| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Intellectual disability syndromic and non-syndromic v2.9 | DOP1A |
Zornitza Stark gene: DOP1A was added gene: DOP1A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: DOP1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: DOP1A were set to 42164854; 38818041 Phenotypes for gene: DOP1A were set to Neurodevelopmental disorder, MONDO:0700092, DOP1A-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.7 | MAGED1 |
Sarah Milton gene: MAGED1 was added gene: MAGED1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAGED1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: MAGED1 were set to 42162770 Phenotypes for gene: MAGED1 were set to Neurodevelopmental disorder, MONDO:0700092, MAGED1-related Review for gene: MAGED1 was set to AMBER Added comment: MAGED1 encodes Melanoma-Associated Antigen D1. It is expressed in the developing brain and is involved in controlling cell cycle progression and neuronal apoptosis. PMID 42162770 reports two unrelated male probands with de novo variants in MAGED1 presenting with epileptic spasms and severe intellectual disability. One frameshift and one missense variant we observed. It should be noted the missense variant was present in gnomAD v4 with 3 heterozygotes. Functional studies were performed demonstrating altered protein interactions and changes to cell cycle progression. Proposed mechanism of disease (GOF vs LOF) remains unclear. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.834 | MAGED1 |
Sarah Milton gene: MAGED1 was added gene: MAGED1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: MAGED1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: MAGED1 were set to 42162770 Phenotypes for gene: MAGED1 were set to Neurodevelopmental disorder, MONDO:0700092, MAGED1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.5 | DSCAM | chirag patel Publications for gene: DSCAM were set to PMID: 27824329; 28191889; 21904980 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.1 | SNORD116-1 |
Boris Keren gene: SNORD116-1 was added gene: SNORD116-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNORD116-1 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Publications for gene: SNORD116-1 were set to PMID: 24916642 Phenotypes for gene: SNORD116-1 were set to Intellectual disability, obesity, hypotonia Penetrance for gene: SNORD116-1 were set to Complete Mode of pathogenicity for gene: SNORD116-1 was set to Other Review for gene: SNORD116-1 was set to GREEN gene: SNORD116-1 was marked as current diagnostic Added comment: The paternal deletion of the SNORD166 cluster is the critical region of Prader Willi syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.832 | HDAC2 |
Lucy Spencer gene: HDAC2 was added gene: HDAC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: HDAC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: HDAC2 were set to 30806031; 27620904; 38753158 Phenotypes for gene: HDAC2 were set to Neurodevelopmental disorder (MONDO:0700092), HDAC2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37498-Loss | Region ISCA-37498-Loss: gene migrated from ENSG00000162105 to ENSG00000162105 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37448-Loss | Region ISCA-37448-Loss: gene migrated from ENSG00000170113 to ENSG00000170113 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-46290-Gain | Region ISCA-46290-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37500-Loss | Region ISCA-37500-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37494-Gain | Region ISCA-37494-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37493-Loss | Region ISCA-37493-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37486-Loss | Region ISCA-37486-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37478-Loss | Region ISCA-37478-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37478-Gain | Region ISCA-37478-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37468-Loss | Region ISCA-37468-Loss: gene migrated from ENSG00000069535 to ENSG00000069535 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37446-Loss | Region ISCA-37446-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-46299-Gain | Region ISCA-46299-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37446-Gain | Region ISCA-37446-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37443-Loss | Region ISCA-37443-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37441-Loss | Region ISCA-37441-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-46300-Loss | Region ISCA-46300-Loss: gene migrated from ENSG00000169375 to ENSG00000169375 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-46304-Gain | Region ISCA-46304-Gain: gene migrated from ENSG00000169057 to ENSG00000169057 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-46743-Gain | Region ISCA-46743-Gain: gene migrated from ENSG00000101972 to ENSG00000101972 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37432-Gain | Region ISCA-37432-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37439-Gain | Region ISCA-37439-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37434-Loss | Region ISCA-37434-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37431-Loss | Region ISCA-37431-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37433-Loss | Region ISCA-37433-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37424-Loss | Region ISCA-37424-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37429-Loss | Region ISCA-37429-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37431-Gain | Region ISCA-37431-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37411-Loss | Region ISCA-37411-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37415-Gain | Region ISCA-37415-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37421-Gain | Region ISCA-37421-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37423-Loss | Region ISCA-37423-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37425-Loss | Region ISCA-37425-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-46296-Loss | Region ISCA-46296-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37430-Loss | Region ISCA-37430-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37440-Loss | Region ISCA-37440-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37430-Gain | Region ISCA-37430-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37423-Gain | Region ISCA-37423-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37406-Loss | Region ISCA-37406-Loss: gene migrated from ENSG00000005339 to ENSG00000005339 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37433-Gain | Region ISCA-37433-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37418-Loss | Region ISCA-37418-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37405-Loss | Region ISCA-37405-Loss: gene migrated from ENSG00000144061 to ENSG00000144061 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37404-Loss | Region ISCA-37404-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37404-Gain | Region ISCA-37404-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37432-Loss | Region ISCA-37432-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37393-Gain | Region ISCA-37393-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37394-Loss | Region ISCA-37394-Loss: gene migrated from ENSG00000068024 to ENSG00000068024 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37396-Loss | Region ISCA-37396-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37397-Gain | Region ISCA-37397-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37397-Loss | Region ISCA-37397-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37400-Gain | Region ISCA-37400-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37400-Loss | Region ISCA-37400-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37418-Gain | Region ISCA-37418-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-46295-Loss | Region ISCA-46295-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37390-Loss | Region ISCA-37390-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37392-Gain | Region ISCA-37392-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37392-Loss | Region ISCA-37392-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37425-Gain | Region ISCA-37425-Gain migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA-37421-Loss | Region ISCA-37421-Loss migrated (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DIP2B_FRA12A_CGG | STR DIP2B_FRA12A_CGG: gene migrated from ENSG00000066084 to ENSG00000066084 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DMPK_DM1_CTG | STR DMPK_DM1_CTG: gene migrated from ENSG00000104936 to ENSG00000104936 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLS_GDPAG_GCA | STR GLS_GDPAG_GCA: gene migrated from ENSG00000115419 to ENSG00000115419 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FMR1_FXS_CGG | STR FMR1_FXS_CGG: gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARX_EIEE1_GCN2 | STR ARX_EIEE1_GCN2: gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | XYLT1_DBQD2_GGC | STR XYLT1_DBQD2_GGC: gene migrated from ENSG00000103489 to ENSG00000103489 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARX_EIEE1_GCN1 | STR ARX_EIEE1_GCN1: gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF4A3_RCPS_complex | STR EIF4A3_RCPS_complex: gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AFF2_FRAXE_GCC | STR AFF2_FRAXE_GCC: gene migrated from ENSG00000155966 to ENSG00000155966 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZIC2_HPE5_GCN | STR ZIC2_HPE5_GCN: gene migrated from ENSG00000043355 to ENSG00000043355 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DMPK | Gene migrated from ENSG00000104936 to ENSG00000104936 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PROSER1 | Gene migrated from ENSG00000120685 to ENSG00000120685 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RIN2 | Gene migrated from ENSG00000132669 to ENSG00000132669 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RIMS1 | Gene migrated from ENSG00000079841 to ENSG00000079841 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TP63 | Gene migrated from ENSG00000073282 to ENSG00000073282 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAX | Gene migrated from ENSG00000134438 to ENSG00000134438 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRKRA | Gene migrated from ENSG00000180228 to ENSG00000180228 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRKN | Gene migrated from ENSG00000185345 to ENSG00000185345 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRKDC | Gene migrated from ENSG00000253729 to ENSG00000253729 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB27A | Gene migrated from ENSG00000069974 to ENSG00000069974 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RASA1 | Gene migrated from ENSG00000145715 to ENSG00000145715 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIM74 | Gene migrated from ENSG00000155428 to ENSG00000155428 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAPPC6A | Gene migrated from ENSG00000007255 to ENSG00000007255 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TFAP2A | Gene migrated from ENSG00000137203 to ENSG00000137203 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRICKLE1 | Gene migrated from ENSG00000139174 to ENSG00000139174 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRF1 | Gene migrated from ENSG00000180644 to ENSG00000180644 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PREPL | Gene migrated from ENSG00000138078 to ENSG00000138078 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRDM8 | Gene migrated from ENSG00000152784 to ENSG00000152784 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SYT14 | Gene migrated from ENSG00000143469 to ENSG00000143469 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAPSN | Gene migrated from ENSG00000165917 to ENSG00000165917 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRHR | Gene migrated from ENSG00000174417 to ENSG00000174417 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TPR | Gene migrated from ENSG00000047410 to ENSG00000047410 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | THAP1 | Gene migrated from ENSG00000131931 to ENSG00000131931 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP2R5E | Gene migrated from ENSG00000154001 to ENSG00000154001 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RFX6 | Gene migrated from ENSG00000185002 to ENSG00000185002 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNF135 | Gene migrated from ENSG00000181481 to ENSG00000181481 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RANBP2 | Gene migrated from ENSG00000153201 to ENSG00000153201 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RALGAPB | Gene migrated from ENSG00000170471 to ENSG00000170471 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TFG | Gene migrated from ENSG00000114354 to ENSG00000114354 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM260 | Gene migrated from ENSG00000070269 to ENSG00000070269 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TGFBR2 | Gene migrated from ENSG00000163513 to ENSG00000163513 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP1R2 | Gene migrated from ENSG00000184203 to ENSG00000184203 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TGFBR1 | Gene migrated from ENSG00000106799 to ENSG00000106799 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STX11 | Gene migrated from ENSG00000135604 to ENSG00000135604 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STT3B | Gene migrated from ENSG00000163527 to ENSG00000163527 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SYNE2 | Gene migrated from ENSG00000054654 to ENSG00000054654 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TG | Gene migrated from ENSG00000042832 to ENSG00000042832 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FTL | Gene migrated from ENSG00000087086 to ENSG00000087086 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TIMM8A | Gene migrated from ENSG00000126953 to ENSG00000126953 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RET | Gene migrated from ENSG00000165731 to ENSG00000165731 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FSCN1 | Gene migrated from ENSG00000075618 to ENSG00000075618 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRMT1L | Gene migrated from ENSG00000121486 to ENSG00000121486 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMPRSS7 | Gene migrated from ENSG00000176040 to ENSG00000176040 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | QSER1 | Gene migrated from ENSG00000060749 to ENSG00000060749 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMLHE | Gene migrated from ENSG00000185973 to ENSG00000185973 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RECQL4 | Gene migrated from ENSG00000160957 to ENSG00000160957 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RDH14 | Gene migrated from ENSG00000240857 to ENSG00000240857 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TREM2 | Gene migrated from ENSG00000095970 to ENSG00000095970 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIM37 | Gene migrated from ENSG00000108395 to ENSG00000108395 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBPJ | Gene migrated from ENSG00000168214 to ENSG00000168214 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TECR | Gene migrated from ENSG00000099797 to ENSG00000099797 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSMC1 | Gene migrated from ENSG00000100764 to ENSG00000100764 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PYGL | Gene migrated from ENSG00000100504 to ENSG00000100504 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TPK1 | Gene migrated from ENSG00000196511 to ENSG00000196511 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBM8A | Gene migrated from ENSG00000265241 to ENSG00000265241 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRX | Gene migrated from ENSG00000105227 to ENSG00000105227 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TPH2 | Gene migrated from ENSG00000139287 to ENSG00000139287 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TFAP2B | Gene migrated from ENSG00000008196 to ENSG00000008196 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRRX1 | Gene migrated from ENSG00000116132 to ENSG00000116132 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB40AL | Gene migrated from ENSG00000102128 to ENSG00000102128 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRIPTO | Gene symbol changed from TDGF1 to CRIPTO during gene set migration (ENSG00000241186 -> ENSG00000241186) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNH1 | Gene migrated from ENSG00000023191 to ENSG00000023191 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBFOX3 | Gene migrated from ENSG00000167281 to ENSG00000167281 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIM32 | Gene migrated from ENSG00000119401 to ENSG00000119401 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDKL1 | Gene migrated from ENSG00000100490 to ENSG00000100490 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPAST | Gene migrated from ENSG00000021574 to ENSG00000021574 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STK3 | Gene migrated from ENSG00000104375 to ENSG00000104375 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF507 | Gene migrated from ENSG00000168813 to ENSG00000168813 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FGF3 | Gene migrated from ENSG00000186895 to ENSG00000186895 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPAG9 | Gene migrated from ENSG00000008294 to ENSG00000008294 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INTS8 | Gene migrated from ENSG00000164941 to ENSG00000164941 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SP7 | Gene migrated from ENSG00000170374 to ENSG00000170374 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FMO4 | Gene migrated from ENSG00000076258 to ENSG00000076258 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK5R1 | Gene migrated from ENSG00000176749 to ENSG00000176749 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SAMD9L | Gene migrated from ENSG00000177409 to ENSG00000177409 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DIP2B | Gene migrated from ENSG00000066084 to ENSG00000066084 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX8 | Gene migrated from ENSG00000005513 to ENSG00000005513 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SHROOM4 | Gene migrated from ENSG00000158352 to ENSG00000158352 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR83 | Gene migrated from ENSG00000123154 to ENSG00000123154 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASMT | Gene migrated from ENSG00000196433 to ENSG00000196433 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STAT5B | Gene migrated from ENSG00000173757 to ENSG00000173757 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF496 | Gene migrated from ENSG00000162714 to ENSG00000162714 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EVC2 | Gene migrated from ENSG00000173040 to ENSG00000173040 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EVC | Gene migrated from ENSG00000072840 to ENSG00000072840 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASAH2 | Gene migrated from ENSG00000188611 to ENSG00000188611 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPSM2 | Gene migrated from ENSG00000121957 to ENSG00000121957 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ETS1 | Gene migrated from ENSG00000134954 to ENSG00000134954 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPS19 | Gene migrated from ENSG00000105372 to ENSG00000105372 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDH15 | Gene migrated from ENSG00000129910 to ENSG00000129910 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPL11 | Gene migrated from ENSG00000142676 to ENSG00000142676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDC6 | Gene migrated from ENSG00000094804 to ENSG00000094804 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SH3TC2 | Gene migrated from ENSG00000169247 to ENSG00000169247 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLIP2 | Gene migrated from ENSG00000106665 to ENSG00000106665 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UCHL1 | Gene migrated from ENSG00000154277 to ENSG00000154277 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF423 | Gene migrated from ENSG00000102935 to ENSG00000102935 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOST | Gene migrated from ENSG00000167941 to ENSG00000167941 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GOSR2 | Gene migrated from ENSG00000108433 to ENSG00000108433 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARID3A | Gene migrated from ENSG00000116017 to ENSG00000116017 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLIC2 | Gene migrated from ENSG00000155962 to ENSG00000155962 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCTD13 | Gene migrated from ENSG00000174943 to ENSG00000174943 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VANGL1 | Gene migrated from ENSG00000173218 to ENSG00000173218 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SGCA | Gene migrated from ENSG00000108823 to ENSG00000108823 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARHGEF6 | Gene migrated from ENSG00000129675 to ENSG00000129675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SALL1 | Gene migrated from ENSG00000103449 to ENSG00000103449 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARHGEF2 | Gene migrated from ENSG00000116584 to ENSG00000116584 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBA8 | Gene migrated from ENSG00000183785 to ENSG00000183785 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC5A2 | Gene migrated from ENSG00000140675 to ENSG00000140675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDX39A | Gene migrated from ENSG00000123136 to ENSG00000123136 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SF3B4 | Gene migrated from ENSG00000143368 to ENSG00000143368 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZDHHC15 | Gene migrated from ENSG00000102383 to ENSG00000102383 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTR | Gene migrated from ENSG00000118271 to ENSG00000118271 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDR2 | Gene migrated from ENSG00000162733 to ENSG00000162733 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOBP | Gene migrated from ENSG00000112320 to ENSG00000112320 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AR | Gene migrated from ENSG00000169083 to ENSG00000169083 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERMARD | Gene migrated from ENSG00000130023 to ENSG00000130023 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | APTX | Gene migrated from ENSG00000137074 to ENSG00000137074 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC93 | Gene migrated from ENSG00000125633 to ENSG00000125633 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VAMP1 | Gene migrated from ENSG00000139190 to ENSG00000139190 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF41 | Gene migrated from ENSG00000147124 to ENSG00000147124 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | XIST | Gene migrated from ENSG00000229807 to ENSG00000229807 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WWP1 | Gene migrated from ENSG00000123124 to ENSG00000123124 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COLEC10 | Gene migrated from ENSG00000184374 to ENSG00000184374 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNRPE | Gene migrated from ENSG00000182004 to ENSG00000182004 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLCNKA | Gene migrated from ENSG00000186510 to ENSG00000186510 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DBX1 | Gene migrated from ENSG00000109851 to ENSG00000109851 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNA14 | Gene migrated from ENSG00000156049 to ENSG00000156049 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNJ11 | Gene migrated from ENSG00000187486 to ENSG00000187486 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC8 | Gene migrated from ENSG00000169515 to ENSG00000169515 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DYNC2I2 | Gene symbol changed from WDR34 to DYNC2I2 during gene set migration (ENSG00000119333 -> ENSG00000119333) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SRPX2 | Gene migrated from ENSG00000102359 to ENSG00000102359 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC44A1 | Gene migrated from ENSG00000070214 to ENSG00000070214 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CYP2U1 | Gene migrated from ENSG00000155016 to ENSG00000155016 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANKRD31 | Gene migrated from ENSG00000145700 to ENSG00000145700 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CYP27A1 | Gene migrated from ENSG00000135929 to ENSG00000135929 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLYAT | Gene migrated from ENSG00000149124 to ENSG00000149124 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANKH | Gene migrated from ENSG00000154122 to ENSG00000154122 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNRPA | Gene migrated from ENSG00000077312 to ENSG00000077312 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CYC1 | Gene migrated from ENSG00000179091 to ENSG00000179091 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HOXD10 | Gene migrated from ENSG00000128710 to ENSG00000128710 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLUD1 | Gene migrated from ENSG00000148672 to ENSG00000148672 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INSR | Gene migrated from ENSG00000171105 to ENSG00000171105 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBR4 | Gene migrated from ENSG00000127481 to ENSG00000127481 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLRA1 | Gene migrated from ENSG00000145888 to ENSG00000145888 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC39A4 | Gene migrated from ENSG00000147804 to ENSG00000147804 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERCC4 | Gene migrated from ENSG00000175595 to ENSG00000175595 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INS | Gene migrated from ENSG00000254647 to ENSG00000254647 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALS2 | Gene migrated from ENSG00000003393 to ENSG00000003393 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LHX3 | Gene migrated from ENSG00000107187 to ENSG00000107187 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSEN34 | Gene migrated from ENSG00000170892 to ENSG00000170892 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNC3 | Gene migrated from ENSG00000131398 to ENSG00000131398 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF81 | Gene migrated from ENSG00000197779 to ENSG00000197779 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SELENON | Gene migrated from ENSG00000162430 to ENSG00000162430 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CUBN | Gene migrated from ENSG00000107611 to ENSG00000107611 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZFP57 | Gene migrated from ENSG00000204644 to ENSG00000204644 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTSF | Gene migrated from ENSG00000174080 to ENSG00000174080 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTC21B | Gene migrated from ENSG00000123607 to ENSG00000123607 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GJB1 | Gene migrated from ENSG00000169562 to ENSG00000169562 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GJA1 | Gene migrated from ENSG00000152661 to ENSG00000152661 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LGI4 | Gene migrated from ENSG00000153902 to ENSG00000153902 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALDOB | Gene migrated from ENSG00000136872 to ENSG00000136872 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EPM2A | Gene migrated from ENSG00000112425 to ENSG00000112425 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLASP1 | Gene migrated from ENSG00000074054 to ENSG00000074054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GHR | Gene migrated from ENSG00000112964 to ENSG00000112964 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTC1 | Gene migrated from ENSG00000113312 to ENSG00000113312 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEC24C | Gene migrated from ENSG00000176986 to ENSG00000176986 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTBK1 | Gene migrated from ENSG00000146216 to ENSG00000146216 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLX4 | Gene migrated from ENSG00000188827 to ENSG00000188827 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AKR1C2 | Gene migrated from ENSG00000151632 to ENSG00000151632 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZCCHC12 | Gene migrated from ENSG00000174460 to ENSG00000174460 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KATNAL2 | Gene migrated from ENSG00000167216 to ENSG00000167216 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EPB41L1 | Gene migrated from ENSG00000088367 to ENSG00000088367 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSTB | Gene migrated from ENSG00000160213 to ENSG00000160213 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AHSG | Gene migrated from ENSG00000145192 to ENSG00000145192 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FLNB | Gene migrated from ENSG00000136068 to ENSG00000136068 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CISD2 | Gene migrated from ENSG00000145354 to ENSG00000145354 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSHR | Gene migrated from ENSG00000165409 to ENSG00000165409 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGTR2 | Gene migrated from ENSG00000180772 to ENSG00000180772 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CANT1 | Gene migrated from ENSG00000171302 to ENSG00000171302 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGT | Gene migrated from ENSG00000135744 to ENSG00000135744 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGPS | Gene migrated from ENSG00000018510 to ENSG00000018510 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EOMES | Gene migrated from ENSG00000163508 to ENSG00000163508 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGO3 | Gene migrated from ENSG00000126070 to ENSG00000126070 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSMD2 | Gene migrated from ENSG00000121904 to ENSG00000121904 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UROC1 | Gene migrated from ENSG00000159650 to ENSG00000159650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EOGT | Gene migrated from ENSG00000163378 to ENSG00000163378 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGL | Gene migrated from ENSG00000162688 to ENSG00000162688 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGK | Gene migrated from ENSG00000006530 to ENSG00000006530 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGGF1 | Gene migrated from ENSG00000164252 to ENSG00000164252 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GCK | Gene migrated from ENSG00000106633 to ENSG00000106633 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AFG3L2 | Gene migrated from ENSG00000141385 to ENSG00000141385 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRTAP | Gene migrated from ENSG00000170275 to ENSG00000170275 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCO1 | Gene migrated from ENSG00000133028 to ENSG00000133028 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCN9A | Gene migrated from ENSG00000169432 to ENSG00000169432 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GBX1 | Gene migrated from ENSG00000164900 to ENSG00000164900 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADRA2B | Gene migrated from ENSG00000274286 to ENSG00000274286 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRLF1 | Gene migrated from ENSG00000006016 to ENSG00000006016 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRKL | Gene migrated from ENSG00000099942 to ENSG00000099942 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GBE1 | Gene migrated from ENSG00000114480 to ENSG00000114480 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADGRG6 | Gene migrated from ENSG00000112414 to ENSG00000112414 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GBA2 | Gene migrated from ENSG00000070610 to ENSG00000070610 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADGRB3 | Gene migrated from ENSG00000135298 to ENSG00000135298 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LBR | Gene migrated from ENSG00000143815 to ENSG00000143815 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COA3 | Gene migrated from ENSG00000183978 to ENSG00000183978 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EN2 | Gene migrated from ENSG00000164778 to ENSG00000164778 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNTNAP5 | Gene migrated from ENSG00000155052 to ENSG00000155052 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KANK1 | Gene migrated from ENSG00000107104 to ENSG00000107104 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SBDS | Gene migrated from ENSG00000126524 to ENSG00000126524 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADAMTSL2 | Gene migrated from ENSG00000197859 to ENSG00000197859 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UQCRQ | Gene migrated from ENSG00000164405 to ENSG00000164405 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNHIT6 | Gene migrated from ENSG00000117174 to ENSG00000117174 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNG2 | Gene migrated from ENSG00000166862 to ENSG00000166862 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADA2 | Gene migrated from ENSG00000093072 to ENSG00000093072 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GATA1 | Gene migrated from ENSG00000102145 to ENSG00000102145 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CPA6 | Gene migrated from ENSG00000165078 to ENSG00000165078 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CP | Gene migrated from ENSG00000047457 to ENSG00000047457 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHRNA4 | Gene migrated from ENSG00000101204 to ENSG00000101204 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX6B1 | Gene migrated from ENSG00000126267 to ENSG00000126267 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACTA1 | Gene migrated from ENSG00000143632 to ENSG00000143632 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX4I2 | Gene migrated from ENSG00000131055 to ENSG00000131055 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACOX2 | Gene migrated from ENSG00000168306 to ENSG00000168306 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GAP43 | Gene migrated from ENSG00000172020 to ENSG00000172020 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR19 | Gene migrated from ENSG00000157796 to ENSG00000157796 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNTN6 | Gene migrated from ENSG00000134115 to ENSG00000134115 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPTLC1 | Gene migrated from ENSG00000090054 to ENSG00000090054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPTBN5 | Gene migrated from ENSG00000137877 to ENSG00000137877 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ELP1 | Gene migrated from ENSG00000070061 to ENSG00000070061 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GAN | Gene migrated from ENSG00000261609 to ENSG00000261609 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMG6 | Gene migrated from ENSG00000070366 to ENSG00000070366 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IMMP2L | Gene migrated from ENSG00000184903 to ENSG00000184903 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CORO1A | Gene migrated from ENSG00000102879 to ENSG00000102879 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RUBCN | Gene migrated from ENSG00000145016 to ENSG00000145016 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABCG5 | Gene migrated from ENSG00000138075 to ENSG00000138075 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMCHD1 | Gene migrated from ENSG00000101596 to ENSG00000101596 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ELMOD1 | Gene migrated from ENSG00000110675 to ENSG00000110675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | JAG1 | Gene migrated from ENSG00000101384 to ENSG00000101384 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABCC6 | Gene migrated from ENSG00000091262 to ENSG00000091262 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WRAP53 | Gene migrated from ENSG00000141499 to ENSG00000141499 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNTN4 | Gene migrated from ENSG00000144619 to ENSG00000144619 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IYD | Gene migrated from ENSG00000009765 to ENSG00000009765 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF804A | Gene migrated from ENSG00000170396 to ENSG00000170396 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CA5A | Gene migrated from ENSG00000174990 to ENSG00000174990 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IGF2 | Gene migrated from ENSG00000167244 to ENSG00000167244 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBN1 | Gene migrated from ENSG00000166147 to ENSG00000166147 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBLN5 | Gene migrated from ENSG00000140092 to ENSG00000140092 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DIPK2A | Gene symbol changed from C3orf58 to DIPK2A during gene set migration (ENSG00000181744 -> ENSG00000181744) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UGT1A1 | Gene migrated from ENSG00000241635 to ENSG00000241635 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC9A9 | Gene migrated from ENSG00000181804 to ENSG00000181804 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB5IF | Gene symbol changed from C20orf24 to RAB5IF during gene set migration (ENSG00000101084 -> ENSG00000101084) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IGBP1 | Gene migrated from ENSG00000089289 to ENSG00000089289 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | C19orf12 | Gene migrated from ENSG00000131943 to ENSG00000131943 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | C18orf32 | Gene migrated from ENSG00000177576 to ENSG00000177576 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNTN3 | Gene migrated from ENSG00000113805 to ENSG00000113805 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC2A10 | Gene migrated from ENSG00000197496 to ENSG00000197496 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CFHR3 | Gene migrated from ENSG00000116785 to ENSG00000116785 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC29A3 | Gene migrated from ENSG00000198246 to ENSG00000198246 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2B5 | Gene migrated from ENSG00000145191 to ENSG00000145191 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2B4 | Gene migrated from ENSG00000115211 to ENSG00000115211 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2B3 | Gene migrated from ENSG00000070785 to ENSG00000070785 