and homozygous loss of function microdeletion encompassing the last 19 exons of CTNND2 in consanguineous family. Three siblings with homozygous deletion have severe NDD including absent speech, profound motor delay, stereotypical behaviour and other. Heterozygous carriers (sibling and parents) showed milder NDD phenotype similar to previously reported heterozygous cases. PMID: 25473103 - mother and daughter with borderline intelligence, learning problems and dyslexia carry balanced reciprocal translocations: t(1;8) (p22;q24) and t(5;18)(p15;q11). No genes were affected at breakpoints on chromosomes 1 and 8. The t(5;18) showed a breakpoint in intron 9 of CTNND2, while the chromosome 18 breakpoint was in a gene without morbid associations. The genes run in opposite directions and the fusion genes are predicted to cause loss of function. Third case with out of frame deletion exon 12-18 has mild intellectual disability, reading difficulties and facial features. The deletion is present in the mother in mosaic form. PMID: 31814264 – de novo 97kb duplication, containing exon 3 of CTNND2, which is out of frame and predicted to undergo NMD, and was shown to be in tandem. The individual has developmental delay, behavioural problems and dysmorphic features. Secondary deletion on 5q14.1 deemed not pathogenic as present in mother and sibling without matching features. No functional studies available. Not sure on biallelic/AR as single family with AR inheritance is consanguineous (although tested by exomes using ID gene panel). AD NDD/ID seems to have variable expressivity. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.470 | ABI2 |
Zornitza Stark changed review comment from: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Sources: Literature; to: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Amber as still a preprint. Additional individual with recurrent variant identified internally. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.470 | ABI2 |
Zornitza Stark gene: ABI2 was added gene: ABI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ABI2 were set to 40475134 Phenotypes for gene: ABI2 were set to Neurodevelopmental disorder, MONDO:0700092, ABI2-related Review for gene: ABI2 was set to AMBER Added comment: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.414 | SRRM1 |
Zornitza Stark gene: SRRM1 was added gene: SRRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SRRM1 were set to 41145827 Phenotypes for gene: SRRM1 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM1-related Review for gene: SRRM1 was set to GREEN Added comment: PMID 41145827 reports three individuals from three unrelated families with heterozygous truncating SRRM1 variants presenting with a neurodevelopmental disorder characterised by developmental delay, intellectual disability, short stature, behavioural and skeletal anomalies, and facial dysmorphism. Two variants are confirmed de novo and functional assays in neuronal‑like cells and Drosophila support haploinsufficiency as a disease mechanism. Serine/arginine repetitive matrix protein 1 (SRRM1) is a key component of spliceosomes and plays various roles in messenger RNA processing. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | RNU6ATAC |
Lucy Spencer gene: RNU6ATAC was added gene: RNU6ATAC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU6ATAC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNU6ATAC were set to 40975062 Phenotypes for gene: RNU6ATAC were set to Neurodevelopmental disorder (MONDO:0700092), RNU6ATAC-related Review for gene: RNU6ATAC was set to RED Added comment: PMID: 40975062 1 patient compound heterozygous for n.36T>G and n.28C>T. Has short stature, microcephaly, hypotonia, neurodevelopmental delay, ID, seizures, ataxia, ventriculomegaly, syndactyly, nystagmus and oculomotor apraxia. Identified in a cohort of individuals with an excess of significant intron retention outliers in minor intron containing genes which are usually removed by the minor spliceosome of which RNU6ATAC is a part (as is RNU4ATAC). Proband had no candidate variants in RNU4ATAC or RNU12. Both RNU6ATAC variants are in a highly conserved 39bp region, and affect nucleotides predicted to be important for binding to U4ATAC. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.342 | SYNE2 |
chirag patel gene: SYNE2 was added gene: SYNE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SYNE2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SYNE2 were set to 34573277 Phenotypes for gene: SYNE2 were set to Neurodevelopmental disorder, MONDO:0700092, SYNE2 related Review for gene: SYNE2 was set to RED Added comment: 1 individual with autism spectrum disorder, developmental delay and intellectual disability (from a cohort of 410 trios with neurodevelopmental disorders). Trio WES found compound heterozygous variants in SYNE2 [c.2483T>G; p.(Val828Gly) and c.2362G>A; p.(Glu788Lys)]. Both variants are rare, predicted to be highly damaging using in silico tools, and located in the nesprin-2 giant spectrin repeat domain. Both parents and the healthy brother were heterozygous. Expression and functional testing in patient lymphoblastoid cell lines showed a significant reduction of nesprin-2 giant protein levels, however SYNE2 transcription and the nuclear envelope localisation of the mutant proteins was unaffected as compared to parental control cells. SYNE 1-4 genes encode for nesprins (nuclear envelope spectrin repeat proteins) which play fundamental roles in nuclear architecture and positioning, directed cell migration, cellular signalling, ciliogenesis, and mechanobiology. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | INTS6 |
Sarah Milton changed review comment from: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature; to: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | INTS6 |
Sarah Milton gene: INTS6 was added gene: INTS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: INTS6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: INTS6 were set to PMID: 40966122 Phenotypes for gene: INTS6 were set to Neurodevelopmental disorder, MONDO:0700092, INTS6-related Review for gene: INTS6 was set to GREEN Added comment: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.295 | SKOR2 |
Zornitza Stark gene: SKOR2 was added gene: SKOR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SKOR2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SKOR2 were set to 40890458; 29997391; 21937600 Phenotypes for gene: SKOR2 were set to complex neurodevelopmental disorder with motor features MONDO:0100516 Review for gene: SKOR2 was set to GREEN Added comment: 3 unrelated families with consistent phenotypes and a supportive mouse model: PMID: 40890458 - 2 unrelated consanguineous Iranian families with a combination of learning disability, facial dysmorphisms, and motor and speech impairments with homozygous variants (c.374 G>C: p.Arg125Pro & c.1271_1274del: p.K424Rfs*71). The homozygous missense variant segregated with disease in 8 individuals (no unaffected individuals tested were homozygous). PMID: 29997391 - proband with neurodevelopmental delay, hypotonia, ataxia, cerebellar dysplasia from a consanguineous Turkish family with a homozygous null variant (NM_001278063.1:c.2750C>G; p.Ser917*). None of the 4 healthy siblings were homozygous for the variant. PMID: 21937600 - Skor2 -/- mouse model had defective Purkinje cell development, a severe reduction of granule cell proliferation and a malformed cerebellum. Mouse had unstable gait. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.264 | DDX39A |
Zornitza Stark gene: DDX39A was added gene: DDX39A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DDX39A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDX39A were set to 40726340 Phenotypes for gene: DDX39A were set to Neurodevelopmental disorder, MONDO:0700092, DDX39A-related Review for gene: DDX39A was set to RED Added comment: PMID: 40726340 Ahmed et al 2025 (Clinical Genetics) report a 7 month old F with GDD, seizures, microcephaly, hypotonia, corpus callosum thinning and homozygous missense variant (p.Lys137Gln) in DDX39A on trio WES with both non-consanguineous parents confirmed to be heterozygous carriers. DDX39A is involved in mRNA splicing and export. Patient-derived fibroblast studies showed that mutant protein resulted in aberrant nuclear clumping and failure to interact with the TREX complex. Of note, closely-related paralogue DDX39B is also a component of the TREX complex and has a definitive monoallelic association with neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.253 | CCDC93 |
Sarah Milton gene: CCDC93 was added gene: CCDC93 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC93 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC93 were set to PMID: 40601774 Phenotypes for gene: CCDC93 were set to Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related Review for gene: CCDC93 was set to AMBER Added comment: CCDC93 encodes the coiled coil domain containing subunit of commander complex involved in recycling of integral membrane proteins. PMID: 40601774 describes 1 affected individual with compound heterozygous variants in CCDC93 who presented with Ritscher Schinzel like phenotype. Features included hypoplasia of cerebellar hemispheres, hypoplasia of the brainstem and of the corpus callosum, distinctive facial features and multiple small renal cysts. Variants were missense and nonsense. No homozygous LOF variants in gnomAD v4. Some supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.248 | TMPRSS7 |
Zornitza Stark gene: TMPRSS7 was added gene: TMPRSS7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMPRSS7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMPRSS7 were set to 40796295 Phenotypes for gene: TMPRSS7 were set to Neurodevelopmental disorder, TMPRSS7-related Review for gene: TMPRSS7 was set to RED Added comment: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.213 | ST5 |
Rylee Peters gene: ST5 was added gene: ST5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ST5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ST5 were set to 40717498 Phenotypes for gene: ST5 were set to Neurodevelopmental disorder (MONDO:0700092), DENND2B-related Review for gene: ST5 was set to GREEN Added comment: HGNC: DENND2B Cohort of 11 individuals all with a history of motor and/or language developmental delay, intellectual disability in 6/11 (mild to severe), brain structure/function abnormalities were reported in 9/11 patients (7/11 seizures; 5/9 abnormal findings on brain MRI), muscle weakness/hypotonia in 8/9, psychosis in 4/10 patients, symptoms of catatonia in 4/10, other psychiatric/behavioural concerns (anxiety, attention deficit, autism or autistic features) in 10/10. Total of 10 variants including 2x frameshift/nonsense, 6x missense, 1x splice, 1x single amino acid deletion – all absent from v4 and de novo except 1 inherited from a father with cognitive and psychiatric symptoms and the inframe del which has 2 hets in gnomAD and is inherited an unaffected father (no formal assessment). In vivo zebrafish modelling measuring cilia length suggests that patient variants tested (9/10 excluding the splice variant) did not induce cilia length shortening, which is consistent with KO models and therefore a loss of function effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.173 | ANKS1B |
Lilian Rudd gene: ANKS1B was added gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: ANKS1B. Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKS1B were set to PMID: 31388001; 38129387 Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related Review for gene: ANKS1B was set to GREEN Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model. Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.164 | PTPN1 |
Zornitza Stark gene: PTPN1 was added gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN1 were set to 39986310 Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related Review for gene: PTPN1 was set to GREEN Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.106 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.104 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 |
Sarah Milton gene: CDKL1 was added gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL1 were set to PMID: 40088891 Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related Mode of pathogenicity for gene: CDKL1 was set to Other Review for gene: CDKL1 was set to AMBER Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4). Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL2 |
Sarah Milton gene: CDKL2 was added gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL2 were set to PMID: 40088891 Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related Penetrance for gene: CDKL2 were set to Complete Mode of pathogenicity for gene: CDKL2 was set to Other Review for gene: CDKL2 was set to AMBER Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion. 2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging. Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5) Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.90 | SVBP | Zornitza Stark edited their review of gene: SVBP: Added comment: PMID 39412222: 6 individuals from 3 families with spastic paraplegia and the same homozygous missense (L49P). Presented from birth or childhood with DD/ID and spastic paraplegia. Additional features: verbal apraxia, axonal neuropathy, ataxia, nystagmus, epilepsy, and aggressive behaviour. Brain MRIs were performed in 3 individuals and showed thinning of the corpus callosum, cerebellar atrophy, and ventriculomegaly; frontal ventricular hyperintensities suggestive of the 'ear of the lynx' sign in 2. Three individuals had a history of cancer of epithelial origin, including adenocarcinoma (patient 1), colonic tubular adenoma (patient 2), and breast cancer (patient 3).; Changed publications: 39412222; Changed phenotypes: Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569, Spastic paraplegia 94, autosomal recessive, MIM# 621150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.89 | CRMP1 |
Zornitza Stark gene: CRMP1 was added gene: CRMP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CRMP1 were set to 36511780; 39758889 Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092, CRMP2-related Review for gene: CRMP1 was set to GREEN Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants. PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID. Four individuals with neurodevelopmental disorders and de novo variants in this gene. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.79 | PPP2R5E |
chirag patel gene: PPP2R5E was added gene: PPP2R5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP2R5E was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPP2R5E were set to PMID: 39284558 Phenotypes for gene: PPP2R5E were set to Mendelian neurodevelopmental disorder MONDO:0100500 Review for gene: PPP2R5E was set to RED Added comment: One 20yrs old individual with learning issues, motor coordination disorders, hypotonia (myopathy on EMG), and behavioural issues (mood and emotional dysregulation). WES testing identified a de novo heterozygous missense variant (Glu191Lys) in PPP2R5E gene. The variant was not found in the 4 healthy brothers of the individual. The variant is located within a conserved LFDSEDPRER motif common to all PPP2R5 B-subunits. Biochemical assays demonstrated a decreased interaction with the PP2A A and C subunits, leading to disturbances in holoenzyme formation. Protein phosphatase 2A (PP2A) is a family of multifunctional enzymatic complexes crucial for cellular signalling, playing a pivotal role in brain function and development. Mutations in specific genes encoding PP2A complexes have been associated with neurodevelopmental disorders with hypotonia and high risk of seizures (e.g. PP2AR-1A, 2B, 3C, 5C, 5D). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.62 | ARHGEF40 |
chirag patel gene: ARHGEF40 was added gene: ARHGEF40 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARHGEF40 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARHGEF40 were set to PMID: 39838643 Phenotypes for gene: ARHGEF40 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: ARHGEF40 was set to RED Added comment: 2 individuals with global developmental delay, hypotonia, short stature, hearing impairment, nystagmus, feeding issues, and dysmorphism (bifid uvula, narrow mouth, high palate, micrognathia). Trio clinical whole exome sequencing identified de novo variants in the ARHGEF40 gene at position p.Arg225, which is fully conserved in mammals and located within the n-terminal keratin binding region (p.Arg225Trp and p.Arg225Gln). Of note, multiple additional probands with rare missense variants at the p.Arg225 residue have been identified by the same laboratory (but there was no consent for publication, providing further evidence of the importance of this residue. The ARHGEF40 gene (aka SOLO) is a member of the Rho guanine nucleotide exchange factor (Rho-GEF) family of proteins, which stimulate Rho signal transduction molecules by converting them from inactive GDP-bound form to the active GTP-bound state. No functional studies to characterise disease-gene relationship or disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.59 | HECTD1 |
chirag patel gene: HECTD1 was added gene: HECTD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HECTD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HECTD1 were set to PMID: 39879987 Phenotypes for gene: HECTD1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: HECTD1 was set to GREEN Added comment: 14 unrelated individuals (identified through GeneMatcher) with 15 variants of uncertain significance (VUS) in HECTD1 (10 missense, 3 frameshift, 1 nonsense, and 1 splicing variant). Of the 15 different variants in HECTD1, 10 occurred de novo, 3 had unknown inheritance, and 2 were compound heterozygous. All variants were absent in gnomAD, and HECTD1 is highly intolerant to loss-of-function variation (loss-of-function-intolerant score of 1). Clinical presentation was variable developmental delay, intellectual disability, autism spectrum disorder, ADHD, and epilepsy. The one individual with compound heterozygous variants had growth impairment along with NDD. The variants were inherited from apparently healthy parents, suggesting that genetic or environmental modifiers may be required to develop the phenotype. Significant enrichment of de novo variants in HECTD1 was also shown in an independent cohort of 53,305 published trios with NDDs or congenital heart disease. HECT-domain-containing protein 1 (HECTD1) mediates developmental pathways, including cell signalling, gene expression, and embryogenesis. Conditional knockout of Hectd1 in the neural lineage in mice resulted in microcephaly, severe hippocampal malformations, and complete agenesis of the corpus callosum, supporting a role for Hectd1 in embryonic brain development. Functional studies of 2 missense variants and 1 nonsense variant in C. elegans revealed dominant effects, including either change-of-function or loss-of-function/haploinsufficient mechanisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.37 | EEFSEC |
Zornitza Stark gene: EEFSEC was added gene: EEFSEC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EEFSEC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EEFSEC were set to 39753114 Phenotypes for gene: EEFSEC were set to Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related Review for gene: EEFSEC was set to GREEN Added comment: Nine individuals from 8 unrelated families reported with bi-allelic variants in this gene and progressive neurodevelopmental disorder manifesting with global developmental delay, progressive spasticity, ataxia, and seizures. Cerebral MRI primarily demonstrated a cerebellar pathology, including hypoplasia and progressive atrophy. In line with the clinical phenotype, an eEFSec-RNAi Drosophila model displays progressive impairment of motor function, which is reflected in the synaptic defects in this model organisms. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.23 | RUNX1T1 |
chirag patel gene: RUNX1T1 was added gene: RUNX1T1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RUNX1T1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340 Phenotypes for gene: RUNX1T1 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: RUNX1T1 was set to GREEN Added comment: RUNX1T1 encodes a transcription regulator for hematopoietic genes and is well-known for its involvement in hematologic malignancies. Germline RUNX1T1 variants may also play a role in human congenital neurodevelopmental disorders. PMID: 39568205 3 unrelated individuals with developmental delay, learning disability, ASD, ADHD, and dysmorphism (1 x heart defects). Trio WES identified de novo variants in RUNX1T1 gene (1 x nonsense variant in 5' region [p.Gln36Ter], 2 x missense variants in C-terminus [p.Gly412Arg and p.His521Tyr]). PMID: 19172993 1 individual with mild-moderate ID and congenital heart disease, and chromosome t(5;8)(q32;q21.3) translocation. Molecular characterization revealed that one of the break points was within the RUNX1T1 gene. Analysis of RUNX1T1 expression in human embryonic and fetal tissues suggests a role of RUNX1T1 in brain and heart development. PMID: 22644616 1 individual with mild ID and dysmorphism, and de novo deletion exons 3-7 in RUNX1T1. PMID: 31223340 1 individual with ID, anaemia, atrial septal defect, dysmorphism, and seizures. Found to have a 2.1 Mb deletion at 8q21.3q22.1 involving entire RUNX1T1 gene (and 2 adjacent genes - SLC26A7 and TRIQK), and a benign familial 4.3 Mb duplication at 1p22.1p21.3 (present in unaffected healthy brother). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6652 | MRPL49 |
Zornitza Stark gene: MRPL49 was added gene: MRPL49 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRPL49 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MRPL49 were set to 39417135 Phenotypes for gene: MRPL49 were set to Mitochondrial disease, MONDO:0044970, MRPL49-related Review for gene: MRPL49 was set to GREEN Added comment: Five unrelated families with presentations ranging from Perrault syndrome (primary ovarian insufficiency and sensorineural hearing loss) to severe childhood onset of leukodystrophy, learning disability, microcephaly and retinal dystrophy and bi-allelic variants in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6628 | MARK2 |
chirag patel gene: MARK2 was added gene: MARK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MARK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MARK2 were set to PMID: 39419027, 39436150 Phenotypes for gene: MARK2 were set to Neurodevelopmental disorder MONDO:0700092 Review for gene: MARK2 was set to GREEN Added comment: 31 individuals with autism spectrum disorder (30/31), intellectual disability/developmental delay (100%), motor delay (62%), speech-language problems (100%), seizure/epilepsy (46%), behaviour disorders (ADHD, aggression, anxiety)(74%), and distinctive facial features (narrow face, abnormal or broad forehead, downslanting palpebral fissures, and large or dysplastic ears). WES/WGS identified 25 LOF and 6 missense variants in MARK2 gene (Microtubule affinity-regulating kinase 2) which contributes to establishing neuronal polarity and developing dendritic spines. LOF variants were de novo (16/25), inherited (4/25), or unk (5/25). All 6 missense variants were de novo and clustered in the kinase or KA1 domains. The mRNA and protein expression of MARK2 in PBMCs were significantly lower in affected individuals with LOF variants than in the control group. In vitro expression assay of missense variants supported the effect of MARK2 loss. Proband-derived and CRISPR-engineered isogenic induced pluripotent stem cells (iPSCs) showed MARK2 loss leads to early neuronal developmental and functional deficits, including anomalous polarity and disorganization in neural rosettes, as well as imbalanced proliferation and differentiation in neural progenitor cells (NPCs). Mark2+/- mice showed abnormal cortical formation and partition and ASD-like behaviour. Through the use of RNA sequencing (RNA-seq) and lithium treatment, they linked MARK2 loss to downregulation of the WNT/β-catenin signaling pathway and identified lithium as a potential drug for treating MARK2-associated ASD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6447 | PTS | Zornitza Stark Phenotypes for gene: PTS were changed from Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 to Hyperphenylalaninaemia, BH4-deficient, A, MIM# 261640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6446 | PTS | Zornitza Stark Phenotypes for gene: PTS were changed from to Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6444 | PTS | Zornitza Stark reviewed gene: PTS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6418 | MAT1A | Zornitza Stark Phenotypes for gene: MAT1A were changed from to Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850; Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850; Disorders of the metabolism of sulphur amino acids | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6303 | MAT1A | chirag patel reviewed gene: MAT1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 27604308, 7560086; Phenotypes: Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850, Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850, Disorders of the metabolism of sulphur amino acids; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6299 | GCH1 | Bryony Thompson Phenotypes for gene: GCH1 were changed from to GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6295 | GCH1 | Bryony Thompson reviewed gene: GCH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22473768, 7869202; Phenotypes: GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6214 | DNMT3B |
Ken Lee Wan changed review comment from: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692). Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860). Mechanism of disease: loss of function; to: DNMT3B is a well-established gene disease association with autosomal recessive immunodeficiency-centromeric instability-facial anomalies syndrome 1 (https://search.clinicalgenome.org/CCID:004692). Immunodeficiency, centromeric instability and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency and branching of chromosomes 1, 9 and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes. The most frequent symptoms of the syndrome are facial dysmorphism, intellectual disability, recurrent and prolonged respiratory infections, infections of the skin and digestive system and variable immune deficiency with a constant decrease of IgA (MIM: 242860). Mechanism of disease: loss of function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6195 | CEP76 |
Mark Cleghorn gene: CEP76 was added gene: CEP76 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038; Joubert syndrome; Bardet-Biedl syndrome; retinitis pigmentosa Penetrance for gene: CEP76 were set to unknown Review for gene: CEP76 was set to GREEN Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago ESHG presentation 4/6/24, unpublished CEP76 associated with syndromic ciliopathy CEP76 localizes to centrioles and basal body primary cilia Role in normal centriolar duplication Index case Bardet Biedl syndrome Compound heterozygous pLoF variants in CEP76 Via Gene matcher 7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum: Obesity Ocular phenotype Structural brain anomalies Renal? 3/7 families clinical Dx Joubert syndrome 1/7 BBS 1/7 GDD/ID NOS 2/7 retinitis pigmentosa (1 of these with learning difficulties) Mixture of biallelic pLOF and missense variant CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6188 | MED16 |
Mark Cleghorn gene: MED16 was added gene: MED16 was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED16 were set to complex neurodevelopmental disorder MONDO:0100038 Penetrance for gene: MED16 were set to unknown Review for gene: MED16 was set to GREEN Added comment: MED16 Charlotte Guillouet, Imagine institute Paris ESHG presentation 4/6/24, unpublished MED16 is part of tail of ‘mediator complex’ Plays a role in enhancer/promotor regions Disruptive variants in other genes encoding proteins within this mediator complex (MED11/12/12/17/20, CDK8) are assoc w neurodevelopmental/neurodegenerative disorders Cases index family Sibs (M/F) to consanguineous parents w NDD/mod ID, tetralogy of Fallot or VSD, bilat deafness, micrognathia, malar hypoplasia, dental AbN, pre auricular tags, hypoplastic nails, brachydactly WES: biallelic MED16 p.Asp217Asn Via genematcher 16 families total, 22 individuals, homozygous or compound het rare MED16 variants Mixture of pLoF and missense variants Motor delay in 16/17 DD or ID in 17/17 Speech delay in 15/15 6/19 ToF 7/19 other septal/aortic defects 6/18 deafness 11/18 microretognathia 6/17 cleft palate 8/19 preauricular tags 9/20 puffy eyelids 12/20 nasal dysplasia (most commonly short columella w bulbous nasal tip) 7/20 corpus callosum anomalies Not clear that functional work recapitulated phenotype as yet? Immunofluroescence on HeLa cells transfected with variants observed ?conclusion MED16 knockout mouse > growth delay, pre weaning lethality MED16 knockout zebrafish > reduced body length, early death, no obvious craniofacial phenotype Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6068 | SRPK3 |
Zornitza Stark gene: SRPK3 was added gene: SRPK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRPK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SRPK3 were set to 38429495; 39073169 Phenotypes for gene: SRPK3 were set to Neurodevelopmental disorder, MONDO:0700092, SRPK3-related Review for gene: SRPK3 was set to GREEN Added comment: PMID 39073169: 9 individuals from 5 unrelated families reported with 4 missense and 1 putative truncating variant and a neurodevelopmental phenotype. The 8 patients ascertained postnatally shared common clinical features including intellectual disability, agenesis of the corpus callosum, abnormal eye movement, and ataxia. A ninth case, ascertained prenatally, had a complex structural brain phenotype. Supportive animal model data (mouse and zebrafish). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.6048 | PSMD11 |
Bryony Thompson gene: PSMD11 was added gene: PSMD11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PSMD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PSMD11 were set to 38866022; 30733659 Phenotypes for gene: PSMD11 were set to Neurodevelopmental disorder, MONDO:0700092, PSMD11-related Review for gene: PSMD11 was set to GREEN Added comment: PMID: 38866022 - 10 unrelated children with early-onset syndromic intellectual disability and neurodevelopmental delay with recurrent obesity. Cognitive impairment is recapitulated in a drosophila model. Loss of function is the mechanism of disease PMID: 30733659 - 4 probands with ID and different 17q11.2 deletions spanning PSMD11 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5881 | SLC25A1 | Alyson Lewis reviewed gene: SLC25A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31527857, PMID: 26870663; Phenotypes: Impaired intellectual development, mild, Learning disabilities, Delayed motor development; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5873 | GABRA4 |
Adam Ivey gene: GABRA4 was added gene: GABRA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GABRA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABRA4 were set to PMID: 38565639 Phenotypes for gene: GABRA4 were set to Developmental delay; Intellectual disability; Epileptic seizures Penetrance for gene: GABRA4 were set to Complete Review for gene: GABRA4 was set to GREEN Added comment: Four unrelated individuals with unique de novo missense variants in the transmembrane domain of GABRA4 have developmental delay and varying degrees of intellectual disability (PMID: 38565639). These variants are not present in gnomAD and three of the four variants have pathogenic REVEL scores. Two of the GABRA4 variants were heterozygous, while the remaining two were mosaic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5821 | SLC25A15 | Rajkumar Krishnaswamy reviewed gene: SLC25A15: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 18978333, 25874378; Phenotypes: Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome, 238970, hyperammonemia, lethargy, somnolence, refusal to feed, vomiting, tachypnea with respiratory alkalosis, seizures, protein intolerance, developmental delay, spasticity, intellectual disability / mental retardation, dysarthria, learning disabilities, spasticity, liver dysfunction; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5786 | PRMT9 |
chirag patel gene: PRMT9 was added gene: PRMT9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRMT9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PRMT9 were set to PMID: 38561334 Phenotypes for gene: PRMT9 were set to Neurodevelopmental disorder, MONDO:0100500 Review for gene: PRMT9 was set to RED Added comment: A homozygous variant (G189R) in PRMT9 is reported based on large WGS study in 136 consanguineous families - unclear if only found in 1 family and no clinical information on case(s). PMRTs (protein arginine methyltransferases) catalyse post translational modification via arginine methylation. Functional studies showed that the G189R variant abolishes PRMT9's methyltransferase activity - specifically at the R508 residue of SF3B2 RNA (exclusively methylated by PRMT9) - and leads to heavy PRMT9 ubiquitination, and abnormal splicing activity of SF3B2. Knock out mouse model showed PRMT9 loss in excitatory neurons leads to aberrant synapse development and impaired learning and memory. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5761 | SEPHS1 |
Zornitza Stark gene: SEPHS1 was added gene: SEPHS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SEPHS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SEPHS1 were set to 38531365 Phenotypes for gene: SEPHS1 were set to Neurodevelopmental disorder, MONDO:0700092, SEPHS1-related Review for gene: SEPHS1 was set to GREEN Added comment: Nine individuals from eight families with developmental delay, growth and feeding problems, hypotonia, and dysmorphic features, all with heterozygous missense variants in SEPHS1. Eight of these individuals had a recurrent variant at amino acid position 371 of SEPHS1 (p.Arg371Trp, p.Arg371Gln, and p.Arg371Gly); seven of these variants were known to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5729 | USP14 |
Zornitza Stark gene: USP14 was added gene: USP14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: USP14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: USP14 were set to 38469793; 35066879 Phenotypes for gene: USP14 were set to Syndromic disease MONDO:0002254, USP14-related Review for gene: USP14 was set to AMBER Added comment: AMBER rating as two of the families had affected fetuses, one had a severely affected newborn, and fourth had a progressive course: none fit well with ID, though there's likely to be a continuum. PMID 35066879: 3 fetuses from 2 different branches of a consanguineous family, presenting with distal arthrogryposis, underdevelopment of the corpus callosum, and dysmorphic facial features. Exome sequencing identified a biallelic 4-bp deletion (c.233_236delTTCC; p.Leu78Glnfs*11) in USP14, and sequencing of family members showed segregation with the phenotype. Ubiquitin-specific protease 14 (USP14) encodes a major proteasome-associated deubiquitinating enzyme with an established dual role as an inhibitor and an activator of proteolysis, maintaining protein homeostasis. Usp14-deficient mice show a phenotype similar to lethal human multiple congenital contractures phenotypes, with callosal anomalies, muscle wasting, and early lethality, attributed to neuromuscular junction defects due to decreased monomeric ubiquitin pool. RT-qPCR experiment in an unaffected heterozygote revealed that mutant USP14 was expressed, indicating that abnormal transcript escapes nonsense-mediated mRNA decay. PMID 38469793: biallelic USP14 variants in four individuals from three unrelated families: one fetus, a newborn with a syndromic NDD, and two siblings affected by a progressive neurological disease. Specifically, the two siblings from the latter family carried two compound heterozygous variants c.8T>C p.(Leu3Pro) and c.988C>T p.(Arg330*), while the fetus had a homozygous frameshift c.899_902del p.(Lys300Serfs*24) variant and the newborn patient harbored a homozygous frameshift c.233_236del p.(Leu78Glnfs*11) variant. The fetus and the newborn had extensive brain malformations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5712 | SNF8 |
Chern Lim gene: SNF8 was added gene: SNF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNF8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNF8 were set to 38423010 Phenotypes for gene: SNF8 were set to Severe developmental delay, epileptic encephalopathy, brain MRI abnormality; intellectual disability, childhood-onset optic atrophy, ataxia Review for gene: SNF8 was set to GREEN gene: SNF8 was marked as current diagnostic Added comment: PMID: 38423010 - Nine individuals from six families presenting with a spectrum of neurodevelopmental/neurodegenerative features caused by bi-allelic variants in SNF8. In total, three putative LoF variants and four missense variants were identified. - The phenotypic spectrum included four individuals with severe developmental and epileptic encephalopathy, massive reduction of white matter, hypo-/aplasia of the corpus callosum, neurodevelopmental arrest, and early death. A second cohort shows a milder phenotype with intellectual disability, childhood-onset optic atrophy, or ataxia. All mildly affected individuals shared the same hypomorphic variant, c.304G>A (p.Val102Ile) as compound heterozygous. - Functional studies using fibroblasts derived from patients and zebrafish model showed LoF is the disease mech. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5706 | ZFX |
Sarah Leigh gene: ZFX was added gene: ZFX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZFX was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: ZFX were set to 26350204; 26740508; 38325380 Phenotypes for gene: ZFX were set to X-linked neurodevelopmental disorder with recurrent facial gestalt Review for gene: ZFX was set to GREEN Added comment: To date, germline variants in ZFX have not been associated with a phenotype in OMIM or Gen2Phen. A single ZFX variant has been associated with a neurodevelopmental disorder, that has a Rett syndrome-like phenotype disorder, in a 14 year old male. The ZFX variant was allelic with another X-linked variant in SHROOM4. These variants were inherited from the mother, who had random X inactivation pattern (PMID: 26740508). PMID: 38325380 reports 11 ZFX variants in 18 subjects from 16 unrelated families (14 males and 4 females) with an X-linked neurodevelopmental disorder with recurrent facial gestalt. Seven variants were truncating and the remaining were missense variants within the Zinc finger array. In the pedigree of family 6 (figure 3, PMID: 38325380), it was apparent that there were female carriers of the ZFX variant (GRCh38 chrX: 24229396A>G, c.2438A>G, p.Tyr774Cys) with hyperparathyroidism and two affected males and one affected female, with the neurodevelopmental disorder. It appeared that skewed X-inactivation in the female carriers was responsible for the different phenotypic features. The association between ZFX variants and a novel neurodevelopmental disorder, was further supported by functional studies showing altered transcriptional activity in missense variants and altered behavior in a zebrafish loss-of-function model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5687 | WDR44 |
Zornitza Stark gene: WDR44 was added gene: WDR44 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR44 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: WDR44 were set to 38191484 Phenotypes for gene: WDR44 were set to Ciliopathy, MONDO:0005308, WDR44-related Review for gene: WDR44 was set to GREEN Added comment: 11 male patients with 6 missense and 1 nonsense variant in WDR44 displaying a wide range of cognitive impairment and variable congenital anomalies associated with primary cilium dysfunction. All patients had learning difficulties with 8 labelled as intellectually disabled (mild-moderate). Other clinical features included anomalies of craniofacial, musculoskeletal, brain, renal and cardiac development. WDR44 is a negative regulator of ciliogenesis. Increased binding is hypothesised to underlie the pathogenicity of WDR44 variants identified in this cohort. Functional data supported impaired ciliogenesis initiation in patient fibroblasts and a zebrafish model. A zebrafish model recapitulated the human phenotype when morphants expressed WDR44 L668S, D669N, S764F, G782C, H839R, and R733* variants. Of note, D648G or N840S did not recapitulate the phenotype in the zebrafish model. The studies supported a GoF mechanism, but the authors could not rule out that LoF of WDR44 contributes to the ciliopathy-like phenotype observed, because protein expression data was only available for a limited number of patients. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5628 | PLA2G16 |
Lauren Rogers gene: PLA2G16 was added gene: PLA2G16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PLA2G16 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PLA2G16 were set to PMID: 37919452 Phenotypes for gene: PLA2G16 were set to Lipodystrophy (MONDO:0006573) Added comment: 7 patients from 4 unrelated consanguineous families with homozygous loss of function PTC variants. Features: 4/7 metabolic features, 6/7 neurological/skeletal features, 3/7 Psychomotor retardation/intellectual disability, 5/7 demyelinating peripheral neuropathy. Null mouse and patient derived white adipose tissue showed enrichment of arachidonic acid-containing membrane phospholipids and a strong decrease in PPARγ. CRISPR–Cas9-mediated PLAAT3 inactivation in human adipose stem cells induced insulin resistance, altered adipocyte differentiation with decreased lipid droplet formation and reduced the expression of adipogenic and mature adipocyte markers, including PPARγ. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5616 | DOT1L |
Zornitza Stark gene: DOT1L was added gene: DOT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DOT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DOT1L were set to 37827158 Phenotypes for gene: DOT1L were set to Neurodevelopmental disorder, MONDO:0700092, DOT1L-related Mode of pathogenicity for gene: DOT1L was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: DOT1L was set to GREEN Added comment: Nine individuals reported with seven de novo missense variants. All had DD/ID and variable patterns of associated congenital anomalies. Variants demonstrated to be GoF and lead to increased H3K79 methylation levels in flies and human cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5599 | CASP2 |
Ain Roesley gene: CASP2 was added gene: CASP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CASP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CASP2 were set to 37880421 Phenotypes for gene: CASP2 were set to neurodevelopmental disorder MONDO:0700092, CASP2-related Penetrance for gene: CASP2 were set to Complete Review for gene: CASP2 was set to GREEN gene: CASP2 was marked as current diagnostic Added comment: 7 patients from 5 families 4 families hom for PTCs, 1 family Chet for splice+PTC RNA studies done for the splice to indicate usage of 2 cryptic splice donor sites 5/5 have ID/dev delay 1/5 has seizures 2/5 hypotonia 3/5 lissencephaly (pachygyria and cortical thickening) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5598 | ELP1 |
Sarah Pantaleo gene: ELP1 was added gene: ELP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ELP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ELP1 were set to PMID: 36864284 Phenotypes for gene: ELP1 were set to Neurodevelopmental disorder, MONDO:0700092, ELP1-related Review for gene: ELP1 was set to RED Added comment: “A novel ELP1 mutation impairs the function of the Elongator complex and causes a severe neurodevelopment disorder”. The Elongator complex is suggested to play a role in NDDs, given that patient-derived mutations in its ELP2, ELP3, ELP4 and ELP6 subunits have been associated with these disorders. Pathogenic variants in ELP1 have been previously found in familial dysautonomia and medulloblastoma, with no link to NDDs affecting primarily the central nervous system. Clinical investigation included patient history and physical, neurological and MRI. A novel homozygous likely pathogenic ELP1 variant was identified by WGS (absent from gnomAD). Functional studies included in silico analysis of the mutated ELP1 in the context of the holo-complex, production and purification of the ELP1 harbouring the identified mutation and in vitro analyses. Report a novel missense mutation in the ELP1 identified in two siblings with ID and GDD (both less than 10 years old). The mutation is shown to perturb the ability of ELP123 to bind tRNAs and compromises the function of the Elongator in vitro and in human cells. Both sibling are non-verbal and had severe ID/GDD. MRI revealed white matter lesions with enlarged perivascular spaces, suggestive of an inflammatory reaction associate with demyelination. WGS identified c.2444A>C; p.(Lys815Thr), homozygous in both siblings. Consanguineous family. Parents heterozygous and asymptomatic. Carry out significant functional studies. Conclude that screening for ELP1 mutations “may be beneficial”. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5595 | PTPN4 |