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2B2 | Gene migrated from ENSG00000119718 to ENSG00000119718 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CFHR1 | Gene migrated from ENSG00000244414 to ENSG00000244414 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2B1 | Gene migrated from ENSG00000111361 to ENSG00000111361 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC27A3 | Gene migrated from ENSG00000143554 to ENSG00000143554 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A4 | Gene migrated from ENSG00000151729 to ENSG00000151729 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2AK1 | Gene migrated from ENSG00000086232 to ENSG00000086232 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CFH | Gene migrated from ENSG00000000971 to ENSG00000000971 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A24 | Gene migrated from ENSG00000085491 to ENSG00000085491 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF674 | Gene migrated from ENSG00000251192 to ENSG00000251192 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EFNB2 | Gene migrated from ENSG00000125266 to ENSG00000125266 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR18 | Gene migrated from ENSG00000065268 to ENSG00000065268 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EFNB1 | Gene migrated from ENSG00000090776 to ENSG00000090776 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A20 | Gene migrated from ENSG00000178537 to ENSG00000178537 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KYNU | Gene migrated from ENSG00000115919 to ENSG00000115919 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A19 | Gene migrated from ENSG00000125454 to ENSG00000125454 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPRTN | Gene migrated from ENSG00000010072 to ENSG00000010072 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A13 | Gene migrated from ENSG00000004864 to ENSG00000004864 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBE2U | Gene migrated from ENSG00000177414 to ENSG00000177414 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EDNRB | Gene migrated from ENSG00000136160 to ENSG00000136160 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STAC3 | Gene migrated from ENSG00000185482 to ENSG00000185482 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EDC3 | Gene migrated from ENSG00000179151 to ENSG00000179151 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BMPER | Gene migrated from ENSG00000164619 to ENSG00000164619 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC7A7 | Gene migrated from ENSG00000155465 to ENSG00000155465 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IFT140 | Gene migrated from ENSG00000187535 to ENSG00000187535 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BLM | Gene migrated from ENSG00000197299 to ENSG00000197299 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BIN1 | Gene migrated from ENSG00000136717 to ENSG00000136717 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC22A5 | Gene migrated from ENSG00000197375 to ENSG00000197375 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BICD2 | Gene migrated from ENSG00000185963 to ENSG00000185963 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCN11A | Gene migrated from ENSG00000168356 to ENSG00000168356 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BDNF | Gene migrated from ENSG00000176697 to ENSG00000176697 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DYNC2H1 | Gene migrated from ENSG00000187240 to ENSG00000187240 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UQCRB | Gene migrated from ENSG00000156467 to ENSG00000156467 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS45 | Gene migrated from ENSG00000136631 to ENSG00000136631 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC1A3 | Gene migrated from ENSG00000079215 to ENSG00000079215 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KLLN | Gene migrated from ENSG00000227268 to ENSG00000227268 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DUOXA2 | Gene migrated from ENSG00000140274 to ENSG00000140274 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR13 | Gene migrated from ENSG00000101940 to ENSG00000101940 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DSE | Gene migrated from ENSG00000111817 to ENSG00000111817 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCAT1 | Gene migrated from ENSG00000060982 to ENSG00000060982 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS26C | Gene symbol changed from DSCR3 to VPS26C during gene set migration (ENSG00000157538 -> ENSG00000157538) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COMMD9 | Gene migrated from ENSG00000110442 to ENSG00000110442 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ST7 | Gene migrated from ENSG00000004866 to ENSG00000004866 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF185 | Gene migrated from ENSG00000147394 to ENSG00000147394 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HARS2 | Gene migrated from ENSG00000112855 to ENSG00000112855 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC6A4 | Gene migrated from ENSG00000108576 to ENSG00000108576 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FHIP2A | Gene symbol changed from FAM160B1 to FHIP2A during gene set migration (ENSG00000151553 -> ENSG00000151553) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COL1A2 | Gene migrated from ENSG00000164692 to ENSG00000164692 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WASHC5 | Gene migrated from ENSG00000164961 to ENSG00000164961 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPP6 | Gene migrated from ENSG00000130226 to ENSG00000130226 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FAM111A | Gene migrated from ENSG00000166801 to ENSG00000166801 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPP10 | Gene migrated from ENSG00000175497 to ENSG00000175497 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FAAH2 | Gene migrated from ENSG00000165591 to ENSG00000165591 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPM3 | Gene migrated from ENSG00000179085 to ENSG00000179085 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BANF1 | Gene migrated from ENSG00000175334 to ENSG00000175334 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HAL | Gene migrated from ENSG00000084110 to ENSG00000084110 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FA2H | Gene migrated from ENSG00000103089 to ENSG00000103089 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC19A2 | Gene migrated from ENSG00000117479 to ENSG00000117479 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HADH | Gene migrated from ENSG00000138796 to ENSG00000138796 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KLF8 | Gene migrated from ENSG00000102349 to ENSG00000102349 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UNC13D | Gene migrated from ENSG00000092929 to ENSG00000092929 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIRREL3 | Gene migrated from ENSG00000149571 to ENSG00000149571 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B3GAT3 | Gene migrated from ENSG00000149541 to ENSG00000149541 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COL18A1 | Gene migrated from ENSG00000182871 to ENSG00000182871 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H19 | Gene migrated from ENSG00000130600 to ENSG00000130600 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GYS2 | Gene migrated from ENSG00000111713 to ENSG00000111713 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AVPR2 | Gene migrated from ENSG00000126895 to ENSG00000126895 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AVPR1A | Gene migrated from ENSG00000166148 to ENSG00000166148 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AVP | Gene migrated from ENSG00000101200 to ENSG00000101200 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOK7 | Gene migrated from ENSG00000175920 to ENSG00000175920 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPINK5 | Gene migrated from ENSG00000133710 to ENSG00000133710 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOCK8 | Gene migrated from ENSG00000107099 to ENSG00000107099 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | XPNPEP3 | Gene migrated from ENSG00000196236 to ENSG00000196236 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATXN10 | Gene migrated from ENSG00000130638 to ENSG00000130638 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPG7 | Gene migrated from ENSG00000197912 to ENSG00000197912 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HYPK | Gene migrated from ENSG00000242028 to ENSG00000242028 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TXNL4A | Gene migrated from ENSG00000141759 to ENSG00000141759 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TWNK | Gene migrated from ENSG00000107815 to ENSG00000107815 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPEG | Gene migrated from ENSG00000072195 to ENSG00000072195 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP6V1C1 | Gene migrated from ENSG00000155097 to ENSG00000155097 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTF2IRD1 | Gene migrated from ENSG00000006704 to ENSG00000006704 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COMMD4 | Gene migrated from ENSG00000140365 to ENSG00000140365 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNAJC6 | Gene migrated from ENSG00000116675 to ENSG00000116675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNAJC3 | Gene migrated from ENSG00000102580 to ENSG00000102580 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTF2H4 | Gene migrated from ENSG00000213780 to ENSG00000213780 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDT1 | Gene migrated from ENSG00000167513 to ENSG00000167513 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CYFIP1 | Gene migrated from ENSG00000273749 to ENSG00000273749 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CMAS | Gene migrated from ENSG00000111726 to ENSG00000111726 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLUAP1 | Gene migrated from ENSG00000103351 to ENSG00000103351 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNAJA1 | Gene migrated from ENSG00000086061 to ENSG00000086061 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP2C2 | Gene migrated from ENSG00000064270 to ENSG00000064270 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNAH14 | Gene migrated from ENSG00000185842 to ENSG00000185842 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF1B | Gene migrated from ENSG00000054523 to ENSG00000054523 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATL1 | Gene migrated from ENSG00000198513 to ENSG00000198513 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP2A2 | Gene migrated from ENSG00000174437 to ENSG00000174437 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC12A1 | Gene migrated from ENSG00000074803 to ENSG00000074803 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRPR | Gene migrated from ENSG00000126010 to ENSG00000126010 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF16B | Gene migrated from ENSG00000089177 to ENSG00000089177 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UQCRC2 | Gene migrated from ENSG00000140740 to ENSG00000140740 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPS28 | Gene migrated from ENSG00000233927 to ENSG00000233927 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP10A | Gene migrated from ENSG00000206190 to ENSG00000206190 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DLK1 | Gene migrated from ENSG00000185559 to ENSG00000185559 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLPP | Gene migrated from ENSG00000125656 to ENSG00000125656 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DLGAP2 | Gene migrated from ENSG00000198010 to ENSG00000198010 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPOX | Gene migrated from ENSG00000143224 to ENSG00000143224 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PANK2 | Gene migrated from ENSG00000125779 to ENSG00000125779 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED14 | Gene migrated from ENSG00000180182 to ENSG00000180182 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NRXN2 | Gene migrated from ENSG00000110076 to ENSG00000110076 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDSS2 | Gene migrated from ENSG00000164494 to ENSG00000164494 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAT8L | Gene migrated from ENSG00000185818 to ENSG00000185818 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLD2 | Gene migrated from ENSG00000106628 to ENSG00000106628 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MCM4 | Gene migrated from ENSG00000104738 to ENSG00000104738 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLD1 | Gene migrated from ENSG00000062822 to ENSG00000062822 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLR3D | Gene migrated from ENSG00000168495 to ENSG00000168495 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAGS | Gene migrated from ENSG00000161653 to ENSG00000161653 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDGFB | Gene migrated from ENSG00000100311 to ENSG00000100311 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAA30 | Gene migrated from ENSG00000139977 to ENSG00000139977 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POU1F1 | Gene migrated from ENSG00000064835 to ENSG00000064835 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDE11A | Gene migrated from ENSG00000128655 to ENSG00000128655 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MARS2 | Gene migrated from ENSG00000247626 to ENSG00000247626 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MARK4 | Gene migrated from ENSG00000007047 to ENSG00000007047 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPID | Gene migrated from ENSG00000171497 to ENSG00000171497 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYT1 | Gene migrated from ENSG00000196132 to ENSG00000196132 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYO7A | Gene migrated from ENSG00000137474 to ENSG00000137474 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NOP58 | Gene migrated from ENSG00000055044 to ENSG00000055044 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYMK | Gene migrated from ENSG00000187616 to ENSG00000187616 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYH3 | Gene migrated from ENSG00000109063 to ENSG00000109063 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NOP10 | Gene migrated from ENSG00000182117 to ENSG00000182117 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYCBP2 | Gene migrated from ENSG00000005810 to ENSG00000005810 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGF | Gene migrated from ENSG00000151665 to ENSG00000151665 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ORC6 | Gene migrated from ENSG00000091651 to ENSG00000091651 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ORC4 | Gene migrated from ENSG00000115947 to ENSG00000115947 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ORC1 | Gene migrated from ENSG00000085840 to ENSG00000085840 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAGT1 | Gene migrated from ENSG00000102158 to ENSG00000102158 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NIN | Gene migrated from ENSG00000100503 to ENSG00000100503 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MACROD2 | Gene migrated from ENSG00000172264 to ENSG00000172264 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NHLRC1 | Gene migrated from ENSG00000187566 to ENSG00000187566 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTPAP | Gene migrated from ENSG00000107951 to ENSG00000107951 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NHEJ1 | Gene migrated from ENSG00000187736 to ENSG00000187736 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIP5K1B | Gene migrated from ENSG00000107242 to ENSG00000107242 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NGF | Gene migrated from ENSG00000134259 to ENSG00000134259 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTMR2 | Gene migrated from ENSG00000087053 to ENSG00000087053 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTM1 | Gene migrated from ENSG00000171100 to ENSG00000171100 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LSM11 | Gene migrated from ENSG00000155858 to ENSG00000155858 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PINK1 | Gene migrated from ENSG00000158828 to ENSG00000158828 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POP1 | Gene migrated from ENSG00000104356 to ENSG00000104356 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCDH9 | Gene migrated from ENSG00000184226 to ENSG00000184226 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LRP5 | Gene migrated from ENSG00000162337 to ENSG00000162337 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WASHC3 | Gene migrated from ENSG00000120860 to ENSG00000120860 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NFE2L1 | Gene migrated from ENSG00000082641 to ENSG00000082641 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCDH15 | Gene migrated from ENSG00000150275 to ENSG00000150275 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LMNA | Gene migrated from ENSG00000160789 to ENSG00000160789 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIK3R1 | Gene migrated from ENSG00000145675 to ENSG00000145675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCDH10 | Gene migrated from ENSG00000138650 to ENSG00000138650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MSH6 | Gene migrated from ENSG00000116062 to ENSG00000116062 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MRPS16 | Gene migrated from ENSG00000182180 to ENSG00000182180 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NUP62 | Gene migrated from ENSG00000213024 to ENSG00000213024 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIK3C3 | Gene migrated from ENSG00000078142 to ENSG00000078142 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MRAP | Gene migrated from ENSG00000170262 to ENSG00000170262 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRG1 | Gene migrated from ENSG00000163285 to ENSG00000163285 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MPZ | Gene migrated from ENSG00000158887 to ENSG00000158887 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NEGR1 | Gene migrated from ENSG00000172260 to ENSG00000172260 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PON3 | Gene migrated from ENSG00000105852 to ENSG00000105852 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MPI | Gene migrated from ENSG00000178802 to ENSG00000178802 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHKG2 | Gene migrated from ENSG00000156873 to ENSG00000156873 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCBD1 | Gene migrated from ENSG00000166228 to ENSG00000166228 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | G6PC3 | Gene migrated from ENSG00000141349 to ENSG00000141349 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHKA2 | Gene migrated from ENSG00000044446 to ENSG00000044446 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MNX1 | Gene migrated from ENSG00000130675 to ENSG00000130675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FZD3 | Gene migrated from ENSG00000104290 to ENSG00000104290 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PNP | Gene migrated from ENSG00000198805 to ENSG00000198805 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MLH1 | Gene migrated from ENSG00000076242 to ENSG00000076242 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MIS18BP1 | Gene migrated from ENSG00000129534 to ENSG00000129534 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MID2 | Gene migrated from ENSG00000080561 to ENSG00000080561 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MGP | Gene migrated from ENSG00000111341 to ENSG00000111341 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MGME1 | Gene migrated from ENSG00000125871 to ENSG00000125871 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NTNG1 | Gene migrated from ENSG00000162631 to ENSG00000162631 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MFN2 | Gene migrated from ENSG00000116688 to ENSG00000116688 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAX7 | Gene migrated from ENSG00000009709 to ENSG00000009709 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | METAP1 | Gene migrated from ENSG00000164024 to ENSG00000164024 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MET | Gene migrated from ENSG00000105976 to ENSG00000105976 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MEPCE | Gene migrated from ENSG00000146834 to ENSG00000146834 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MELK | Gene migrated from ENSG00000165304 to ENSG00000165304 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAX3 | Gene migrated from ENSG00000135903 to ENSG00000135903 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAX2 | Gene migrated from ENSG00000075891 to ENSG00000075891 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDN | Gene migrated from ENSG00000182636 to ENSG00000182636 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLXNA2 | Gene migrated from ENSG00000076356 to ENSG00000076356 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFS3 | Gene migrated from ENSG00000213619 to ENSG00000213619 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MMGT1 | Gene migrated from ENSG00000169446 to ENSG00000169446 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFS2 | Gene migrated from ENSG00000158864 to ENSG00000158864 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGY | Gene migrated from ENSG00000255072 to ENSG00000255072 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFB9 | Gene migrated from ENSG00000147684 to ENSG00000147684 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NHP2 | Gene migrated from ENSG00000145912 to ENSG00000145912 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFB3 | Gene migrated from ENSG00000119013 to ENSG00000119013 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDE2A | Gene migrated from ENSG00000186642 to ENSG00000186642 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFAF6 | Gene migrated from ENSG00000156170 to ENSG00000156170 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFAF5 | Gene migrated from ENSG00000101247 to ENSG00000101247 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MRTFB | Gene symbol changed from MKL2 to MRTFB during gene set migration (ENSG00000186260 -> ENSG00000186260) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFAF4 | Gene migrated from ENSG00000123545 to ENSG00000123545 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTERF3 | Gene migrated from ENSG00000156469 to ENSG00000156469 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MIR17HG | Gene migrated from ENSG00000215417 to ENSG00000215417 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIEZO2 | Gene migrated from ENSG00000154864 to ENSG00000154864 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFAF3 | Gene migrated from ENSG00000178057 to ENSG00000178057 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFAF2 | Gene migrated from ENSG00000164182 to ENSG00000164182 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LINGO1 | Gene migrated from ENSG00000169783 to ENSG00000169783 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFV2 | Gene migrated from ENSG00000178127 to ENSG00000178127 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MOCS3 | Gene migrated from ENSG00000124217 to ENSG00000124217 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MGA | Gene migrated from ENSG00000174197 to ENSG00000174197 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFA9 | Gene migrated from ENSG00000139180 to ENSG00000139180 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFA8 | Gene migrated from ENSG00000119421 to ENSG00000119421 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MRPL3 | Gene migrated from ENSG00000114686 to ENSG00000114686 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LYST | Gene migrated from ENSG00000143669 to ENSG00000143669 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLEKHG2 | Gene migrated from ENSG00000090924 to ENSG00000090924 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGU | Gene migrated from ENSG00000101464 to ENSG00000101464 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NFXL1 | Gene migrated from ENSG00000170448 to ENSG00000170448 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFS6 | Gene migrated from ENSG00000145494 to ENSG00000145494 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NECAP1 | Gene migrated from ENSG00000089818 to ENSG00000089818 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NUBP2 | Gene migrated from ENSG00000095906 to ENSG00000095906 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFA11 | Gene migrated from ENSG00000174886 to ENSG00000174886 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFA10 | Gene migrated from ENSG00000130414 to ENSG00000130414 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PFAS | Gene migrated from ENSG00000178921 to ENSG00000178921 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LIPT2 | Gene migrated from ENSG00000175536 to ENSG00000175536 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED29 | Gene migrated from ENSG00000063322 to ENSG00000063322 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAX1 | Gene migrated from ENSG00000125813 to ENSG00000125813 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NMNAT1 | Gene migrated from ENSG00000173614 to ENSG00000173614 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLCH1 | Gene migrated from ENSG00000114805 to ENSG00000114805 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED22 | Gene migrated from ENSG00000148297 to ENSG00000148297 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LRRC8C | Gene migrated from ENSG00000171488 to ENSG00000171488 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MANF | Gene migrated from ENSG00000145050 to ENSG00000145050 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KGD4 | Gene symbol changed from MRPS36 to KGD4 during gene set migration (ENSG00000134056 -> ENSG00000134056) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NLGN1 | Gene migrated from ENSG00000169760 to ENSG00000169760 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LRRC45 | Gene migrated from ENSG00000169683 to ENSG00000169683 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NCAPG2 | Gene migrated from ENSG00000146918 to ENSG00000146918 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHC1 | Gene migrated from ENSG00000111752 to ENSG00000111752 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NBN | Gene migrated from ENSG00000104320 to ENSG00000104320 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDS5B | Gene migrated from ENSG00000083642 to ENSG00000083642 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDS5A | Gene migrated from ENSG00000121892 to ENSG00000121892 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAV2 | Gene migrated from ENSG00000166833 to ENSG00000166833 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MDGA1 | Gene migrated from ENSG00000112139 to ENSG00000112139 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAN2A2 | Gene migrated from ENSG00000196547 to ENSG00000196547 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHACTR4 | Gene migrated from ENSG00000204138 to ENSG00000204138 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LRRC32 | Gene migrated from ENSG00000137507 to ENSG00000137507 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAL | Gene migrated from ENSG00000172005 to ENSG00000172005 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLOD3 | Gene migrated from ENSG00000106397 to ENSG00000106397 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MCCC2 | Gene migrated from ENSG00000131844 to ENSG00000131844 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MCCC1 | Gene migrated from ENSG00000078070 to ENSG00000078070 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCNT | Gene migrated from ENSG00000160299 to ENSG00000160299 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NUP85 | Gene migrated from ENSG00000125450 to ENSG00000125450 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPM1K | Gene migrated from ENSG00000163644 to ENSG00000163644 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCNA | Gene migrated from ENSG00000132646 to ENSG00000132646 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PJA1 | Gene migrated from ENSG00000181191 to ENSG00000181191 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AASS | Gene migrated from ENSG00000008311 to ENSG00000008311 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UQCC2 | Gene migrated from ENSG00000137288 to ENSG00000137288 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ITGA7 | Gene migrated from ENSG00000135424 to ENSG00000135424 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCD2 | Gene migrated from ENSG00000108604 to ENSG00000108604 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ITCH | Gene migrated from ENSG00000078747 to ENSG00000078747 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COG3 | Gene migrated from ENSG00000136152 to ENSG00000136152 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FKBP4 | Gene migrated from ENSG00000004478 to ENSG00000004478 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IRF2BP1 | Gene migrated from ENSG00000170604 to ENSG00000170604 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FICD | Gene migrated from ENSG00000198855 to ENSG00000198855 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IQSEC3 | Gene migrated from ENSG00000120645 to ENSG00000120645 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STN1 | Gene migrated from ENSG00000107960 to ENSG00000107960 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNKSR1 | Gene migrated from ENSG00000142675 to ENSG00000142675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FGFR2 | Gene migrated from ENSG00000066468 to ENSG00000066468 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UNC13C | Gene migrated from ENSG00000137766 to ENSG00000137766 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FEM1C | Gene migrated from ENSG00000145780 to ENSG00000145780 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLCN7 | Gene migrated from ENSG00000103249 to ENSG00000103249 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SACS | Gene migrated from ENSG00000151835 to ENSG00000151835 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLCN2 | Gene migrated from ENSG00000114859 to ENSG00000114859 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RUSC2 | Gene migrated from ENSG00000198853 to ENSG00000198853 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | YAP1 | Gene migrated from ENSG00000137693 to ENSG00000137693 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IMPA1 | Gene migrated from ENSG00000133731 to ENSG00000133731 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHST14 | Gene migrated from ENSG00000169105 to ENSG00000169105 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHRM1 | Gene migrated from ENSG00000168539 to ENSG00000168539 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHMP3 | Gene migrated from ENSG00000115561 to ENSG00000115561 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IKZF2 | Gene migrated from ENSG00000030419 to ENSG00000030419 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC9A7 | Gene migrated from ENSG00000065923 to ENSG00000065923 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP89 | Gene migrated from ENSG00000121289 to ENSG00000121289 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP63 | Gene migrated from ENSG00000182923 to ENSG00000182923 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FANCG | Gene migrated from ENSG00000221829 to ENSG00000221829 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FANCD2 | Gene migrated from ENSG00000144554 to ENSG00000144554 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FANCB | Gene migrated from ENSG00000181544 to ENSG00000181544 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACACA | Gene migrated from ENSG00000278540 to ENSG00000278540 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ICE1 | Gene migrated from ENSG00000164151 to ENSG00000164151 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZDHHC16 | Gene migrated from ENSG00000171307 to ENSG00000171307 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HYLS1 | Gene migrated from ENSG00000198331 to ENSG00000198331 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXOSC4 | Gene migrated from ENSG00000178896 to ENSG00000178896 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDO1 | Gene migrated from ENSG00000129596 to ENSG00000129596 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDKN1C | Gene migrated from ENSG00000129757 to ENSG00000129757 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDKL2 | Gene migrated from ENSG00000138769 to ENSG00000138769 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK9 | Gene migrated from ENSG00000136807 to ENSG00000136807 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXOSC2 | Gene migrated from ENSG00000130713 to ENSG00000130713 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXOSC10 | Gene migrated from ENSG00000171824 to ENSG00000171824 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HTT | Gene migrated from ENSG00000197386 to ENSG00000197386 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPS23 | Gene migrated from ENSG00000186468 to ENSG00000186468 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXOC2 | Gene migrated from ENSG00000112685 to ENSG00000112685 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HSPA9 | Gene migrated from ENSG00000113013 to ENSG00000113013 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CD96 | Gene migrated from ENSG00000153283 to ENSG00000153283 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC5A5 | Gene migrated from ENSG00000105641 to ENSG00000105641 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CENATAC | Gene symbol changed from CCDC84 to CENATAC during gene set migration (ENSG00000186166 -> ENSG00000186166) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERGIC3 | Gene migrated from ENSG00000125991 to ENSG00000125991 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC78 | Gene migrated from ENSG00000162004 to ENSG00000162004 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC174 | Gene migrated from ENSG00000154781 to ENSG00000154781 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SREK1 | Gene migrated from ENSG00000153914 to ENSG00000153914 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SREBF2 | Gene migrated from ENSG00000198911 to ENSG00000198911 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERBB4 | Gene migrated from ENSG00000178568 to ENSG00000178568 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EPHA7 | Gene migrated from ENSG00000135333 to ENSG00000135333 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC35F1 | Gene migrated from ENSG00000196376 to ENSG00000196376 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC35B2 | Gene migrated from ENSG00000157593 to ENSG00000157593 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC35A3 | Gene migrated from ENSG00000117620 to ENSG00000117620 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAMK2G | Gene migrated from ENSG00000148660 to ENSG00000148660 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EMX2 | Gene migrated from ENSG00000170370 to ENSG00000170370 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EMG1 | Gene migrated from ENSG00000126749 to ENSG00000126749 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNB4 | Gene migrated from ENSG00000182389 to ENSG00000182389 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC35A1 | Gene migrated from ENSG00000164414 to ENSG00000164414 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA2D1 | Gene migrated from ENSG00000153956 to ENSG00000153956 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H4C11 | Gene symbol changed from HIST1H4J to H4C11 during gene set migration (ENSG00000197238 -> ENSG00000197238) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MIDEAS | Gene symbol changed from ELMSAN1 to MIDEAS during gene set migration (ENSG00000156030 -> ENSG00000156030) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H4C6 | Gene symbol changed from HIST1H4F to H4C6 during gene set migration (ENSG00000274618 -> ENSG00000274618) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZC3H14 | Gene migrated from ENSG00000100722 to ENSG00000100722 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H4C4 | Gene symbol changed from HIST1H4D to H4C4 during gene set migration (ENSG00000277157 -> ENSG00000277157) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CFAP418 | Gene symbol changed from C8orf37 to CFAP418 during gene set migration (ENSG00000156172 -> ENSG00000156172) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRPC5 | Gene migrated from ENSG00000072315 to ENSG00000072315 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF3K | Gene migrated from ENSG00000178982 to ENSG00000178982 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF3I | Gene migrated from ENSG00000084623 to ENSG00000084623 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC2A2 | Gene migrated from ENSG00000163581 to ENSG00000163581 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTNAP1 | Gene symbol changed from C17orf80 to MTNAP1 during gene set migration (ENSG00000141219 -> ENSG00000141219) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZBTB7B | Gene migrated from ENSG00000160685 to ENSG00000160685 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BUB1 | Gene migrated from ENSG00000169679 to ENSG00000169679 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2A | Gene migrated from ENSG00000144895 to ENSG00000144895 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRIP1 | Gene migrated from ENSG00000136492 to ENSG00000136492 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF668 | Gene migrated from ENSG00000167394 to ENSG00000167394 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HEATR5B | Gene migrated from ENSG00000008869 to ENSG00000008869 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HEATR3 | Gene migrated from ENSG00000155393 to ENSG00000155393 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC20A2 | Gene migrated from ENSG00000168575 to ENSG00000168575 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCORL1 | Gene migrated from ENSG00000085185 to ENSG00000085185 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBA7 | Gene migrated from ENSG00000182179 to ENSG00000182179 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DSCAM | Gene migrated from ENSG00000171587 to ENSG00000171587 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DROSHA | Gene migrated from ENSG00000113360 to ENSG00000113360 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HAX1 | Gene migrated from ENSG00000143575 to ENSG00000143575 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HARS1 | Gene symbol changed from HARS to HARS1 during gene set migration (ENSG00000170445 -> ENSG00000170445) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPYSL2 | Gene migrated from ENSG00000092964 to ENSG00000092964 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC1A1 | Gene migrated from ENSG00000106688 to ENSG00000106688 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPYD | Gene migrated from ENSG00000188641 to ENSG00000188641 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBOX1 | Gene migrated from ENSG00000129151 to ENSG00000129151 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BAZ2B | Gene migrated from ENSG00000123636 to ENSG00000123636 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WFS1 | Gene migrated from ENSG00000109501 to ENSG00000109501 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS37A | Gene migrated from ENSG00000155975 to ENSG00000155975 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B3GALT6 | Gene migrated from ENSG00000176022 to ENSG00000176022 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATXN2L | Gene migrated from ENSG00000168488 to ENSG00000168488 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF5A | Gene migrated from ENSG00000155980 to ENSG00000155980 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDTC1 | Gene migrated from ENSG00000142784 to ENSG00000142784 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF21A | Gene migrated from ENSG00000139116 to ENSG00000139116 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNAJA3 | Gene migrated from ENSG00000103423 to ENSG00000103423 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP5F1E | Gene symbol changed from ATP5E to ATP5F1E during gene set migration (ENSG00000124172 -> ENSG00000124172) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP13A2 | Gene migrated from ENSG00000159363 to ENSG00000159363 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP11A | Gene migrated from ENSG00000068650 to ENSG00000068650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATM | Gene migrated from ENSG00000149311 to ENSG00000149311 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUFM | Gene migrated from ENSG00000178952 to ENSG00000178952 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DLG2 | Gene migrated from ENSG00000150672 to ENSG00000150672 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATAD2B | Gene migrated from ENSG00000119778 to ENSG00000119778 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBGCP4 | Gene migrated from ENSG00000137822 to ENSG00000137822 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRORP | Gene symbol changed from KIAA0391 to PRORP during gene set migration (ENSG00000100890 -> ENSG00000100890) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASTN2 | Gene migrated from ENSG00000148219 to ENSG00000148219 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX9 | Gene migrated from ENSG00000125398 to ENSG00000125398 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHX32 | Gene migrated from ENSG00000089876 to ENSG00000089876 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHTKD1 | Gene migrated from ENSG00000181192 to ENSG00000181192 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASAP2 | Gene migrated from ENSG00000151693 to ENSG00000151693 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZBTB16 | Gene migrated from ENSG00000109906 to ENSG00000109906 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPN2 | Gene migrated from ENSG00000142751 to ENSG00000142751 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX3 | Gene migrated from ENSG00000134595 to ENSG00000134595 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF865 | Gene migrated from ENSG00000261221 to ENSG00000261221 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR59 | Gene migrated from ENSG00000103091 to ENSG00000103091 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DENR | Gene migrated from ENSG00000139726 to ENSG00000139726 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARNT2 | Gene migrated from ENSG00000172379 to ENSG00000172379 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GORAB | Gene migrated from ENSG00000120370 to ENSG00000120370 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARHGEF40 | Gene migrated from ENSG00000165801 to ENSG00000165801 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARHGAP31 | Gene migrated from ENSG00000031081 to ENSG00000031081 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | YWHAZ | Gene migrated from ENSG00000164924 to ENSG00000164924 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AQP4 | Gene migrated from ENSG00000171885 to ENSG00000171885 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTL | Gene migrated from ENSG00000114999 to ENSG00000114999 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNAQ | Gene migrated from ENSG00000156052 to ENSG00000156052 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNK3 | Gene migrated from ENSG00000171303 to ENSG00000171303 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNRPN | Gene migrated from ENSG00000128739 to ENSG00000128739 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DCAF15 | Gene migrated from ENSG00000132017 to ENSG00000132017 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF407 | Gene migrated from ENSG00000215421 to ENSG00000215421 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GMNN | Gene migrated from ENSG00000112312 to ENSG00000112312 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNJ1 | Gene migrated from ENSG00000151704 to ENSG00000151704 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLYCTK | Gene migrated from ENSG00000168237 to ENSG00000168237 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANAPC7 | Gene migrated from ENSG00000196510 to ENSG00000196510 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNORD118 | Gene migrated from ENSG00000200463 to ENSG00000200463 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNIP1 | Gene migrated from ENSG00000163877 to ENSG00000163877 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALX4 | Gene migrated from ENSG00000052850 to ENSG00000052850 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALX3 | Gene migrated from ENSG00000156150 to ENSG00000156150 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALX1 | Gene migrated from ENSG00000180318 to ENSG00000180318 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | YKT6 | Gene migrated from ENSG00000106636 to ENSG00000106636 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEMA5A | Gene migrated from ENSG00000112902 to ENSG00000112902 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEMA3E | Gene migrated from ENSG00000170381 to ENSG00000170381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | USP14 | Gene migrated from ENSG00000101557 to ENSG00000101557 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALDOA | Gene migrated from ENSG00000149925 to ENSG00000149925 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTNND1 | Gene migrated from ENSG00000198561 to ENSG00000198561 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTC1 | Gene migrated from ENSG00000178971 to ENSG00000178971 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AKAP6 | Gene migrated from ENSG00000151320 to ENSG00000151320 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSTF2 | Gene migrated from ENSG00000101811 to ENSG00000101811 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP5MK | Gene symbol changed from USMG5 to ATP5MK during gene set migration (ENSG00000173915 -> ENSG00000173915) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSHZ3 | Gene migrated from ENSG00000121297 to ENSG00000121297 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSNK1G1 | Gene migrated from ENSG00000169118 to ENSG00000169118 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGPAT3 | Gene migrated from ENSG00000160216 to ENSG00000160216 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSF1R | Gene migrated from ENSG00000182578 to ENSG00000182578 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GBA1 | Gene symbol changed from GBA to GBA1 during gene set migration (ENSG00000177628 -> ENSG00000177628) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADD1 | Gene migrated from ENSG00000087274 to ENSG00000087274 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADCY5 | Gene migrated from ENSG00000173175 to ENSG00000173175 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRBN | Gene migrated from ENSG00000113851 to ENSG00000113851 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | JPH3 | Gene migrated from ENSG00000154118 to ENSG00000154118 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADAM23 | Gene migrated from ENSG00000114948 to ENSG00000114948 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCN3B | Gene migrated from ENSG00000166257 to ENSG00000166257 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX7B | Gene migrated from ENSG00000131174 to ENSG00000131174 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX20 | Gene migrated from ENSG00000203667 to ENSG00000203667 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX14 | Gene migrated from ENSG00000178449 to ENSG00000178449 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACAT1 | Gene migrated from ENSG00000075239 to ENSG00000075239 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACADSB | Gene migrated from ENSG00000196177 to ENSG00000196177 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACADS | Gene migrated from ENSG00000122971 to ENSG00000122971 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABI2 | Gene migrated from ENSG00000138443 to ENSG00000138443 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COQ9 | Gene migrated from ENSG00000088682 to ENSG00000088682 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | JAKMIP1 | Gene migrated from ENSG00000152969 to ENSG00000152969 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABCB7 | Gene migrated from ENSG00000131269 to ENSG00000131269 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COQ2 | Gene migrated from ENSG00000173085 to ENSG00000173085 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FOXR1 | Gene migrated from ENSG00000176302 to ENSG00000176302 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TNIK | Gene migrated from ENSG00000154310 to ENSG00000154310 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TARS1 | Gene symbol changed from TARS to TARS1 during gene set migration (ENSG00000113407 -> ENSG00000113407) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB14 | Gene migrated from ENSG00000119396 to ENSG00000119396 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RMRP | Gene migrated from ENSG00000269900 to ENSG00000277027 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAF13 | Gene migrated from ENSG00000197780 to ENSG00000197780 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TACO1 | Gene migrated from ENSG00000136463 to ENSG00000136463 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RIC1 | Gene migrated from ENSG00000107036 to ENSG00000107036 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTPRD | Gene migrated from ENSG00000153707 to ENSG00000153707 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TKT | Gene migrated from ENSG00000163931 to ENSG00000163931 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TKFC | Gene migrated from ENSG00000149476 to ENSG00000149476 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTPA | Gene migrated from ENSG00000119383 to ENSG00000119383 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FRMD4A | Gene migrated from ENSG00000151474 to ENSG00000151474 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | REPS2 | Gene migrated from ENSG00000169891 to ENSG00000169891 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTBP2 | Gene migrated from ENSG00000117569 to ENSG00000117569 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSPAN7 | Gene migrated from ENSG00000156298 to ENSG00000156298 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SV2A | Gene migrated from ENSG00000159164 to ENSG00000159164 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBMX | Gene migrated from ENSG00000147274 to ENSG00000147274 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSMB1 | Gene migrated from ENSG00000008018 to ENSG00000008018 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSAT1 | Gene migrated from ENSG00000135069 to ENSG00000135069 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBM28 | Gene migrated from ENSG00000106344 to ENSG00000106344 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRSS12 | Gene migrated from ENSG00000164099 to ENSG00000164099 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRRT2 | Gene migrated from ENSG00000167371 to ENSG00000167371 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBX2 | Gene migrated from ENSG00000121068 to ENSG00000121068 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIP13 | Gene migrated from ENSG00000071539 to ENSG00000071539 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUPT6H | Gene migrated from ENSG00000109111 to ENSG00000109111 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRODH | Gene migrated from ENSG00000100033 to ENSG00000100033 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | THRB | Gene migrated from ENSG00000151090 to ENSG00000151090 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM231 | Gene migrated from ENSG00000205084 to ENSG00000205084 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRKD1 | Gene migrated from ENSG00000184304 to ENSG00000184304 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRICKLE2 | Gene migrated from ENSG00000163637 to ENSG00000163637 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | THG1L | Gene migrated from ENSG00000113272 to ENSG00000113272 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBCB | Gene migrated from ENSG00000105254 to ENSG00000105254 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP5C | Gene migrated from ENSG00000011485 to ENSG00000011485 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TNK2 | Gene migrated from ENSG00000061938 to ENSG00000061938 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP2R2B | Gene migrated from ENSG00000156475 to ENSG00000156475 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEDS1 | Gene symbol changed from TMEM189 to PEDS1 during gene set migration (ENSG00000240849 -> ENSG00000240849) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP1R3F | Gene migrated from ENSG00000049769 to ENSG00000049769 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TGFB1 | Gene migrated from ENSG00000105329 to ENSG00000105329 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FTCD | Gene migrated from ENSG00000160282 to ENSG00000160282 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNU5A-1 | Gene migrated from ENSG00000199568 to ENSG00000199568 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FRYL | Gene migrated from ENSG00000075539 to ENSG00000075539 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FRY | Gene migrated from ENSG00000073910 to ENSG00000073910 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAB2 | Gene migrated from ENSG00000055208 to ENSG00000055208 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SZT2 | Gene migrated from ENSG00000198198 to ENSG00000198198 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SYT1 | Gene migrated from ENSG00000067715 to ENSG00000067715 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SYP | Gene migrated from ENSG00000102003 to ENSG00000102003 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SYNJ1 | Gene migrated from ENSG00000159082 to ENSG00000159082 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SYNGAP1 | Gene migrated from ENSG00000197283 to ENSG00000197283 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SYNCRIP | Gene migrated from ENSG00000135316 to ENSG00000135316 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SYN1 | Gene migrated from ENSG00000008056 to ENSG00000008056 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SVBP | Gene migrated from ENSG00000177868 to ENSG00000177868 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUZ12 | Gene migrated from ENSG00000178691 to ENSG00000178691 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SURF1 | Gene migrated from ENSG00000148290 to ENSG00000148290 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUPT4H1 | Gene migrated from ENSG00000213246 to ENSG00000213246 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUPT16H | Gene migrated from ENSG00000092201 to ENSG00000092201 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUOX | Gene migrated from ENSG00000139531 to ENSG00000139531 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUMF1 | Gene migrated from ENSG00000144455 to ENSG00000144455 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUFU | Gene migrated from ENSG00000107882 to ENSG00000107882 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUCO | Gene migrated from ENSG00000094975 to ENSG00000094975 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUCLG1 | Gene migrated from ENSG00000163541 to ENSG00000163541 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SUCLA2 | Gene migrated from ENSG00000136143 to ENSG00000136143 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STXBP1 | Gene migrated from ENSG00000136854 to ENSG00000136854 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STX1B | Gene migrated from ENSG00000099365 to ENSG00000099365 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STX1A | Gene migrated from ENSG00000106089 to ENSG00000106089 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNU6ATAC | Gene migrated from ENSG00000221676 to ENSG00000221676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNU5B-1 | Gene migrated from ENSG00000200156 to ENSG00000200156 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNU4ATAC | Gene migrated from ENSG00000264229 to ENSG00000264229 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNU4-2 | Gene migrated from ENSG00000202538 to ENSG00000202538 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNU2-2 | Gene symbol changed from RNU2-2P to RNU2-2 during gene set migration (ENSG00000222328 -> ENSG00000222328) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNPC3 | Gene migrated from ENSG00000185946 to ENSG00000185946 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNF220 | Gene migrated from ENSG00000187147 to ENSG00000187147 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNF2 | Gene migrated from ENSG00000121481 to ENSG00000121481 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNF13 | Gene migrated from ENSG00000082996 to ENSG00000082996 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNF125 | Gene migrated from ENSG00000101695 to ENSG00000101695 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNF113A | Gene migrated from ENSG00000125352 to ENSG00000125352 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNASET2 | Gene migrated from ENSG00000026297 to ENSG00000026297 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNASEH2C | Gene migrated from ENSG00000172922 to ENSG00000172922 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNASEH2B | Gene migrated from ENSG00000136104 to ENSG00000136104 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNASEH2A | Gene migrated from ENSG00000104889 to ENSG00000104889 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RMND1 | Gene migrated from ENSG00000155906 to ENSG00000155906 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RLIM | Gene migrated from ENSG00000131263 to ENSG00000131263 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RIT1 | Gene migrated from ENSG00000143622 to ENSG00000143622 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RING1 | Gene migrated from ENSG00000204227 to ENSG00000204227 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RICTOR | Gene migrated from ENSG00000164327 to ENSG00000164327 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RHOBTB2 | Gene migrated from ENSG00000008853 to ENSG00000008853 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RHEB | Gene migrated from ENSG00000106615 to ENSG00000106615 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RFX7 | Gene migrated from ENSG00000181827 to ENSG00000181827 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RFX4 | Gene migrated from ENSG00000111783 to ENSG00000111783 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RFX3 | Gene migrated from ENSG00000080298 to ENSG00000080298 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RFT1 | Gene migrated from ENSG00000163933 to ENSG00000163933 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RFC4 | Gene migrated from ENSG00000163918 to ENSG00000163918 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RERE | Gene migrated from ENSG00000142599 to ENSG00000142599 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RELN | Gene migrated from ENSG00000189056 to ENSG00000189056 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RDH11 | Gene migrated from ENSG00000072042 to ENSG00000072042 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBSN | Gene migrated from ENSG00000131381 to ENSG00000131381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBM10 | Gene migrated from ENSG00000182872 to ENSG00000182872 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBL2 | Gene migrated from ENSG00000103479 to ENSG00000103479 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBFOX1 | Gene migrated from ENSG00000078328 to ENSG00000078328 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBBP8 | Gene migrated from ENSG00000101773 to ENSG00000101773 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RBBP5 | Gene migrated from ENSG00000117222 to ENSG00000117222 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RARS2 | Gene migrated from ENSG00000146282 to ENSG00000146282 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RARS1 | Gene symbol changed from RARS to RARS1 during gene set migration (ENSG00000113643 -> ENSG00000113643) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RARB | Gene migrated from ENSG00000077092 to ENSG00000077092 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAPGEF2 | Gene migrated from ENSG00000109756 to ENSG00000109756 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAP1GDS1 | Gene migrated from ENSG00000138698 to ENSG00000138698 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAP1B | Gene migrated from ENSG00000127314 to ENSG00000127314 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RALGAPA1 | Gene migrated from ENSG00000174373 to ENSG00000174373 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RALA | Gene migrated from ENSG00000006451 to ENSG00000006451 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAI1 | Gene migrated from ENSG00000108557 to ENSG00000108557 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAF1 | Gene migrated from ENSG00000132155 to ENSG00000132155 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAD21 | Gene migrated from ENSG00000164754 to ENSG00000164754 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAC3 | Gene migrated from ENSG00000169750 to ENSG00000169750 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAC1 | Gene migrated from ENSG00000136238 to ENSG00000136238 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RABGAP1 | Gene migrated from ENSG00000011454 to ENSG00000011454 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB5C | Gene migrated from ENSG00000108774 to ENSG00000108774 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB3GAP2 | Gene migrated from ENSG00000118873 to ENSG00000118873 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB3GAP1 | Gene migrated from ENSG00000115839 to ENSG00000115839 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB3A | Gene migrated from ENSG00000105649 to ENSG00000105649 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB39B | Gene migrated from ENSG00000155961 to ENSG00000155961 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB23 | Gene migrated from ENSG00000112210 to ENSG00000112210 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB1A | Gene migrated from ENSG00000138069 to ENSG00000138069 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB18 | Gene migrated from ENSG00000099246 to ENSG00000099246 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB11B | Gene migrated from ENSG00000185236 to ENSG00000185236 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RAB11A | Gene migrated from ENSG00000103769 to ENSG00000103769 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | QRICH1 | Gene migrated from ENSG00000198218 to ENSG00000198218 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | QDPR | Gene migrated from ENSG00000151552 to ENSG00000151552 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | QARS1 | Gene symbol changed from QARS to QARS1 during gene set migration (ENSG00000172053 -> ENSG00000172053) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PYCR2 | Gene migrated from ENSG00000143811 to ENSG00000143811 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PYCR1 | Gene migrated from ENSG00000183010 to ENSG00000183010 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PUS7 | Gene migrated from ENSG00000091127 to ENSG00000091127 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PUS3 | Gene migrated from ENSG00000110060 to ENSG00000110060 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PUS1 | Gene migrated from ENSG00000177192 to ENSG00000177192 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PURA | Gene migrated from ENSG00000185129 to ENSG00000185129 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PUM1 | Gene migrated from ENSG00000134644 to ENSG00000134644 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PUF60 | Gene migrated from ENSG00000179950 to ENSG00000179950 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTS | Gene migrated from ENSG00000150787 to ENSG00000150787 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTRHD1 | Gene migrated from ENSG00000184924 to ENSG00000184924 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTRH2 | Gene migrated from ENSG00000141378 to ENSG00000141378 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTPN4 | Gene migrated from ENSG00000088179 to ENSG00000088179 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTPN23 | Gene migrated from ENSG00000076201 to ENSG00000076201 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTPN11 | Gene migrated from ENSG00000179295 to ENSG00000179295 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTPN1 | Gene migrated from ENSG00000196396 to ENSG00000196396 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTPMT1 | Gene migrated from ENSG00000110536 to ENSG00000110536 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTF1A | Gene migrated from ENSG00000168267 to ENSG00000168267 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTEN | Gene migrated from ENSG00000171862 to ENSG00000171862 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTDSS1 | Gene migrated from ENSG00000156471 to ENSG00000156471 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTCHD1 | Gene migrated from ENSG00000165186 to ENSG00000165186 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTCH1 | Gene migrated from ENSG00000185920 to ENSG00000185920 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTCD3 | Gene migrated from ENSG00000132300 to ENSG00000132300 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PTBP1 | Gene migrated from ENSG00000011304 to ENSG00000011304 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSPH | Gene migrated from ENSG00000146733 to ENSG00000146733 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSMF1 | Gene migrated from ENSG00000125818 to ENSG00000125818 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSMD12 | Gene migrated from ENSG00000197170 to ENSG00000197170 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSMD11 | Gene migrated from ENSG00000108671 to ENSG00000108671 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSMC5 | Gene migrated from ENSG00000087191 to ENSG00000087191 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSMC3 | Gene migrated from ENSG00000165916 to ENSG00000165916 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PSAP | Gene migrated from ENSG00000197746 to ENSG00000197746 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRUNE1 | Gene migrated from ENSG00000143363 to ENSG00000143363 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRR12 | Gene migrated from ENSG00000126464 to ENSG00000126464 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRPS1 | Gene migrated from ENSG00000147224 to ENSG00000147224 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRPF8 | Gene migrated from ENSG00000174231 to ENSG00000174231 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRPF19 | Gene migrated from ENSG00000110107 to ENSG00000110107 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRMT9 | Gene migrated from ENSG00000164169 to ENSG00000164169 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRMT7 | Gene migrated from ENSG00000132600 to ENSG00000132600 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRMT1 | Gene migrated from ENSG00000126457 to ENSG00000126457 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRKAR1B | Gene migrated from ENSG00000188191 to ENSG00000188191 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRKAR1A | Gene migrated from ENSG00000108946 to ENSG00000108946 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRKACB | Gene migrated from ENSG00000142875 to ENSG00000142875 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PRDM13 | Gene migrated from ENSG00000112238 to ENSG00000112238 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PQBP1 | Gene migrated from ENSG00000102103 to ENSG00000102103 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPT1 | Gene migrated from ENSG00000131238 to ENSG00000131238 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP3CA | Gene migrated from ENSG00000138814 to ENSG00000138814 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP2R5C | Gene migrated from ENSG00000078304 to ENSG00000078304 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP2R1A | Gene migrated from ENSG00000105568 to ENSG00000105568 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP2R5D | Gene migrated from ENSG00000112640 to ENSG00000112640 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP2CA | Gene migrated from ENSG00000113575 to ENSG00000113575 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP1R21 | Gene migrated from ENSG00000162869 to ENSG00000162869 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP1R15B | Gene migrated from ENSG00000158615 to ENSG00000158615 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FCSK | Gene symbol changed from FUK to FCSK during gene set migration (ENSG00000157353 -> ENSG00000157353) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FUCA1 | Gene migrated from ENSG00000179163 to ENSG00000179163 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FTSJ1 | Gene migrated from ENSG00000068438 to ENSG00000068438 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FTO | Gene migrated from ENSG00000140718 to ENSG00000140718 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FSD1L | Gene migrated from ENSG00000106701 to ENSG00000106701 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRMT10A | Gene migrated from ENSG00000145331 to ENSG00000145331 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRMT1 | Gene migrated from ENSG00000104907 to ENSG00000104907 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIT1 | Gene migrated from ENSG00000043514 to ENSG00000043514 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIP12 | Gene migrated from ENSG00000153827 to ENSG00000153827 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIO | Gene migrated from ENSG00000038382 to ENSG00000038382 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIM8 | Gene migrated from ENSG00000171206 to ENSG00000171206 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRIM71 | Gene migrated from ENSG00000206557 to ENSG00000206557 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TREX1 | Gene migrated from ENSG00000213689 to ENSG00000213689 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAPPC9 | Gene migrated from ENSG00000167632 to ENSG00000167632 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAPPC6B | Gene migrated from ENSG00000182400 to ENSG00000182400 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAPPC4 | Gene migrated from ENSG00000196655 to ENSG00000196655 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAPPC2L | Gene migrated from ENSG00000167515 to ENSG00000167515 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAPPC12 | Gene migrated from ENSG00000171853 to ENSG00000171853 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAPPC11 | Gene migrated from ENSG00000168538 to ENSG00000168538 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAPPC10 | Gene migrated from ENSG00000160218 to ENSG00000160218 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAK1 | Gene migrated from ENSG00000182606 to ENSG00000182606 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAIP | Gene migrated from ENSG00000183763 to ENSG00000183763 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRAF7 | Gene migrated from ENSG00000131653 to ENSG00000131653 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRA2B | Gene migrated from ENSG00000136527 to ENSG00000136527 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TPP2 | Gene migrated from ENSG00000134900 to ENSG00000134900 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TPP1 | Gene migrated from ENSG00000166340 to ENSG00000166340 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TP73 | Gene migrated from ENSG00000078900 to ENSG00000078900 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TOP2B | Gene migrated from ENSG00000077097 to ENSG00000077097 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TOGARAM1 | Gene migrated from ENSG00000198718 to ENSG00000198718 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TOE1 | Gene migrated from ENSG00000132773 to ENSG00000132773 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TNRC6B | Gene migrated from ENSG00000100354 to ENSG00000100354 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TNR | Gene migrated from ENSG00000116147 to ENSG00000116147 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TNPO2 | Gene migrated from ENSG00000105576 to ENSG00000105576 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMX2 | Gene migrated from ENSG00000213593 to ENSG00000213593 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMTC3 | Gene migrated from ENSG00000139324 to ENSG00000139324 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM94 | Gene migrated from ENSG00000177728 to ENSG00000177728 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM70 | Gene migrated from ENSG00000175606 to ENSG00000175606 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM67 | Gene migrated from ENSG00000164953 to ENSG00000164953 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM63C | Gene migrated from ENSG00000165548 to ENSG00000165548 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM63B | Gene migrated from ENSG00000137216 to ENSG00000137216 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RXYLT1 | Gene symbol changed from TMEM5 to RXYLT1 during gene set migration (ENSG00000118600 -> ENSG00000118600) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LYSET | Gene symbol changed from TMEM251 to LYSET during gene set migration (ENSG00000153485 -> ENSG00000153485) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM240 | Gene migrated from ENSG00000205090 to ENSG00000205090 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM237 | Gene migrated from ENSG00000155755 to ENSG00000155755 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM222 | Gene migrated from ENSG00000186501 to ENSG00000186501 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM218 | Gene migrated from ENSG00000150433 to ENSG00000150433 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM216 | Gene migrated from ENSG00000187049 to ENSG00000187049 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM184B | Gene migrated from ENSG00000198792 to ENSG00000198792 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM167A | Gene migrated from ENSG00000174695 to ENSG00000174695 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM165 | Gene migrated from ENSG00000134851 to ENSG00000134851 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM163 | Gene migrated from ENSG00000152128 to ENSG00000152128 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM161B | Gene migrated from ENSG00000164180 to ENSG00000164180 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM147 | Gene migrated from ENSG00000105677 to ENSG00000105677 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMEM106B | Gene migrated from ENSG00000106460 to ENSG00000106460 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRPM7 | Gene migrated from ENSG00000092439 to ENSG00000092439 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TMCO1 | Gene migrated from ENSG00000143183 to ENSG00000143183 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TM2D3 | Gene migrated from ENSG00000184277 to ENSG00000184277 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TLK2 | Gene migrated from ENSG00000146872 to ENSG00000146872 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TINF2 | Gene migrated from ENSG00000092330 to ENSG00000092330 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TIMM50 | Gene migrated from ENSG00000105197 to ENSG00000105197 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TIAM1 | Gene migrated from ENSG00000156299 to ENSG00000156299 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | THUMPD1 | Gene migrated from ENSG00000066654 to ENSG00000066654 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | THRA | Gene migrated from ENSG00000126351 to ENSG00000126351 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | THOC6 | Gene migrated from ENSG00000131652 to ENSG00000131652 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | THOC2 | Gene migrated from ENSG00000125676 to ENSG00000125676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TH | Gene migrated from ENSG00000180176 to ENSG00000180176 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TGIF1 | Gene migrated from ENSG00000177426 to ENSG00000177426 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TFE3 | Gene migrated from ENSG00000068323 to ENSG00000068323 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TET3 | Gene migrated from ENSG00000187605 to ENSG00000187605 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TERT | Gene migrated from ENSG00000164362 to ENSG00000164362 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TENM3 | Gene migrated from ENSG00000218336 to ENSG00000218336 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TELO2 | Gene migrated from ENSG00000100726 to ENSG00000100726 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TEFM | Gene migrated