Bryony Thompson changed review comment from: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature; to: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines PMID: 34527963 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5516 | SYN1 | Zornitza Stark Phenotypes for gene: SYN1 were changed from to X-linked complex neurodevelopmental disorder MONDO:0100148; epilepsy, X-linked 1, with variable learning disabilities and behavior disorders MONDO:0010339 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5514 | SYN1 | Kaitlyn Dianna Weldon reviewed gene: SYN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148, epilepsy, X-linked 1, with variable learning disabilities and behavior disorders MONDO:0010339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5390 | RAB5C |
Rylee Peters changed review comment from: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature; to: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All have mild to severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5387 | RAB5C |
Rylee Peters gene: RAB5C was added gene: RAB5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB5C were set to PMID: 37552066 Phenotypes for gene: RAB5C were set to Neurodevelopmental disorder MONDO:0700092, RAB5C-related Penetrance for gene: RAB5C were set to Complete Review for gene: RAB5C was set to GREEN gene: RAB5C was marked as current diagnostic Added comment: 12 individuals with nine different heterozygous de novo variants in RAB5C. 9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe). All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5383 | ATM | Zornitza Stark edited their review of gene: ATM: Added comment: Progressive cerebellar dysfunction. Intellectual ability is typically normal. However, learning can be impaired due to motor and speech difficulties.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5333 | HNRNPC |
Zornitza Stark gene: HNRNPC was added gene: HNRNPC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HNRNPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HNRNPC were set to 37541189 Phenotypes for gene: HNRNPC were set to Neurodevelopmental disorder (MONDO:0700092), HNRNPC-related Review for gene: HNRNPC was set to GREEN Added comment: 13 individuals with global developmental delay, intellectual disability, behavioral abnormalities, and subtle facial dysmorphology with heterozygous HNRNPC germline variants. Five had an identical in-frame deletion of nine amino acids in the extreme C terminus. Supportive functional data; haploinsufficiency is the mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5317 | PHF5A |
Daniel Flanagan gene: PHF5A was added gene: PHF5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: PHF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PHF5A were set to PMID: 37422718 Phenotypes for gene: PHF5A were set to Neurodevelopmental disorder (MONDO#0700092), PHF5A-related Review for gene: PHF5A was set to GREEN Added comment: Nine subjects with congenital malformations, including hypospadias, growth abnormalities, and developmental delay who had de novo PHF5A variants. Prenatally, six subjects had intrauterine growth retardation. All subjects had motor and speech delay and developmental delay. Congenital abnormalities comprised hypospadias in three of four male subjects, and heart defects (3/9), inguinal hernia (3/9), and sacral dimple (3/9). Six of the nine subjects had short stature. Craniofacial dysmorphism is variable in the nine subjects, high forehead and preauricular skin tag(s) in five subjects. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5277 | NSUN6 | chirag patel changed review comment from: Sufficient evidence for upgrade; to: Drosophila KO showed locomotion defects and reduced learning ability. Sufficient evidence for upgrade | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5252 | SART3 |
Daniel Flanagan gene: SART3 was added gene: SART3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: SART3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SART3 were set to PMID: 37296101 Phenotypes for gene: SART3 were set to Neurodevelopmental disorder (MONDO#0700092), SART3-related, with 46,XY gonadal dysgenesis Review for gene: SART3 was set to GREEN Added comment: Nine individuals from six families presenting with intellectual disability, global developmental delay, a subset of brain anomalies, together with gonadal dysgenesis in 46,XY individuals. Additionally, two individuals had seizures and two had epileptiform activity reported on EEG. Human induced pluripotent stem cells carrying patient variants in SART3 show disruption to multiple signalling pathways, upregulation of spliceosome components and demonstrate aberrant gonadal and neuronal differentiation in vitro. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5250 | RPH3A |
Lucy Spencer gene: RPH3A was added gene: RPH3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RPH3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RPH3A were set to 37403762; 29441694 Phenotypes for gene: RPH3A were set to Neurodevelopmental disorder (MONDO#0700092), RPH3A-related Review for gene: RPH3A was set to GREEN Added comment: PMID: 37403762- 6 patients with RPH3A variant. All 6 have ID, 4 have epilepsy, 2 with obesity, 1 with dysmorphic features. All 6 have missense variants, 3 shown to be de novo, the other 3 parents were not available for testing. I patient also had language and motor impairment, breathing issues and mixed hypo/hypertonia- he also had variants in CUL4B, PRKAG2, SCN4A, none of these genes cause seizures (which he had). Patch clamp studies on 2 of the missense showed they increased either the number of NMDA receptors on neuron membrane surface or increased their conductance. Study suggests that the variants interrupt the normal role of RPH3A activity at the synaptic NMDAR complex which is needed for the induction of synaptic plasticity and NMDAR-dependant behaviours Also previously 1 biallelic patient was reported, PMID: 29441694- 1 girl with learning disabilities, tremors, ataxia, hyperglycemia and muscle fatigability. Chet for 2 RPH3A missense. Functional analysis showed strong and marginal impairment of protein binding for each variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5239 | UNC79 |
Krithika Murali gene: UNC79 was added gene: UNC79 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UNC79 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UNC79 were set to PMID:37183800 Phenotypes for gene: UNC79 were set to Complex neurodevelopmental disorder - MONDO:0100038 Review for gene: UNC79 was set to AMBER Added comment: PMID:37183800 Bayat et al 2023 report 6 unrelated patients with heterozygous NMD-predicted LoF variants in UNC79 - x1 canonical splice site variant, x5 nonsense/frameshift. 5 were confirmed de novo, 1 not identified in mother - father unavailable for testing. All variants absent in gnomAD and v2 pLI score for UNC79 is 1. Patients with UNC79 variants were identified through GeneMatcher or an international network of Epilepsy and Genetics departments. x1 patient underwent duo exome sequencing, remaining had trio exome sequencing - no other causative variants identified. Phenotypic features included: - 4/6 autistic features - 5/6 patients mild-moderate ID - 4/6 behavioural issues (aggression, stereotypies) - 4/6 epilepsy (focal to bilateral tonic-clonic seizures) - 5/6 hypotonia unc79 knockdown drosophila flies exhibited significantly higher rate of seizure-like behaviour than controls. unc79 haploinsufficiency shown to lead to significant reduction in protein levels of both unc79 and unc80 in mouse brains. Unc79 haploinsufficiency associated with deficiency in hippocampal-dependent learning and memory in mice. Authors have reviewed their own evidence in relation to the gene-disease criteria detailed by Strande et al 2017 and note that their clinical and experimental data provides moderate-level evidence supporting the association between UNC79 and a neurodevelopment disorder including ASD. Amber association favoured due to clinical phenotypic range reported between affected individuals and their lack of specificity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5212 | KDM5A |
Zornitza Stark gene: KDM5A was added gene: KDM5A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KDM5A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: KDM5A were set to 21937992; 33350388 Phenotypes for gene: KDM5A were set to Neurodevelopmental disorder MONDO:0700092, KDM5A-related Review for gene: KDM5A was set to GREEN Added comment: PMID:21937992 reported a family with recessive missense KDM5A variant presenting with an undefined developmental disorder characterised with intellectual disability and facial dysmorphisms. PMID:33350388 reported nine patients from seven unrelated families identified with variants in KDM5A, of which three unrelated patients harboured heterozygous variants, while six patients from four unrelated families had homozygous variants. These patients presented with autism spectrum disorder (ASD) and a spectrum of neurodevelopmental phenotypes including intellectual disability, lack of speech, developmental delay and motor impairment. In addition, loss of KDM5A has resulted in repetitive behaviors, sociability deficits, cognitive dysfunction, and abnormal dendritic morphogenesis in mice. This gene has already been associated with phenotype in Gene2Phenotype (biallelic inheritance with 'limited' rating), but not in OMIM. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5183 | RRAS2 |
Elena Savva gene: RRAS2 was added gene: RRAS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RRAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: RRAS2 were set to PMID: 31130282; 31130285 Phenotypes for gene: RRAS2 were set to Noonan syndrome 12 MIM#618624 Mode of pathogenicity for gene: RRAS2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: RRAS2 was set to AMBER Added comment: Gene has an established GOF mechanism PMID: 31130282 - 3/9 individuals had mild learning difficulties or mild GDD PMID: 31130285 - 1/3 individuals had mild ID, 1/3 had severe ID, 1/3 normal Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5177 | ROBO1 |
Achchuthan Shanmugasundram gene: ROBO1 was added gene: ROBO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ROBO1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ROBO1 were set to 28286008; 30692597; 35227688; 35348658 Phenotypes for gene: ROBO1 were set to intellectual disability, MONDO:0001071 Review for gene: ROBO1 was set to GREEN Added comment: Comment on gene classification: This gene should be rated green as this gene has been associated with intellectual disability from six unrelated cases. However, the MOI should be set as "BIALLELIC, autosomal or pseudoautosomal" as five of these cases were reported with biallelic variants and only one case was reported with monoallelic variant. PMID:28286008 reported a boy with compound heterozygous variants that was presented with developmental delay in 13 months and had severe intellectual disability and hyperactivity at nine years of age. He was nonverbal and wheelchair dependent because of spastic diplegia and ataxia. PMID:30692597 reported a five year old boy identified with a homozygous ROBO1 variant who had combined pituitary hormone deficiency, psychomotor developmental delay, severe intellectual disability, sensorineural hearing loss, strabismus and characteristic facial features. PMID:35227688 reported eight patients including the boy reported in PMID:30692597. Of the other seven patients, three were presented with intellectual disability. Of these three patients, two harboured compound heterozygous and one harboured homozygous variants. PMID:35348658 reported a patient identified with monoallelic de novo variant (p.D422G) who presented with early-onset epileptic encephalopathy and had severe developmental delay. This gene has not yet been associated with any phenotypes in OMIM or Gene2Phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5148 | TRPC5 |
Zornitza Stark gene: TRPC5 was added gene: TRPC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRPC5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890 Phenotypes for gene: TRPC5 were set to Neurodevelopmental disorder, MONDO:0700092, TRPC5-related Review for gene: TRPC5 was set to AMBER Added comment: PMID: 36323681; Leitão E. et al. (2022) Nat Commun.13(1):6570: Missense variant NM_012471.2:c.523C>T, p.(Arg175Cys in three brothers with intellectual disability (ID) and autistic spectrum disorder (ASD), inherited from an asymptomatic mother and absent in the maternal grandparents. Whole cell patch clamp studies of HEK293 created by site-directed mutagenesis showed increased current of this calcium channel (constitutively opened). (This variant is absent in gnomAD v2.1.1). Also, the nonsense variant, c.965G> A, p.(Trp322*) was found in a high functioning ASD male (maternally inherited), NMD-predicted. Other papers and TRPC5 variants that were cited to associate this gene with X-linked ID and/or ASD include: PMID: 24817631; Mignon-Ravix, C. et al. (2014) Am. J.Med. Genet. A 164A: 1991–1997: A hemizygous 47-kb deletion in Xq23 including exon 1 of the TRPC5 gene. He had macrocephaly, delayed psychomotor development, speech delay, behavioural problems, and autistic features. Maternally inherited, and a family history compatible with X-linked inheritance (i.e., maternal great uncle was also affected, although not tested). In addition, PMID: 36323681; Leitão E. et al. (2022) cites papers with the variants p.(Pro667Thr), p.(Arg71Gln) and p.(Trp225*). NB. p.(Pro667Thr) is absent in gnomAD (v2.1.1), p.(Arg71Gln) is also absent (the alternative variant p.(Arg71Trp) is present once as heterozygous only). p.(Trp225*) is absent, and it should be noted that PTCs / LoF variants are very rare (pLI = 1). However, looking further into the three references, the evidence is not as clear or as accurate as was stated. The missense variant c.1999C>A, p.(Pro667Thr), was stated as de novo, but was actually maternally inherited but was still considered a candidate for severe intellectual disability (shown in the Appendix, Patient 93, with severe speech delay, autism spectrum disorder and Gilles de la Tourette). This patient also has a de novo MTF1 variant. Reference: PMID: 23033978; de Ligt, J. et al. (2012) N. Engl. J. Med. 367: 1921–1929). Missense variant (de novo): c.212G>A, p.(Arg71Gln), was found as part of the Deciphering Developmental Disorders (DDD) study and is shown in individual 164 in Supplementary Table 2 of PMID: 33504798; Martin, HC. et al. (2021) Nat. Commun.12: 627. Also displayed in DECIPHER (DDD research variant) with several phenotype traits, but ID and ASD are not specifically mentioned. Nonsense variant: c.674G>A. p.(Trp225*) was stated as de novo but was inherited (reference PMID: 28191890; Kosmicki, JA. et al. (2017) Nat. Genet. 49: 504–510. Supplement Table 7). This was a study of severe intellectual delay, developmental delay / autism. (NB. The de novo p.(Arg71Gln) variant from the DDD study is also listed (subject DDD 342 in Supplement 4 / Table 2). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5127 | SETD2 |
Zornitza Stark edited their review of gene: SETD2: Added comment: PMID 32710489: 12 unrelated patients, ranging from 1 month to 12 years of age, with a multisystemic neurodevelopmental disorder associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740W). Key clinical features: severely impaired global development apparent from infancy, feeding difficulties with failure to thrive, small head circumference, and dysmorphic facial features. Affected individuals have impaired intellectual development and hypotonia; they do not achieve walking or meaningful speech. Other neurologic findings may include seizures, hearing loss, ophthalmologic defects, and brain imaging abnormalities. There is variable involvement of other organ systems, including skeletal, genitourinary, cardiac, and possibly endocrine. Further 3 unrelated patients identified with mild to moderately impaired intellectual development associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740Q). These are distinct clinically from Luscan-Lumish syndrome, which is characterised by overgrowth.; Changed publications: 29681085, 32710489; Changed phenotypes: Luscan-Lumish syndrome, MIM#616831, Rabin-Pappas syndrome,MIM# 620155, Intellectual developmental disorder, autosomal dominant 70, MIM# 620157 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5060 | CBS |
Lloyd Pereira changed review comment from: Listed in OMIM with a strong disease association (MIM #236200 homocysteinuria). Multiple experimental and clinical studies demonstrate link between CBS and homocysteinuria (see below): Multiple LOF variants classified as pathogenic or likely pathogenic in ClinVar and reported in the literature in multiple homozygote and compound heterozygote individuals affected with homocystinuria, e.g. c.19dup p.(Gln7fs) (PMID: 25218699; 12124992) and c.919G>A p.(Gly307Ser) (PMID: 7506602, 7581402, 8744616, 9889017, 23733603). Multiple CBS variants reported in CBS deficiency (PMID: 12124992). ClinGen classify as definitive for Homocysteinuria. Clingen states- Twenty-one unique variants were curated (missense, nonsense, frameshift, and splice site) in 15 probands from 8 publications, and three of these probands each had two affected siblings in whom CBS variants were identified (PMID 1301198, 10408774, 7762555, 12815602, 16307898, 25455305, 26667307, 29508359). Gene-disease relationship is supported by the biochemical function of CBS, which is consistent with the biochemical features in patients with homocystinuria (including elevated plasma total homocysteine and methionine) (PMID 13654400, 15890029), functional studies in yeast, bacteria, and cultured cells, including chaperone studies in fibroblasts from patients with homocystinuria (PMID 9590298, 25331909), as well as the biochemical and clinical features of mouse models (PMID 18987302) and enzyme replacement studies in mice (PMID 29398487). Recent review reports on role of CBS in down syndrome (PMID: 31955501). However, caveat that multiple genes are associated with down syndrome. Not a strong body of research available linking CBS variants and down syndrome.; to: Listed in OMIM with a strong disease association (MIM #236200 homocysteinuria). Multiple experimental and clinical studies demonstrate link between CBS and homocysteinuria (see below): Multiple LOF variants classified as pathogenic or likely pathogenic in ClinVar and reported in the literature in multiple homozygote and compound heterozygote individuals affected with homocystinuria, e.g. c.19dup p.(Gln7fs) (PMID: 25218699; 12124992) and c.919G>A p.(Gly307Ser) (PMID: 7506602, 7581402, 8744616, 9889017, 23733603). Multiple CBS variants reported in CBS deficiency (PMID: 12124992). ClinGen classify as definitive for Homocysteinuria. Clingen states- Twenty-one unique variants were curated (missense, nonsense, frameshift, and splice site) in 15 probands from 8 publications, and three of these probands each had two affected siblings in whom CBS variants were identified (PMID 1301198, 10408774, 7762555, 12815602, 16307898, 25455305, 26667307, 29508359). Gene-disease relationship is supported by the biochemical function of CBS, which is consistent with the biochemical features in patients with homocystinuria (including elevated plasma total homocysteine and methionine) (PMID 13654400, 15890029), functional studies in yeast, bacteria, and cultured cells, including chaperone studies in fibroblasts from patients with homocystinuria (PMID 9590298, 25331909), as well as the biochemical and clinical features of mouse models (PMID 18987302) and enzyme replacement studies in mice (PMID 29398487). Recent review reports on role of CBS in down syndrome (PMID: 31955501). However, caveat that multiple genes are associated with down syndrome. Not a strong body of research available linking CBS variants and down syndrome. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.5031 | KIF26A |
chirag patel gene: KIF26A was added gene: KIF26A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIF26A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF26A were set to PMID: 36228617 Phenotypes for gene: KIF26A were set to Congenital brain malformations, no OMIM # Review for gene: KIF26A was set to GREEN Added comment: 5 unrelated patients with biallelic loss-of-function variants in KIF26A (found through WES), exhibiting a spectrum of congenital brain malformations (schizencephaly, corpus callosum anomalies, polymicrgyria, and ventriculomegaly). Combining mice and human iPSC-derived organoid models, they discovered that loss of KIF26A causes excitatory neuron-specific defects in radial migration, localization, dendritic and axonal growth, and apoptosis, offering a convincing explanation of the disease etiology in patients. Single-cell RNA sequencing in KIF26A knockout organoids revealed transcriptional changes in MAPK, MYC, and E2F pathways. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4957 | ARG1 | Zornitza Stark Phenotypes for gene: ARG1 were changed from to Argininaemia MIM#207800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4955 | ARG1 | Zornitza Stark reviewed gene: ARG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Argininaemia MIM#207800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4939 | PTPA |
Konstantinos Varvagiannis changed review comment from: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature; to: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp UK or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4939 | PTPA |
Konstantinos Varvagiannis gene: PTPA was added gene: PTPA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTPA were set to 36073231 Phenotypes for gene: PTPA were set to Intellectual disability; Parkinsonism Penetrance for gene: PTPA were set to Complete Review for gene: PTPA was set to AMBER Added comment: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below. There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID. Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports. ------ Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants. These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation. Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies. Role of the gene: As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders. Variant studies: Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt. Drosophila / animal models: Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment. Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4895 | ZMYND8 |
Konstantinos Varvagiannis gene: ZMYND8 was added gene: ZMYND8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZMYND8 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ZMYND8 were set to 35916866; 32530565 Phenotypes for gene: ZMYND8 were set to Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures Penetrance for gene: ZMYND8 were set to unknown Review for gene: ZMYND8 was set to GREEN Added comment: Dias et al (2022 - PMID: 35916866) describe the phenotype of 11 unrelated individuals with monoallelic de novo (or suspected de novo) missense (N=9) or truncating (N=2) ZMYND8 variants. One of these subjects was previously reported by Suzuki et al (2020 - PMID: 32530565). Features included speech delay/language difficulties (9/11), motor delay (9/11), ID (in 10/11 - profound in 1, moderate in 2), CHD (7/11 - PDA, VSD, ASD, pulmonary stenosis, etc), hearing or vision impairment (7/11). Seizures were reported in few (in text 5/11, table 2/11). Variable non-familial facial features were present in (9/11). As the authors discuss, ZMYND8 encodes a multidomain protein playing a role in transcription regulation, chromatin remodeling, regulation of super enhancers, DNA damage response/tumor suppression. The protein is broadly expressed in brain and shows highest expression in early development. Molecular modeling and/or a yeast two-hybrid system were suggestive of disrupted interaction of ZMYND8 with Drebrin (missense variants in PWWP domain) or GATAD2A (variants in MYND domain). Neuronal Zmynd8 knockdown in Drosophila resulted in deficits in habituation learning. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4865 | ADGRL1 |
Elena Savva gene: ADGRL1 was added gene: ADGRL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADGRL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ADGRL1 were set to PMID: 35907405 Phenotypes for gene: ADGRL1 were set to Neurodevelopmental disorder, ADGRL1-related (MONDO#0700092) Review for gene: ADGRL1 was set to GREEN Added comment: PMID: 35907405 - 9 patients w/ ADHD (3/9), autism (4/9), mild-moderate ID (5/9) and epilepsy (2/9) and facial dysmorphism (7/9). Variants include missense (4) and PTCs (5), and were either de novo (7/9) or inherited from parents with learning difficulties/ID (2/9). Functional studies on both PTCs and missense variants show significant reductions in calcium signalling and surface protein. Het null mouse model shows neurological and developmental abnormalities, with hom null mice non-viable. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4854 | KMT2B | Zornitza Stark edited their review of gene: KMT2B: Added comment: Nine individuals reported in PMID 33150406 with heterozygous variants in this gene and intellectual disability, speech delay, microcephaly, growth delay, feeding problems, and dysmorphic features, including epicanthic folds, posteriorly rotated ears, syndactyly/clinodactyly of toes, and fifth finger clinodactyly, normal MRIs and NO dystonia.; Changed publications: 33150406; Changed phenotypes: Dystonia 28, childhood-onset 617284, MONDO:0015004, Intellectual developmental disorder, autosomal dominant 68, MIM# 619934 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4532 | QDPR | Zornitza Stark Phenotypes for gene: QDPR were changed from to Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4529 | QDPR | Zornitza Stark reviewed gene: QDPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 11153907; Phenotypes: Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4507 | CHKA |
Konstantinos Varvagiannis gene: CHKA was added gene: CHKA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHKA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHKA were set to 35202461 Phenotypes for gene: CHKA were set to Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature Penetrance for gene: CHKA were set to Complete Review for gene: CHKA was set to GREEN Added comment: Klöckner (2022 - PMID: 35202461) describe the phenotype of 6 individuals (from 5 unrelated families) harboring biallelic CHKA variants. Shared features incl. abnormal muscle tone(6/6 - hypertonia or hypotonia, 3/6 each), DD/ID (6/6,severe in 4, severe/profound in 2), epilepsy (6/6 - onset: infancy - 3y2m | epileptic spasms or GS at onset), microcephaly (6/6), movement disorders (3/6 - incl. dyskinesia, rigidity, choreoatetotic movements). 2/5 individuals exhibited MRI abnormalities, notably hypomyelination. Short stature was observed in 4/6. Eventual previous genetic testing was not discussed. Exome sequencing (quattro ES for 2 sibs, trio ES for 1 individual, singleton for 3 probands) revealed biallelic CHKA variants in all affected individuals. Sanger sequencing was performed for confirmation and segregation studies. Other variants (in suppl.) were not deemed to be causative for the neurodevelopmental phenotype. 3 different missense, 1 start-loss and 1 truncating variant were identified, namely (NM_0012772.2): - c.421C>T/p.(Arg141Trp) [3 hmz subjects from 2 consanguineous families], - c.580C>T/p.Pro194Ser [1 hmz individual born to consanguineous parents], - c.2T>C/p.(Met1?) [1 hmz individual born to related parents], - c.14dup/p.(Cys6Leufs*19) in trans with c.1021T>C/p.(Phe341Leu) in 1 individual. CHKA encodes choline kinase alpha, an enzyme catalyzing the first step of phospholipid synthesis in the Kennedy pathway. The pathway is involved in de novo synthesis of glycerophospholipids, phosphatidylcholine and phosphatidylethanolamine being the most abundant in eukaryotic membranes. CHKA with its paralog (CHKB) phosphorylates either choline or ethanolamine to phosphocholine or phosphoethanolamine respectively with conversion of ATP to ADP. As the authors comment, biallelic pathogenic variants in CHKB cause a NDD with muscular dystrophy, hypotonia, ID, microcephaly and structural mitochondrial anomalies (MIM 602541). [Prominent mitochondrial patterning was observed in a single muscle biopsy available from an individual with biallelic CHKA variants]. Other disorders of the Kennedy pathway (due to biallelic PCYT2, SELENOI, PCYT1A variants) present with overlapping features incl. variable DD/ID (no-severe), microcephaly, seizures, visual impairment etc. CHKA variants were either absent or observed once in gnomAD, affected highly conserved AAs with multiple in silico predictions in favor of a deleterious effect. In silico modeling suggests structural effects for several of the missense variants (Arg141Trp, Pro194Ser presumably affect ADP binding, Phe341 lying close to the binding site of phosphocholine). Each of the missense variants was expressed in yeast cells and W. Blot suggested expression at the expected molecular weight at comparative levels. The 3 aforementioned variants exhibited reduced catalytic activity (20%, 15%, 50% respectively). NMD is thought to underly the deleterious effect of the frameshift one (not studied). The start-loss variant is expected to result in significantly impaired expression and protein function as eventual utilization of the next possible start codon - occurring at position 123 - would remove 26% of the protein. Chka(-/-) is embryonically lethal in mice, suggesting that complete loss is not compatible with life. Reduction of choline kinase activity by 30% in heterozygous mice did not appear to result in behavioral abnormalities although this was not studied in detail (PMID cited: 18029352). Finally, screening of 1566 mouse lines identified 198 genes whose disruption yields neuroanatomical phenotypes, Chka(+/-) mice being among these (PMID cited: 31371714). There is no associated phenotype in OMIM, Gene2Phenotype or SysID. Overall this gene can be considered for inclusion in the ID and epilepsy panes with green or amber rating (>3 individuals, >3 variants, variant studies, overlapping phenotype of disorders belonging to the same pathway, etc). Consider also inclusion in the microcephaly panel (where available this seemed to be of postnatal onset). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4494 | PAX5 |
Bryony Thompson gene: PAX5 was added gene: PAX5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PAX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PAX5 were set to 35094443; 31452935; 28263302; 25418537; 8001127; 27626380 Phenotypes for gene: PAX5 were set to neurodevelopmental disorder MONDO:0700092 Review for gene: PAX5 was set to GREEN Added comment: 5 individuals from 4 families with large deletions involving PAX5 and 11 individuals from 9 families with frameshift/stopgain/missense variants and neurodevelopmental phenotypes that included delayed developmental milestones (DD), intellectual disability (ID), and/or ASD. 6 of the variants are de novo. Null mouse have retarded growth and altered patterning of the posterior midbrain. Pax5+/− mice of both sexes are hyperactive and have abnormal auditory brainstem responses. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4484 | SOD1 |
Naomi Baker gene: SOD1 was added gene: SOD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SOD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SOD1 were set to PMID: 31314961; 31332433; 34788402 Phenotypes for gene: SOD1 were set to Spastic tetraplegia and axial hypotonia, progressive, MIM#618598 Review for gene: SOD1 was set to GREEN Added comment: Phenotypes include one individual with axial hypotonia and loss of gross and fine motor function beginning at 6 months of age, after which severe, progressive spastic tetraparesis developed and Babinski’s sign was present in both feet. MRI of brain detected mild frontoparietal atrophy. The second individual had severe and marked by progressive loss of motor abilities from 9 months of age, tetraspasticity with predominance in the lower extremities, mild cerebellar atrophy, and hyperekplexia-like symptoms. Dysmorphic features such as low set, posteriorly rotated ears, and overlapping toes The third individual is an infant with severe global developmental delay, axial hypotonia and limb spasticity. No dysmorphic facial features were noted, but she had a high arched palate, bilateral 5th finger clinodactyly, partial toe syndactyly of the second and third toes, and a single hyperpigmented macule tongue fasciculations, axial hypotonia with limb spasticity (more pronounced in the lower limbs), ankle clonus, and brisk patellar deep tendon reflexes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4416 | PRDM13 |
Seb Lunke gene: PRDM13 was added gene: PRDM13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature founder tags were added to gene: PRDM13. Mode of inheritance for gene: PRDM13 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PRDM13 were set to 34730112 Phenotypes for gene: PRDM13 were set to intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia Review for gene: PRDM13 was set to AMBER Added comment: Recessive disease causing ID and DSD described in three supposedly unrelated families (2 consanguine), but all are from Malta, and all share the same 13bp deletion spanning an exon-intron boundary. Mouse KO is embryonically lethal, and tissue specific KO failed to replicate many of the patients phenotypes, other than hypoplasia of the cerebellar vermis and hemispheres at P21. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4391 | CSTF2 |
Zornitza Stark gene: CSTF2 was added gene: CSTF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSTF2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: CSTF2 were set to 32816001 Phenotypes for gene: CSTF2 were set to Intellectual disability Review for gene: CSTF2 was set to AMBER Added comment: Four individuals from a single family, spanning two generations, segregating a missense variant. Functional data, including a mouse model and a gene reporter assay. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty edited their review of gene: OGDHL: Added comment: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function.; Changed rating: GREEN |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty commented on gene: OGDHL: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty changed review comment from: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. Sources: Literature; to: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4322 | OGDHL |
Melanie Marty gene: OGDHL was added gene: OGDHL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: OGDHL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OGDHL were set to PMID: 34800363 Phenotypes for gene: OGDHL were set to Neurodevelopmental disorder featuring epilepsy, hearing loss and visual impairment Added comment: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum. Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing. Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | PRICKLE2 |
Hazel Phillimore gene: PRICKLE2 was added gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRICKLE2 were set to PMID: 34092786 Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms Review for gene: PRICKLE2 was set to GREEN Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4104 | UBE2U |
Ee Ming Wong gene: UBE2U was added gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBE2U were set to PMID: 33776059 Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay Penetrance for gene: UBE2U were set to Complete Review for gene: UBE2U was set to RED gene: UBE2U was marked as current diagnostic Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband) - in silico analyses predicts the UBE2U variant to be damaging - no functional - another STUM missense variant identified in the same family predicted to be benign - additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4102 | CACNA1I |
Kristin Rigbye gene: CACNA1I was added gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1I were set to 33704440 Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CACNA1I was set to Other Review for gene: CACNA1I was set to GREEN Added comment: 4 different missense variants identified and shown to result in a gain of function. 2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy. 1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4059 | RNF220 |
Konstantinos Varvagiannis changed review comment from: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Sources: Literature, Other; to: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Consider inclusion in panels for leukodystrophies, childhood onset ataxia, sensorineural hearing loss, corpus callosum anomalies, cardiomyopathies, hepatopathies, etc in all cases with green rating. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4059 | RNF220 |
Konstantinos Varvagiannis gene: RNF220 was added gene: RNF220 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNF220 were set to 33964137; 10881263 Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum Penetrance for gene: RNF220 were set to Complete Review for gene: RNF220 was set to GREEN Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal. Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9). The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263). Extensive segregation analyses were carried out including several affected and unaffected members. RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc : *RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS) *The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions. *Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome. *Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2). *RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1. *Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt. *Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies. There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4058 | ARF3 |
Konstantinos Varvagiannis gene: ARF3 was added gene: ARF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: ARF3 were set to 34346499 Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system Penetrance for gene: ARF3 were set to unknown Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality. Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu. Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both. ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively. Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons. There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185). In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val). This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia. Evidence to support the effect of each variant include: Arg99Leu: Had identical Golgi localization to that of wt Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF) In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF). In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu) Asp67Val: Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant) Displayed decreased protein stability In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF) In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye. There is no associated phenotype in OMIM, G2P or SysID. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4053 | PLXNA2 |
Konstantinos Varvagiannis gene: PLXNA2 was added gene: PLXNA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLXNA2 were set to 34327814 Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology Penetrance for gene: PLXNA2 were set to Incomplete Review for gene: PLXNA2 was set to AMBER Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants. The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members. Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)). Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed). The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed). Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved. Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele. As the authors discuss: *PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration. *Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch. *Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD. *Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus. Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg: - Cyanotic heart disease explaining discordance in cognitive outcome among sibs - Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or - Additional pathogenic variants possibly explaining the CHD in the first subject. There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes. Sources: Literature, Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4040 | PIDD1 |
Konstantinos Varvagiannis gene: PIDD1 was added gene: PIDD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010 Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum Penetrance for gene: PIDD1 were set to Complete Review for gene: PIDD1 was set to GREEN Added comment: There is enough evidence to include this gene in the current panel with green rating. Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested. The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families]. Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants. Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder. PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage. There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation. Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants. Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26 Evidence so far provided includes: - Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern. - Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability. - Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp] - Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain. - Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD. Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects. There is currently no associated phenotype in OMIM, PanelApp Australia. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes. Overall the gene appears to be relevant for the epilepsy panel, panels for gyration and/or corpus callosum anomalies etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4023 | AP1G1 |
Zornitza Stark changed review comment from: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. Sources: Literature; to: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. GREEN for mono-allelic, AMBER for bi-allelic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4023 | AP1G1 |
Zornitza Stark gene: AP1G1 was added gene: AP1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: AP1G1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: AP1G1 were set to 34102099 Phenotypes for gene: AP1G1 were set to Neurodevelopmental disorder (NDD); Intellectual Disability; Epilepsy Review for gene: AP1G1 was set to GREEN Added comment: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants. Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site. Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality. All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4020 | CLCN3 |
Zornitza Stark gene: CLCN3 was added gene: CLCN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CLCN3 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: CLCN3 were set to 34186028 Phenotypes for gene: CLCN3 were set to Neurodevelopmental disorder Mode of pathogenicity for gene: CLCN3 was set to Other Review for gene: CLCN3 was set to GREEN Added comment: 11 individuals reported, 9 that carried 8 different rare heterozygous missense variants in CLCN3, and 2 siblings that were homozygous for an NMD-predicted frameshift variant likely abolishing ClC-3 function. All missense variants were confirmed to be de novo in eight individuals for whom parental data was available. The 11 individuals in the cohort share clinical features of variable severity. All 11 have GDD or ID and dysmorphic features, and a majority has mood or behavioural disorders and structural brain abnormalities: - Structural brain abnormalities on MRI (9/11) included partial or full agenesis of the corpus callosum (6/9), disorganized cerebellar folia (4/9), delayed myelination (3/9), decreased white matter volume (3/9), pons hypoplasia (3/9), and dysmorphic dentate nuclei (3/9). Six of those with brain abnormalities also presented with seizures. - Nine have abnormal vision, including strabismus in four and inability to fix or follow in the two with homozygous loss-of-function variants. - Hypotonia ranging from mild to severe was reported in 7 of the 11 individuals. - Six have mood or behavioural disorders, particularly anxiety (3/6). - Consistent dysmorphic facial features included microcephaly, prominent forehead, hypertelorism, down-slanting palpebral fissures, full cheeks, and micrognathia. The severity of disease in the two siblings with homozygous disruption of ClC-3 is consistent with the drastic phenotype seen in Clcn3 KO mice. The disease was more severe in two siblings carrying homozygous loss-of-function variants with the presence of GDD, absent speech, seizures, and salt and pepper fundal pigmentation in both individuals, with one deceased at 14 months of age. The siblings also had significant neuroanatomical findings including diffusely decreased white matter volume, thin corpora callosa, small hippocampi, and disorganized cerebellar folia. Supporting biallelic inheritance for LoF variants, disruption of mouse Clcn3 results in drastic neurodegeneration with loss of the hippocampus a few months after birth and early retinal degeneration. Clcn3−/− mice display severe neurodegeneration, whereas heterozygous Clcn3+/− mice appear normal. Patch-clamp studies were used to investigate four of the missense variants. These suggested a gain of function in two variants with increased current in HEK cells, however they also showed reduced rectification of voltage and a loss of transient current, plus decreased current amplitude, glycosylation and surface expression when expressed in oocytes, and were suspected to interfere with channel gating and a negative feedback mechanism. These effects were also shown to vary depending on pH levels. The current of the remaining two variants did not differ from WT. For heterozygous missense variants, the disruption induced may be at least partially conferred to mutant/WT homodimers and mutant/ClC-4 heterodimers. Both loss and gain of function in this gene resulted in the same phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4016 | SPTBN1 |