from ENSG00000172171 to ENSG00000172171 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TECPR2 | Gene migrated from ENSG00000196663 to ENSG00000196663 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TDP2 | Gene migrated from ENSG00000111802 to ENSG00000111802 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCTN3 | Gene migrated from ENSG00000119977 to ENSG00000119977 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCTN2 | Gene migrated from ENSG00000168778 to ENSG00000168778 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCTN1 | Gene migrated from ENSG00000204852 to ENSG00000204852 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCP1 | Gene migrated from ENSG00000120438 to ENSG00000120438 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCN2 | Gene migrated from ENSG00000185339 to ENSG00000185339 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCF7L2 | Gene migrated from ENSG00000148737 to ENSG00000148737 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCF4 | Gene migrated from ENSG00000196628 to ENSG00000196628 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCF20 | Gene migrated from ENSG00000100207 to ENSG00000100207 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TCEAL1 | Gene migrated from ENSG00000172465 to ENSG00000172465 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBX1 | Gene migrated from ENSG00000184058 to ENSG00000184058 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBR1 | Gene migrated from ENSG00000136535 to ENSG00000136535 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBL1XR1 | Gene migrated from ENSG00000177565 to ENSG00000177565 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBCK | Gene migrated from ENSG00000145348 to ENSG00000145348 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBCE | Gene migrated from ENSG00000116957 to ENSG00000284770 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBCD | Gene migrated from ENSG00000141556 to ENSG00000141556 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBC1D7 | Gene migrated from ENSG00000145979 to ENSG00000145979 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBC1D32 | Gene migrated from ENSG00000146350 to ENSG00000146350 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBC1D2B | Gene migrated from ENSG00000167202 to ENSG00000167202 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBC1D24 | Gene migrated from ENSG00000162065 to ENSG00000162065 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBC1D23 | Gene migrated from ENSG00000036054 to ENSG00000036054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TBC1D20 | Gene migrated from ENSG00000125875 to ENSG00000125875 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAFAZZIN | Gene symbol changed from TAZ to TAFAZZIN during gene set migration (ENSG00000102125 -> ENSG00000102125) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAT | Gene migrated from ENSG00000198650 to ENSG00000198650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TASP1 | Gene migrated from ENSG00000089123 to ENSG00000089123 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TARS2 | Gene migrated from ENSG00000143374 to ENSG00000143374 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAOK2 | Gene migrated from ENSG00000149930 to ENSG00000149930 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAOK1 | Gene migrated from ENSG00000160551 to ENSG00000160551 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TANGO2 | Gene migrated from ENSG00000183597 to ENSG00000183597 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TANC2 | Gene migrated from ENSG00000170921 to ENSG00000170921 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAF8 | Gene migrated from ENSG00000137413 to ENSG00000137413 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAF6 | Gene migrated from ENSG00000106290 to ENSG00000106290 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAF4 | Gene migrated from ENSG00000130699 to ENSG00000130699 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAF2 | Gene migrated from ENSG00000064313 to ENSG00000064313 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAF1C | Gene migrated from ENSG00000103168 to ENSG00000103168 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TAF1 | Gene migrated from ENSG00000147133 to ENSG00000147133 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FRRS1L | Gene migrated from ENSG00000260230 to ENSG00000260230 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FRMPD4 | Gene migrated from ENSG00000169933 to ENSG00000169933 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FRMD5 | Gene migrated from ENSG00000171877 to ENSG00000171877 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRNT1 | Gene migrated from ENSG00000072756 to ENSG00000072756 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OPA3 | Gene migrated from ENSG00000125741 to ENSG00000125741 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OLA1 | Gene migrated from ENSG00000138430 to ENSG00000138430 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OGT | Gene migrated from ENSG00000147162 to ENSG00000147162 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OGDHL | Gene migrated from ENSG00000197444 to ENSG00000197444 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OGDH | Gene migrated from ENSG00000105953 to ENSG00000105953 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OFD1 | Gene migrated from ENSG00000046651 to ENSG00000046651 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ODC1 | Gene migrated from ENSG00000115758 to ENSG00000115758 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OCRL | Gene migrated from ENSG00000122126 to ENSG00000122126 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OCLN | Gene migrated from ENSG00000197822 to ENSG00000197822 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NUS1 | Gene migrated from ENSG00000153989 to ENSG00000153989 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NUP214 | Gene migrated from ENSG00000126883 to ENSG00000126883 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NUP188 | Gene migrated from ENSG00000095319 to ENSG00000095319 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NUDT2 | Gene migrated from ENSG00000164978 to ENSG00000164978 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NUBPL | Gene migrated from ENSG00000151413 to ENSG00000151413 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NTRK2 | Gene migrated from ENSG00000148053 to ENSG00000148053 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NTRK1 | Gene migrated from ENSG00000198400 to ENSG00000198400 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NTNG2 | Gene migrated from ENSG00000196358 to ENSG00000196358 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NT5C2 | Gene migrated from ENSG00000076685 to ENSG00000076685 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NSUN6 | Gene migrated from ENSG00000241058 to ENSG00000241058 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NSUN3 | Gene migrated from ENSG00000178694 to ENSG00000178694 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NSUN2 | Gene migrated from ENSG00000037474 to ENSG00000037474 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NSRP1 | Gene migrated from ENSG00000126653 to ENSG00000126653 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NSF | Gene migrated from ENSG00000073969 to ENSG00000073969 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NSDHL | Gene migrated from ENSG00000147383 to ENSG00000147383 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NSD2 | Gene migrated from ENSG00000109685 to ENSG00000109685 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NSD1 | Gene migrated from ENSG00000165671 to ENSG00000165671 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NRXN1 | Gene migrated from ENSG00000179915 to ENSG00000179915 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NRROS | Gene migrated from ENSG00000174004 to ENSG00000174004 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NRDC | Gene migrated from ENSG00000078618 to ENSG00000078618 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NRCAM | Gene migrated from ENSG00000091129 to ENSG00000091129 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NRAS | Gene migrated from ENSG00000213281 to ENSG00000213281 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NR4A2 | Gene migrated from ENSG00000153234 to ENSG00000153234 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NR2F2 | Gene migrated from ENSG00000185551 to ENSG00000185551 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NR2F1 | Gene migrated from ENSG00000175745 to ENSG00000175745 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NPRL2 | Gene migrated from ENSG00000114388 to ENSG00000114388 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NPHP3 | Gene migrated from ENSG00000113971 to ENSG00000113971 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NPHP1 | Gene migrated from ENSG00000144061 to ENSG00000144061 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NPC2 | Gene migrated from ENSG00000119655 to ENSG00000119655 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NPC1 | Gene migrated from ENSG00000141458 to ENSG00000141458 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NOVA2 | Gene migrated from ENSG00000104967 to ENSG00000104967 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NOTCH3 | Gene migrated from ENSG00000074181 to ENSG00000074181 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NOTCH1 | Gene migrated from ENSG00000148400 to ENSG00000148400 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NONO | Gene migrated from ENSG00000147140 to ENSG00000147140 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NLGN4X | Gene migrated from ENSG00000146938 to ENSG00000146938 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NLGN3 | Gene migrated from ENSG00000196338 to ENSG00000196338 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NKX2-1 | Gene migrated from ENSG00000136352 to ENSG00000136352 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NKAP | Gene migrated from ENSG00000101882 to ENSG00000101882 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NIPBL | Gene migrated from ENSG00000164190 to ENSG00000164190 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NHS | Gene migrated from ENSG00000188158 to ENSG00000188158 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NGLY1 | Gene migrated from ENSG00000151092 to ENSG00000151092 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NFU1 | Gene migrated from ENSG00000169599 to ENSG00000169599 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NFIX | Gene migrated from ENSG00000008441 to ENSG00000008441 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NFIB | Gene migrated from ENSG00000147862 to ENSG00000147862 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NFIA | Gene migrated from ENSG00000162599 to ENSG00000162599 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NFASC | Gene migrated from ENSG00000163531 to ENSG00000163531 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NF1 | Gene migrated from ENSG00000196712 to ENSG00000196712 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NEXMIF | Gene migrated from ENSG00000050030 to ENSG00000050030 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NEUROG1 | Gene migrated from ENSG00000181965 to ENSG00000181965 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NEUROD2 | Gene migrated from ENSG00000171532 to ENSG00000171532 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NEU1 | Gene migrated from ENSG00000204386 to ENSG00000204386 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NEMF | Gene migrated from ENSG00000165525 to ENSG00000165525 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NEDD4L | Gene migrated from ENSG00000049759 to ENSG00000049759 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFV1 | Gene migrated from ENSG00000167792 to ENSG00000167792 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFS8 | Gene migrated from ENSG00000110717 to ENSG00000110717 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFS7 | Gene migrated from ENSG00000115286 to ENSG00000115286 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFS4 | Gene migrated from ENSG00000164258 to ENSG00000164258 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFS1 | Gene migrated from ENSG00000023228 to ENSG00000023228 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFB7 | Gene migrated from ENSG00000099795 to ENSG00000099795 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFAF1 | Gene migrated from ENSG00000137806 to ENSG00000137806 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COXFA4 | Gene symbol changed from NDUFA4 to COXFA4 during gene set migration (ENSG00000189043 -> ENSG00000189043) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFA3 | Gene migrated from ENSG00000170906 to ENSG00000170906 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFA2 | Gene migrated from ENSG00000131495 to ENSG00000131495 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDUFA1 | Gene migrated from ENSG00000125356 to ENSG00000125356 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDST1 | Gene migrated from ENSG00000070614 to ENSG00000070614 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDP | Gene migrated from ENSG00000124479 to ENSG00000124479 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDE1 | Gene migrated from ENSG00000072864 to ENSG00000072864 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NDC1 | Gene migrated from ENSG00000058804 to ENSG00000058804 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NCOR1 | Gene migrated from ENSG00000141027 to ENSG00000141027 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NCKAP1 | Gene migrated from ENSG00000061676 to ENSG00000061676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NCDN | Gene migrated from ENSG00000020129 to ENSG00000020129 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NCAPD2 | Gene migrated from ENSG00000010292 to ENSG00000010292 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NBEA | Gene migrated from ENSG00000172915 to ENSG00000172915 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAV3 | Gene migrated from ENSG00000067798 to ENSG00000067798 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NARS1 | Gene symbol changed from NARS to NARS1 during gene set migration (ENSG00000134440 -> ENSG00000134440) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAPB | Gene migrated from ENSG00000125814 to ENSG00000125814 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NANS | Gene migrated from ENSG00000095380 to ENSG00000095380 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NALCN | Gene migrated from ENSG00000102452 to ENSG00000102452 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAGLU | Gene migrated from ENSG00000108784 to ENSG00000108784 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAGA | Gene migrated from ENSG00000198951 to ENSG00000198951 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAE1 | Gene migrated from ENSG00000159593 to ENSG00000159593 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NACC1 | Gene migrated from ENSG00000160877 to ENSG00000160877 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAA20 | Gene migrated from ENSG00000173418 to ENSG00000173418 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAA15 | Gene migrated from ENSG00000164134 to ENSG00000164134 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | NAA10 | Gene migrated from ENSG00000102030 to ENSG00000102030 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYT1L | Gene migrated from ENSG00000186487 to ENSG00000186487 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYO5A | Gene migrated from ENSG00000197535 to ENSG00000197535 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYH10 | Gene migrated from ENSG00000133026 to ENSG00000133026 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MYCN | Gene migrated from ENSG00000134323 to ENSG00000134323 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MVK | Gene migrated from ENSG00000110921 to ENSG00000110921 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MMUT | Gene symbol changed from MUT to MMUT during gene set migration (ENSG00000146085 -> ENSG00000146085) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-TW | Gene migrated from ENSG00000210117 to ENSG00000210117 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-TV | Gene migrated from ENSG00000210077 to ENSG00000210077 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-TS2 | Gene migrated from ENSG00000210184 to ENSG00000210184 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-TS1 | Gene migrated from ENSG00000210151 to ENSG00000210151 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-TR | Gene migrated from ENSG00000210174 to ENSG00000210174 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-TE | Gene migrated from ENSG00000210194 to ENSG00000210194 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTSS2 | Gene symbol changed from MTSS1L to MTSS2 during gene set migration (ENSG00000132613 -> ENSG00000132613) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTRR | Gene migrated from ENSG00000124275 to ENSG00000124275 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTR | Gene migrated from ENSG00000116984 to ENSG00000116984 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTOR | Gene migrated from ENSG00000198793 to ENSG00000198793 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTO1 | Gene migrated from ENSG00000135297 to ENSG00000135297 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR37 | Gene migrated from ENSG00000047056 to ENSG00000047056 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-ND4 | Gene migrated from ENSG00000198886 to ENSG00000198886 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTHFS | Gene migrated from ENSG00000136371 to ENSG00000136371 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTHFR | Gene migrated from ENSG00000177000 to ENSG00000177000 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTFMT | Gene migrated from ENSG00000103707 to ENSG00000103707 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-CO2 | Gene migrated from ENSG00000198712 to ENSG00000198712 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MT-ATP6 | Gene migrated from ENSG00000198899 to ENSG00000198899 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MSMO1 | Gene migrated from ENSG00000052802 to ENSG00000052802 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MSL3 | Gene migrated from ENSG00000005302 to ENSG00000005302 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MSL2 | Gene migrated from ENSG00000174579 to ENSG00000174579 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MRPS34 | Gene migrated from ENSG00000074071 to ENSG00000074071 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MRPS22 | Gene migrated from ENSG00000175110 to ENSG00000175110 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MRPL49 | Gene migrated from ENSG00000149792 to ENSG00000149792 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MRAS | Gene migrated from ENSG00000158186 to ENSG00000158186 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MPV17 | Gene migrated from ENSG00000115204 to ENSG00000115204 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PALS1 | Gene symbol changed from MPP5 to PALS1 during gene set migration (ENSG00000072415 -> ENSG00000072415) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MPLKIP | Gene migrated from ENSG00000168303 to ENSG00000168303 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MPDZ | Gene migrated from ENSG00000107186 to ENSG00000107186 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MPDU1 | Gene migrated from ENSG00000129255 to ENSG00000129255 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MORC2 | Gene migrated from ENSG00000133422 to ENSG00000133422 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MOGS | Gene migrated from ENSG00000115275 to ENSG00000115275 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MOCS2 | Gene migrated from ENSG00000164172 to ENSG00000164172 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MOCS1 | Gene migrated from ENSG00000124615 to ENSG00000124615 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MN1 | Gene migrated from ENSG00000169184 to ENSG00000169184 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MMADHC | Gene migrated from ENSG00000168288 to ENSG00000168288 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MMACHC | Gene migrated from ENSG00000132763 to ENSG00000132763 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MMAB | Gene migrated from ENSG00000139428 to ENSG00000139428 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MMAA | Gene migrated from ENSG00000151611 to ENSG00000151611 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MLYCD | Gene migrated from ENSG00000103150 to ENSG00000103150 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MLC1 | Gene migrated from ENSG00000100427 to ENSG00000100427 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MKS1 | Gene migrated from ENSG00000011143 to ENSG00000011143 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MKKS | Gene migrated from ENSG00000125863 to ENSG00000125863 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MID1 | Gene migrated from ENSG00000101871 to ENSG00000101871 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MICU1 | Gene migrated from ENSG00000107745 to ENSG00000107745 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MGAT2 | Gene migrated from ENSG00000168282 to ENSG00000168282 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MFSD8 | Gene migrated from ENSG00000164073 to ENSG00000164073 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MFSD2A | Gene migrated from ENSG00000168389 to ENSG00000168389 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MFF | Gene migrated from ENSG00000168958 to ENSG00000168958 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | METTL5 | Gene migrated from ENSG00000138382 to ENSG00000138382 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | METTL23 | Gene migrated from ENSG00000181038 to ENSG00000181038 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MEIS2 | Gene migrated from ENSG00000134138 to ENSG00000134138 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MEGF8 | Gene migrated from ENSG00000105429 to ENSG00000105429 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MEG3 | Gene migrated from ENSG00000214548 to ENSG00000214548 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MEF2C | Gene migrated from ENSG00000081189 to ENSG00000081189 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED27 | Gene migrated from ENSG00000160563 to ENSG00000160563 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED25 | Gene migrated from ENSG00000104973 to ENSG00000104973 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED23 | Gene migrated from ENSG00000112282 to ENSG00000112282 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED17 | Gene migrated from ENSG00000042429 to ENSG00000042429 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED16 | Gene migrated from ENSG00000175221 to ENSG00000175221 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED13L | Gene migrated from ENSG00000123066 to ENSG00000123066 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED13 | Gene migrated from ENSG00000108510 to ENSG00000108510 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED12L | Gene migrated from ENSG00000144893 to ENSG00000144893 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED12 | Gene migrated from ENSG00000184634 to ENSG00000184634 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MED11 | Gene migrated from ENSG00000161920 to ENSG00000161920 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MECP2 | Gene migrated from ENSG00000169057 to ENSG00000169057 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MDH2 | Gene migrated from ENSG00000146701 to ENSG00000146701 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MDGA2 | Gene migrated from ENSG00000139915 to ENSG00000139915 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MCPH1 | Gene migrated from ENSG00000147316 to ENSG00000147316 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MCOLN1 | Gene migrated from ENSG00000090674 to ENSG00000090674 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MCM6 | Gene migrated from ENSG00000076003 to ENSG00000076003 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MCM3AP | Gene migrated from ENSG00000160294 to ENSG00000160294 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MBTPS2 | Gene migrated from ENSG00000012174 to ENSG00000012174 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MBOAT7 | Gene migrated from ENSG00000125505 to ENSG00000125505 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MBD5 | Gene migrated from ENSG00000204406 to ENSG00000204406 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAX | Gene migrated from ENSG00000125952 to ENSG00000125952 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAU2 | Gene migrated from ENSG00000129933 to ENSG00000129933 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAT1A | Gene migrated from ENSG00000151224 to ENSG00000151224 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAST4 | Gene migrated from ENSG00000069020 to ENSG00000069020 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAST3 | Gene migrated from ENSG00000099308 to ENSG00000099308 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAST1 | Gene migrated from ENSG00000105613 to ENSG00000105613 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MASP1 | Gene migrated from ENSG00000127241 to ENSG00000127241 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MARK2 | Gene migrated from ENSG00000072518 to ENSG00000072518 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAPRE2 | Gene migrated from ENSG00000166974 to ENSG00000166974 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAPKAPK5 | Gene migrated from ENSG00000089022 to ENSG00000089022 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAPK8IP3 | Gene migrated from ENSG00000138834 to ENSG00000138834 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAPK1 | Gene migrated from ENSG00000100030 to ENSG00000100030 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAP4K4 | Gene migrated from ENSG00000071054 to ENSG00000071054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAP2K4 | Gene migrated from ENSG00000065559 to ENSG00000065559 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAP2K2 | Gene migrated from ENSG00000126934 to ENSG00000126934 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAP2K1 | Gene migrated from ENSG00000169032 to ENSG00000169032 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAP1B | Gene migrated from ENSG00000131711 to ENSG00000131711 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAOA | Gene migrated from ENSG00000189221 to ENSG00000189221 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MANBA | Gene migrated from ENSG00000109323 to ENSG00000109323 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAN2C1 | Gene migrated from ENSG00000140400 to ENSG00000140400 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAN2B1 | Gene migrated from ENSG00000104774 to ENSG00000104774 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAN1B1 | Gene migrated from ENSG00000177239 to ENSG00000177239 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAGEL2 | Gene migrated from ENSG00000254585 to ENSG00000254585 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAF | Gene migrated from ENSG00000178573 to ENSG00000178573 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAEA | Gene migrated from ENSG00000090316 to ENSG00000090316 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MADD | Gene migrated from ENSG00000110514 to ENSG00000110514 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MACF1 | Gene migrated from ENSG00000127603 to ENSG00000127603 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAB21L2 | Gene migrated from ENSG00000181541 to ENSG00000181541 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MAB21L1 | Gene migrated from ENSG00000180660 to ENSG00000180660 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LZTR1 | Gene migrated from ENSG00000099949 to ENSG00000099949 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LZTFL1 | Gene migrated from ENSG00000163818 to ENSG00000163818 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LYRM7 | Gene migrated from ENSG00000186687 to ENSG00000186687 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LTBP1 | Gene migrated from ENSG00000049323 to ENSG00000049323 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LSS | Gene migrated from ENSG00000160285 to ENSG00000160285 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LSM1 | Gene migrated from ENSG00000175324 to ENSG00000175324 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LRRC7 | Gene migrated from ENSG00000033122 to ENSG00000033122 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LRPPRC | Gene migrated from ENSG00000138095 to ENSG00000138095 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LRP2 | Gene migrated from ENSG00000081479 to ENSG00000081479 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LONP1 | Gene migrated from ENSG00000196365 to ENSG00000196365 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LNPK | Gene migrated from ENSG00000144320 to ENSG00000144320 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LMNB2 | Gene migrated from ENSG00000176619 to ENSG00000176619 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LMNB1 | Gene migrated from ENSG00000113368 to ENSG00000113368 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LMBRD2 | Gene migrated from ENSG00000164187 to ENSG00000164187 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LMBRD1 | Gene migrated from ENSG00000168216 to ENSG00000168216 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LMAN2L | Gene migrated from ENSG00000114988 to ENSG00000114988 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LIPT1 | Gene migrated from ENSG00000144182 to ENSG00000144182 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LINS1 | Gene migrated from ENSG00000140471 to ENSG00000140471 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LINGO4 | Gene migrated from ENSG00000213171 to ENSG00000213171 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHASERR | Gene symbol changed from LINC01578 to CHASERR during gene set migration (ENSG00000272888 -> ENSG00000272888) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GALE | Gene migrated from ENSG00000117308 to ENSG00000117308 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GALC | Gene migrated from ENSG00000054983 to ENSG00000054983 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GAD1 | Gene migrated from ENSG00000128683 to ENSG00000128683 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRG2 | Gene migrated from ENSG00000113327 to ENSG00000113327 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRD | Gene migrated from ENSG00000187730 to ENSG00000187730 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRB3 | Gene migrated from ENSG00000166206 to ENSG00000166206 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRB2 | Gene migrated from ENSG00000145864 to ENSG00000145864 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRA5 | Gene migrated from ENSG00000186297 to ENSG00000186297 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRA4 | Gene migrated from ENSG00000109158 to ENSG00000109158 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRA3 | Gene migrated from ENSG00000011677 to ENSG00000011677 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRA2 | Gene migrated from ENSG00000151834 to ENSG00000151834 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABRA1 | Gene migrated from ENSG00000022355 to ENSG00000022355 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABBR2 | Gene migrated from ENSG00000136928 to ENSG00000136928 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GABBR1 | Gene migrated from ENSG00000204681 to ENSG00000204681 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GALT | Gene migrated from ENSG00000213930 to ENSG00000213930 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FZR1 | Gene migrated from ENSG00000105325 to ENSG00000105325 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FUT8 | Gene migrated from ENSG00000033170 to ENSG00000033170 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP1CB | Gene migrated from ENSG00000213639 to ENSG00000213639 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPM1D | Gene migrated from ENSG00000170836 to ENSG00000170836 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPIL1 | Gene migrated from ENSG00000137168 to ENSG00000137168 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPFIBP1 | Gene migrated from ENSG00000110841 to ENSG00000110841 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPFIA3 | Gene migrated from ENSG00000177380 to ENSG00000177380 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPFIA2 | Gene migrated from ENSG00000139220 to ENSG00000139220 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POU3F3 | Gene migrated from ENSG00000198914 to ENSG00000198914 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POU3F2 | Gene migrated from ENSG00000184486 to ENSG00000184486 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PORCN | Gene migrated from ENSG00000102312 to ENSG00000102312 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POMT2 | Gene migrated from ENSG00000009830 to ENSG00000009830 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POMT1 | Gene migrated from ENSG00000130714 to ENSG00000130714 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POMK | Gene migrated from ENSG00000185900 to ENSG00000185900 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POMGNT2 | Gene migrated from ENSG00000144647 to ENSG00000144647 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POMGNT1 | Gene migrated from ENSG00000085998 to ENSG00000085998 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLRMT | Gene migrated from ENSG00000099821 to ENSG00000099821 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLR3K | Gene migrated from ENSG00000161980 to ENSG00000161980 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLR3B | Gene migrated from ENSG00000013503 to ENSG00000013503 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLR3A | Gene migrated from ENSG00000148606 to ENSG00000148606 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLR2A | Gene migrated from ENSG00000181222 to ENSG00000181222 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLR1C | Gene migrated from ENSG00000171453 to ENSG00000171453 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLR1A | Gene migrated from ENSG00000068654 to ENSG00000068654 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLG | Gene migrated from ENSG00000140521 to ENSG00000140521 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POLA1 | Gene migrated from ENSG00000101868 to ENSG00000101868 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POGZ | Gene migrated from ENSG00000143442 to ENSG00000143442 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | POC1A | Gene migrated from ENSG00000164087 to ENSG00000164087 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PNPT1 | Gene migrated from ENSG00000138035 to ENSG00000138035 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PNPLA8 | Gene migrated from ENSG00000135241 to ENSG00000135241 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PNPLA6 | Gene migrated from ENSG00000032444 to ENSG00000032444 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PNKP | Gene migrated from ENSG00000039650 to ENSG00000039650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PMPCB | Gene migrated from ENSG00000105819 to ENSG00000105819 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PMPCA | Gene migrated from ENSG00000165688 to ENSG00000165688 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PMM2 | Gene migrated from ENSG00000140650 to ENSG00000140650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLXNB2 | Gene migrated from ENSG00000196576 to ENSG00000196576 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLXNA1 | Gene migrated from ENSG00000114554 to ENSG00000114554 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLPBP | Gene migrated from ENSG00000147471 to ENSG00000147471 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLP1 | Gene migrated from ENSG00000123560 to ENSG00000123560 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLK4 | Gene migrated from ENSG00000142731 to ENSG00000142731 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLK1 | Gene migrated from ENSG00000166851 to ENSG00000166851 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLCB1 | Gene migrated from ENSG00000182621 to ENSG00000182621 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLAT | Gene migrated from ENSG00000104368 to ENSG00000104368 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLAA | Gene migrated from ENSG00000137055 to ENSG00000137055 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLA2G6 | Gene migrated from ENSG00000184381 to ENSG00000184381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PLAAT3 | Gene symbol changed from PLA2G16 to PLAAT3 during gene set migration (ENSG00000176485 -> ENSG00000176485) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PITRM1 | Gene migrated from ENSG00000107959 to ENSG00000107959 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PISD | Gene migrated from ENSG00000241878 to ENSG00000241878 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIP5K1C | Gene migrated from ENSG00000186111 to ENSG00000186111 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIK3R2 | Gene migrated from ENSG00000105647 to ENSG00000105647 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIK3CA | Gene migrated from ENSG00000121879 to ENSG00000121879 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIK3C2A | Gene migrated from ENSG00000011405 to ENSG00000011405 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGW | Gene migrated from ENSG00000277161 to ENSG00000277161 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGV | Gene migrated from ENSG00000060642 to ENSG00000060642 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGT | Gene migrated from ENSG00000124155 to ENSG00000124155 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGS | Gene migrated from ENSG00000087111 to ENSG00000087111 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGQ | Gene migrated from ENSG00000007541 to ENSG00000007541 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGP | Gene migrated from ENSG00000185808 to ENSG00000185808 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGO | Gene migrated from ENSG00000165282 to ENSG00000165282 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGN | Gene migrated from ENSG00000197563 to ENSG00000197563 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGL | Gene migrated from ENSG00000108474 to ENSG00000108474 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGK | Gene migrated from ENSG00000142892 to ENSG00000142892 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGH | Gene migrated from ENSG00000100564 to ENSG00000100564 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGG | Gene migrated from ENSG00000174227 to ENSG00000174227 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGC | Gene migrated from ENSG00000135845 to ENSG00000135845 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGB | Gene migrated from ENSG00000069943 to ENSG00000069943 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIGA | Gene migrated from ENSG00000165195 to ENSG00000165195 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIDD1 | Gene migrated from ENSG00000177595 to ENSG00000177595 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PIBF1 | Gene migrated from ENSG00000083535 to ENSG00000083535 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PI4KA | Gene migrated from ENSG00000241973 to ENSG00000241973 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PI4K2A | Gene migrated from ENSG00000155252 to ENSG00000155252 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHIP | Gene migrated from ENSG00000146247 to ENSG00000146247 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHGDH | Gene migrated from ENSG00000092621 to ENSG00000092621 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHF8 | Gene migrated from ENSG00000172943 to ENSG00000172943 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHF6 | Gene migrated from ENSG00000156531 to ENSG00000156531 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHF5A | Gene migrated from ENSG00000100410 to ENSG00000100410 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHF21A | Gene migrated from ENSG00000135365 to ENSG00000135365 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PHACTR1 | Gene migrated from ENSG00000112137 to ENSG00000112137 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PGM3 | Gene migrated from ENSG00000013375 to ENSG00000013375 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PGM2L1 | Gene migrated from ENSG00000165434 to ENSG00000165434 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PGK1 | Gene migrated from ENSG00000102144 to ENSG00000102144 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PGBD5 | Gene migrated from ENSG00000177614 to ENSG00000177614 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PGAP3 | Gene migrated from ENSG00000161395 to ENSG00000161395 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PGAP2 | Gene migrated from ENSG00000148985 to ENSG00000148985 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PGAP1 | Gene migrated from ENSG00000197121 to ENSG00000197121 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX7 | Gene migrated from ENSG00000112357 to ENSG00000112357 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX6 | Gene migrated from ENSG00000124587 to ENSG00000124587 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX5 | Gene migrated from ENSG00000139197 to ENSG00000139197 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX3 | Gene migrated from ENSG00000034693 to ENSG00000034693 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX26 | Gene migrated from ENSG00000215193 to ENSG00000215193 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX2 | Gene migrated from ENSG00000164751 to ENSG00000164751 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX19 | Gene migrated from ENSG00000162735 to ENSG00000162735 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX16 | Gene migrated from ENSG00000121680 to ENSG00000121680 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX14 | Gene migrated from ENSG00000142655 to ENSG00000142655 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX13 | Gene migrated from ENSG00000162928 to ENSG00000162928 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX12 | Gene migrated from ENSG00000108733 to ENSG00000108733 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX11B | Gene migrated from ENSG00000131779 to ENSG00000131779 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX10 | Gene migrated from ENSG00000157911 to ENSG00000157911 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEX1 | Gene migrated from ENSG00000127980 to ENSG00000127980 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PET100 | Gene migrated from ENSG00000229833 to ENSG00000229833 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PEPD | Gene migrated from ENSG00000124299 to ENSG00000124299 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDZD8 | Gene migrated from ENSG00000165650 to ENSG00000165650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDSS1 | Gene migrated from ENSG00000148459 to ENSG00000148459 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDP1 | Gene migrated from ENSG00000164951 to ENSG00000164951 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDHX | Gene migrated from ENSG00000110435 to ENSG00000110435 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDHB | Gene migrated from ENSG00000168291 to ENSG00000168291 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDHA1 | Gene migrated from ENSG00000131828 to ENSG00000131828 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDGFRB | Gene migrated from ENSG00000113721 to ENSG00000113721 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDE6D | Gene migrated from ENSG00000156973 to ENSG00000156973 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDE4D | Gene migrated from ENSG00000113448 to ENSG00000113448 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDE1B | Gene migrated from ENSG00000123360 to ENSG00000123360 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDE10A | Gene migrated from ENSG00000112541 to ENSG00000112541 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PDCD6IP | Gene migrated from ENSG00000170248 to ENSG00000170248 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCYT2 | Gene migrated from ENSG00000185813 to ENSG00000185813 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCLO | Gene migrated from ENSG00000186472 to ENSG00000186472 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCGF2 | Gene migrated from ENSG00000277258 to ENSG00000277258 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCDHGC4 | Gene migrated from ENSG00000242419 to ENSG00000242419 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCDH19 | Gene migrated from ENSG00000165194 to ENSG00000165194 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCDH12 | Gene migrated from ENSG00000113555 to ENSG00000113555 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCCB | Gene migrated from ENSG00000114054 to ENSG00000114054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCCA | Gene migrated from ENSG00000175198 to ENSG00000175198 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCBP2 | Gene migrated from ENSG00000197111 to ENSG00000197111 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PCBP1 | Gene migrated from ENSG00000169564 to ENSG00000169564 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PC | Gene migrated from ENSG00000173599 to ENSG00000173599 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PBX1 | Gene migrated from ENSG00000185630 to ENSG00000185630 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAX8 | Gene migrated from ENSG00000125618 to ENSG00000125618 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAX6 | Gene migrated from ENSG00000007372 to ENSG00000007372 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAX5 | Gene migrated from ENSG00000196092 to ENSG00000196092 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PARP6 | Gene migrated from ENSG00000137817 to ENSG00000137817 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PARN | Gene migrated from ENSG00000140694 to ENSG00000140694 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAN2 | Gene migrated from ENSG00000135473 to ENSG00000135473 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAM16 | Gene migrated from ENSG00000217930 to ENSG00000217930 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAK3 | Gene migrated from ENSG00000077264 to ENSG00000077264 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAK2 | Gene migrated from ENSG00000180370 to ENSG00000180370 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAK1 | Gene migrated from ENSG00000149269 to ENSG00000149269 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAH | Gene migrated from ENSG00000171759 to ENSG00000171759 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PAFAH1B1 | Gene migrated from ENSG00000007168 to ENSG00000007168 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PACS2 | Gene migrated from ENSG00000179364 to ENSG00000179364 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PACS1 | Gene migrated from ENSG00000175115 to ENSG00000175115 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PABPC1 | Gene migrated from ENSG00000070756 to ENSG00000070756 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | P4HTM | Gene migrated from ENSG00000178467 to ENSG00000178467 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OXR1 | Gene migrated from ENSG00000164830 to ENSG00000164830 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OTX2 | Gene migrated from ENSG00000165588 to ENSG00000165588 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OTUD7A | Gene migrated from ENSG00000169918 to ENSG00000169918 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OTUD6B | Gene migrated from ENSG00000155100 to ENSG00000155100 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OTUD5 | Gene migrated from ENSG00000068308 to ENSG00000068308 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OTC | Gene migrated from ENSG00000036473 to ENSG00000036473 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OSGEP | Gene migrated from ENSG00000092094 to ENSG00000092094 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | OPHN1 | Gene migrated from ENSG00000079482 to ENSG00000079482 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | PPP1R12A | Gene migrated from ENSG00000058272 to ENSG00000058272 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IBA57 | Gene migrated from ENSG00000181873 to ENSG00000181873 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IARS1 | Gene symbol changed from IARS to IARS1 during gene set migration (ENSG00000196305 -> ENSG00000196305) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HUWE1 | Gene migrated from ENSG00000086758 to ENSG00000086758 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HTRA2 | Gene migrated from ENSG00000115317 to ENSG00000115317 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HSPG2 | Gene migrated from ENSG00000142798 to ENSG00000142798 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HSPD1 | Gene migrated from ENSG00000144381 to ENSG00000144381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HSD17B4 | Gene migrated from ENSG00000133835 to ENSG00000133835 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HSD17B10 | Gene migrated from ENSG00000072506 to ENSG00000072506 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HS6ST2 | Gene migrated from ENSG00000171004 to ENSG00000171004 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HS2ST1 | Gene migrated from ENSG00000153936 to ENSG00000153936 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HRAS | Gene migrated from ENSG00000174775 to ENSG00000174775 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HPRT1 | Gene migrated from ENSG00000165704 to ENSG00000165704 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HPDL | Gene migrated from ENSG00000186603 to ENSG00000186603 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HPD | Gene migrated from ENSG00000158104 to ENSG00000158104 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HOXA1 | Gene migrated from ENSG00000105991 to ENSG00000105991 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HNRNPU | Gene migrated from ENSG00000153187 to ENSG00000153187 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HNRNPR | Gene migrated from ENSG00000125944 to ENSG00000125944 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HNRNPK | Gene migrated from ENSG00000165119 to ENSG00000165119 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HNRNPH2 | Gene migrated from ENSG00000126945 to ENSG00000126945 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HNRNPH1 | Gene migrated from ENSG00000169045 to ENSG00000169045 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HNRNPD | Gene migrated from ENSG00000138668 to ENSG00000138668 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HNRNPC | Gene migrated from ENSG00000092199 to ENSG00000092199 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HNMT | Gene migrated from ENSG00000150540 to ENSG00000150540 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HMGCL | Gene migrated from ENSG00000117305 to ENSG00000117305 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HMGB1 | Gene migrated from ENSG00000189403 to ENSG00000189403 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HMBS | Gene migrated from ENSG00000256269 to ENSG00000256269 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HLCS | Gene migrated from ENSG00000159267 to ENSG00000159267 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HK1 | Gene migrated from ENSG00000156515 to ENSG00000156515 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HIVEP2 | Gene migrated from ENSG00000010818 to ENSG00000010818 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H4C9 | Gene symbol changed from HIST1H4I to H4C9 during gene set migration (ENSG00000276180 -> ENSG00000276180) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H4C5 | Gene symbol changed from HIST1H4E to H4C5 during gene set migration (ENSG00000276966 -> ENSG00000276966) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H4C3 | Gene symbol changed from HIST1H4C to H4C3 during gene set migration (ENSG00000197061 -> ENSG00000197061) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H1-4 | Gene symbol changed from HIST1H1E to H1-4 during gene set migration (ENSG00000168298 -> ENSG00000168298) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HIRA | Gene migrated from ENSG00000100084 to ENSG00000100084 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HIKESHI | Gene migrated from ENSG00000149196 to ENSG00000149196 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HID1 | Gene migrated from ENSG00000167861 to ENSG00000167861 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HIBCH | Gene migrated from ENSG00000198130 to ENSG00000198130 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HGSNAT | Gene migrated from ENSG00000165102 to ENSG00000165102 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HEXB | Gene migrated from ENSG00000049860 to ENSG00000049860 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HEXA | Gene migrated from ENSG00000213614 to ENSG00000213614 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HESX1 | Gene migrated from ENSG00000163666 to ENSG00000163666 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HERC2 | Gene migrated from ENSG00000128731 to ENSG00000128731 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HERC1 | Gene migrated from ENSG00000103657 to ENSG00000103657 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HEPACAM | Gene migrated from ENSG00000165478 to ENSG00000165478 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HECW2 | Gene migrated from ENSG00000138411 to ENSG00000138411 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HECTD4 | Gene migrated from ENSG00000173064 to ENSG00000173064 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HECTD1 | Gene migrated from ENSG00000092148 to ENSG00000092148 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HDAC8 | Gene migrated from ENSG00000147099 to ENSG00000147099 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HDAC3 | Gene migrated from ENSG00000171720 to ENSG00000171720 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HCN2 | Gene migrated from ENSG00000099822 to ENSG00000099822 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HCN1 | Gene migrated from ENSG00000164588 to ENSG00000164588 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HCFC1 | Gene migrated from ENSG00000172534 to ENSG00000172534 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HCCS | Gene migrated from ENSG00000004961 to ENSG00000004961 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HDAC4 | Gene migrated from ENSG00000068024 to ENSG00000068024 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HADHB | Gene migrated from ENSG00000138029 to ENSG00000138029 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HADHA | Gene migrated from ENSG00000084754 to ENSG00000084754 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HACE1 | Gene migrated from ENSG00000085382 to ENSG00000085382 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H3-3B | Gene symbol changed from H3F3B to H3-3B during gene set migration (ENSG00000132475 -> ENSG00000132475) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | H3-3A | Gene symbol changed from H3F3A to H3-3A during gene set migration (ENSG00000163041 -> ENSG00000163041) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GUSB | Gene migrated from ENSG00000169919 to ENSG00000169919 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTPBP3 | Gene migrated from ENSG00000130299 to ENSG00000130299 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTPBP2 | Gene migrated from ENSG00000172432 to ENSG00000172432 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTPBP1 | Gene migrated from ENSG00000100226 to ENSG00000100226 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTF3C5 | Gene migrated from ENSG00000148308 to ENSG00000148308 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTF3C3 | Gene migrated from ENSG00000119041 to ENSG00000119041 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTF2H5 | Gene migrated from ENSG00000272047 to ENSG00000272047 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTF2E2 | Gene migrated from ENSG00000197265 to ENSG00000197265 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GSX2 | Gene migrated from ENSG00000180613 to ENSG00000180613 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GSS | Gene migrated from ENSG00000100983 to ENSG00000100983 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GSPT2 | Gene migrated from ENSG00000189369 to ENSG00000189369 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRM7 | Gene migrated from ENSG00000196277 to ENSG00000196277 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRM1 | Gene migrated from ENSG00000152822 to ENSG00000152822 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIN2D | Gene migrated from ENSG00000105464 to ENSG00000105464 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIN2B | Gene migrated from ENSG00000273079 to ENSG00000273079 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIN2A | Gene migrated from ENSG00000183454 to ENSG00000183454 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIN1 | Gene migrated from ENSG00000176884 to ENSG00000176884 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIK2 | Gene migrated from ENSG00000164418 to ENSG00000164418 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRID2 | Gene migrated from ENSG00000152208 to ENSG00000152208 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIA4 | Gene migrated from ENSG00000152578 to ENSG00000152578 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIA3 | Gene migrated from ENSG00000125675 to ENSG00000125675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIA2 | Gene migrated from ENSG00000120251 to ENSG00000120251 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GRIA1 | Gene migrated from ENSG00000155511 to ENSG00000155511 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPT2 | Gene migrated from ENSG00000166123 to ENSG00000166123 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPRC5B | Gene migrated from ENSG00000167191 to ENSG00000167191 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPHN | Gene migrated from ENSG00000171723 to ENSG00000171723 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPC4 | Gene migrated from ENSG00000076716 to ENSG00000076716 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPC3 | Gene migrated from ENSG00000147257 to ENSG00000147257 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPATCH11 | Gene migrated from ENSG00000152133 to ENSG00000152133 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GPAA1 | Gene migrated from ENSG00000197858 to ENSG00000197858 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GOT2 | Gene migrated from ENSG00000125166 to ENSG00000125166 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GON4L | Gene migrated from ENSG00000116580 to ENSG00000116580 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GOLGA2 | Gene migrated from ENSG00000167110 to ENSG00000167110 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNS | Gene migrated from ENSG00000135677 to ENSG00000135677 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNPTG | Gene migrated from ENSG00000090581 to ENSG00000090581 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNPTAB | Gene migrated from ENSG00000111670 to ENSG00000111670 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNPAT | Gene migrated from ENSG00000116906 to ENSG00000116906 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNE | Gene migrated from ENSG00000159921 to ENSG00000159921 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNB5 | Gene migrated from ENSG00000069966 to ENSG00000069966 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNB2 | Gene migrated from ENSG00000172354 to ENSG00000172354 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNB1 | Gene migrated from ENSG00000078369 to ENSG00000078369 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNAS | Gene migrated from ENSG00000087460 to ENSG00000087460 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNAO1 | Gene migrated from ENSG00000087258 to ENSG00000087258 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNAI2 | Gene migrated from ENSG00000114353 to ENSG00000114353 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GNAI1 | Gene migrated from ENSG00000127955 to ENSG00000127955 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GMPPB | Gene migrated from ENSG00000173540 to ENSG00000173540 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GMPPA | Gene migrated from ENSG00000144591 to ENSG00000144591 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GM2A | Gene migrated from ENSG00000196743 to ENSG00000196743 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLUL | Gene migrated from ENSG00000135821 to ENSG00000135821 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLS | Gene migrated from ENSG00000115419 to ENSG00000115419 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLRA2 | Gene migrated from ENSG00000101958 to ENSG00000101958 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLIS3 | Gene migrated from ENSG00000107249 to ENSG00000107249 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLI3 | Gene migrated from ENSG00000106571 to ENSG00000106571 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLI2 | Gene migrated from ENSG00000074047 to ENSG00000074047 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLDC | Gene migrated from ENSG00000178445 to ENSG00000178445 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GLB1 | Gene migrated from ENSG00000170266 to ENSG00000170266 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GK | Gene migrated from ENSG00000198814 to ENSG00000198814 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GJC2 | Gene migrated from ENSG00000198835 to ENSG00000198835 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GIGYF1 | Gene migrated from ENSG00000146830 to ENSG00000146830 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GFM2 | Gene migrated from ENSG00000164347 to ENSG00000164347 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GFM1 | Gene migrated from ENSG00000168827 to ENSG00000168827 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GFER | Gene migrated from ENSG00000127554 to ENSG00000127554 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GFAP | Gene migrated from ENSG00000131095 to ENSG00000131095 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GEMIN5 | Gene migrated from ENSG00000082516 to ENSG00000082516 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GEMIN4 | Gene migrated from ENSG00000179409 to ENSG00000179409 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GDI1 | Gene migrated from ENSG00000203879 to ENSG00000203879 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GCSH | Gene migrated from ENSG00000140905 to ENSG00000140905 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GCH1 | Gene migrated from ENSG00000131979 to ENSG00000131979 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GCDH | Gene migrated from ENSG00000105607 to ENSG00000105607 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GATM | Gene migrated from ENSG00000171766 to ENSG00000171766 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GATAD2B | Gene migrated from ENSG00000143614 to ENSG00000143614 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GATAD2A | Gene migrated from ENSG00000167491 to ENSG00000167491 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GATA6 | Gene migrated from ENSG00000141448 to ENSG00000141448 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GAMT | Gene migrated from ENSG00000130005 to ENSG00000130005 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GALNT2 | Gene migrated from ENSG00000143641 to ENSG00000143641 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FRAS1 | Gene migrated from ENSG00000138759 to ENSG00000138759 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FRA10AC1 | Gene migrated from ENSG00000148690 to ENSG00000148690 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FOXRED1 | Gene migrated from ENSG00000110074 to ENSG00000110074 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FOXP4 | Gene migrated from ENSG00000137166 to ENSG00000137166 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FOXP2 | Gene migrated from ENSG00000128573 to ENSG00000128573 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FOXP1 | Gene migrated from ENSG00000114861 to ENSG00000114861 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FOXG1 | Gene migrated from ENSG00000176165 to ENSG00000176165 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FOSL2 | Gene migrated from ENSG00000075426 to ENSG00000075426 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FOLR1 | Gene migrated from ENSG00000110195 to ENSG00000110195 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FMR1 | Gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FMN2 | Gene migrated from ENSG00000155816 to ENSG00000155816 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FLVCR2 | Gene migrated from ENSG00000119686 to ENSG00000119686 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FLVCR1 | Gene migrated from ENSG00000162769 to ENSG00000162769 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FLNA | Gene migrated from ENSG00000196924 to ENSG00000196924 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FKTN | Gene migrated from ENSG00000106692 to ENSG00000106692 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FKRP | Gene migrated from ENSG00000181027 to ENSG00000181027 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FITM2 | Gene migrated from ENSG00000197296 to ENSG00000197296 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FIG4 | Gene migrated from ENSG00000112367 to ENSG00000112367 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FIBP | Gene migrated from ENSG00000172500 to ENSG00000172500 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FH | Gene migrated from ENSG00000091483 to ENSG00000091483 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FGFR3 | Gene migrated from ENSG00000068078 to ENSG00000068078 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FGFR1 | Gene migrated from ENSG00000077782 to ENSG00000077782 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FGF14 | Gene migrated from ENSG00000102466 to ENSG00000102466 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FGF13 | Gene migrated from ENSG00000129682 to ENSG00000129682 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FGF12 | Gene migrated from ENSG00000114279 to ENSG00000114279 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FGD1 | Gene migrated from ENSG00000102302 to ENSG00000102302 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FEZF2 | Gene migrated from ENSG00000153266 to ENSG00000153266 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FEM1B | Gene migrated from ENSG00000169018 to ENSG00000169018 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FDXR | Gene migrated from ENSG00000161513 to ENSG00000161513 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FDFT1 | Gene migrated from ENSG00000079459 to ENSG00000079459 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBXW7 | Gene migrated from ENSG00000109670 to ENSG00000109670 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBXW11 | Gene migrated from ENSG00000072803 to ENSG00000072803 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBXO31 | Gene migrated from ENSG00000103264 to ENSG00000103264 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBXO28 | Gene migrated from ENSG00000143756 to ENSG00000143756 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBXO22 | Gene migrated from ENSG00000167196 to ENSG00000167196 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBXO11 | Gene migrated from ENSG00000138081 to ENSG00000138081 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBXL4 | Gene migrated from ENSG00000112234 to ENSG00000112234 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBXL3 | Gene migrated from ENSG00000005812 to ENSG00000005812 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FBRSL1 | Gene migrated from ENSG00000112787 to ENSG00000112787 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FAT4 | Gene migrated from ENSG00000196159 to ENSG00000196159 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FASTKD5 | Gene migrated from ENSG00000215251 to ENSG00000215251 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FASTKD2 | Gene migrated from ENSG00000118246 to ENSG00000118246 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FARSB | Gene migrated from ENSG00000116120 to ENSG00000116120 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FARSA | Gene migrated from ENSG00000179115 to ENSG00000179115 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FARS2 | Gene migrated from ENSG00000145982 to ENSG00000145982 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FAR1 | Gene migrated from ENSG00000197601 to ENSG00000197601 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FAM50A | Gene migrated from ENSG00000071859 to ENSG00000071859 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FAM20C | Gene migrated from ENSG00000177706 to ENSG00000177706 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FAM177A1 | Gene migrated from ENSG00000151327 to ENSG00000151327 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FAM149B1 | Gene migrated from ENSG00000138286 to ENSG00000138286 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | HYCC1 | Gene symbol changed from FAM126A to HYCC1 during gene set migration (ENSG00000122591 -> ENSG00000122591) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EZH2 | Gene migrated from ENSG00000106462 to ENSG00000106462 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EZH1 | Gene migrated from ENSG00000108799 to ENSG00000108799 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXTL3 | Gene migrated from ENSG00000012232 to ENSG00000012232 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXT2 | Gene migrated from ENSG00000151348 to ENSG00000151348 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXOSC8 | Gene migrated from ENSG00000120699 to ENSG00000120699 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXOSC3 | Gene migrated from ENSG00000107371 to ENSG00000107371 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXOC8 | Gene migrated from ENSG00000116903 to ENSG00000116903 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EXOC7 | Gene migrated from ENSG00000182473 to ENSG00000182473 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ETHE1 | Gene migrated from ENSG00000105755 to ENSG00000105755 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ETFDH | Gene migrated from ENSG00000171503 to ENSG00000171503 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ETFB | Gene migrated from ENSG00000105379 to ENSG00000105379 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ETFA | Gene migrated from ENSG00000140374 to ENSG00000140374 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ESRRG | Gene migrated from ENSG00000196482 to ENSG00000196482 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ESCO2 | Gene migrated from ENSG00000171320 to ENSG00000171320 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ESAM | Gene migrated from ENSG00000149564 to ENSG00000149564 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERLIN2 | Gene migrated from ENSG00000147475 to ENSG00000147475 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERI1 | Gene migrated from ENSG00000104626 to ENSG00000104626 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERF | Gene migrated from ENSG00000105722 to ENSG00000105722 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERCC8 | Gene migrated from ENSG00000049167 to ENSG00000049167 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERCC6L2 | Gene migrated from ENSG00000182150 to ENSG00000182150 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERCC6 | Gene migrated from ENSG00000225830 to ENSG00000225830 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERCC5 | Gene migrated from ENSG00000134899 to ENSG00000134899 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERCC3 | Gene migrated from ENSG00000163161 to ENSG00000163161 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERCC2 | Gene migrated from ENSG00000104884 to ENSG00000104884 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ERCC1 | Gene migrated from ENSG00000012061 to ENSG00000012061 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EPRS1 | Gene symbol changed from EPRS to EPRS1 during gene set migration (ENSG00000136628 -> ENSG00000136628) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EPG5 | Gene migrated from ENSG00000152223 to ENSG00000152223 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EPB41L3 | Gene migrated from ENSG00000082397 to ENSG00000082397 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EP400 | Gene migrated from ENSG00000183495 to ENSG00000183495 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EP300 | Gene migrated from ENSG00000100393 to ENSG00000100393 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ENTPD1 | Gene migrated from ENSG00000138185 to ENSG00000138185 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EMC10 | Gene migrated from ENSG00000161671 to ENSG00000161671 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EML1 | Gene migrated from ENSG00000066629 to ENSG00000066629 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EMC1 | Gene migrated from ENSG00000127463 to ENSG00000127463 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ELP2 | Gene migrated from ENSG00000134759 to ENSG00000134759 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ELOVL4 | Gene migrated from ENSG00000118402 to ENSG00000118402 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ELAC2 | Gene migrated from ENSG00000006744 to ENSG00000006744 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIPR1 | Gene migrated from ENSG00000032389 to ENSG00000032389 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF5A | Gene migrated from ENSG00000132507 to ENSG00000132507 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF4A3 | Gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF4A2 | Gene migrated from ENSG00000156976 to ENSG00000156976 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF3F | Gene migrated from ENSG00000175390 to ENSG00000175390 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF3B | Gene migrated from ENSG00000106263 to ENSG00000106263 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF3A | Gene migrated from ENSG00000107581 to ENSG00000107581 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2S3 | Gene migrated from ENSG00000130741 to ENSG00000130741 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2AK3 | Gene migrated from ENSG00000172071 to ENSG00000172071 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EIF2AK2 | Gene migrated from ENSG00000055332 to ENSG00000055332 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EHMT1 | Gene migrated from ENSG00000181090 to ENSG00000181090 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EFTUD2 | Gene migrated from ENSG00000108883 to ENSG00000108883 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EEFSEC | Gene migrated from ENSG00000132394 to ENSG00000132394 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EEF2 | Gene migrated from ENSG00000167658 to ENSG00000167658 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EEF1D | Gene migrated from ENSG00000104529 to ENSG00000104529 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EEF1B2 | Gene migrated from ENSG00000114942 to ENSG00000114942 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EEF1A2 | Gene migrated from ENSG00000101210 to ENSG00000101210 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EED | Gene migrated from ENSG00000074266 to ENSG00000074266 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EDEM3 | Gene migrated from ENSG00000116406 to ENSG00000116406 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EBP | Gene migrated from ENSG00000147155 to ENSG00000147155 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EBF3 | Gene migrated from ENSG00000108001 to ENSG00000108001 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | EARS2 | Gene migrated from ENSG00000103356 to ENSG00000103356 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DYRK1A | Gene migrated from ENSG00000157540 to ENSG00000157540 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DYNC1I2 | Gene migrated from ENSG00000077380 to ENSG00000077380 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DYNC1H1 | Gene migrated from ENSG00000197102 to ENSG00000197102 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DYM | Gene migrated from ENSG00000141627 to ENSG00000141627 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DTYMK | Gene migrated from ENSG00000168393 to ENSG00000168393 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DRG1 | Gene migrated from ENSG00000185721 to ENSG00000185721 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DRD1 | Gene migrated from ENSG00000184845 to ENSG00000184845 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPYSL5 | Gene migrated from ENSG00000157851 to ENSG00000157851 