Belinda Chong changed review comment from: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature; to: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures (9/29); behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4015 | SPTBN1 |
Belinda Chong gene: SPTBN1 was added gene: SPTBN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SPTBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SPTBN1 were set to PMID: 34211179 PMID: 33847457 Phenotypes for gene: SPTBN1 were set to Neurodevelopmental Syndrome Review for gene: SPTBN1 was set to GREEN Added comment: PMID: 34211179 - Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features. - Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics. PMID: 33847457 - Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset. - identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities). - Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.4002 | SYNCRIP |
Konstantinos Varvagiannis gene: SYNCRIP was added gene: SYNCRIP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SYNCRIP were set to 34157790; 30504930; 27479843; 23020937 Phenotypes for gene: SYNCRIP were set to Global developmental delay; Intellectual disability; Autism; Myoclonic atonic seizures; Abnormality of nervous system morphology Review for gene: SYNCRIP was set to AMBER Added comment: Semino et al (2021 - PMID: 34157790) provide clinical details on 3 unrelated individuals with de novo SYNCRIP variants and provide a review of 5 additional subjects previously identified within large cohorts in the literature and databases. Features included DD, ID (7/7 for whom this information was available), ASD or autistic features (4/7). MRI abnormalities were observed in 3 (widening of CSF spaces, periventricular nodular heterotopia, prominent lat. ventricles). Epilepsy (myoclonic-astatic epilepsy / Doose syndrome) was reported for 2(/8) individuals. The 3 patients here reported were identified following trio/singleton exome with Sanger confirmation of the variants and their de novo occurrence. Variants are in almost all cases de novo (7/7 for whom this was known) and in 5/8 cases were pLoF, in 2/8 missense SNVs while a case from DECIPHER had a 77.92 kb whole gene deletion not involving other genes with unknown inheritance. Overall the variants reported to date include [NM_006372.5]: 1 - c.858_859del p.(Gly287Leufs*5) 2 - c.854dupA p.(Asn285Lysfs*8) 3 - c.734T>C p.(Leu245Pro) 4 - chr6:85605276-85683190 deletion (GRCh38) 5 - c.629T>C p.(Phe210Ser) 6 - c.1573_1574delinsTT p.(Gln525Leu) 7 - c.1247_1250del p.(Arg416Lysfs*145) 8 - c.1518_1519insC p.(Ala507Argfs*14) [P1-3: this report, P4: DECIPHER 254774, P5-6: Guo et al 2019 - PMID: 30504930, P7: Lelieveld et al 2016 - PMID: 27479843, P8: Rauch et al 2012 - PMID: 23020937 / all other Refs not here reviewed, clinical details summarized by Semino et al in table 1] SYNCRIP (also known as HNRNPQ) encodes synaptotagmin‐binding cytoplasmic RNA‐interacting protein. As the authors note, this RNA-binding protein is involved in multiple pathways associated with neuronal/muscular developmental disorders. Several references are provided for its involvement in regulation of RNA metabolism, among others sequence recognition, pre-mRNA splicing, translation, transport and degradation. Mutations in other RNA-interacting proteins and hnRNP members (e.g. HNRNPU, HNRNPD) are associated with NDD. The missense variant (p.Leu245Pro) is within RRM2 one of the 3 RNA recognition motif (RRM) domains of the protein. These 3 domains, corresponding to the central part of the protein (aa 150-400), are relatively intolerant to variation (based on in silico predictions and/or variation in gnomAD). Leu245 localizes within an RNA binding pocket and in silico modeling suggests alteration of the tertiary structure and RNA-binding capacity of RRM2. There are no additional studies performed. Overall haploinsufficiency appears to be the underlying disease mechanism based on the truncating variants and the gene deletion. [pLI in gnomAD : 1, %HI : 2.48%] Animal models are not discussed. There is no associated phenotype in OMIM. This gene is included in the DD panel of G2P (monoallelic LoF variants / SYNCRIP-related developmental disorder). SysID also lists SYNCRIP within the current primary ID genes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3985 | SUFU |
Zornitza Stark edited their review of gene: SUFU: Added comment: Heterozygous truncating variants in SUFU in 15 subjects from 6 unrelated families of various ethnic backgrounds (familial and de novo cases). Clinical features of early-onset (congenital) ocular ataxia and developmental delay, with some phenotypic variability. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign of Joubert syndrome. Paper reports that condition reported here and SUFU-associated Basal cell nevus syndrome (Gorlin) are likely allelic disorders, as there is currently no convincing evidence for a clinical overlap. Functional studies showed no differences in cilia occurrence, morphology, or localization of ciliary proteins, such as smoothened. However, analysis of expression of HH signaling target genes detected a significant increase in the general signaling activity in COMA patient–derived fibroblasts compared with control cells. We observed higher basal HH signaling activity resulting in increased basal expression levels of GLI1, GLI2, GLI3, and Patched1. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign. Knockout mice with SuFu deficiency demonstrated that SuFu is required for proper midhindbrain patterning and controls cerebellar patterning.; Changed rating: GREEN; Changed publications: 28965847, 33024317; Changed phenotypes: Joubert syndrome 32, MIM#617757, SUFU-related neurodevelopmental syndrome; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3984 | PCDHGC4 |
Zornitza Stark gene: PCDHGC4 was added gene: PCDHGC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PCDHGC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCDHGC4 were set to 34244665 Phenotypes for gene: PCDHGC4 were set to Intellectual disability; Seizures Review for gene: PCDHGC4 was set to GREEN Added comment: Eight variants reported in 19 members of nine unreleted families with a neurodevelopmental syndrome. Severe or moderate intellectual disabilty in eight families and seizures in four families. Four of the variants were LoF, in silico analysis of the remaining missense (n=3) and splice variants were predicted to be pathogenic. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3978 | IMPDH2 |
Laura Raiti gene: IMPDH2 was added gene: IMPDH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IMPDH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: IMPDH2 were set to PMID: 33098801 Added comment: 6 unrelated individuals 1x individual in a dystonia cohort index case with infancy-onset dystonia and other neurological manifestations with a de-novo missense variant, c.338G>A (p.Gly113Glu) in IMPDH2, predicted to disrupt an invariant residue within the cystathionine-β-synthase (CBS) domain pair of the encoded protein. IMPDH2 encodes IMPDH2, a key enzyme in the purine biosynthetic pathway, expressed throughout the brain and not linked previously to any human Mendelian condition. 1x individual with a de-novo substitution, c.337G>A (p.Gly113Arg), was found in in-house whole-exome sequencing data from 500 individuals with neurodevelopmental disorders. Through GeneMatcher, de novo variants identified: 3 x missense: c.729G>C (p.Gln243His), c.619G>C (p.Gly207Arg), and c.619G>A (p.Gly207Arg) 1 x deletion: c.478_480delTCC (p.Ser160del) The six variants were predicted to be deleterious and none of them seen in control databases. All affected conserved amino acids and resided in and around the cystathionine-β-synthase domain pair. The described variants are situated in and around the CBS domain pair, a regulatory element in which clustering of pathogenic missense variants has already been shown for the homologue of IMPDH2, IMPDH1. The variant carriers shared similar neurodevelopmental phenotypes. Apart from the dystonia cohort index case, one participant had evidence of dystonic posturing. Modelling of the variants on 3D protein structures revealed spatial clustering near specific functional sites, predicted to result in deregulation of IMPDH2 activity. Additionally, thermal-shift assays showed that the c.619G>A (p.Gly207Arg) variant, identified as within the CBS domain pair, and c.729G>C (p.Gln243His), which is in close vicinity, affected the stability or folding behaviour of IMPDH2. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3952 | ERGIC3 |
Seb Lunke gene: ERGIC3 was added gene: ERGIC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ERGIC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERGIC3 were set to ERGIC3 Phenotypes for gene: ERGIC3 were set to 33710394; 31585110 Review for gene: ERGIC3 was set to AMBER Added comment: PMID: 33710394 - two homozygous sibs with mild ID, a novel canonical splice (c.717+1G>A). Absent in gnomAD, no splice studies. Classed as a VUS. PMID: 31585110 - 1 hom (p.Gln233Argfs*10) in a male 8yo with Growth retardation, Microcephaly, Learning disability, Facial dysmorphism, Abnormal pigmentation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3937 | EPHA7 |
Zornitza Stark gene: EPHA7 was added gene: EPHA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: EPHA7. Mode of inheritance for gene: EPHA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EPHA7 were set to 34176129 Phenotypes for gene: EPHA7 were set to Intellectual disability Review for gene: EPHA7 was set to AMBER Added comment: Lévy et al (2021 - PMID: 34176129) provide evidence that haploinssuficiency of EPHA7 results in a neurodevelopmental disorder. The authors report on 12 individuals belonging to 9 unrelated families, all harboring with 6q microdeletions spanning EPHA7. Overlapping features included DD (13/13), ID (10/10 - mild in most cases, individuals with larger CNVs/additional variants had more severe phenotype), speech delay and behavioral disorders. Variable other features incl. hypotonia (70%), non specific facial features, eye abnormalities (40%) and cardiac defects (25%). The CNVs ranged from 152 kb to few Mb in size but in 4 subjects (P5-8) were only minimal, involving only EPHA7. 9 out of 12 individuals had inherited the deletion (5 subjects paternal, 4 maternal), in 1 subject (P12) this occured de novo, while for 2 others inheritance was not specified. Most deletions were inherited from an unaffected parent (in 6/7 families), with unclear contribution in a further one. The authors discuss on previous studies suggesting an important role for EphA7 in brain development (modulation of cell-cell adhesion and repulsion, regulation of dendrite morphogenesis in early corticogenesis, role in dendritic spine formation later in development. EphA7 has also been proposed to drive neuronal maturation and synaptic function). Haploinsufficiency for other ephrins or ephrin receptors has been implicated in other NDDs. Overall Lévy et al promote incomplete penetrance and variable expressivity with haploinsufficiency of this gene being a risk factor for NDD. [The gene has also an %HI of 2.76% and a pLI of 1]. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3928 | ATP2C2 |
Zornitza Stark gene: ATP2C2 was added gene: ATP2C2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP2C2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP2C2 were set to 33864365; 28440294 Phenotypes for gene: ATP2C2 were set to language impairment, HP:0002463 Review for gene: ATP2C2 was set to RED Added comment: PMID: 33864365 - Martinelli et al 2021 - report a family with a missense variant NM_001286527.2:c.304G>A, p.(Val102Met) in ATP2C2 in a father and two siblings with specific language impairment. However two other affected siblings did not have this variant. This variant was also reported by Chen et al. They found that the variant had a higher frequency in language cases (1.8%, N = 360) compared with cohorts selected for dyslexia (0.8%, N = 520) and ADHD (0.7%, N = 150), which presented frequencies comparable to reference databases (0.9%, N = 24 046 gnomAD controls). They postulate that variant is not sufficient on its own to cause a disorder but is a susceptibility factor which increases the risk for language impairment. PMID: 28440294 - Chen et al 2017 - report 2 probands with severe learning impairment, and missense variants in ATP2C2 (NM_001286527: c.G304A:p.V102M and NM_001291454:exon21: c.C1936T:p.R646W). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3786 | UFSP2 |
Konstantinos Varvagiannis changed review comment from: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature; to: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. **Monoallelic** (correction to previous review) UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3785 | UFSP2 |
Konstantinos Varvagiannis gene: UFSP2 was added gene: UFSP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UFSP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UFSP2 were set to 33473208 Phenotypes for gene: UFSP2 were set to Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus Penetrance for gene: UFSP2 were set to Complete Review for gene: UFSP2 was set to AMBER Added comment: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)]. Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3). Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2. The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity. Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8). UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided] UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1). Additional studies were carried to provide evidence for pathogenicity of this variant. Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability. The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization. Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers. Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain. Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants. Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance. In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes. You may consider inclusion in the current panel with amber/green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3753 | TMEM222 |
Konstantinos Varvagiannis gene: TMEM222 was added gene: TMEM222 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM222 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM222 were set to 33824500 Phenotypes for gene: TMEM222 were set to Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality Penetrance for gene: TMEM222 were set to Complete Review for gene: TMEM222 was set to GREEN Added comment: Polla et al (2021 - PMID: 33824500) report 17 individuals from 9 unrelated families, with biallelic TMEM222 pathogenic variants. The phenotype included motor, speech delay and moderate to severe ID (as universal features). Other manifestations included hypotonia (10/15), broad gait (5/12), seizures (7/17 - belonging to 6/9 families), MRI abnormalities (5/8). Variable behavioral abnormalities were observed (aggressive behavior, shy character, stereotypic movements etc). Abnormal OFC was a feature in several with microcephaly in 7 subjects from 4 families (measurements not available for all 17). Nonspecific facial features were reported in 10/17. Rare features incl. body tremors, decreased lower extremity muscle mass or disorder of motor neurons. TMEM222 variants were identified following exome sequencing. Previous investigations incl. metabolic studies, FMR1, chromosomes by standard karyotype or CMA, SMA, CMT1A were reported to be normal (available for some individuals). TMEM222 variants missense and pLoF ones mostly found in homozygosity (7/9 families were consanguineous, compound heterozygosity reported in a single case from the 9 families). Sanger sequencing was used for confirmation of variants, parental carrier state as well as testing of sibs (unaffected sibs tested in 4 families). Few individuals had additional genetic findings in other genes, though classified as VUS (3 families). The gene encodes transmembrane protein 222 (208 residues) which however has unknown function. The protein comprises 3 transmembrane domains and a domain of unknown function. TMEMs are a group of transmembrane proteins spanning membranes with - most commonly - unclear function. The authors measured expression by qPCR mRNA analysis, demonstrating highest fetal and adult brain expression (incl. parietal and occipital cortex). Expression levels from GTEx data also support a role in neurodevelopment. Immunocytochemistry revealed highest levels in mature human iPSC-derived glutaminergic cortical neurons and moderate in immature ones. Additional studies supported that the gene is highly expressed in dendrites and might play a role in postsynaptic vesicles (colocalization with postsynaptic and early endosomal markers). A previous study by Riazuddin et al (2017 - PMID: 27457812) had identified TMEM222 as a candidate gene for ID. This family (PKMR213) however appears to be included as family 2 in the aforementioned publication (same pedigree, variant and phenotype in both articles). In OMIM there is currently no associated phenotype. The gene is listed among the primary ID genes in SysID. Please consider inclusion in the ID panel with green (or amber) rating. This gene may also be included in other panels e.g. for epilepsy, microcephaly, etc. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3746 | DPYSL5 |
Zornitza Stark gene: DPYSL5 was added gene: DPYSL5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DPYSL5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DPYSL5 were set to 33894126 Phenotypes for gene: DPYSL5 were set to Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities Review for gene: DPYSL5 was set to GREEN Added comment: Nine individuals with brain malformations, including corpus callosum agenesis and/or posterior fossa abnormalities, associated with variable degrees of intellectual disability. The recurrent de novo p.Glu41Lys was found in eight unrelated patients, and a p.Gly47Arg variant was identified in one individual from the first family reported with Ritscher-Schinzel syndrome. Both impaired DPYSL5 function on dendritic outgrowth regulation by preventing the formation of the ternary complex with MAP2 and βIII-tubulin, ultimately leading to abnormal brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3738 | PTPN4 |
Bryony Thompson gene: PTPN4 was added gene: PTPN4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN4 were set to 17953619; 25424712; 30238967; DOI: https://doi.org/10.1016/j.xhgg.2021.100033 Phenotypes for gene: PTPN4 were set to Intellectual disability; developmental delay Review for gene: PTPN4 was set to GREEN Added comment: >3 unrelated probands and supporting mouse model PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3713 | JMJD1C |
Chris Richmond gene: JMJD1C was added gene: JMJD1C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: JMJD1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: JMJD1C were set to 26181491; 32996679 Phenotypes for gene: JMJD1C were set to Intellectual disability Penetrance for gene: JMJD1C were set to unknown Review for gene: JMJD1C was set to GREEN Added comment: Reported in ID cohort (with Rett-like phenotypic overlap) with supporting functional studies (PMID: 26181491) "Functional study of the JMJD1C mutant Rett syndrome patient demonstrated that the altered protein had abnormal subcellular localization, diminished activity to demethylate the DNA damage-response protein MDC1, and reduced binding to MECP2. We confirmed that JMJD1C protein is widely expressed in brain regions and that its depletion compromises dendritic activity." Splice-disrupting JMJD1C variant reported in association with learning disability and myoclonic epilepsy (PMID 32996679) Disruption of gene due to balanced translocation (PMID 33591602) implicated in autism spectrum disease phenotype. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3604 | NMNAT1 |
Zornitza Stark gene: NMNAT1 was added gene: NMNAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV, founder tags were added to gene: NMNAT1. Mode of inheritance for gene: NMNAT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NMNAT1 were set to 32533184; 33668384 Phenotypes for gene: NMNAT1 were set to Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual disability, and Leber congenital amaurosis (SHILCA), MIM#619260; Leber congenital amaurosis 9, MIM# 608553 Review for gene: NMNAT1 was set to AMBER Added comment: Three families reported, but two are distantly related (shared haplotype). The affected children in those two families were homozygous for 7.4-kb duplication involving the last 2 exons of the NMNAT1 gene, spanning the beginning of intron 3 to the middle of the 3-prime UTR (chr1:10,036,359-10,043,727, GRCh37). The third affected individual was compound het for the duplication and a splicing variant. Note bi-allelic variants in this gene are associated with non-syndromic LCA, multiple families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3538 | SATB1 |
Zornitza Stark edited their review of gene: SATB1: Added comment: Kohlschutter-Tonz syndrome-like (KTZSL) is characterized by global developmental delay with moderately to severely impaired intellectual development, poor or absent speech, and delayed motor skills. Although the severity of the disorder varies, many patients are nonverbal and have hypotonia with inability to sit or walk. Early-onset epilepsy is common and may be refractory to treatment, leading to epileptic encephalopathy and further interruption of developmental progress. Most patients have feeding difficulties with poor overall growth and dysmorphic facial features, as well as significant dental anomalies resembling amelogenesis imperfecta. This phenotype was reported in 28 patients (patients 13 to 40, PMID 33513338), including 9 patients from 3 families. Most variants were de novo, though some were inherited, suggestive of incomplete penetrance and variable expressivity. Developmental delay with dysmorphic facies and dental anomalies (DEFDA) is characterized by generally mild global developmental delay with variably impaired intellectual development, walking by 2 to 3 years, and slow language acquisition. The severity of the disorder ranges from moderate cognitive deficits to mild learning difficulties or behavioral abnormalities. Most patients have dysmorphic facial features, often with abnormal dentition and nonspecific visual defects, such as myopia, astigmatism, and strabismus. Although rare, involvement of other systems, such as skeletal, cardiac, and gastrointestinal, may be present. 12 individuals from 11 families reported (one inherited variant, affected parent).; Changed phenotypes: Kohlschutter-Tonz syndrome-like, MIM# 619229, Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228, Developmental disorders |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3482 | SIAH1 |
Zornitza Stark gene: SIAH1 was added gene: SIAH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SIAH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SIAH1 were set to 32430360 Phenotypes for gene: SIAH1 were set to Developmental delay; Infantile hypotonia; Dysmorphic features; Laryngomalacia Review for gene: SIAH1 was set to GREEN Added comment: - PMID: 32430360 (2021) - Five unrelated individuals with shared features of developmental delay, infantile hypotonia, dysmorphic features and laryngomalacia. All had speech delay and where cognitive assessment was age appropriate individuals exhibited learning difficulties. Trio WES revealed distinct de novo variants in SIAH1. In vitro assays demonstrated that SIAH1 mutants induce loss of Wnt stimulatory activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3378 | FGF13 |
Zornitza Stark gene: FGF13 was added gene: FGF13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FGF13 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: FGF13 were set to 33245860 Phenotypes for gene: FGF13 were set to Intellectual disability; epilepsy Mode of pathogenicity for gene: FGF13 was set to Other Review for gene: FGF13 was set to GREEN Added comment: Two sibling pairs and three unrelated males reported who presented in infancy with intractable focal seizures and severe developmental delay. The variants were located in the N-terminal domain of the A isoform of FGF13/FHF2 (FHF2A). The X-linked FHF2 gene (also known as FGF13) has alternative first exons which produce multiple protein isoforms that differ in their N-terminal sequence. The variants were located at highly conserved residues in the FHF2A inactivation particle that competes with the intrinsic fast inactivation mechanism of Nav channels. Functional characterization of mutant FHF2A co-expressed with wild-type Nav1.6 (SCN8A) revealed that mutant FHF2A proteins lost the ability to induce rapid-onset, long-term blockade of the channel while retaining pro-excitatory properties. These gain-of-function effects are likely to increase neuronal excitability consistent with the epileptic potential of FHF2 variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3264 | RAP1B |
chirag patel gene: RAP1B was added gene: RAP1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAP1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAP1B were set to PMID: 32627184 Phenotypes for gene: RAP1B were set to RAP1B‐associated phenotype, no OMIM # Review for gene: RAP1B was set to RED Added comment: De novo variants in the RAP1B gene (c.35G>T p.(Gly12Val) and c.178G>C p.(Gly60Arg)) in two unrelated patients with thrombocytopenia, microcephaly, learning difficulties, renal malformations, structural anomalies of the brain and other features (not Kabuki like). RAP1B is a member of the RAS superfamily of small GTPases. There is strong evidence that the p.Gly12Val and p.Gly60Arg variants in the RAP1B gene lead into a dysregulation of the downstream pathway. Both substitutions have been described previously as dominant constitutively active in RAS‐related proteins (gain of function variants). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3262 | FBXO28 |
Zornitza Stark changed review comment from: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All patients had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features. Sources: Literature; to: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3261 | FBXO28 |
Zornitza Stark gene: FBXO28 was added gene: FBXO28 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXO28 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FBXO28 were set to 33280099 Phenotypes for gene: FBXO28 were set to Developmental and epileptic encephalopathy Review for gene: FBXO28 was set to GREEN Added comment: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All patients had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3248 | KDM4B |
Kristin Rigbye gene: KDM4B was added gene: KDM4B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KDM4B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KDM4B were set to PMID: 33232677 Phenotypes for gene: KDM4B were set to Global developmental delay, intellectual disability and neuroanatomical defects Review for gene: KDM4B was set to GREEN Added comment: Nine individuals with mono-allelic de novo or inherited variants in KDM4B. All individuals presented with dysmorphic features and global developmental delay (GDD) with language and motor skills most affected. Three individuals had a history of seizures, and four had anomalies on brain imaging ranging from agenesis of the corpus callosum with hydrocephalus to cystic formations, abnormal hippocampi, and polymicrogyria. In a knockout mouse the total brain volume was significantly reduced with decreased size of the hippocampal dentate gyrus, partial agenesis of the corpus callosum, and ventriculomegaly. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3127 | MPP5 |
Konstantinos Varvagiannis gene: MPP5 was added gene: MPP5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MPP5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MPP5 were set to 33073849 Phenotypes for gene: MPP5 were set to Global developmental delay; Intellectual disability; Delayed speech and language development; Developmental regression; Behavioral abnormality Penetrance for gene: MPP5 were set to unknown Review for gene: MPP5 was set to GREEN Added comment: Sterling et al (2020 - PMID: 33073849) provide information on the phenotype of 3 individuals with de novo MPP5 variants. Common features included global developmental delay, intellectual disability (3/3 - severe in 2/3), speech delay/regression (the latter in at least 2) and behavioral abnormalities. Variable other features were reported, among others microcephaly (1/3), abnormal vision (1/3 : CVI, retinal dystrophy, nystagmus), brain MRI abnormalities (2/3), late-onset seizures (1/3). These subjects displayed variable and non-specific dysmorphic features. All were investigated by exome sequencing (previous investigations not mentioned). One subject was found to harbor a de novo mosaic (5/25 reads) stopgain variant, further confirmed by Sanger sequencing [NM_022474.4:c.1555C>T - p.(Arg519Ter). The specific variant is reported once in gnomAD (1/251338). Two de novo missense variants were identified in the remaining individuals [c.1289A>G - p.Glu430Gly / c.974A>C - p.His325Pro). All variants had in silico predictions in favor of a deleterious effect (CADD score >24). The authors comment that MPP5 encodes an apical complex protein with asymmetric localization to the apical side of polarized cells. It is expressed in brain, peripheral nervous system and other tissues. MPP5 is a member of the membrane-associated guanylate kinase family of proteins (MAGUK p55 subfamily), determining cell polarity at tight junctions. Previous animal models suggest that complete Mpp5(Pals1) KO in mice leads to near absence of cerebral cortical neurons. Htz KO display reduction in size of cerebral cortex and hippocampus. The gene is expressed in proliferating cell populations of cerebellum and important for establishment cerebellar architecture. Conditional KO of Mpp5(Pals1) in retinal progenitor cells mimics the retinal pathology observed in LCA. [Several refs. provided] The authors studied a heterozygous CNS-specific Mpp5 KO mouse model. These mice presented microcephaly, decreased cerebellar volume and cortical thickness, decreased ependymal cells and Mpp5 at the apical surface of cortical vertrical zone. The proportion of cortical cells undergoing apoptotic cell death was increased. Mice displayed behavioral abnormalities (hyperactivity) and visual deficits, with ERG traces further suggesting retinal blindness. Overall the mouse model was thought to recapitulate the behavioral abnormalities observed in affected subjects as well as individual rare features such as microcephaly and abnormal vision. Haploinsufficiency (rather than a dominant negative effect) is favored as the underlying disease mechanism. This is also in line with a dose dependent effect observed in mice. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | CSNK1G1 |
Konstantinos Varvagiannis changed review comment from: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) are also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature; to: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presented ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) are also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | CSNK1G1 |
Konstantinos Varvagiannis changed review comment from: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature; to: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) are also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3078 | CSNK1G1 |
Konstantinos Varvagiannis gene: CSNK1G1 was added gene: CSNK1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSNK1G1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CSNK1G1 were set to 33009664 Phenotypes for gene: CSNK1G1 were set to Global developmental delay; Intellectual disability; Autism; Seizures; Abnormality of the face; Abnromality of limbs Penetrance for gene: CSNK1G1 were set to unknown Review for gene: CSNK1G1 was set to AMBER Added comment: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883). Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress). CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited). One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn]. Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD. There were no variant studies performed. The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies). The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated. Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) also discussed. Overall, this gene can be considered for inclusion with probably amber rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides produced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration in mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variant were on the same allele, as phase was not determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3053 | NEMF |
Konstantinos Varvagiannis changed review comment from: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could be ruled out that the de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration).; to: Biallelic (and possibly monoallelic) pathogenic variants in this gene are associated with DD/ID. Martin et al (2020 - PMID:32934225) report on 8 individuals from 6 families with a juvenile neuromuscular disease due to biallelic NEMF variants. (In one of these 8 cases it could not be ruled out that a de novo and maternally inherited variants were on the same allele, as phase was not been determined). A ninth individual with similar presentation was found to harbor a single NEMF missense SNV as de novo event (due to a speculated dominant-negative effect). This individual had a similar presentation. Features incl. hypotonia (4/8 with biallelic variant (B) | 1/1 monoallelic (M) ), DD/ID (7/8B | 0/1M) with speech delay as universal feature (8/8B | 1/1M), axonal neuropathy (3/3B | 1/1M), ataxia (3/8B | 0/1M). Other findings included tremor (1/7B | 1/1M), abnormal brain imaging (2/6B / ?/1M), kyphosis/scoliosis (4/8B | 0/1M), respiratory distress (1/8B | 0/1M). NEMF (Rqc2 in yeast) encodes the nuclear export mediator factor, a component of the Ribosome-associated Quality Control (RCQ) complex which is involved in proteolytic targeting of incomplete polypeptides prodduced by ribosome stalling. NEMF facilitates the recruitment of E3 ligase Listerin (LTN1) which ubiquitinates nascent polypeptide chains for subsequent proteasomal degradation. The author provide evidence that mice homozygous for Nemf missense mutations display progressive motor phenotypes, exhibit neurogenic atrophy and progressive axonal degeneration. A further NEMF-null mouse model displayed more severe phenotype (with heterozygous mice being unaffected). Equivalent mutations (of those in the above mouse model) in yeast (Rqc2) were shown to interfere with its ability to modify aberrant translation products with C-terminal tails which assist RQC-mediated protein degradation. Mutation of Ltn1 (belonging to the same protein control pathway) has been also shown to lead to neurodegeneration im mice. Overall NEMF is thought to play a role in neuronal translational homeostasis and the disorder to be mediated by dysfunction of the RQC pathway (normally protecting neurons against degeneration). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3050 | HPDL |
Zornitza Stark changed review comment from: Intellectual impairment is variable, ranging from poor visual contact with inability to walk or speak to milder intellectual disability with the ability to say some words.; to: 17 individuals from 13 families, with a spectrum of neurologic impairment ranging from a severe congenital form without any neurological development (n = 2/17, 12%) to infantile-onset presentations (n = 10/17, 59%) with moderate to severe neurodevelopmental issues, partly with a pathology reminiscent of mitochondrial disease (Leigh-like syndrome), to juvenile-onset spastic paraplegia (n = 5/17, 29%). Intellectual impairment is variable, ranging from poor visual contact with inability to walk or speak to milder intellectual disability with the ability to say some words. Frequently observed additional clinical findings included chronic progression of neurological signs (n = 16/17, 94%), microcephaly (n = 9/16, 56%), and seizures/epilepsy (n = 9/17, 53%). Other relevant clinical findings were visual disturbances/strabismus (n = 9/17, 53%) and loss of developmental milestones (n = 6/17, 35%). Acute central respiratory failure leading to life-threatening events requiring partly mechanically assisted ventilation occurred in half of individuals with infantile presentation (n = 5/10, 50%), respectively one third of all individuals (n = 5/17, 29%). Demyelinating neuropathy was present in three individuals (n = 3/11, 27%), with reduced sensory nerve conduction velocity (NCV) in all and severely reduced motor NCV in one. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.3012 | NEMF |
Zornitza Stark gene: NEMF was added gene: NEMF was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NEMF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NEMF were set to 32934225 Phenotypes for gene: NEMF were set to Intellectual disability; neuropathy Review for gene: NEMF was set to GREEN Added comment: Nine individuals from 7 unrelated families reported with a mixed CNS/PNS phenotype. 7/9 had ID, 4/9 had formal assessments demonstrating axonal neuropathy, 3/9 had ataxia; muscular atrophy, hypotonia, respiratory distress, scoliosis also described in some. Three independently generated mouse models had progressive motor neuron degeneration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2920 | CTNND1 |
Zornitza Stark gene: CTNND1 was added gene: CTNND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CTNND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CTNND1 were set to 28301459; 32196547 Phenotypes for gene: CTNND1 were set to Blepharocheilodontic syndrome 2, MIM# 617681 Review for gene: CTNND1 was set to AMBER Added comment: 4 individuals from 3 unrelated families with blepharocheilodontic syndrome and mutations in the CTNND1 gene reported originally in PMID 28301459. All had eyelid anomalies, including ectropion of the lower lids, euryblepharon, lagophthalmia, and distichiasis. In addition, all 4 showed typical facial dysmorphism with hypertelorism, flat face, and high forehead, and all had conical teeth and tooth agenesis. Three had cleft lip and palate, 3 had hair anomalies, and 1 had hypothyroidism due to hypoplasia or aplasia of the thyroid gland. None of the patients exhibited anal atresia or neural tube defects. PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13). This more recent publication suggests a broader phenotype associated with CTNND1 variants including dev delay, ADHD/ASD, behavioural issues. Unclear from description whether significant ID present. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2849 | LMBRD2 |
Konstantinos Varvagiannis gene: LMBRD2 was added gene: LMBRD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LMBRD2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: LMBRD2 were set to 32820033; https://doi.org/10.1101/797787 Phenotypes for gene: LMBRD2 were set to Global developmental delay; Intellectual disability; Microcephaly; Seizures; Abnormality of nervous system morphology; Abnormality of the eye Penetrance for gene: LMBRD2 were set to unknown Mode of pathogenicity for gene: LMBRD2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: LMBRD2 was set to AMBER Added comment: You may consider inclusion with green (13 individuals with dn missense SNVs overall, overlapping features for 10 with available phenotype / a recurring variant has been identified in 2 different studies) or amber rating (role of the gene not known, no variant studies, animal model probably not available). ► Malhotra et al (2020 - PMID: 32820033) report on 10 unrelated individuals with de novo missense LMBRD2 variants. Features included DD (9/10), ID (6/8 of relevant age), microcephaly (7/10), seizures (5/10 - >=3 different variants), structural brain abnormalities (e.g. thin CC in 6/9), highly variable ocular abnormalities (5/10) and dysmorphic features in some (7/10 - nonspecific). All had variable prior non-diagnostic genetic tests (CMA, gene panel, mendeliome, karyotype). WES/WGS revealed LMBRD2 missense variants, in all cases de novo. A single individual had additional variants with weaker evidence of pathogenicity. 5 unique missense SNVs and 2 recurrent ones (NM_001007527:c.367T>C - p.Trp123Arg / c.1448G>A - p.Arg483His) were identified. These occurred in different exons. Variants were not present in gnomAD and all had several in silico predictions in favor of a deleterious effect. There was phenotypic variability among individuals with the same variant (e.g. seizures in 1/3 and microchephaly in 2/3 of those harboring R483H). The gene has a pLI of 0 (although o/e ranges from 0.23 to 0.55), %HI of 15.13 and z-score of 2.27. The authors presume that haploinsufficiency may not apply, and consider a gain-of-function/dominant-negative effect more likely. As the authors comment LMBRD2 (LMBR1 domain containing 2) encodes a membrane bound protein with poorly described function. It is widely expressed across tissues with notable expression in human brain (also in Drosophila, or Xenopus laevis). It displays high interspecies conservation. It has been suggested (Paek et al - PMID: 28388415) that LMBRD2 is a potential regulator of β2 adrenoreceptor signalling through involvement in GPCR signalling. ► Kaplanis et al (2020 - https://doi.org/10.1101/797787) in a dataset of 31058 parent-offspring trios (WES) previously identified 3 individuals with developmental disorder, harboring c.1448G>A - p.Arg483His. These individuals (1 from the DDD study, and 2 GeneDx patients) appear in Decipher. [ https://decipher.sanger.ac.uk/ddd/research-variant/40e17c78cc9655a6721006fc1e0c98db/overview ]. The preprint by Kaplanis et al is cited by Malhotra et al, with Arg483His reported in 6 patients overall in both studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2833 | FAM50A |
Konstantinos Varvagiannis gene: FAM50A was added gene: FAM50A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FAM50A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: FAM50A were set to 32703943 Phenotypes for gene: FAM50A were set to Mental retardation syndrome, X-linked, Armfield type (MIM #300261) Penetrance for gene: FAM50A were set to unknown Review for gene: FAM50A was set to GREEN Added comment: Lee et al (2020 - PMID: 32703943) provide evidence that Armfield X-Linked intellectual disability syndrome is caused by monoallelic FAM50A pathogenic variants. The current review is based only on this reference. The authors provide clinical details on 6 affected individuals from 5 families. Features included postnatal growth delay, DD and ID (6/6 - also evident for those without formal IQ assesment), seizures (3/6 from 2 families), prominent forehead with presence of other facial features and variable head circumference (5th to >97th %le), ocular anomalies (5/6 - strabismus/nystagmus/Axenfeld-Rieger), cardiac (3/6 - ASD/Fallot) and genitourinary anomalies (3/6). In the first of these families (Armfield et al 1999 - PMID: 10398235), linkage analysis followed by additional studies (Sanger, NGS of 718 genes on chrX, X-exome NGS - several refs provided) allowed the identification of a FAM50A variant. Variants in other families were identified by singleton (1 fam) or trio-ES (3 fam). In affected individuals from 3 families, the variant had occurred de novo. Carrier females in the other families were unaffected (based on pedigrees and/or the original publication). XCI was rather biased in most obligate carrier females from the 1st family (although this ranged from 95:5 to 60:40). Missense variants were reported in all affected subjects incl. Trp206Gly, Asp255Gly, Asp255Asn (dn), Glu254Gly (dn), Arg273Trp (dn) (NM_004699.3). Previous studies have demonstrated that FAM50A has ubiquitous expression in human fetal and adult tissues (incl. brain in fetal ones). Immunostaining suggests a nuclear localization for the protein (NIH/3T3 cells). Comparison of protein levels in LCLs from affected males and controls did not demonstrate significant differences. Protein localization for 3 variants (transfection of COS-7 cells) was shown to be similar to wt. Complementation studies in zebrafish provided evidence that the identified variants confer partial loss of function (rescue of the morpholino phenotype with co-injection of wt but not mt mRNA). The zebrafish ko model seemed to recapitulate the abnormal development of cephalic structures and was indicative of diminished/defective neurogenesis. Transcriptional dysregulation was demonstrated in zebrafish (altered levels and mis-splicing). Upregulation of spliceosome effectors was demonstrated in ko zebrafish. Similarly, mRNA expression and splicing defects were demonstrated in LCLs from affected individuals. FAM50A pulldown followed by mass spectrometry in transfected HEK293T cells demonstrated enrichment of binding proteins involved in RNA processing and co-immunoprecipitation assays (transfected U-87 cells) suggested that FAM50A interacts with spliceosome U5 and C-complex proteins. Overall aberrant spliceosome C-complex function is suggested as the underlying pathogenetic mechanism. Several other neurodevelopmental syndromes are caused by variants in genes encoding C-complex affiliated proteins (incl. EFTUD2, EIF4A3, THOC2, etc.). Please consider inclusion in the ID panel with green rating and epilepsy panel with amber (seizures in individuals from 2 families). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2833 | ADK | Zornitza Stark Phenotypes for gene: ADK were changed from to Hypermethioninemia due to adenosine kinase deficiency, MIM# 614300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2830 | ADK | Zornitza Stark reviewed gene: ADK: Rating: GREEN; Mode of pathogenicity: None; Publications: 21963049, 17120046; Phenotypes: Hypermethioninemia due to adenosine kinase deficiency, MIM# 614300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2803 | MAPK1 |