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPYS | Gene migrated from ENSG00000147647 to ENSG00000147647 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPM2 | Gene migrated from ENSG00000136908 to ENSG00000136908 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPM1 | Gene migrated from ENSG00000000419 to ENSG00000000419 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPH5 | Gene migrated from ENSG00000117543 to ENSG00000117543 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPH2 | Gene migrated from ENSG00000132768 to ENSG00000132768 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPH1 | Gene migrated from ENSG00000108963 to ENSG00000108963 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPF2 | Gene migrated from ENSG00000133884 to ENSG00000133884 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DPAGT1 | Gene migrated from ENSG00000172269 to ENSG00000172269 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOT1L | Gene migrated from ENSG00000104885 to ENSG00000104885 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOLK | Gene migrated from ENSG00000175283 to ENSG00000175283 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOHH | Gene migrated from ENSG00000129932 to ENSG00000129932 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOCK7 | Gene migrated from ENSG00000116641 to ENSG00000116641 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOCK6 | Gene migrated from ENSG00000130158 to ENSG00000130158 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOCK4 | Gene migrated from ENSG00000128512 to ENSG00000128512 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DOCK3 | Gene migrated from ENSG00000088538 to ENSG00000088538 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNMT3B | Gene migrated from ENSG00000088305 to ENSG00000088305 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNMT3A | Gene migrated from ENSG00000119772 to ENSG00000119772 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNM1L | Gene migrated from ENSG00000087470 to ENSG00000087470 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNAJC19 | Gene migrated from ENSG00000205981 to ENSG00000205981 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNAJC12 | Gene migrated from ENSG00000108176 to ENSG00000108176 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DNM1 | Gene migrated from ENSG00000106976 to ENSG00000106976 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DMXL2 | Gene migrated from ENSG00000104093 to ENSG00000104093 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DMD | Gene migrated from ENSG00000198947 to ENSG00000198947 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DMAP1 | Gene migrated from ENSG00000178028 to ENSG00000178028 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DLL1 | Gene migrated from ENSG00000198719 to ENSG00000198719 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DLG4 | Gene migrated from ENSG00000132535 to ENSG00000132535 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DLG3 | Gene migrated from ENSG00000082458 to ENSG00000082458 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DLD | Gene migrated from ENSG00000091140 to ENSG00000091140 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DLAT | Gene migrated from ENSG00000150768 to ENSG00000150768 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DKC1 | Gene migrated from ENSG00000130826 to ENSG00000130826 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DISP1 | Gene migrated from ENSG00000154309 to ENSG00000154309 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DIS3L2 | Gene migrated from ENSG00000144535 to ENSG00000144535 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DIP2C | Gene migrated from ENSG00000151240 to ENSG00000151240 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DIAPH1 | Gene migrated from ENSG00000131504 to ENSG00000131504 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHX9 | Gene migrated from ENSG00000135829 to ENSG00000135829 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHX37 | Gene migrated from ENSG00000150990 to ENSG00000150990 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHX30 | Gene migrated from ENSG00000132153 to ENSG00000132153 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHRSX | Gene migrated from ENSG00000169084 to ENSG00000169084 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHPS | Gene migrated from ENSG00000095059 to ENSG00000095059 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHFR | Gene migrated from ENSG00000228716 to ENSG00000228716 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHDDS | Gene migrated from ENSG00000117682 to ENSG00000117682 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHCR7 | Gene migrated from ENSG00000172893 to ENSG00000172893 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DHCR24 | Gene migrated from ENSG00000116133 to ENSG00000116133 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DEPDC5 | Gene migrated from ENSG00000100150 to ENSG00000100150 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DENND5B | Gene migrated from ENSG00000170456 to ENSG00000170456 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DENND5A | Gene migrated from ENSG00000184014 to ENSG00000184014 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DEGS1 | Gene migrated from ENSG00000143753 to ENSG00000143753 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DEAF1 | Gene migrated from ENSG00000177030 to ENSG00000177030 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDX6 | Gene migrated from ENSG00000110367 to ENSG00000110367 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDX59 | Gene migrated from ENSG00000118197 to ENSG00000118197 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDX3X | Gene migrated from ENSG00000215301 to ENSG00000215301 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDX39B | Gene migrated from ENSG00000198563 to ENSG00000198563 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDX23 | Gene migrated from ENSG00000174243 to ENSG00000174243 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDX17 | Gene migrated from ENSG00000100201 to ENSG00000100201 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDX11 | Gene migrated from ENSG00000013573 to ENSG00000013573 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDOST | Gene migrated from ENSG00000244038 to ENSG00000244038 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDHD2 | Gene migrated from ENSG00000085788 to ENSG00000085788 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDC | Gene migrated from ENSG00000132437 to ENSG00000132437 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DDB1 | Gene migrated from ENSG00000167986 to ENSG00000167986 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DCX | Gene migrated from ENSG00000077279 to ENSG00000077279 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DCPS | Gene migrated from ENSG00000110063 to ENSG00000110063 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DCHS1 | Gene migrated from ENSG00000166341 to ENSG00000166341 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DCAF17 | Gene migrated from ENSG00000115827 to ENSG00000115827 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DBT | Gene migrated from ENSG00000137992 to ENSG00000137992 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DARS2 | Gene migrated from ENSG00000117593 to ENSG00000117593 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DARS1 | Gene symbol changed from DARS to DARS1 during gene set migration (ENSG00000115866 -> ENSG00000115866) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DAGLA | Gene migrated from ENSG00000134780 to ENSG00000134780 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DAG1 | Gene migrated from ENSG00000173402 to ENSG00000173402 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | D2HGDH | Gene migrated from ENSG00000180902 to ENSG00000180902 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZFTRAF1 | Gene symbol changed from CYHR1 to ZFTRAF1 during gene set migration (ENSG00000187954 -> ENSG00000187954) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CYFIP2 | Gene migrated from ENSG00000055163 to ENSG00000055163 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CYB5R3 | Gene migrated from ENSG00000100243 to ENSG00000100243 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STEEP1 | Gene symbol changed from CXorf56 to STEEP1 during gene set migration (ENSG00000018610 -> ENSG00000018610) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CWF19L1 | Gene migrated from ENSG00000095485 to ENSG00000095485 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CWC27 | Gene migrated from ENSG00000153015 to ENSG00000153015 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CUX2 | Gene migrated from ENSG00000111249 to ENSG00000111249 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CUX1 | Gene migrated from ENSG00000257923 to ENSG00000257923 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CUL4B | Gene migrated from ENSG00000158290 to ENSG00000158290 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CUL3 | Gene migrated from ENSG00000036257 to ENSG00000036257 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CUL1 | Gene migrated from ENSG00000055130 to ENSG00000055130 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTU2 | Gene migrated from ENSG00000174177 to ENSG00000174177 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTSD | Gene migrated from ENSG00000117984 to ENSG00000117984 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTSA | Gene migrated from ENSG00000064601 to ENSG00000064601 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTR9 | Gene migrated from ENSG00000198730 to ENSG00000198730 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTNND2 | Gene migrated from ENSG00000169862 to ENSG00000169862 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTNNB1 | Gene migrated from ENSG00000168036 to ENSG00000168036 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTNNA2 | Gene migrated from ENSG00000066032 to ENSG00000066032 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTDP1 | Gene migrated from ENSG00000060069 to ENSG00000060069 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTCF | Gene migrated from ENSG00000102974 to ENSG00000102974 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CTBP1 | Gene migrated from ENSG00000159692 to ENSG00000159692 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSPP1 | Gene migrated from ENSG00000104218 to ENSG00000104218 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSNK2B | Gene migrated from ENSG00000204435 to ENSG00000204435 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSNK2A1 | Gene migrated from ENSG00000101266 to ENSG00000101266 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSMD1 | Gene migrated from ENSG00000183117 to ENSG00000183117 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CSDE1 | Gene migrated from ENSG00000009307 to ENSG00000009307 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRNKL1 | Gene migrated from ENSG00000101343 to ENSG00000101343 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRMP1 | Gene migrated from ENSG00000072832 to ENSG00000072832 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRLS1 | Gene migrated from ENSG00000088766 to ENSG00000088766 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRIPT | Gene migrated from ENSG00000119878 to ENSG00000119878 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRELD1 | Gene migrated from ENSG00000163703 to ENSG00000163703 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CREBBP | Gene migrated from ENSG00000005339 to ENSG00000005339 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRB2 | Gene migrated from ENSG00000148204 to ENSG00000148204 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRADD | Gene migrated from ENSG00000169372 to ENSG00000169372 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CPSF3 | Gene migrated from ENSG00000119203 to ENSG00000119203 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CPS1 | Gene migrated from ENSG00000021826 to ENSG00000021826 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CPE | Gene migrated from ENSG00000109472 to ENSG00000109472 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX4I1 | Gene migrated from ENSG00000131143 to ENSG00000131143 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX11 | Gene migrated from ENSG00000166260 to ENSG00000166260 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX10 | Gene migrated from ENSG00000006695 to ENSG00000006695 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COQ8A | Gene migrated from ENSG00000163050 to ENSG00000163050 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COQ5 | Gene migrated from ENSG00000110871 to ENSG00000110871 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COQ4 | Gene migrated from ENSG00000167113 to ENSG00000167113 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COPB2 | Gene migrated from ENSG00000184432 to ENSG00000184432 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COPB1 | Gene migrated from ENSG00000129083 to ENSG00000129083 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COLEC11 | Gene migrated from ENSG00000118004 to ENSG00000118004 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COX15 | Gene migrated from ENSG00000014919 to ENSG00000014919 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CERT1 | Gene symbol changed from COL4A3BP to CERT1 during gene set migration (ENSG00000113163 -> ENSG00000113163) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COL4A2 | Gene migrated from ENSG00000134871 to ENSG00000134871 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COL4A1 | Gene migrated from ENSG00000187498 to ENSG00000187498 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COG8 | Gene migrated from ENSG00000213380 to ENSG00000213380 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COG7 | Gene migrated from ENSG00000168434 to ENSG00000168434 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COG6 | Gene migrated from ENSG00000133103 to ENSG00000133103 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COG5 | Gene migrated from ENSG00000164597 to ENSG00000164597 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COG4 | Gene migrated from ENSG00000103051 to ENSG00000103051 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COG1 | Gene migrated from ENSG00000166685 to ENSG00000166685 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COASY | Gene migrated from ENSG00000068120 to ENSG00000068120 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNTNAP2 | Gene migrated from ENSG00000174469 to ENSG00000174469 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNTNAP1 | Gene migrated from ENSG00000108797 to ENSG00000108797 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNPY3 | Gene migrated from ENSG00000137161 to ENSG00000137161 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNP | Gene migrated from ENSG00000173786 to ENSG00000173786 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNOT9 | Gene migrated from ENSG00000144580 to ENSG00000144580 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNOT3 | Gene migrated from ENSG00000088038 to ENSG00000088038 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNOT2 | Gene migrated from ENSG00000111596 to ENSG00000111596 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNOT1 | Gene migrated from ENSG00000125107 to ENSG00000125107 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNNM2 | Gene migrated from ENSG00000148842 to ENSG00000148842 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CNKSR2 | Gene migrated from ENSG00000149970 to ENSG00000149970 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLTC | Gene migrated from ENSG00000141367 to ENSG00000141367 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLPB | Gene migrated from ENSG00000162129 to ENSG00000162129 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLP1 | Gene migrated from ENSG00000172409 to ENSG00000172409 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLN8 | Gene migrated from ENSG00000182372 to ENSG00000182372 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLN6 | Gene migrated from ENSG00000128973 to ENSG00000128973 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLN5 | Gene migrated from ENSG00000102805 to ENSG00000102805 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLN3 | Gene migrated from ENSG00000188603 to ENSG00000188603 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLDN5 | Gene migrated from ENSG00000184113 to ENSG00000184113 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLCNKB | Gene migrated from ENSG00000184908 to ENSG00000184908 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLCN6 | Gene migrated from ENSG00000011021 to ENSG00000011021 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLCN4 | Gene migrated from ENSG00000073464 to ENSG00000073464 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CLCN3 | Gene migrated from ENSG00000109572 to ENSG00000109572 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CKAP2L | Gene migrated from ENSG00000169607 to ENSG00000169607 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CIT | Gene migrated from ENSG00000122966 to ENSG00000122966 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CIC | Gene migrated from ENSG00000079432 to ENSG00000079432 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHTF18 | Gene migrated from ENSG00000127586 to ENSG00000127586 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHMP1A | Gene migrated from ENSG00000131165 to ENSG00000131165 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHKB | Gene migrated from ENSG00000100288 to ENSG00000100288 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHKA | Gene migrated from ENSG00000110721 to ENSG00000110721 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHD8 | Gene migrated from ENSG00000100888 to ENSG00000100888 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHD7 | Gene migrated from ENSG00000171316 to ENSG00000171316 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHD5 | Gene migrated from ENSG00000116254 to ENSG00000116254 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHD4 | Gene migrated from ENSG00000111642 to ENSG00000111642 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHD3 | Gene migrated from ENSG00000170004 to ENSG00000170004 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHD2 | Gene migrated from ENSG00000173575 to ENSG00000173575 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHD1 | Gene migrated from ENSG00000153922 to ENSG00000153922 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CHAMP1 | Gene migrated from ENSG00000198824 to ENSG00000198824 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP85L | Gene migrated from ENSG00000111860 to ENSG00000111860 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP83 | Gene migrated from ENSG00000173588 to ENSG00000173588 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP76 | Gene migrated from ENSG00000101624 to ENSG00000101624 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP57 | Gene migrated from ENSG00000166037 to ENSG00000166037 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP55 | Gene migrated from ENSG00000138180 to ENSG00000138180 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP41 | Gene migrated from ENSG00000106477 to ENSG00000106477 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP295 | Gene migrated from ENSG00000166004 to ENSG00000166004 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP290 | Gene migrated from ENSG00000198707 to ENSG00000198707 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP164 | Gene migrated from ENSG00000110274 to ENSG00000110274 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP152 | Gene migrated from ENSG00000103995 to ENSG00000103995 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP135 | Gene migrated from ENSG00000174799 to ENSG00000174799 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP120 | Gene migrated from ENSG00000168944 to ENSG00000168944 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CEP104 | Gene migrated from ENSG00000116198 to ENSG00000116198 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CPAP | Gene symbol changed from CENPJ to CPAP during gene set migration (ENSG00000151849 -> ENSG00000151849) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CENPF | Gene migrated from ENSG00000117724 to ENSG00000117724 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CELSR3 | Gene migrated from ENSG00000008300 to ENSG00000008300 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CELSR1 | Gene migrated from ENSG00000075275 to ENSG00000075275 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CELF4 | Gene migrated from ENSG00000101489 to ENSG00000101489 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CELF2 | Gene migrated from ENSG00000048740 to ENSG00000048740 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CECR2 | Gene migrated from ENSG00000099954 to ENSG00000099954 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDON | Gene migrated from ENSG00000064309 to ENSG00000064309 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDKL5 | Gene migrated from ENSG00000008086 to ENSG00000008086 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK8 | Gene migrated from ENSG00000132964 to ENSG00000132964 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK6 | Gene migrated from ENSG00000105810 to ENSG00000105810 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK5RAP2 | Gene migrated from ENSG00000136861 to ENSG00000136861 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK4 | Gene migrated from ENSG00000135446 to ENSG00000135446 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK19 | Gene migrated from ENSG00000155111 to ENSG00000155111 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK16 | Gene migrated from ENSG00000102225 to ENSG00000102225 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK13 | Gene migrated from ENSG00000065883 to ENSG00000065883 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDK10 | Gene migrated from ENSG00000185324 to ENSG00000185324 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDH2 | Gene migrated from ENSG00000170558 to ENSG00000170558 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDH11 | Gene migrated from ENSG00000140937 to ENSG00000140937 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDC42BPB | Gene migrated from ENSG00000198752 to ENSG00000198752 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CDC42 | Gene migrated from ENSG00000070831 to ENSG00000070831 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCT6A | Gene migrated from ENSG00000146731 to ENSG00000146731 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCT3 | Gene migrated from ENSG00000163468 to ENSG00000163468 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCNK | Gene migrated from ENSG00000090061 to ENSG00000090061 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCND2 | Gene migrated from ENSG00000118971 to ENSG00000118971 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC88C | Gene migrated from ENSG00000015133 to ENSG00000015133 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC88A | Gene migrated from ENSG00000115355 to ENSG00000115355 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC82 | Gene migrated from ENSG00000149231 to ENSG00000149231 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC47 | Gene migrated from ENSG00000108588 to ENSG00000108588 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC22 | Gene migrated from ENSG00000101997 to ENSG00000101997 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCDC186 | Gene migrated from ENSG00000165813 to ENSG00000165813 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VMA22 | Gene symbol changed from CCDC115 to VMA22 during gene set migration (ENSG00000136710 -> ENSG00000136710) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CCBE1 | Gene migrated from ENSG00000183287 to ENSG00000183287 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CC2D2A | Gene migrated from ENSG00000048342 to ENSG00000048342 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CC2D1A | Gene migrated from ENSG00000132024 to ENSG00000132024 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CBY1 | Gene migrated from ENSG00000100211 to ENSG00000100211 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CBX1 | Gene migrated from ENSG00000108468 to ENSG00000108468 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CBS | Gene migrated from ENSG00000160200 to ENSG00000160200 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CBL | Gene migrated from ENSG00000110395 to ENSG00000110395 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CASP2 | Gene migrated from ENSG00000106144 to ENSG00000106144 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CASK | Gene migrated from ENSG00000147044 to ENSG00000147044 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CARS2 | Gene migrated from ENSG00000134905 to ENSG00000134905 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CARS1 | Gene symbol changed from CARS to CARS1 during gene set migration (ENSG00000110619 -> ENSG00000110619) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAPZA2 | Gene migrated from ENSG00000198898 to ENSG00000198898 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAPRIN1 | Gene migrated from ENSG00000135387 to ENSG00000135387 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAPN15 | Gene migrated from ENSG00000103326 to ENSG00000103326 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAMTA1 | Gene migrated from ENSG00000171735 to ENSG00000171735 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAMSAP1 | Gene migrated from ENSG00000130559 to ENSG00000130559 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAMK4 | Gene migrated from ENSG00000152495 to ENSG00000152495 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAMK2D | Gene migrated from ENSG00000145349 to ENSG00000145349 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAMK2B | Gene migrated from ENSG00000058404 to ENSG00000058404 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAMK2A | Gene migrated from ENSG00000070808 to ENSG00000070808 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CAD | Gene migrated from ENSG00000084774 to ENSG00000084774 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA2D2 | Gene migrated from ENSG00000007402 to ENSG00000007402 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA1I | Gene migrated from ENSG00000100346 to ENSG00000100346 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA1G | Gene migrated from ENSG00000006283 to ENSG00000006283 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA1E | Gene migrated from ENSG00000198216 to ENSG00000198216 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA1D | Gene migrated from ENSG00000157388 to ENSG00000157388 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA1C | Gene migrated from ENSG00000151067 to ENSG00000151067 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA1B | Gene migrated from ENSG00000148408 to ENSG00000148408 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACNA1A | Gene migrated from ENSG00000141837 to ENSG00000141837 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CACHD1 | Gene migrated from ENSG00000158966 to ENSG00000158966 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CA8 | Gene migrated from ENSG00000178538 to ENSG00000178538 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CA2 | Gene migrated from ENSG00000104267 to ENSG00000104267 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CPLANE1 | Gene symbol changed from C5orf42 to CPLANE1 during gene set migration (ENSG00000197603 -> ENSG00000197603) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | C2orf69 | Gene migrated from ENSG00000178074 to ENSG00000178074 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | C2CD3 | Gene migrated from ENSG00000168014 to ENSG00000168014 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AIRIM | Gene symbol changed from C1orf109 to AIRIM during gene set migration (ENSG00000116922 -> ENSG00000116922) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS35L | Gene symbol changed from C16orf62 to VPS35L during gene set migration (ENSG00000103544 -> ENSG00000103544) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TEDC1 | Gene symbol changed from C14orf80 to TEDC1 during gene set migration (ENSG00000185347 -> ENSG00000185347) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KICS2 | Gene symbol changed from C12orf66 to KICS2 during gene set migration (ENSG00000174206 -> ENSG00000174206) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | MTRFR | Gene symbol changed from C12orf65 to MTRFR during gene set migration (ENSG00000130921 -> ENSG00000130921) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | C12orf57 | Gene migrated from ENSG00000111678 to ENSG00000111678 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | FERRY3 | Gene symbol changed from C12orf4 to FERRY3 during gene set migration (ENSG00000047621 -> ENSG00000047621) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BUB1B | Gene migrated from ENSG00000156970 to ENSG00000156970 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BTD | Gene migrated from ENSG00000169814 to ENSG00000169814 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BSND | Gene migrated from ENSG00000162399 to ENSG00000162399 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BSN | Gene migrated from ENSG00000164061 to ENSG00000164061 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BSCL2 | Gene migrated from ENSG00000168000 to ENSG00000168000 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRWD3 | Gene migrated from ENSG00000165288 to ENSG00000165288 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRSK2 | Gene migrated from ENSG00000174672 to ENSG00000174672 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRSK1 | Gene migrated from ENSG00000160469 to ENSG00000160469 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRPF1 | Gene migrated from ENSG00000156983 to ENSG00000156983 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRF2 | Gene migrated from ENSG00000104221 to ENSG00000104221 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRF1 | Gene migrated from ENSG00000185024 to ENSG00000185024 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRD4 | Gene migrated from ENSG00000141867 to ENSG00000141867 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRPM3 | Gene migrated from ENSG00000083067 to ENSG00000083067 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRAT1 | Gene migrated from ENSG00000106009 to ENSG00000106009 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BRAF | Gene migrated from ENSG00000157764 to ENSG00000157764 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BPTF | Gene migrated from ENSG00000171634 to ENSG00000171634 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BORCS8 | Gene migrated from ENSG00000254901 to ENSG00000254901 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BORCS5 | Gene migrated from ENSG00000165714 to ENSG00000165714 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BOLA3 | Gene migrated from ENSG00000163170 to ENSG00000163170 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BMP4 | Gene migrated from ENSG00000125378 to ENSG00000125378 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BLOC1S1 | Gene migrated from ENSG00000135441 to ENSG00000135441 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BICRA | Gene migrated from ENSG00000063169 to ENSG00000063169 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BHLHE22 | Gene migrated from ENSG00000180828 to ENSG00000180828 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCS1L | Gene migrated from ENSG00000074582 to ENSG00000074582 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCOR | Gene migrated from ENSG00000183337 to ENSG00000183337 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCL11B | Gene migrated from ENSG00000127152 to ENSG00000127152 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCL11A | Gene migrated from ENSG00000119866 to ENSG00000119866 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCKDK | Gene migrated from ENSG00000103507 to ENSG00000103507 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCKDHB | Gene migrated from ENSG00000083123 to ENSG00000083123 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCKDHA | Gene migrated from ENSG00000248098 to ENSG00000248098 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCAS3 | Gene migrated from ENSG00000141376 to ENSG00000141376 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BCAP31 | Gene migrated from ENSG00000185825 to ENSG00000185825 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBS9 | Gene migrated from ENSG00000122507 to ENSG00000122507 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBS7 | Gene migrated from ENSG00000138686 to ENSG00000138686 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBS5 | Gene migrated from ENSG00000163093 to ENSG00000163093 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBS4 | Gene migrated from ENSG00000140463 to ENSG00000140463 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBS2 | Gene migrated from ENSG00000125124 to ENSG00000125124 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBS12 | Gene migrated from ENSG00000181004 to ENSG00000181004 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBS10 | Gene migrated from ENSG00000179941 to ENSG00000179941 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBS1 | Gene migrated from ENSG00000174483 to ENSG00000174483 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BBIP1 | Gene migrated from ENSG00000214413 to ENSG00000214413 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BAP1 | Gene migrated from ENSG00000163930 to ENSG00000163930 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BAIAP2 | Gene migrated from ENSG00000175866 to ENSG00000175866 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B9D2 | Gene migrated from ENSG00000123810 to ENSG00000123810 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B9D1 | Gene migrated from ENSG00000108641 to ENSG00000108641 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B4GALT7 | Gene migrated from ENSG00000027847 to ENSG00000027847 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B4GALT1 | Gene migrated from ENSG00000086062 to ENSG00000086062 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B4GALNT1 | Gene migrated from ENSG00000135454 to ENSG00000135454 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B3GLCT | Gene migrated from ENSG00000187676 to ENSG00000187676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | B3GALNT2 | Gene migrated from ENSG00000162885 to ENSG00000162885 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AXIN1 | Gene migrated from ENSG00000103126 to ENSG00000103126 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AUTS2 | Gene migrated from ENSG00000158321 to ENSG00000158321 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AUH | Gene migrated from ENSG00000148090 to ENSG00000148090 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATXN7L3 | Gene migrated from ENSG00000087152 to ENSG00000087152 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATRX | Gene migrated from ENSG00000085224 to ENSG00000085224 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATR | Gene migrated from ENSG00000175054 to ENSG00000175054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP9A | Gene migrated from ENSG00000054793 to ENSG00000054793 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP8A2 | Gene migrated from ENSG00000132932 to ENSG00000132932 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP7A | Gene migrated from ENSG00000165240 to ENSG00000165240 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP6V1B2 | Gene migrated from ENSG00000147416 to ENSG00000147416 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP6V1A | Gene migrated from ENSG00000114573 to ENSG00000114573 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP6V0C | Gene migrated from ENSG00000185883 to ENSG00000185883 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP6V0A2 | Gene migrated from ENSG00000185344 to ENSG00000185344 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP6V0A1 | Gene migrated from ENSG00000033627 to ENSG00000033627 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP6AP2 | Gene migrated from ENSG00000182220 to ENSG00000182220 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP6AP1 | Gene migrated from ENSG00000071553 to ENSG00000071553 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP5PO | Gene symbol changed from ATP5O to ATP5PO during gene set migration (ENSG00000241837 -> ENSG00000241837) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP5F1A | Gene symbol changed from ATP5A1 to ATP5F1A during gene set migration (ENSG00000152234 -> ENSG00000152234) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP2B3 | Gene migrated from ENSG00000067842 to ENSG00000067842 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP2B2 | Gene migrated from ENSG00000157087 to ENSG00000157087 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP2B1 | Gene migrated from ENSG00000070961 to ENSG00000070961 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP1A3 | Gene migrated from ENSG00000105409 to ENSG00000105409 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP1A2 | Gene migrated from ENSG00000018625 to ENSG00000018625 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATP1A1 | Gene migrated from ENSG00000163399 to ENSG00000163399 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATN1 | Gene migrated from ENSG00000111676 to ENSG00000111676 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATIC | Gene migrated from ENSG00000138363 to ENSG00000138363 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATG7 | Gene migrated from ENSG00000197548 to ENSG00000197548 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATG4D | Gene migrated from ENSG00000130734 to ENSG00000130734 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATG12 | Gene migrated from ENSG00000145782 to ENSG00000145782 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATAD3A | Gene migrated from ENSG00000197785 to ENSG00000197785 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ATAD1 | Gene migrated from ENSG00000138138 to ENSG00000138138 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASXL3 | Gene migrated from ENSG00000141431 to ENSG00000141431 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASXL2 | Gene migrated from ENSG00000143970 to ENSG00000143970 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASXL1 | Gene migrated from ENSG00000171456 to ENSG00000171456 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASTN1 | Gene migrated from ENSG00000152092 to ENSG00000152092 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASPM | Gene migrated from ENSG00000066279 to ENSG00000066279 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASPA | Gene migrated from ENSG00000108381 to ENSG00000108381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASNS | Gene migrated from ENSG00000070669 to ENSG00000070669 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASS1 | Gene migrated from ENSG00000130707 to ENSG00000130707 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASL | Gene migrated from ENSG00000126522 to ENSG00000126522 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASH1L | Gene migrated from ENSG00000116539 to ENSG00000116539 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASCC3 | Gene migrated from ENSG00000112249 to ENSG00000112249 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ASAH1 | Gene migrated from ENSG00000104763 to ENSG00000104763 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARX | Gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARV1 | Gene migrated from ENSG00000173409 to ENSG00000173409 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARSL | Gene symbol changed from ARSE to ARSL during gene set migration (ENSG00000157399 -> ENSG00000157399) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARSB | Gene migrated from ENSG00000113273 to ENSG00000113273 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARSA | Gene migrated from ENSG00000100299 to ENSG00000100299 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARPC4 | Gene migrated from ENSG00000241553 to ENSG00000241553 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BMAL1 | Gene symbol changed from ARNTL to BMAL1 during gene set migration (ENSG00000133794 -> ENSG00000133794) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARMC9 | Gene migrated from ENSG00000135931 to ENSG00000135931 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARL6 | Gene migrated from ENSG00000113966 to ENSG00000113966 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARL13B | Gene migrated from ENSG00000169379 to ENSG00000169379 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARID2 | Gene migrated from ENSG00000189079 to ENSG00000189079 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARID1B | Gene migrated from ENSG00000049618 to ENSG00000049618 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARID1A | Gene migrated from ENSG00000117713 to ENSG00000117713 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARHGEF9 | Gene migrated from ENSG00000131089 to ENSG00000131089 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARHGAP35 | Gene migrated from ENSG00000160007 to ENSG00000160007 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARG1 | Gene migrated from ENSG00000118520 to ENSG00000118520 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARFGEF2 | Gene migrated from ENSG00000124198 to ENSG00000124198 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARFGEF1 | Gene migrated from ENSG00000066777 to ENSG00000066777 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARF3 | Gene migrated from ENSG00000134287 to ENSG00000134287 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARF1 | Gene migrated from ENSG00000143761 to ENSG00000143761 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ARCN1 | Gene migrated from ENSG00000095139 to ENSG00000095139 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | COA8 | Gene symbol changed from APOPT1 to COA8 during gene set migration (ENSG00000256053 -> ENSG00000256053) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | APC2 | Gene migrated from ENSG00000115266 to ENSG00000115266 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP4S1 | Gene migrated from ENSG00000100478 to ENSG00000100478 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP4M1 | Gene migrated from ENSG00000221838 to ENSG00000221838 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP4E1 | Gene migrated from ENSG00000081014 to ENSG00000081014 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP4B1 | Gene migrated from ENSG00000134262 to ENSG00000134262 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP3B2 | Gene migrated from ENSG00000103723 to ENSG00000103723 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP3B1 | Gene migrated from ENSG00000132842 to ENSG00000132842 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP2S1 | Gene migrated from ENSG00000042753 to ENSG00000042753 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP2M1 | Gene migrated from ENSG00000161203 to ENSG00000161203 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP1S2 | Gene migrated from ENSG00000182287 to ENSG00000182287 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP1S1 | Gene migrated from ENSG00000106367 to ENSG00000106367 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP1G1 | Gene migrated from ENSG00000166747 to ENSG00000166747 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AP1B1 | Gene migrated from ENSG00000100280 to ENSG00000100280 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANO4 | Gene migrated from ENSG00000151572 to ENSG00000151572 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANKS1B | Gene migrated from ENSG00000185046 to ENSG00000185046 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANKRD17 | Gene migrated from ENSG00000132466 to ENSG00000132466 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANKRD11 | Gene migrated from ENSG00000167522 to ENSG00000167522 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANK3 | Gene migrated from ENSG00000151150 to ENSG00000151150 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ANK2 | Gene migrated from ENSG00000145362 to ENSG00000145362 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AMT | Gene migrated from ENSG00000145020 to ENSG00000145020 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AMPD2 | Gene migrated from ENSG00000116337 to ENSG00000116337 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AMOTL1 | Gene migrated from ENSG00000166025 to ENSG00000166025 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AMER1 | Gene migrated from ENSG00000184675 to ENSG00000184675 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALMS1 | Gene migrated from ENSG00000116127 to ENSG00000116127 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALKBH8 | Gene migrated from ENSG00000137760 to ENSG00000137760 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG9 | Gene migrated from ENSG00000086848 to ENSG00000086848 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG8 | Gene migrated from ENSG00000159063 to ENSG00000159063 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG6 | Gene migrated from ENSG00000088035 to ENSG00000088035 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG3 | Gene migrated from ENSG00000214160 to ENSG00000214160 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG2 | Gene migrated from ENSG00000119523 to ENSG00000119523 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG14 | Gene migrated from ENSG00000172339 to ENSG00000172339 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG13 | Gene migrated from ENSG00000101901 to ENSG00000101901 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG12 | Gene migrated from ENSG00000182858 to ENSG00000182858 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG11 | Gene migrated from ENSG00000253710 to ENSG00000253710 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALG1 | Gene migrated from ENSG00000033011 to ENSG00000033011 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALDH7A1 | Gene migrated from ENSG00000164904 to ENSG00000164904 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALDH5A1 | Gene migrated from ENSG00000112294 to ENSG00000112294 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALDH4A1 | Gene migrated from ENSG00000159423 to ENSG00000159423 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALDH3A2 | Gene migrated from ENSG00000072210 to ENSG00000072210 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ALDH18A1 | Gene migrated from ENSG00000059573 to ENSG00000059573 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AKT3 | Gene migrated from ENSG00000117020 to ENSG00000117020 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AJAP1 | Gene migrated from ENSG00000196581 to ENSG00000196581 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AIMP1 | Gene migrated from ENSG00000164022 to ENSG00000164022 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AIFM1 | Gene migrated from ENSG00000156709 to ENSG00000156709 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AHI1 | Gene migrated from ENSG00000135541 to ENSG00000135541 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AHDC1 | Gene migrated from ENSG00000126705 to ENSG00000126705 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AHCY | Gene migrated from ENSG00000101444 to ENSG00000101444 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGTPBP1 | Gene migrated from ENSG00000135049 to ENSG00000135049 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGO2 | Gene migrated from ENSG00000123908 to ENSG00000123908 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGO1 | Gene migrated from ENSG00000092847 to ENSG00000092847 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGMO | Gene migrated from ENSG00000187546 to ENSG00000187546 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AGA | Gene migrated from ENSG00000038002 to ENSG00000038002 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AFF4 | Gene migrated from ENSG00000072364 to ENSG00000072364 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AFF3 | Gene migrated from ENSG00000144218 to ENSG00000144218 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AFF2 | Gene migrated from ENSG00000155966 to ENSG00000155966 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADSL | Gene migrated from ENSG00000239900 to ENSG00000239900 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADNP | Gene migrated from ENSG00000101126 to ENSG00000101126 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADK | Gene migrated from ENSG00000156110 to ENSG00000156110 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADGRL1 | Gene migrated from ENSG00000072071 to ENSG00000072071 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADGRG1 | Gene migrated from ENSG00000205336 to ENSG00000205336 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADD3 | Gene migrated from ENSG00000148700 to ENSG00000148700 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADAT3 | Gene migrated from ENSG00000213638 to ENSG00000213638 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADARB1 | Gene migrated from ENSG00000197381 to ENSG00000197381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADAR | Gene migrated from ENSG00000160710 to ENSG00000160710 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADAMTS10 | Gene migrated from ENSG00000142303 to ENSG00000142303 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ADAM22 | Gene migrated from ENSG00000008277 to ENSG00000008277 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACY1 | Gene migrated from ENSG00000243989 to ENSG00000243989 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACTL6B | Gene migrated from ENSG00000077080 to ENSG00000077080 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACTL6A | Gene migrated from ENSG00000136518 to ENSG00000136518 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACTG1 | Gene migrated from ENSG00000184009 to ENSG00000184009 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACTB | Gene migrated from ENSG00000075624 to ENSG00000075624 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACSL4 | Gene migrated from ENSG00000068366 to ENSG00000068366 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACOX1 | Gene migrated from ENSG00000161533 to ENSG00000161533 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACO2 | Gene migrated from ENSG00000100412 to ENSG00000100412 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACBD6 | Gene migrated from ENSG00000230124 to ENSG00000230124 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACADM | Gene migrated from ENSG00000117054 to ENSG00000117054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ACAD9 | Gene migrated from ENSG00000177646 to ENSG00000177646 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABHD5 | Gene migrated from ENSG00000011198 to ENSG00000011198 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABHD16A | Gene migrated from ENSG00000204427 to ENSG00000204427 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABCD4 | Gene migrated from ENSG00000119688 to ENSG00000119688 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABCD1 | Gene migrated from ENSG00000101986 to ENSG00000101986 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABCC9 | Gene migrated from ENSG00000069431 to ENSG00000069431 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABCA2 | Gene migrated from ENSG00000107331 to ENSG00000107331 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ABAT | Gene migrated from ENSG00000183044 to ENSG00000183044 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AAAS | Gene migrated from ENSG00000094914 to ENSG00000094914 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | GTF2I | Gene migrated from ENSG00000263001 to ENSG00000263001 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZSWIM6 | Gene migrated from ENSG00000130449 to ENSG00000130449 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZSCAN10 | Gene migrated from ENSG00000130182 to ENSG00000130182 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZRSR2 | Gene migrated from ENSG00000169249 to ENSG00000169249 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNRF3 | Gene migrated from ENSG00000183579 to ENSG00000183579 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNHIT3 | Gene migrated from ENSG00000273611 to ENSG00000273611 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF711 | Gene migrated from ENSG00000147180 to ENSG00000147180 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF699 | Gene migrated from ENSG00000196110 to ENSG00000196110 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF526 | Gene migrated from ENSG00000167625 to ENSG00000167625 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF462 | Gene migrated from ENSG00000148143 to ENSG00000148143 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF335 | Gene migrated from ENSG00000198026 to ENSG00000198026 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF292 | Gene migrated from ENSG00000188994 to ENSG00000188994 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF148 | Gene migrated from ENSG00000163848 to ENSG00000163848 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZNF142 | Gene migrated from ENSG00000115568 to ENSG00000115568 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZMYND8 | Gene migrated from ENSG00000101040 to ENSG00000101040 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZMYND11 | Gene migrated from ENSG00000015171 to ENSG00000015171 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZMYM3 | Gene migrated from ENSG00000147130 to ENSG00000147130 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZMYM2 | Gene migrated from ENSG00000121741 to ENSG00000121741 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZMIZ1 | Gene migrated from ENSG00000108175 to ENSG00000108175 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZIC2 | Gene migrated from ENSG00000043355 to ENSG00000043355 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZIC1 | Gene migrated from ENSG00000152977 to ENSG00000152977 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZFYVE26 | Gene migrated from ENSG00000072121 to ENSG00000072121 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZFX | Gene migrated from ENSG00000005889 to ENSG00000005889 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZFHX4 | Gene migrated from ENSG00000091656 to ENSG00000091656 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZFHX3 | Gene migrated from ENSG00000140836 to ENSG00000140836 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZEB2 | Gene migrated from ENSG00000169554 to ENSG00000169554 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZDHHC9 | Gene migrated from ENSG00000188706 to ENSG00000188706 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZC4H2 | Gene migrated from ENSG00000126970 to ENSG00000126970 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZBTB7A | Gene migrated from ENSG00000178951 to ENSG00000178951 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZBTB47 | Gene migrated from ENSG00000114853 to ENSG00000114853 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZBTB24 | Gene migrated from ENSG00000112365 to ENSG00000112365 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZBTB20 | Gene migrated from ENSG00000181722 to ENSG00000181722 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZBTB18 | Gene migrated from ENSG00000179456 to ENSG00000179456 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ZBTB11 | Gene migrated from ENSG00000066422 to ENSG00000066422 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | YY1 | Gene migrated from ENSG00000100811 to ENSG00000100811 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | YWHAG | Gene migrated from ENSG00000170027 to ENSG00000170027 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | YWHAE | Gene migrated from ENSG00000108953 to ENSG00000108953 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | YIF1B | Gene migrated from ENSG00000167645 to ENSG00000167645 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | YARS1 | Gene symbol changed from YARS to YARS1 during gene set migration (ENSG00000134684 -> ENSG00000134684) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | XYLT1 | Gene migrated from ENSG00000103489 to ENSG00000103489 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | XRCC4 | Gene migrated from ENSG00000152422 to ENSG00000152422 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | XPOT | Gene migrated from ENSG00000184575 to ENSG00000184575 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | XPO1 | Gene migrated from ENSG00000082898 to ENSG00000082898 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | XPA | Gene migrated from ENSG00000136936 to ENSG00000136936 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WWOX | Gene migrated from ENSG00000186153 to ENSG00000186153 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WSB2 | Gene migrated from ENSG00000176871 to ENSG00000176871 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WNT5A | Gene migrated from ENSG00000114251 to ENSG00000114251 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WNT1 | Gene migrated from ENSG00000125084 to ENSG00000125084 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WNK3 | Gene migrated from ENSG00000196632 to ENSG00000196632 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WIPI2 | Gene migrated from ENSG00000157954 to ENSG00000157954 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR91 | Gene migrated from ENSG00000105875 to ENSG00000105875 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR83OS | Gene migrated from ENSG00000105583 to ENSG00000105583 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR81 | Gene migrated from ENSG00000167716 to ENSG00000167716 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR73 | Gene migrated from ENSG00000177082 to ENSG00000177082 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR62 | Gene migrated from ENSG00000075702 to ENSG00000075702 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR5 | Gene migrated from ENSG00000196363 to ENSG00000196363 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR47 | Gene migrated from ENSG00000085433 to ENSG00000085433 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR45B | Gene migrated from ENSG00000141580 to ENSG00000141580 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR45 | Gene migrated from ENSG00000196998 to ENSG00000196998 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR44 | Gene migrated from ENSG00000131725 to ENSG00000131725 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR4 | Gene migrated from ENSG00000160193 to ENSG00000160193 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR26 | Gene migrated from ENSG00000162923 to ENSG00000162923 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDR11 | Gene migrated from ENSG00000120008 to ENSG00000120008 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDPCP | Gene migrated from ENSG00000143951 to ENSG00000143951 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WDFY3 | Gene migrated from ENSG00000163625 to ENSG00000163625 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WBP4 | Gene migrated from ENSG00000120688 to ENSG00000120688 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WASHC4 | Gene migrated from ENSG00000136051 to ENSG00000136051 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WASF1 | Gene migrated from ENSG00000112290 to ENSG00000112290 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WARS2 | Gene migrated from ENSG00000116874 to ENSG00000116874 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WARS1 | Gene symbol changed from WARS to WARS1 during gene set migration (ENSG00000140105 -> ENSG00000140105) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WAPL | Gene migrated from ENSG00000062650 to ENSG00000062650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | WAC | Gene migrated from ENSG00000095787 to ENSG00000095787 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VWA3B | Gene migrated from ENSG00000168658 to ENSG00000168658 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VRK1 | Gene migrated from ENSG00000100749 to ENSG00000100749 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS53 | Gene migrated from ENSG00000141252 to ENSG00000141252 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS51 | Gene migrated from ENSG00000149823 to ENSG00000149823 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS50 | Gene migrated from ENSG00000004766 to ENSG00000004766 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS4A | Gene migrated from ENSG00000132612 to ENSG00000132612 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS41 | Gene migrated from ENSG00000006715 to ENSG00000006715 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS33B | Gene migrated from ENSG00000184056 to ENSG00000184056 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS16 | Gene migrated from ENSG00000215305 to ENSG00000215305 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS13B | Gene migrated from ENSG00000132549 to ENSG00000132549 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VPS11 | Gene migrated from ENSG00000160695 to ENSG00000160695 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VLDLR | Gene migrated from ENSG00000147852 to ENSG00000147852 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VIPAS39 | Gene migrated from ENSG00000151445 to ENSG00000151445 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VCP | Gene migrated from ENSG00000165280 to ENSG00000165280 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VARS2 | Gene migrated from ENSG00000137411 to ENSG00000137411 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VARS1 | Gene symbol changed from VARS to VARS1 during gene set migration (ENSG00000204394 -> ENSG00000204394) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | VAMP2 | Gene migrated from ENSG00000220205 to ENSG00000220205 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | USP9X | Gene migrated from ENSG00000124486 to ENSG00000124486 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | USP7 | Gene migrated from ENSG00000187555 to ENSG00000187555 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | USP27X | Gene migrated from ENSG00000273820 to ENSG00000273820 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | USP18 | Gene migrated from ENSG00000184979 to ENSG00000184979 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UPF3B | Gene migrated from ENSG00000125351 to ENSG00000125351 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UPF1 | Gene migrated from ENSG00000005007 to ENSG00000005007 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UPB1 | Gene migrated from ENSG00000100024 to ENSG00000100024 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UNC80 | Gene migrated from ENSG00000144406 to ENSG00000144406 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UNC79 | Gene migrated from ENSG00000133958 to ENSG00000133958 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UNC13A | Gene migrated from ENSG00000130477 to ENSG00000130477 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UMPS | Gene migrated from ENSG00000114491 to ENSG00000114491 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UGP2 | Gene migrated from ENSG00000169764 to ENSG00000169764 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UGGT1 | Gene migrated from ENSG00000136731 to ENSG00000136731 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UFSP2 | Gene migrated from ENSG00000109775 to ENSG00000109775 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UFM1 | Gene migrated from ENSG00000120686 to ENSG00000120686 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UFC1 | Gene migrated from ENSG00000143222 to ENSG00000143222 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBTF | Gene migrated from ENSG00000108312 to ENSG00000108312 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBR7 | Gene migrated from ENSG00000012963 to ENSG00000012963 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBR5 | Gene migrated from ENSG00000104517 to ENSG00000104517 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UGDH | Gene migrated from ENSG00000109814 to ENSG00000109814 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBR1 | Gene migrated from ENSG00000159459 to ENSG00000159459 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBE4A | Gene migrated from ENSG00000110344 to ENSG00000110344 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBE3C | Gene migrated from ENSG00000009335 to ENSG00000009335 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBE3B | Gene migrated from ENSG00000151148 to ENSG00000151148 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBE3A | Gene migrated from ENSG00000114062 to ENSG00000114062 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBE2A | Gene migrated from ENSG00000077721 to ENSG00000077721 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBAP2L | Gene migrated from ENSG00000143569 to ENSG00000143569 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | UBA5 | Gene migrated from ENSG00000081307 to ENSG00000081307 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | U2AF2 | Gene migrated from ENSG00000063244 to ENSG00000063244 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TWIST1 | Gene migrated from ENSG00000122691 to ENSG00000122691 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUSC3 | Gene migrated from ENSG00000104723 to ENSG00000104723 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBGCP6 | Gene migrated from ENSG00000128159 to ENSG00000128159 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBGCP2 | Gene migrated from ENSG00000130640 to ENSG00000130640 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBG1 | Gene migrated from ENSG00000131462 to ENSG00000131462 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBB4A | Gene migrated from ENSG00000104833 to ENSG00000104833 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBB3 | Gene migrated from ENSG00000258947 to ENSG00000258947 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBB2B | Gene migrated from ENSG00000137285 to ENSG00000137285 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBB2A | Gene migrated from ENSG00000137267 to ENSG00000137267 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBB | Gene migrated from ENSG00000196230 to ENSG00000196230 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TUBA1A | Gene migrated from ENSG00000167552 to ENSG00000167552 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTI2 | Gene migrated from ENSG00000129696 to ENSG00000129696 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTI1 | Gene migrated from ENSG00000101407 to ENSG00000101407 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTC8 | Gene migrated from ENSG00000165533 to ENSG00000165533 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTC5 | Gene migrated from ENSG00000136319 to ENSG00000136319 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SKIC3 | Gene symbol changed from TTC37 to SKIC3 during gene set migration (ENSG00000198677 -> ENSG00000198677) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TTC19 | Gene migrated from ENSG00000011295 to ENSG00000011295 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSPOAP1 | Gene migrated from ENSG00000005379 to ENSG00000005379 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSHB | Gene migrated from ENSG00000134200 to ENSG00000134200 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSFM | Gene migrated from ENSG00000123297 to ENSG00000123297 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSEN54 | Gene migrated from ENSG00000182173 to ENSG00000182173 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSEN2 | Gene migrated from ENSG00000154743 to ENSG00000154743 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSEN15 | Gene migrated from ENSG00000198860 to ENSG00000198860 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSC2 | Gene migrated from ENSG00000103197 to ENSG00000103197 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TSC1 | Gene migrated from ENSG00000165699 to ENSG00000165699 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | TRRAP | Gene migrated from ENSG00000196367 to ENSG00000196367 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STT3A | Gene migrated from ENSG00000134910 to ENSG00000134910 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STRADA | Gene migrated from ENSG00000266173 to ENSG00000266173 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STRA6 | Gene migrated from ENSG00000137868 to ENSG00000137868 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STIL | Gene migrated from ENSG00000123473 to ENSG00000123473 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STAMBP | Gene migrated from ENSG00000124356 to ENSG00000124356 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STAG2 | Gene migrated from ENSG00000101972 to ENSG00000101972 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | STAG1 | Gene migrated from ENSG00000118007 to ENSG00000118007 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | DENND2B | Gene symbol changed from ST5 to DENND2B during gene set migration (ENSG00000166444 -> ENSG00000166444) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ST3GAL5 | Gene migrated from ENSG00000115525 to ENSG00000115525 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ST3GAL3 | Gene migrated from ENSG00000126091 to ENSG00000126091 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SSR4 | Gene migrated from ENSG00000180879 to ENSG00000180879 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SSPOP | Gene symbol changed from SSPO to SSPOP during gene set migration (ENSG00000197558 -> ENSG00000197558) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SRSF1 | Gene migrated from ENSG00000136450 to ENSG00000136450 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SRRM4 | Gene migrated from ENSG00000139767 to ENSG00000139767 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SRRM2 | Gene migrated from ENSG00000167978 to ENSG00000167978 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SRRM1 | Gene migrated from ENSG00000133226 to ENSG00000133226 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SRPK3 | Gene migrated from ENSG00000184343 to ENSG00000184343 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SRD5A3 | Gene migrated from ENSG00000128039 to ENSG00000128039 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SRCAP | Gene migrated from ENSG00000080603 to ENSG00000080603 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPTBN4 | Gene migrated from ENSG00000160460 to ENSG00000160460 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPTBN2 | Gene migrated from ENSG00000173898 to ENSG00000173898 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPTBN1 | Gene migrated from ENSG00000115306 to ENSG00000115306 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPTAN1 | Gene migrated from ENSG00000197694 to ENSG00000197694 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPRED2 | Gene migrated from ENSG00000198369 to ENSG00000198369 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPRED1 | Gene migrated from ENSG00000166068 to ENSG00000166068 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPR | Gene migrated from ENSG00000116096 to ENSG00000116096 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPOUT1 | Gene migrated from ENSG00000198917 to ENSG00000198917 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPOP | Gene migrated from ENSG00000121067 to ENSG00000121067 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPNS1 | Gene migrated from ENSG00000169682 to ENSG00000169682 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPG11 | Gene migrated from ENSG00000104133 to ENSG00000104133 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPEN | Gene migrated from ENSG00000065526 to ENSG00000065526 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPECC1L | Gene migrated from ENSG00000100014 to ENSG00000100014 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AFG2B | Gene symbol changed from SPATA5L1 to AFG2B during gene set migration (ENSG00000171763 -> ENSG00000171763) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AFG2A | Gene symbol changed from SPATA5 to AFG2A during gene set migration (ENSG00000145375 -> ENSG00000145375) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SPART | Gene migrated from ENSG00000133104 to ENSG00000133104 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SP9 | Gene migrated from ENSG00000217236 to ENSG00000217236 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX6 | Gene migrated from ENSG00000110693 to ENSG00000110693 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX5 | Gene migrated from ENSG00000134532 to ENSG00000134532 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX4 | Gene migrated from ENSG00000124766 to ENSG00000124766 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX2 | Gene migrated from ENSG00000181449 to ENSG00000181449 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX11 | Gene migrated from ENSG00000176887 to ENSG00000176887 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOX10 | Gene migrated from ENSG00000100146 to ENSG00000100146 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOS1 | Gene migrated from ENSG00000115904 to ENSG00000115904 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SON | Gene migrated from ENSG00000159140 to ENSG00000159140 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOD1 | Gene migrated from ENSG00000142168 to ENSG00000142168 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SOS2 | Gene migrated from ENSG00000100485 to ENSG00000100485 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNX27 | Gene migrated from ENSG00000143376 to ENSG00000143376 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNX14 | Gene migrated from ENSG00000135317 to ENSG00000135317 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNW1 | Gene migrated from ENSG00000100603 to ENSG00000100603 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNRPB | Gene migrated from ENSG00000125835 to ENSG00000125835 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNF8 | Gene migrated from ENSG00000159210 to ENSG00000159210 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNAPIN | Gene migrated from ENSG00000143553 to ENSG00000143553 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNAPC4 | Gene migrated from ENSG00000165684 to ENSG00000165684 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNAP29 | Gene migrated from ENSG00000099940 to ENSG00000099940 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SNAP25 | Gene migrated from ENSG00000132639 to ENSG00000132639 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMS | Gene migrated from ENSG00000102172 to ENSG00000102172 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMPD4 | Gene migrated from ENSG00000136699 to ENSG00000136699 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMPD1 | Gene migrated from ENSG00000166311 to ENSG00000166311 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMOC1 | Gene migrated from ENSG00000198732 to ENSG00000198732 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMG9 | Gene migrated from ENSG00000105771 to ENSG00000105771 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMG8 | Gene migrated from ENSG00000167447 to ENSG00000167447 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMC5 | Gene migrated from ENSG00000198887 to ENSG00000198887 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMC3 | Gene migrated from ENSG00000108055 to ENSG00000108055 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMC1A | Gene migrated from ENSG00000072501 to ENSG00000072501 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCE1 | Gene migrated from ENSG00000073584 to ENSG00000073584 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCD1 | Gene migrated from ENSG00000066117 to ENSG00000066117 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCC2 | Gene migrated from ENSG00000139613 to ENSG00000139613 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCC1 | Gene migrated from ENSG00000173473 to ENSG00000173473 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCB1 | Gene migrated from ENSG00000099956 to ENSG00000099956 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCA5 | Gene migrated from ENSG00000153147 to ENSG00000153147 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCA4 | Gene migrated from ENSG00000127616 to ENSG00000127616 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCA2 | Gene migrated from ENSG00000080503 to ENSG00000080503 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMARCA1 | Gene migrated from ENSG00000102038 to ENSG00000102038 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMAD6 | Gene migrated from ENSG00000137834 to ENSG00000137834 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SMAD4 | Gene migrated from ENSG00000141646 to ENSG00000141646 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLK | Gene migrated from ENSG00000065613 to ENSG00000065613 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLITRK2 | Gene migrated from ENSG00000185985 to ENSG00000185985 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLF2 | Gene migrated from ENSG00000119906 to ENSG00000119906 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC9A6 | Gene migrated from ENSG00000198689 to ENSG00000198689 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC6A9 | Gene migrated from ENSG00000196517 to ENSG00000196517 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC6A8 | Gene migrated from ENSG00000130821 to ENSG00000130821 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC6A3 | Gene migrated from ENSG00000142319 to ENSG00000142319 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC6A19 | Gene migrated from ENSG00000174358 to