Konstantinos Varvagiannis gene: MAPK1 was added gene: MAPK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAPK1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAPK1 were set to 32721402 Phenotypes for gene: MAPK1 were set to Global developmental delay; Intellectual disability; Behavioral abnormality; Growth delay; Abnormality of the face; Abnormality of the neck; Abnormality of the cardiovascular system; Abnormality of the skin Penetrance for gene: MAPK1 were set to unknown Mode of pathogenicity for gene: MAPK1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: MAPK1 was set to GREEN Added comment: Motta et al (2020 - PMID: 32721402) report on 7 unrelated individuals harboring de novo missense MAPK1 pathogenic variants. The phenotype corresponded to a neurodevelopmental disorder and - as the authors comment - consistently included DD, ID , behavioral problems. Postnatal growth delay was observed in approximately half. Hypertelorism, ptosis, downslant of palpebral fissures, wide nasal bridge as low-set/posteriorly rotated ears were among the facial features observed (each in 3 or more subjects within this cohort). Together with short/webbed neck and abnormalities of skin (lentigines / CAL spots) and growth delay these led to clinical suspicion of Noonan s. or disorder of the same pathway in some. Congenital heart defects (ASD, mitral valve insufficiency, though not cardiomyopathy) occurred in 4/7. Bleeding diathesis and lymphedema were reported only once. MAPK1 encodes the mitogen-activated protein kinase 1 (also known as ERK2) a serine/threonine kinase of the RAS-RAF-MEK-(MAPK/)ERK pathway. MAPK1 de novo variants were identified in all individuals following trio exome sequencing (and extensive previous genetic investigations which were non-diagnostic). The distribution of variants, as well as in silico/vitro/vivo studies suggest a GoF effect (boosted signal through the MAPK cascade. MAPK signaling also upregulated in Noonan syndrome). The authors comment that screening of 267 additional individuals with suspected RASopathy (without mutations in previously implicated genes) did not reveal other MAPK1 variants. Overall this gene can be considered for inclusion in the ID panel with green rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2790 | LARS |
Konstantinos Varvagiannis gene: LARS was added gene: LARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LARS were set to 32699352 Phenotypes for gene: LARS were set to Infantile liver failure syndrome 1, MIM# 615438 Penetrance for gene: LARS were set to Complete Review for gene: LARS was set to GREEN Added comment: Please consider inclusion with amber/green rating in the current panel. Biallelic pathogenic LARS1 variants cause Infantile liver failure syndrome 1, MIM# 615438. Lenz et al (2020 - PMID: 32699352) review the phenotype of 25 affected individuals from 15 families. Seizures occurred in 19/24 and were commonly associated with infections. Encephalopathic episodes (in 13 patients) accompanied by seizures up to status epilepticus occurred independently of hepatic decompensation. In addition 22/24 presented with neurodevelopmental delay. The authors comment that cognitive impairment was present in 13/17 individuals (mild-severe) whereas most presented with learning disabilities. These patients will most likely investigated for their liver disease (although presentation was highly variable and/or very mild in few). The gene encodes a cytoplasmic amino-acyl tRNA synthetase (ARS) with neurologic manifestations observed in almost all patients (and seizures / DD and ID common to other disorders due to mutations in other genes encoding for ARSs). Please note that the HGNC approved symbol for this gene is LARS1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2783 | MORC2 |
Konstantinos Varvagiannis gene: MORC2 was added gene: MORC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MORC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MORC2 were set to https://doi.org/10.1016/j.ajhg.2020.06.013 Phenotypes for gene: MORC2 were set to Charcot-Marie-Tooth disease, axonal, type 2Z, MIM #616688 Penetrance for gene: MORC2 were set to unknown Mode of pathogenicity for gene: MORC2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: MORC2 was set to GREEN Added comment: The current review is based on a recent report by Sacoto et al (2020 - https://doi.org/10.1016/j.ajhg.2020.06.013). While several previous studies focused on the phenotype of axonal motor and senory neuropathy in individuals with heterozygous MORC2 pathogenic variants (Charcot-Marie-Tooth disease, axonal, type 2Z, MIM #616688) some of them presented among others with hypotonia, muscle weakness, intellectual disability, microcephaly or hearing loss [refs provided by Sacoto et al - learning disabilities (in some patients) also listed in OMIM's clinical synopsis]. Sacoto et al present a cohort of 20 individuals having genetic testing for developmental delay or growth failure (with a single one for a diagnosis of sensorimotor neuropathy). Overlapping features included DD, ID (18/20 - mild to severe), short stature (18/20), microcephaly (15/20) and variable craniofacial dysmorphisms. The authors comment that features suggestive of neuropathy (weakness, hyporeflexia, abnormal EMG/NCS) were frequent but not the predominant complaint. EMG/NCS abnormalities were abnormal in 6 out of 10 subjects investigated in this cohort. Other findings included brain MRI abnormalities (12/18 - in 5/18 Leigh-like lesions), hearing loss (11/19) and pigmentary retinopathy in few (5). Affected subjects were found to harbor in all cases missense variants in the ATPase module of MORC2 [residues 1 to 494 - NM_001303256.1 - the module consists of an ATPase domain (aa 1-265), a transducer S5-like domain (266-494) and a coiled-coiled domain (CC1 - aa 282-361)]. Variants had occured mostly as de novo events although inheritance from a similarly affected parent was also reported. Some of them were recurring within this cohort and/or the literature eg. c.79G>A/p.Glu27Lys (x5), c.260C>T/p.Ser87Leu (x2), c.394C>T/p.Arg132Cys (4x), c.1164C>G/p.Ser388Arg (x2), c.1181A>G/p.Tyr394Cys (x3). MORC2 encodes an ATPase involved in chromatin remodeling, DNA repair and transcriptional regulation. Chromatin remodeling and epigenetic silencing by MORC2 is mediated by the HUSH (Human Silencing Hub) complex. Functional studies (MORC2-knockout HeLa cells harboring a HUSH-sensitive GFP reporter were transduced with wt or mt MORC2 followed by measurement of reporter repression) supported the deleterious effect of most variants known at the time (hyperactivation of HUSH-mediating silencing, in line with previous observations). Overall this gene can be considered for inclusion in the ID panel with green rating. Also other gene panels (e.g. for short stature, microcephaly, hearing loss, pigmentary retinopathy, etc) if it meets the respective criteria for inclusion. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | TTI1 | Zornitza Stark commented on gene: TTI1: Two unrelated consanguineous families previously described with homozygous missense variants, both in large cohort papers with multiple candidate genes in inbred population. No functional evidence provided, segregation uninformative. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | KIF21B |
Konstantinos Varvagiannis gene: KIF21B was added gene: KIF21B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KIF21B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: KIF21B were set to 32415109 Phenotypes for gene: KIF21B were set to Global developmental delay; Intellectual disability; Abnormality of brain morphology; Microcephaly Penetrance for gene: KIF21B were set to unknown Mode of pathogenicity for gene: KIF21B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: KIF21B was set to GREEN Added comment: Asselin et al (2020 - PMID: 32415109) report on 4 individuals with KIF21B pathogenic variants. DD/ID (borderline intellectual functioning to severe ID) was a feature in all. Variable other findings included brain malformations (CCA) and microcephaly. 3 missense variants and a 4-bp insertion were identified, in 3 cases as de novo events while in a single subject the variant was inherited from the father who was also affected. The authors provide evidence for a role of KIF21B in the regulation of processes involved in cortical development and deleterious effect of the missense variants impeding neuronal migration and kinesin autoinhibition. Phenotypes specific to variants (e.g. CCA or microcephaly) were recapitulated in animal models. Missense variants are thought to exert a gain-of-function effect. As commented on, the 4-bp duplication (/frameshift) variant might not be pathogenic. In blood sample from the respective individual, RT-qPCR analysis suggested that haploinsufficiency (NMD) applies. Although Kif21b haploinsufficiency in mice was shown to lead to impaired neuronal positioning, the gene might partially tolerate LoF variants as also suggested by 28 such variants in gnomAD. Homozygous Kif21b ko mice display severe morphological abnormalities, partial loss of commissural fibers, cognitive deficits and altered synaptic transmission (several refs to previous studies provided by the authors). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | PAX1 |
Konstantinos Varvagiannis gene: PAX1 was added gene: PAX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Radboud University Medical Center, Nijmegen Mode of inheritance for gene: PAX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PAX1 were set to 29681087; 23851939; 28657137 Phenotypes for gene: PAX1 were set to Otofaciocervical syndrome 2, 615560 Penetrance for gene: PAX1 were set to Complete Review for gene: PAX1 was set to AMBER Added comment: Biallelic PAX1 pathogenic variants cause Otofaciocervical syndrome 2 (OMIM 615560). Brief review of the literature suggests 3 relevant publications to date (04-07-2020). 2 individuals with DD and ID have been reported (Patil et al, 2018 - PMID: 29681087 and Pohl et al, 2013 - PMID: 23851939). Other subjects reported were only evaluated as newborns(mostly)/infants [Paganini et al, 2017 - PMID: 28657137, Patil et al, 2018 - PMID: 29681087]. While the first report by Pohl et al identified a homozygous missense variant supported by functional studies [NM_006192.5:c.497G>T - p.(Gly166Val)] subsequent ones identified homozygosity for pLoF mutations [Patil et al: NM_006192.4:c.1173_1174insGCCCG / Paganini et al: NM_006192:c.1104C>A - p.(Cys368*)]. As discussed by Pohl et al: PAX1 encodes a transcription factor with critical role in pattern formation during embryogenesis. Study of the mouse Gly157Val (equivalent to human Gly166Val) Pax1 variant suggested reduced binding affinity (reduced transactivation of a regulatory sequence of the Nkx3-2 promoter) and hypofunctional nature of this variant. Mouse models seem to recapitulate features of the disorder (skeletal, immunodeficiency) while the role of Pax1 in hearing process was thought to be supported by early expression (P6) in mouse cochlea. Overall this gene can be considered for inclusion in the ID panel with amber/green rating. Sources: Literature, Radboud University Medical Center, Nijmegen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | TMEM106B |
Konstantinos Varvagiannis gene: TMEM106B was added gene: TMEM106B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM106B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TMEM106B were set to 29186371; 29444210; 32595021 Phenotypes for gene: TMEM106B were set to Leukodystrophy, hypomyelinating, 16 (MIM #617964) Penetrance for gene: TMEM106B were set to Complete Mode of pathogenicity for gene: TMEM106B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: TMEM106B was set to GREEN Added comment: 6 unrelated individuals with Leukodystrophy, hypomyelinating, 16 (MIM #617964) due to a recurrent TMEM106B variant have been reported to date in the literature (Simons et al 2017 - PMID: 29186371, Yan et al 2018 - PMID: 29444210, Ikemoto et al 2020 - PMID: 32595021). While a 3 y.o. female described by Yan et al had DD (eg sitting at 9m, walking at 25m) with normal cognitive functioning, and a 38 y.o. female had borderline intellectual functioning (IQ 76), 4 affected individuals had ID. Among them, a 19 y.o. male with severe ID was also found to harbor a second de novo possibly damaging USP7 variant. Seizures have been reported in 2 unrelated subjects. [Clinical features are also summarized in table 1 - Ikemoto et al]. All harbored NM_001134232.2(TMEM106B):c.754G>A (p.Asp252Asn) which in almost all cases occurred as a de novo event. In a single case this variant was inherited from a mosaic parent with mild DD in infancy but normal cognition (reported by Simons et al). As discussed by Ito et al (2018 - PMID: 30643851) the encoded protein is a structural component of the lysosomal membrane, playing a role on lysosome acidification. Acidity of the lysosome mediates multiple aspects of lysosomal function. Ito et al, using patient-derived fibroblasts assessed mRNA and protein levels. These were unaltered compared with controls. While TMEM106B had been previously shown to affect lysosome number, morphology and acidification, Ito et al demonstrated increased number of lysosomes in patient cells as well as impaired acidification compared to controls. As commented lysosomes are required for generation of myelin. Recurrence of this missense variant, the presence of pLoF TMEM106B variants in gnomAD as well as the phenotypically normal Tmem106b null mice suggest that this variant may have a gain-of-function or dominant negative effect. Genes for other forms of hypomyelinating lipodystrophy (incl. PLP1) have green rating in the ID panel. Overall TMEM106B can be considered for the ID panel with green rating and the epilepsy panel with amber rating. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | TBC1D2B |
Konstantinos Varvagiannis gene: TBC1D2B was added gene: TBC1D2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TBC1D2B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBC1D2B were set to 32623794 Phenotypes for gene: TBC1D2B were set to Global developmental delay; Intellectual disability; Seizures; Gingival overgrowth; Behavioral abnormality; Abnormality of the mandible; Abnormality of brain morphology; Abnormality of the eye; Hearing abnormality Penetrance for gene: TBC1D2B were set to Complete Review for gene: TBC1D2B was set to AMBER Added comment: Harms et al (2020 - PMID: 32623794) report on 3 unrelated individuals with biallelic pLoF TBC1D2B variants. Features included cognitive impairment (mild ID in one case, regression at the age of 12y in another, hypotonia and delayed milestones in a third aged 8m), seizures (3/3 - variable age of onset) and/or gingival overgrowth (2/3 - prior to initiation of AEDs). Other findings included behavioral abnormalities, mandibular anomalies, abnormal brain imaging and ophthalmologic or (rarely) audiometric evaluations. All were born to non-consanguineous couples and additional investigations were performed in some. Variants were identified by WES or trio WGS, with Sanger confirmation/compatible segregation analyses. In line with the pLoF variants, mRNA studies in fibroblasts from 2 unrelated affected individuals demonstrated significantly reduced (~80-90%) TBC1C2D mRNA levels compared to controls, restored following cycloheximide treatment. Protein was absent in patient fibroblasts. TBC-domain containing GTPase activating proteins are known as key regulators of RAB GTPase activity. TBC1D2B was shown to colocalize with RAB5-positive endocytic vesicles. CRISPR/Cas9-mediated ko of TBC1D2B in HeLa cells suggested a role in EGF receptor endocytosis and decreased cell viability of TBC1D2B-deficient HeLa cells upon serum deprivation. Genes encoding other TBC domain-containg GTPase-activating proteins, e.g. TBC1D7 and TBC1D20, TBC1D24 are associated with recessive neurodevelopmental disorders (with ID and/or seizures) and the pathophysiological defect in TBC1D2B-related disorder (deficit in vesicle trafficking and/or cell survival) is proposed to be similar to that of TBC1D24. Overall this gene can be considered for inclusion with amber/green rating in the ID panel and green in epilepsy panel. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2750 | EXOC2 |
Konstantinos Varvagiannis gene: EXOC2 was added gene: EXOC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EXOC2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOC2 were set to 32639540 Phenotypes for gene: EXOC2 were set to Global developmental delay; Intellectual disability; Abnormality of the face; Abnormality of brain morphology Penetrance for gene: EXOC2 were set to Complete Review for gene: EXOC2 was set to AMBER Added comment: Van Bergen et al (2020 - PMID: 32639540) report on 3 individuals from 2 families, harboring biallelic EXOC2 mutations. Clinical presentation included DD, ID (severe in 2 subjects from fam1, borderline intellectual functioning in fam2), dysmorphic features and brain abnormalities. Cerebellar anomalies were common to all with a molar tooth sign observed in one (1/3). Other findings limited to subjects from one family included acquired microcephaly, congenital contractures, spastic quadriplegia (each observed 2/3). Previous investigations were in all cases non-diagnostic. WES identified biallelic EXOC2 mutations in all affected individuals. EXOC2 encodes an exocyst subunit. The latter is an octameric complex, component of the membrane transport machinery, required for tethering and fusion of vesicles at the plasma membrane. As discussed ,vesicle transport is important for the development of brain and the function of neurons and glia. Exocyst function is also important for delivery of Arl13b to the primary cilium (biallelic ARL13B mutations cause Joubert syndrome 8) and ciliogenesis. Affected subjects from a broader consanguineous family (fam1) were homozygous for a truncating variant. Fibroblast studies revealed mRNA levels compatible with NMD (further restored in presence of CHX) as well as reduced protein levels. The female belonging to the second non-consanguineous family was found to harbor 2 missense variants in trans configuration. An exocytosis defect was demonstrated in fibroblasts from individuals belonging to both families. Ciliogenesis appeared to be normal, however Arl13b localization/recruitment to the cilia was reduced compared with control cells with the defect rescued upon exogenous expression of wt EXOC2. Mutations in other genes encoding components of the exocyst complex have been previously reported in individuals with relevant phenotypes (e.g. EXOC8 in a boy with features of Joubert s. or EXOC4 in nephrotic syndrome). The authors discuss on the essential role of EXOC2 based on model organism studies (e.g. impaired neuronal membrane traffic, failure of neuronal polarization and neuromuscular junction expansion seen in Drosophila Sec5 (EXOC2) null mutants). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2664 | OTUD7A |
chirag patel gene: OTUD7A was added gene: OTUD7A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: OTUD7A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OTUD7A were set to PMID: 31997314 Phenotypes for gene: OTUD7A were set to Epileptic encephalopathy, no OMIM# yet Review for gene: OTUD7A was set to RED Added comment: One patient with severe global developmental delay, language impairment and epileptic encephalopathy. Homozygous OTUD7A missense variant (c.697C>T, p.Leu233Phe), predicted to alter an ultraconserved amino acid, lying within the OTU catalytic domain. Its subsequent segregation analysis revealed that the parents, presenting with learning disability, and brother were heterozygous carriers. Biochemical assays demonstrated that proteasome complex formation and function were significantly reduced in patient‐derived fibroblasts and in OTUD7A knockout HAP1 cell line. We provide evidence that biallelic pathogenic OTUD7A variation is linked to early‐onset epileptic encephalopathy and proteasome dysfunction. Gene lies in the chromosome 15q13.3 region. Heterozygous microdeletions of chromosome 15q13.3 show incomplete penetrance and are associated with a highly variable phenotype that may include intellectual disability, epilepsy, facial dysmorphism and digit anomalies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2663 | KMT2D |
chirag patel changed review comment from: KMT2D missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism.; to: KMT2D missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism. - 7 unrelated families with choanal atresia, athelia or hypoplastic nipples, branchial sinus abnormalities, neck pits, lacrimal duct anomalies, hearing loss, external ear malformations, and thyroid abnormalities. None of the individuals had intellectual disability. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2659 | TTC5 |
Konstantinos Varvagiannis gene: TTC5 was added gene: TTC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TTC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC5 were set to 29302074; 32439809 Phenotypes for gene: TTC5 were set to Central hypotonia; Global developmental delay; Intellectual disability; Abnormality of nervous system morphology; Microcephaly; Abnormality of the face; Behavioral abnormality; Abnormality of the genitourinary system Penetrance for gene: TTC5 were set to Complete Review for gene: TTC5 was set to GREEN Added comment: Hu et al (2019 - PMID: 29302074) reported briefly on 3 individuals from 2 consanguineous families (from Turkey and Iran) with biallelic TTC5 variants. Features included DD (3/3), ID (severe in 2/2 with relevant age), microcephaly (3/3), brain abnormalities, etc. A nonsense and a variant affecting splice site were identified by WES/WGS. --- In a recent report, Rasheed et al (2020 - PMID: 32439809) report on the phenotype of 8 individuals - belonging to 5 consanguineous families - all 8 harboring homozygous TTC5 mutations. Frequent features included hypotonia (6/8), motor and speech delay, moderate to severe ID (10/10 of relevant age - inclusion of less severely affected subjects was not considered by study design), brain MRI abnormalities (8/8). Other findings included microcephaly in some (6/11), behavioral abnormalities in few (autistic behavior in 2/8, aggression in 2/8), genitourinary anomalies (2/8), seizures (1/11). Facial phenotype incl. thin V-shaped upper lip, low-set ears (in most) and/or additional features. TTC5 encodes a 440 aa protein, functioning as a scaffold to stabilise p300-JMY interactions. Apart from this role in nucleus, it has functions in the cytoplasm (inhibiting actin nucleataion, autophagosome formation, etc). The gene has ubiquitous expression, highest in brain. All variants were identified following WES - as the best candidates - in affected individuals with compatible Sanger studies in all affected family members and carrier parents. 2 missense and 2 nonsense variants were identified with the 2 missense SNVs localizing within TPR domains. qRT-PCR studies for a nonsense variant localizing 19 nt before the last exon, revealed fourfold decreased expression in affected individuals compared to carriers. Families from Egypt shared a homozygous ~6.3 Mb haplotype block spanning TTC5, suggesting that p.(Arg263Ter) is likely a founder mutation. The authors underscore some phenotypic (though not facial) similarities with Rubinstein-Taybi syndrome 2 due to EP300 mutations (in line with the role of TTC5). Biallelic variants in genes encoding other members of the TTC family (containing a TPR motif), e.g. TTC8 or TTC15 cause disorders with neurologic manifestations (and DD/ID). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2629 | CUL3 |
Konstantinos Varvagiannis gene: CUL3 was added gene: CUL3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CUL3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CUL3 were set to 32341456 Phenotypes for gene: CUL3 were set to Global developmental delay; Intellectual disability; Seizures; Abnormality of cardiovascular system morphology; Abnormality of the palate; Pseudohypoaldosteronism, type IIE - MIM #614496 Penetrance for gene: CUL3 were set to unknown Review for gene: CUL3 was set to GREEN Added comment: Please consider inclusion with amber / green rating. -- Nakashima et al (2020 - PMID:32341456) provide clinical details on 3 unrelated individuals with de novo CUL3 variants. Features included DD, variable degrees of ID (P1: severe, P3: mild, P2: NA although he displayed motor and severe speech and language delay and had severe learning difficulties). Two out of three had intractable seizures (onset 2 - 6 months). One presented with congenital heart defects (ASD, PV stenosis) and another submucosal palatoschisis/bifid uvula. There were no facial dysmorphisms reported. CUL3 encodes Cullin-3, a core piece of the E3 ubiquitin ligase complex, thus playing a role in the ubiquitin-proteasome system. [ https://ghr.nlm.nih.gov/gene/CUL3 ]. Germline variants in some other Cullin family genes (eg. CUL4B, CUL7) cause disorders with ID as a feature. The 3 individuals reported by Nakashima had variable previous investigations (karyotype, CMA, metabolic testing) which were non-diagnostic. Singleton or trio exome sequencing identified 2 frameshift and 1 missense variant (NM_003590.4:c.854T>C / p.Val285Ala), further confirmed with Sanger sequencing. De novo occurrence was confirmed by analysis of microsatellite markers in an individual with singleton ES. While the frameshift variants were presumed to lead to NMD (not studied), studies in HEK293T cells suggested that the Val285Ala reduced binding ability with KEAP1, possibly leading to instability of the Cullin-RING ligase (CRL) complex and impairment of the ubiquitin-proteasome system. In OMIM, the phenotype associated with heterozygous CUL3 mutations is Pseudohypoaldosteronism type IIE (PHA2E - # 614496). As OMIM and Nakashima et al comment, PHA2E-associated variants are clustered around exon 9, most lead to skipping of exon 9 and produce an in-frame deletion of 57 aa in the cullin homology domain. Few (probably 3) missense variants in exon 9 have also been reported. Individuals with PHA2E do not display DD/ID and conversely individuals with NDD did not display features of PHA2E. Nakashima et al summarize the phenotypes associated with 12 further de novo CUL3 variants in the literature with most pLOF ones detected in individuals with autism and/or developmental disorders and in few cases with congenital heart disease. Few additional missense variants and a stoploss one have been reported in individuals with NDD and one in SCZ. Heterozygous Cul3 (/tissue-specific) deletion in mice resulted in autism-like behavior. Cul3 deficient mice also demonstrated NMDAR hypofunction and decreased spine density. [PMIDs cited : 31455858, 31780330] Overall haploinsufficiency is favored as the underlying mechanism of variants associated with NDD. Nakashima et al comment that the pathogenesis of missense variants remains unknown and/or that a dominant-negative effect on CRL may be possible. Studies on larger cohorts reporting on individuals with relevant phenotypes due to de novo CUL3 variants (eg. DDD study - PMID: 28135719, Lelieveld et al - PMID: 27479843), are summarized in denovo-db (after filtering for coding variants): http://denovo-db.gs.washington.edu/denovo-db/QueryVariantServlet?searchBy=Gene&target=cul3 Overall, this gene can be considered for inclusion in the ID (amber/green), epilepsy (amber) and/or ASD panels. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2625 | YIF1B |
Konstantinos Varvagiannis gene: YIF1B was added gene: YIF1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: YIF1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YIF1B were set to 32006098 Phenotypes for gene: YIF1B were set to Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement Penetrance for gene: YIF1B were set to Complete Review for gene: YIF1B was set to GREEN Added comment: AlMuhaizea et al (2020 - PMID: 32006098) report on the phenotype of 6 individuals (from 5 families) with biallelic YIF1B truncating variants. Affected subjects presented hypotonia, failure to thrive, microcephaly (5/6), severe global DD and ID (as evident from best motor/language milestones achieved - Table S1) as well as features suggestive of a motor disorder (dystonia/spasticity/dyskinesia). Seizures were reported in 2 unrelated individuals (2/6). MRI abnormalities were observed in some with thin CC being a feature in 3. Variable initial investigations were performed including SNP CMA, MECP2, microcephaly / neurotransmitter disorders gene panel testing did not reveal P/LP variants. YIF1B variants were identified in 3 families within ROH. Following exome sequencing, affected individuals were found to be homozygous for truncating variants (4/5 families being consanguineous). The following 3 variants were identified (NM_001039672.2) : c.186dupT or p.Ala64fs / c.360_361insACAT or p.Gly121fs / c.598G>T or p.Glu200*. YIF1B encodes an intracellular transmembrane protein. It has been previously demonstrated that - similarly to other proteins of the Yip family being implicated in intracellular traffic between the Golgi - Yif1B is involved in the anterograde traffic pathway. Yif1B KO mice demonstrate a disorganized Golgi architecture in pyramidal hippocampal neurons (Alterio et al 2015 - PMID: 26077767). The rat ortholog interacts with serotonin receptor 1 (5-HT1AR) with colocalization of Yif1BB and 5-HT1AR in intermediate compartment vesicles and involvement of the former in intracellular trafficing/modulation of 5-HT1AR transport to dendrites (PMID cited: 18685031). Available mRNA and protein expression data (Protein Atlas) suggest that the gene is widely expressed in all tissues incl. neuronal cells. Immunochemistry data from the Human Brain Atlas also suggest that YIF1B is found in vesicles and localized to the Golgi apparatus. Immunohistochemistry in normal human brain tissue (cerebral cortex) demonstrated labeling of neuronal cells (Human Protein Atlas). Functional/network analysis of genes co-regulated with YIF1B based on available RNAseq data, suggest enrichement in in genes important for nervous system development and function. Please consider inclusion in other panels that may be relevant (e.g. microcephaly, etc). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2619 | CDC42BPB |
Konstantinos Varvagiannis gene: CDC42BPB was added gene: CDC42BPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDC42BPB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CDC42BPB were set to 32031333 Phenotypes for gene: CDC42BPB were set to Central hypotonia; Global developmental delay; Intellectual disability; Seizures; Autistic behavior; Behavioral abnormality Penetrance for gene: CDC42BPB were set to unknown Review for gene: CDC42BPB was set to GREEN Added comment: Chilton et al (2020 - PMID: 32031333) report on 14 individuals with missense and loss-of-function CDC42BPB variants. Features included hypotonia (8/11), DD (12/13 - the 14th was a fetus), ID (7/13), ASD (8/12), clinical seizures (in 3 - a 4th had abnormal EEG without seizures), behavioral abnormalities. Variable non-specific dysmorphic features were reported in some (sparse hair being the most frequent - 4/8). Additional features were observed in few (=<4) incl. cryptorchidism, ophthalmological issues, constipation, kidney abnormalities, micropenis, etc. All individuals had non-diagnostic prior genetic testing (incl. CMA, FMR1, MECP2, Angelman/Prader-Willi methylation studies, autism gene panel - suggesting relevance to the current panel) or metabolic testing. Variants were identified following clinical exome sequencing with Sanger confirmation. Most occurred as de novo events (11/14) while inheritance was not available for few (3/14). Missense variants did not display (particular) clustering. Almost all variants were absent from gnomAD and were predicted to be deleterious in silico (among others almost all had CADD scores >25). As the authors comment, CDC42BPB encodes myotonic dystrophy-related Cdc42-binding kinase β (MRCKβ) a serine/threonine protein kinase playing a role in regulation of cytoskeletal reorganization and cell migration in nonmuscle cells (through phosporylation of MLC2). Previous studies have demonstrated that it is ubiquitously expressed with prenatal brain expression. The gene appears to be intolerant to pLoF (pLI of 1) as well as to missense variants (Z-score of 3.66). CDC42BPB is a downstream effector of CDC42. Mutations of the latter cause Takenouchi-Kosaki syndrome with DD/ID and some further overlapping features (with CDC42BPB-associated phenotypes). Homozygous Cdc42bpb KO in mouse appears to be nonviable (MGI:2136459). Loss of gek in the eyes of Drosophila results in disrupted growth cone targeting to the lamina (gek is the fly CDC42BPB ortholog). Please consider inclusion with amber / green rating in the ID panel (>=4 relevant individuals / variants) and other panels (e.g. for epilepsy, ASD). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2498 | PQBP1 | Zornitza Stark Phenotypes for gene: PQBP1 were changed from to Renpenning syndrome, MIM#309500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2495 | PQBP1 | Zornitza Stark reviewed gene: PQBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31840929, 14634649, 20410308; Phenotypes: Renpenning syndrome, MIM#309500; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2469 | ISCA1 |
Zornitza Stark gene: ISCA1 was added gene: ISCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ISCA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ISCA1 were set to 28356563; 32092383; 31016283; 30113620; 30105122 Phenotypes for gene: ISCA1 were set to Multiple mitochondrial dysfunctions syndrome 5, MIM# 617613 Review for gene: ISCA1 was set to GREEN gene: ISCA1 was marked as current diagnostic Added comment: Multiple unrelated families reported. Severe disorder characterised by progressive neurologic deterioration beginning in early infancy. Affected individuals have essentially no psychomotor development and have early-onset seizures with neurologic decline and spasticity. Brain imaging shows severe leukodystrophy with evidence of dys- or delayed myelination. Rat model results in early lethality. Founder variant c.259G > A, p.(Glu87Lys) reported in Indian families. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2117 | ZIC1 |
chirag patel gene: ZIC1 was added gene: ZIC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: ZIC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZIC1 were set to PMID: 26340333, 30391508 Phenotypes for gene: ZIC1 were set to Structural brain anomalies with impaired intellectual development and craniosynostosis; OMIM #618736 Review for gene: ZIC1 was set to GREEN Added comment: 5 families with heterozygous mutations located in the final (third) exon of ZIC1 who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5-12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture. 2 sibs with BAIDCS, Vandervore et al. (2018) identified heterozygosity for a frameshift mutation in the ZIC1 gene. Neither parent had evidence of the mutation by whole-exome sequencing, suggesting that gonadal mosaicism for the mutation was present in one of the parents. Expression of the mutated allele was detected in patient fibroblasts by RT-PCR, evidence that the mutant mRNA did not undergo nonsense-mediated decay and probably generates an abnormal protein. Also heterozygous deletions of ZIC1 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum. Loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1927 | ERCC4 | Zornitza Stark changed review comment from: Intellect normal in xeroderma pigmentosum; mild learning difficulties described in XFE progressed syndrome.; to: Intellect normal in xeroderma pigmentosum; mild learning difficulties described in XFE progeroid syndrome. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1882 | CUX1 |
Zornitza Stark gene: CUX1 was added gene: CUX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: CUX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CUX1 were set to 25059644; 20510857; 30014507 Phenotypes for gene: CUX1 were set to Global developmental delay with or without impaired intellectual development, MIM#618330 Review for gene: CUX1 was set to GREEN gene: CUX1 was marked as current diagnostic Added comment: Nine individuals from 7 families reported. Three individuals had normal intelligence at school age despite significant early developmental delay. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1673 | MACF1 |
Zornitza Stark gene: MACF1 was added gene: MACF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: MACF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MACF1 were set to 30471716 Phenotypes for gene: MACF1 were set to Lissencephaly 9 with complex brainstem malformation, MIM# 618325 Mode of pathogenicity for gene: MACF1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: MACF1 was set to GREEN Added comment: Nine individuals (including a pair of twins) reported with de novo, likely GoF variants in this gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1637 | CDH2 |
Zornitza Stark gene: CDH2 was added gene: CDH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDH2 were set to 31585109 Phenotypes for gene: CDH2 were set to Intellectual disability; corpus callosum abnormalities; congenital abnormalities Review for gene: CDH2 was set to GREEN Added comment: Nine unrelated individuals reported with de novo variants in this gene. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1499 | EIF3F |
Zornitza Stark gene: EIF3F was added gene: EIF3F was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list Mode of inheritance for gene: EIF3F was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3F were set to 30409806 Phenotypes for gene: EIF3F were set to Mental retardation, autosomal recessive 67, MIM# 618295 Review for gene: EIF3F was set to GREEN Added comment: Nine individuals from 7 families reported, all homozygous for the same missense variant, p.(Phe232Val). This variant is present at 0.12% frequency in non-Finnish Europeans in gnomad (no homozygotes). Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1303 | BRSK2 |
Zornitza Stark gene: BRSK2 was added gene: BRSK2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: BRSK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BRSK2 were set to 30879638 Phenotypes for gene: BRSK2 were set to Intellectual disability; autism Review for gene: BRSK2 was set to GREEN Added comment: Nine unrelated individuals with heterozygous variants in this gene; six confirmed de novo (parents available). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.1294 | BCL11B |
Zornitza Stark gene: BCL11B was added gene: BCL11B was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature Mode of inheritance for gene: BCL11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BCL11B were set to 29985992 Phenotypes for gene: BCL11B were set to Intellectual developmental disorder with dysmorphic facies, speech delay, and T-cell abnormalities, MIM# 618092 Review for gene: BCL11B was set to GREEN Added comment: Nine unrelated individuals, all but one with de novo variants in this gene and syndromic ID/immunodeficiency. Most variants located in the last exon (exon 4) and are predicted to escape nonsense-mediated mRNA decay. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.913 | PCBD1 | Zornitza Stark Phenotypes for gene: PCBD1 were changed from to Hyperphenylalaninemia, BH4-deficient, D, MIM#264070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.910 | PCBD1 | Zornitza Stark reviewed gene: PCBD1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperphenylalaninemia, BH4-deficient, D, MIM#264070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.881 | NIN | Zornitza Stark Marked gene: NIN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.881 | NIN | Zornitza Stark Gene: nin has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.881 | NIN | Zornitza Stark Phenotypes for gene: NIN were changed from to Seckel syndrome 7, MIM#614851 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.880 | NIN | Zornitza Stark Publications for gene: NIN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.879 | NIN | Zornitza Stark Mode of inheritance for gene: NIN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.878 | NIN | Zornitza Stark Classified gene: NIN as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.878 | NIN | Zornitza Stark Gene: nin has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.870 | NIN | Zornitza Stark reviewed gene: NIN: Rating: RED; Mode of pathogenicity: None; Publications: 22933543; Phenotypes: Seckel syndrome 7, MIM#614851; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.713 | AHCY | Zornitza Stark Phenotypes for gene: AHCY were changed from to Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase, MIM#613752 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.710 | ASL | Zornitza Stark Phenotypes for gene: ASL were changed from to Argininosuccinic aciduria, MIM#207900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.579 | KYNU | Zornitza Stark edited their review of gene: KYNU: Changed phenotypes: Hydroxykynureninuria, MIM#236800, Vertebral, cardiac, renal, and limb defects syndrome 2, MIM#617661 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.579 | KYNU | Zornitza Stark Phenotypes for gene: KYNU were changed from to Hydroxykynureninuria, MIM#236800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.576 | KYNU | Zornitza Stark reviewed gene: KYNU: Rating: RED; Mode of pathogenicity: None; Publications: 28792876, 17334708; Phenotypes: Hydroxykynureninuria, MIM#236800; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.302 | ZNF41 | chirag patel changed review comment from: Shoichet et al. (2003) described a female patient with severe nonsyndromic mental retardation and a de novo balanced translocation t(X;7)(p11.3;q11.21) in whom they cloned the DNA fragment that contained the X chromosomal and the autosomal breakpoint. In silico sequence analysis demonstrated that the ZNF41 gene was disrupted. Expression studies indicated that ZNF41 transcripts were absent in the patient cell line, suggesting that the mental disorder in this patient resulted from loss of functional ZNF41. Moreover, screening of a panel of patients with MRX led to the identification of 2 other ZNF41 mutations (314995.0001-314995.0002) that were not found in healthy control individuals. Based on their finding of the mutations in ZNF41 identified by Shoichet et al. (2003) in a total of 7 males in the NHLBI Exome Variant Server, and the additional finding of truncating ZNF41 variants in 1 male and 1 female in that database, Piton et al. (2013) classified the involvement of ZNF41 in mental retardation as highly questionable.; to: Shoichet et al. (2003) described a female patient with severe nonsyndromic mental retardation and a de novo balanced translocation t(X;7)(p11.3;q11.21) in whom they cloned the DNA fragment that contained the X chromosomal and the autosomal breakpoint. In silico sequence analysis demonstrated that the ZNF41 gene was disrupted. Expression studies indicated that ZNF41 transcripts were absent in the patient cell line, suggesting that the mental disorder in this patient resulted from loss of functional ZNF41. Screening of patients with mental retardation led to the identification of 2 other ZNF41 mutations that were not found in healthy control individuals. Based on their finding of the mutations in ZNF41 identified by Shoichet et al. (2003) in a total of 7 males in the NHLBI Exome Variant Server, and the additional finding of truncating ZNF41 variants in 1 male and 1 female in that database, Piton et al. (2013) classified the involvement of ZNF41 in mental retardation as highly questionable. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.102 | DNAJC12 |
Zornitza Stark gene: DNAJC12 was added gene: DNAJC12 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list Mode of inheritance for gene: DNAJC12 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAJC12 were set to Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384 Review for gene: DNAJC12 was set to GREEN Added comment: Highly variable neurological phenotype, including ID, dystonia, parkinsonism. Treatable. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2 | ASL | Zornitza Stark reviewed gene: ASL: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Argininosuccinic aciduria, MIM#207900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.0 | AHCY | Zornitza Stark reviewed gene: AHCY: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase, MIM#613752; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.0 | NIN |
Zornitza Stark gene: NIN was added gene: NIN was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland Mode of inheritance for gene: NIN was set to Unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||