ENSG00000174358 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC6A17 | Gene migrated from ENSG00000197106 to ENSG00000197106 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC6A1 | Gene migrated from ENSG00000157103 to ENSG00000157103 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC5A6 | Gene migrated from ENSG00000138074 to ENSG00000138074 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC4A4 | Gene migrated from ENSG00000080493 to ENSG00000080493 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC4A10 | Gene migrated from ENSG00000144290 to ENSG00000144290 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC46A1 | Gene migrated from ENSG00000076351 to ENSG00000076351 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC45A1 | Gene migrated from ENSG00000162426 to ENSG00000162426 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC39A8 | Gene migrated from ENSG00000138821 to ENSG00000138821 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC39A14 | Gene migrated from ENSG00000104635 to ENSG00000104635 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC38A3 | Gene migrated from ENSG00000188338 to ENSG00000188338 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC35C1 | Gene migrated from ENSG00000181830 to ENSG00000181830 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC35A2 | Gene migrated from ENSG00000102100 to ENSG00000102100 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC33A1 | Gene migrated from ENSG00000169359 to ENSG00000169359 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC32A1 | Gene migrated from ENSG00000101438 to ENSG00000101438 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC31A1 | Gene migrated from ENSG00000136868 to ENSG00000136868 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC30A9 | Gene migrated from ENSG00000014824 to ENSG00000014824 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC2A1 | Gene migrated from ENSG00000117394 to ENSG00000117394 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A22 | Gene migrated from ENSG00000177542 to ENSG00000177542 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A15 | Gene migrated from ENSG00000102743 to ENSG00000102743 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A12 | Gene migrated from ENSG00000115840 to ENSG00000115840 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC25A1 | Gene migrated from ENSG00000100075 to ENSG00000100075 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC1A4 | Gene migrated from ENSG00000115902 to ENSG00000115902 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC1A2 | Gene migrated from ENSG00000110436 to ENSG00000110436 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC19A3 | Gene migrated from ENSG00000135917 to ENSG00000135917 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC18A2 | Gene migrated from ENSG00000165646 to ENSG00000165646 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC17A5 | Gene migrated from ENSG00000119899 to ENSG00000119899 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC16A2 | Gene migrated from ENSG00000147100 to ENSG00000147100 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC13A5 | Gene migrated from ENSG00000141485 to ENSG00000141485 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC12A9 | Gene migrated from ENSG00000146828 to ENSG00000146828 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC12A6 | Gene migrated from ENSG00000140199 to ENSG00000140199 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC12A5 | Gene migrated from ENSG00000124140 to ENSG00000124140 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SLC12A2 | Gene migrated from ENSG00000064651 to ENSG00000064651 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SKOR2 | Gene migrated from ENSG00000215474 to ENSG00000215474 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SKI | Gene migrated from ENSG00000157933 to ENSG00000157933 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SIX3 | Gene migrated from ENSG00000138083 to ENSG00000138083 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SIN3B | Gene migrated from ENSG00000127511 to ENSG00000127511 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SIN3A | Gene migrated from ENSG00000169375 to ENSG00000169375 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SIL1 | Gene migrated from ENSG00000120725 to ENSG00000120725 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SIK1 | Gene migrated from ENSG00000142178 to ENSG00000142178 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SIAH1 | Gene migrated from ENSG00000196470 to ENSG00000196470 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SHOC2 | Gene migrated from ENSG00000108061 to ENSG00000108061 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SHMT2 | Gene migrated from ENSG00000182199 to ENSG00000182199 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SHH | Gene migrated from ENSG00000164690 to ENSG00000164690 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SHANK3 | Gene migrated from ENSG00000251322 to ENSG00000251322 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SHANK2 | Gene migrated from ENSG00000162105 to ENSG00000162105 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SHANK1 | Gene migrated from ENSG00000161681 to ENSG00000161681 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SGSM3 | Gene migrated from ENSG00000100359 to ENSG00000100359 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SGSH | Gene migrated from ENSG00000181523 to ENSG00000181523 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SGPL1 | Gene migrated from ENSG00000166224 to ENSG00000166224 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SFXN4 | Gene migrated from ENSG00000183605 to ENSG00000183605 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SF3B1 | Gene migrated from ENSG00000115524 to ENSG00000115524 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SF1 | Gene migrated from ENSG00000168066 to ENSG00000168066 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SETD5 | Gene migrated from ENSG00000168137 to ENSG00000168137 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SETD2 | Gene migrated from ENSG00000181555 to ENSG00000181555 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SETD1B | Gene migrated from ENSG00000139718 to ENSG00000139718 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SETD1A | Gene migrated from ENSG00000099381 to ENSG00000099381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SETBP1 | Gene migrated from ENSG00000152217 to ENSG00000152217 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SET | Gene migrated from ENSG00000119335 to ENSG00000119335 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SERAC1 | Gene migrated from ENSG00000122335 to ENSG00000122335 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEPTIN2 | Gene symbol changed from SEPT2 to SEPTIN2 during gene set migration (ENSG00000168385 -> ENSG00000168385) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEPSECS | Gene migrated from ENSG00000109618 to ENSG00000109618 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEPHS1 | Gene migrated from ENSG00000086475 to ENSG00000086475 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEMA6B | Gene migrated from ENSG00000167680 to ENSG00000167680 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SELENOI | Gene migrated from ENSG00000138018 to ENSG00000138018 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEL1L | Gene migrated from ENSG00000071537 to ENSG00000071537 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SECISBP2 | Gene migrated from ENSG00000187742 to ENSG00000187742 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SEC31A | Gene migrated from ENSG00000138674 to ENSG00000138674 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SDHAF1 | Gene migrated from ENSG00000205138 to ENSG00000205138 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SDHA | Gene migrated from ENSG00000073578 to ENSG00000073578 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SDCCAG8 | Gene migrated from ENSG00000054282 to ENSG00000054282 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCYL2 | Gene migrated from ENSG00000136021 to ENSG00000136021 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCO2 | Gene migrated from ENSG00000130489 to ENSG00000284194 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCN8A | Gene migrated from ENSG00000196876 to ENSG00000196876 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCN3A | Gene migrated from ENSG00000153253 to ENSG00000153253 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCN2A | Gene migrated from ENSG00000136531 to ENSG00000136531 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCN1B | Gene migrated from ENSG00000105711 to ENSG00000105711 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCN1A | Gene migrated from ENSG00000144285 to ENSG00000144285 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCAPER | Gene migrated from ENSG00000140386 to ENSG00000140386 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCAMP5 | Gene migrated from ENSG00000198794 to ENSG00000198794 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SCAF4 | Gene migrated from ENSG00000156304 to ENSG00000156304 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SC5D | Gene migrated from ENSG00000109929 to ENSG00000109929 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SBF1 | Gene migrated from ENSG00000100241 to ENSG00000100241 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SATB2 | Gene migrated from ENSG00000119042 to ENSG00000119042 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SATB1 | Gene migrated from ENSG00000182568 to ENSG00000182568 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SASS6 | Gene migrated from ENSG00000156876 to ENSG00000156876 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SART3 | Gene migrated from ENSG00000075856 to ENSG00000075856 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SARS2 | Gene migrated from ENSG00000104835 to ENSG00000104835 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SARS1 | Gene symbol changed from SARS to SARS1 during gene set migration (ENSG00000031698 -> ENSG00000031698) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SAMHD1 | Gene migrated from ENSG00000101347 to ENSG00000101347 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | SAMD9 | Gene migrated from ENSG00000205413 to ENSG00000205413 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RYBP | Gene migrated from ENSG00000163602 to ENSG00000163602 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RUNX1T1 | Gene migrated from ENSG00000079102 to ENSG00000079102 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RTTN | Gene migrated from ENSG00000176225 to ENSG00000176225 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RTN4IP1 | Gene migrated from ENSG00000130347 to ENSG00000130347 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RTF1 | Gene migrated from ENSG00000137815 to ENSG00000137815 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RTEL1 | Gene migrated from ENSG00000258366 to ENSG00000258366 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RSRC1 | Gene migrated from ENSG00000174891 to ENSG00000174891 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RSPRY1 | Gene migrated from ENSG00000159579 to ENSG00000159579 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RSF1 | Gene migrated from ENSG00000048649 to ENSG00000048649 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RRM2B | Gene migrated from ENSG00000048392 to ENSG00000048392 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RREB1 | Gene migrated from ENSG00000124782 to ENSG00000124782 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RRAS2 | Gene migrated from ENSG00000133818 to ENSG00000133818 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPS6KC1 | Gene migrated from ENSG00000136643 to ENSG00000136643 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPS6KA3 | Gene migrated from ENSG00000177189 to ENSG00000177189 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPS4X | Gene migrated from ENSG00000198034 to ENSG00000198034 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPL10 | Gene migrated from ENSG00000147403 to ENSG00000147403 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPIA | Gene migrated from ENSG00000153574 to ENSG00000153574 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPH3A | Gene migrated from ENSG00000089169 to ENSG00000089169 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RPGRIP1L | Gene migrated from ENSG00000103494 to ENSG00000103494 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RORA | Gene migrated from ENSG00000069667 to ENSG00000069667 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ROR2 | Gene migrated from ENSG00000169071 to ENSG00000169071 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ROGDI | Gene migrated from ENSG00000067836 to ENSG00000067836 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ROBO1 | Gene migrated from ENSG00000169855 to ENSG00000169855 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | RNU7-1 | Gene migrated from ENSG00000238923 to ENSG00000238923 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LIG4 | Gene migrated from ENSG00000174405 to ENSG00000174405 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LIAS | Gene migrated from ENSG00000121897 to ENSG00000121897 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LHX2 | Gene migrated from ENSG00000106689 to ENSG00000106689 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LGI3 | Gene migrated from ENSG00000168481 to ENSG00000168481 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LGI1 | Gene migrated from ENSG00000108231 to ENSG00000108231 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LETM1 | Gene migrated from ENSG00000168924 to ENSG00000168924 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LEO1 | Gene migrated from ENSG00000166477 to ENSG00000166477 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LAS1L | Gene migrated from ENSG00000001497 to ENSG00000001497 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LARS2 | Gene migrated from ENSG00000011376 to ENSG00000011376 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LARS1 | Gene symbol changed from LARS to LARS1 during gene set migration (ENSG00000133706 -> ENSG00000133706) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LARP7 | Gene migrated from ENSG00000174720 to ENSG00000174720 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LARP1 | Gene migrated from ENSG00000155506 to ENSG00000155506 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LARGE1 | Gene migrated from ENSG00000133424 to ENSG00000133424 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LAMP2 | Gene migrated from ENSG00000005893 to ENSG00000005893 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LAMC3 | Gene migrated from ENSG00000050555 to ENSG00000050555 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LAMB2 | Gene migrated from ENSG00000172037 to ENSG00000172037 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LAMB1 | Gene migrated from ENSG00000091136 to ENSG00000091136 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LAMA2 | Gene migrated from ENSG00000196569 to ENSG00000196569 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LAMA1 | Gene migrated from ENSG00000101680 to ENSG00000101680 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | LAGE3 | Gene migrated from ENSG00000196976 to ENSG00000196976 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | L2HGDH | Gene migrated from ENSG00000087299 to ENSG00000087299 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | L1CAM | Gene migrated from ENSG00000198910 to ENSG00000198910 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KRAS | Gene migrated from ENSG00000133703 to ENSG00000133703 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KPTN | Gene migrated from ENSG00000118162 to ENSG00000118162 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KNL1 | Gene migrated from ENSG00000137812 to ENSG00000137812 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KMT5B | Gene migrated from ENSG00000110066 to ENSG00000110066 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KMT2E | Gene migrated from ENSG00000005483 to ENSG00000005483 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KMT2D | Gene migrated from ENSG00000167548 to ENSG00000167548 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KMT2C | Gene migrated from ENSG00000055609 to ENSG00000055609 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KMT2B | Gene migrated from ENSG00000272333 to ENSG00000272333 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KMT2A | Gene migrated from ENSG00000118058 to ENSG00000118058 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KLHL7 | Gene migrated from ENSG00000122550 to ENSG00000122550 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KLHL20 | Gene migrated from ENSG00000076321 to ENSG00000076321 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KLHL15 | Gene migrated from ENSG00000174010 to ENSG00000174010 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KLHL13 | Gene migrated from ENSG00000003096 to ENSG00000003096 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KLF7 | Gene migrated from ENSG00000118263 to ENSG00000118263 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF7 | Gene migrated from ENSG00000166813 to ENSG00000166813 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF5C | Gene migrated from ENSG00000168280 to ENSG00000168280 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF4A | Gene migrated from ENSG00000090889 to ENSG00000090889 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF2A | Gene migrated from ENSG00000068796 to ENSG00000068796 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF26A | Gene migrated from ENSG00000066735 to ENSG00000066735 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF21B | Gene migrated from ENSG00000116852 to ENSG00000116852 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIFBP | Gene symbol changed from KIF1BP to KIFBP during gene set migration (ENSG00000198954 -> ENSG00000198954) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF1A | Gene migrated from ENSG00000130294 to ENSG00000130294 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF14 | Gene migrated from ENSG00000118193 to ENSG00000118193 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIF11 | Gene migrated from ENSG00000138160 to ENSG00000138160 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIDINS220 | Gene migrated from ENSG00000134313 to ENSG00000134313 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | BLTP1 | Gene symbol changed from KIAA1109 to BLTP1 during gene set migration (ENSG00000138688 -> ENSG00000138688) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KIAA0586 | Gene migrated from ENSG00000100578 to ENSG00000100578 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KATNIP | Gene symbol changed from KIAA0556 to KATNIP during gene set migration (ENSG00000047578 -> ENSG00000047578) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM6B | Gene migrated from ENSG00000132510 to ENSG00000132510 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM6A | Gene migrated from ENSG00000147050 to ENSG00000147050 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM5C | Gene migrated from ENSG00000126012 to ENSG00000126012 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM5B | Gene migrated from ENSG00000117139 to ENSG00000117139 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM5A | Gene migrated from ENSG00000073614 to ENSG00000073614 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM4B | Gene migrated from ENSG00000127663 to ENSG00000127663 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM3B | Gene migrated from ENSG00000120733 to ENSG00000120733 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM2B | Gene migrated from ENSG00000089094 to ENSG00000089094 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM2A | Gene migrated from ENSG00000173120 to ENSG00000173120 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KDM1A | Gene migrated from ENSG00000004487 to ENSG00000004487 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCTD7 | Gene migrated from ENSG00000243335 to ENSG00000243335 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCTD3 | Gene migrated from ENSG00000136636 to ENSG00000136636 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNT2 | Gene migrated from ENSG00000162687 to ENSG00000162687 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNT1 | Gene migrated from ENSG00000107147 to ENSG00000107147 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNQ5 | Gene migrated from ENSG00000185760 to ENSG00000185760 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNQ3 | Gene migrated from ENSG00000184156 to ENSG00000184156 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNQ2 | Gene migrated from ENSG00000075043 to ENSG00000075043 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNN3 | Gene migrated from ENSG00000143603 to ENSG00000143603 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNN2 | Gene migrated from ENSG00000080709 to ENSG00000080709 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNMA1 | Gene migrated from ENSG00000156113 to ENSG00000156113 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNK9 | Gene migrated from ENSG00000169427 to ENSG00000169427 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNK4 | Gene migrated from ENSG00000182450 to ENSG00000182450 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNJ6 | Gene migrated from ENSG00000157542 to ENSG00000157542 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNJ4 | Gene migrated from ENSG00000168135 to ENSG00000168135 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNJ10 | Gene migrated from ENSG00000177807 to ENSG00000177807 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNH5 | Gene migrated from ENSG00000140015 to ENSG00000140015 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNH1 | Gene migrated from ENSG00000143473 to ENSG00000143473 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCND3 | Gene migrated from ENSG00000171385 to ENSG00000171385 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCND2 | Gene migrated from ENSG00000184408 to ENSG00000184408 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCND1 | Gene migrated from ENSG00000102057 to ENSG00000102057 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNC2 | Gene migrated from ENSG00000166006 to ENSG00000166006 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNC1 | Gene migrated from ENSG00000129159 to ENSG00000129159 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNB2 | Gene migrated from ENSG00000182674 to ENSG00000182674 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNB1 | Gene migrated from ENSG00000158445 to ENSG00000158445 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNA3 | Gene migrated from ENSG00000177272 to ENSG00000177272 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNA2 | Gene migrated from ENSG00000177301 to ENSG00000177301 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KBTBD2 | Gene migrated from ENSG00000170852 to ENSG00000170852 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KATNB1 | Gene migrated from ENSG00000140854 to ENSG00000140854 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KAT8 | Gene migrated from ENSG00000103510 to ENSG00000103510 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KAT6B | Gene migrated from ENSG00000156650 to ENSG00000156650 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KAT6A | Gene migrated from ENSG00000083168 to ENSG00000083168 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KAT5 | Gene migrated from ENSG00000172977 to ENSG00000172977 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KARS1 | Gene symbol changed from KARS to KARS1 during gene set migration (ENSG00000065427 -> ENSG00000065427) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KANSL1 | Gene migrated from ENSG00000120071 to ENSG00000120071 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | JMJD1C | Gene migrated from ENSG00000171988 to ENSG00000171988 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | JKAMP | Gene migrated from ENSG00000050130 to ENSG00000050130 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | JARID2 | Gene migrated from ENSG00000008083 to ENSG00000008083 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | JAM3 | Gene migrated from ENSG00000166086 to ENSG00000166086 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IVD | Gene migrated from ENSG00000128928 to ENSG00000128928 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ITSN1 | Gene migrated from ENSG00000205726 to ENSG00000205726 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ITPR1 | Gene migrated from ENSG00000150995 to ENSG00000150995 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ITPA | Gene migrated from ENSG00000125877 to ENSG00000125877 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ITGAV | Gene migrated from ENSG00000138448 to ENSG00000138448 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ITFG2 | Gene migrated from ENSG00000111203 to ENSG00000111203 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | CRPPA | Gene symbol changed from ISPD to CRPPA during gene set migration (ENSG00000214960 -> ENSG00000214960) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA2 | Gene migrated from ENSG00000165898 to ENSG00000165898 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | ISCA1 | Gene migrated from ENSG00000135070 to ENSG00000135070 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IRX5 | Gene migrated from ENSG00000176842 to ENSG00000176842 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IRF2BPL | Gene migrated from ENSG00000119669 to ENSG00000119669 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IREB2 | Gene migrated from ENSG00000136381 to ENSG00000136381 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IQSEC2 | Gene migrated from ENSG00000124313 to ENSG00000124313 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IQSEC1 | Gene migrated from ENSG00000144711 to ENSG00000144711 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IPO8 | Gene migrated from ENSG00000133704 to ENSG00000133704 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INTS6 | Gene migrated from ENSG00000102786 to ENSG00000102786 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INTS13 | Gene migrated from ENSG00000064102 to ENSG00000064102 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INTS11 | Gene migrated from ENSG00000127054 to ENSG00000127054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INTS1 | Gene migrated from ENSG00000164880 to ENSG00000164880 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INPP5K | Gene migrated from ENSG00000132376 to ENSG00000132376 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INPP5E | Gene migrated from ENSG00000148384 to ENSG00000148384 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | INPP4A | Gene migrated from ENSG00000040933 to ENSG00000040933 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IMPDH2 | Gene migrated from ENSG00000178035 to ENSG00000178035 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IL1RAPL1 | Gene migrated from ENSG00000169306 to ENSG00000169306 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IKBKG | Gene migrated from ENSG00000269335 to ENSG00000269335 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IGF1R | Gene migrated from ENSG00000140443 to ENSG00000140443 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IGF1 | Gene migrated from ENSG00000017427 to ENSG00000017427 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IFT74 | Gene migrated from ENSG00000096872 to ENSG00000096872 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IFT27 | Gene migrated from ENSG00000100360 to ENSG00000100360 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IFT172 | Gene migrated from ENSG00000138002 to ENSG00000138002 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IFIH1 | Gene migrated from ENSG00000115267 to ENSG00000115267 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IER3IP1 | Gene migrated from ENSG00000134049 to ENSG00000134049 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IDUA | Gene migrated from ENSG00000127415 to ENSG00000127415 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IDS | Gene migrated from ENSG00000010404 to ENSG00000010404 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | IDH2 | Gene migrated from ENSG00000182054 to ENSG00000182054 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | AARS1 | Gene symbol changed from AARS to AARS1 during gene set migration (ENSG00000090861 -> ENSG00000090861) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | KCNA6 | Gene migrated from ENSG00000151079 to ENSG00000151079 (gene set migration) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v2.0 | Panel migrated to gene set Ensemblv115. Source version: v1.831 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.831 | CLUAP1 |
Sarah Milton gene: CLUAP1 was added gene: CLUAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature,Literature Mode of inheritance for gene: CLUAP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CLUAP1 were set to 34209753; 28679688; 26820066 Phenotypes for gene: CLUAP1 were set to Leber congenital amaurosis, MONDO:0018998, CLUAP1-related; Ciliopathy, MONDO:0005308, CLUAP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.830 | PTPRD |
Sarah Milton gene: PTPRD was added gene: PTPRD was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: PTPRD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPRD were set to 37056996; 31088393; 38890753 Phenotypes for gene: PTPRD were set to Neurodevelopmental disorder, MONDO:0700092, PTPRD related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.829 | TMEM161B |
Zornitza Stark gene: TMEM161B was added gene: TMEM161B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: TMEM161B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM161B were set to 37486637; 36669109; 36669111 Phenotypes for gene: TMEM161B were set to Neurodevelopmental disorder, MONDO:0700092, TMEM161B-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.827 | IRF2BP1 |
Zornitza Stark changed review comment from: PMID 38091987 reports two unrelated individuals with de novo truncating IRF2BP1 variants presenting with neurodevelopmental disorder, severe immunodeficiency, microcephaly and developmental delay, while PMID 37501076 adds a third unrelated individual with a de novo nonsense IRF2BP1 variant causing neonatal‑onset microcephaly, epilepsy, hypotonia and global developmental delay. Sources: Literature; to: PMID 38091987 reports two unrelated individuals with de novo truncating IRF2BP1 variants presenting with neurodevelopmental disorder, severe immunodeficiency, microcephaly and developmental delay, while PMID 37501076 adds a third unrelated individual with a de novo nonsense IRF2BP1 variant causing neonatal‑onset microcephaly, epilepsy, hypotonia and global developmental delay. However, all three individuals were identified as part of large cohort studies and I also note LoF variants in gnomAD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.827 | IRF2BP1 |
Zornitza Stark gene: IRF2BP1 was added gene: IRF2BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: IRF2BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: IRF2BP1 were set to 38091987; 37501076 Phenotypes for gene: IRF2BP1 were set to Neurodevelopmental disorder, MONDO:0700092, IRF2BP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.826 | DENR |
Zornitza Stark gene: DENR was added gene: DENR was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: DENR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DENR were set to 27239039 Phenotypes for gene: DENR were set to Neurodevelopmental disorder, MONDO:0700092, DENR-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.824 | NCOR1 |
Bryony Thompson gene: NCOR1 was added gene: NCOR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NCOR1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: NCOR1 were set to 32034166; 31849593; 30664766; 30289594; 29483668 Phenotypes for gene: NCOR1 were set to complex neurodevelopmental disorder, MONDO:0100038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.820 | PLAT |
Zornitza Stark gene: PLAT was added gene: PLAT was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen,ClinGen disputed tags were added to gene: PLAT. Mode of inheritance for gene: PLAT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLAT were set to 39574431; 37808270; 27417437 Phenotypes for gene: PLAT were set to Syndromic disease, MONDO:0002254, PLAT-related; Thrombophilia, familial, due to decreased release of tissue plasminogen activator MONDO:0012872 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.818 | NLGN1 | Zornitza Stark Publications for gene: NLGN1 were set to PMID: 30460678 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.812 | MACF1 | Lucy Spencer Publications for gene: MACF1 were set to 30471716 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.811 | RING1 | Sangavi Sivagnanasundram Publications for gene: RING1 were set to 29386386; 41653922 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.811 | RING1 | Sangavi Sivagnanasundram Publications for gene: RING1 were set to 29386386 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.806 | UBA7 |
Bryony Thompson gene: UBA7 was added gene: UBA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: UBA7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UBA7 were set to 42023152; 33710394; 28397838 Phenotypes for gene: UBA7 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.805 | MELK |
Zornitza Stark gene: MELK was added gene: MELK was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: MELK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MELK were set to 41973119 Phenotypes for gene: MELK were set to Neurodevelopmental disorder, MONDO:0700092, MELK-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.804 | CECR2 |
Lucy Spencer gene: CECR2 was added gene: CECR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: CECR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CECR2 were set to 41964217; 37424722 Phenotypes for gene: CECR2 were set to Neurodevelopmental disorder, MONDO:0700092, CECR2-related; neural tube defects, susceptibility to MONDO:0020705, CECR2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.800 | SRRM4 |
chirag patel gene: SRRM4 was added gene: SRRM4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SRRM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SRRM4 were set to 41958152 Phenotypes for gene: SRRM4 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM4-related Mode of pathogenicity for gene: SRRM4 was set to Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.799 | RPS4X |
chirag patel gene: RPS4X was added gene: RPS4X was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: RPS4X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: RPS4X were set to 42031741 Phenotypes for gene: RPS4X were set to Neurodevelopmental disorder, MONDO:0700092, RPS4X-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.798 | DRD1 |
chirag patel gene: DRD1 was added gene: DRD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: DRD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DRD1 were set to 41966088; 37048120 Phenotypes for gene: DRD1 were set to Neurodevelopmental disorder, MONDO:0700092, DRD1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.798 | CDK6 | chirag patel Publications for gene: CDK6 were set to 23918663; 40801391; 41856556 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.797 | CDK6 | chirag patel Publications for gene: CDK6 were set to 23918663; 40801391 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.793 | PDS5B | chirag patel Publications for gene: PDS5B were set to 41810376 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.795 | PDS5B | chirag patel Publications for gene: PDS5B were set to 41810376 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.794 | PDS5B | chirag patel Publications for gene: PDS5B were set to Neurodevelopmental disorder, MONDO:0700092, PDS5B-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.793 | PDS5B | chirag patel Publications for gene: PDS5B were set to 10.64898/2026.02.23.26346364 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.790 | PDS5A | chirag patel Publications for gene: PDS5A were set to 30158690; 41810376 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.790 | PDS5A | chirag patel Publications for gene: PDS5A were set to 10.64898/2026.02.23.26346364; 30158690 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.787 | MDGA1 |
chirag patel gene: MDGA1 was added gene: MDGA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: MDGA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MDGA1 were set to 41862769; 40585099 Phenotypes for gene: MDGA1 were set to Neurodevelopmental disorder, MONDO:0700092, MDGA1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.780 | CDK4 | Lucy Spencer Publications for gene: CDK4 were set to 40210435 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.777 | SUPT6H |
Lucy Spencer gene: SUPT6H was added gene: SUPT6H was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: SUPT6H was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SUPT6H were set to 41864309 Phenotypes for gene: SUPT6H were set to Neurodevelopmental disorder, MONDO:0700092, SUPT6H-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.776 | WWP1 |
Zornitza Stark gene: WWP1 was added gene: WWP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: WWP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WWP1 were set to 41786693; 32699206 Phenotypes for gene: WWP1 were set to Neurodevelopmental disorder, MONDO:0700092, WWP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.775 | EMG1 | Zornitza Stark Publications for gene: EMG1 were set to 19463982 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.774 | KLHL15 | Zornitza Stark Publications for gene: KLHL15 were set to 25644381; 24817631 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.772 | GTF2E2 | Zornitza Stark Publications for gene: GTF2E2 were set to PMID: 28973399 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.770 | GSX2 | Zornitza Stark Publications for gene: GSX2 were set to 31412107 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.768 | OLA1 |
Zornitza Stark gene: OLA1 was added gene: OLA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: OLA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OLA1 were set to 41887223 Phenotypes for gene: OLA1 were set to Neurodevelopmental disorder, MONDO:0700092, OLA1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.766 | SUPT4H1 |
Sarah Milton gene: SUPT4H1 was added gene: SUPT4H1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SUPT4H1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SUPT4H1 were set to 41842694 Phenotypes for gene: SUPT4H1 were set to Syndromic disease, MONDO:0002254, SUPT4H1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.765 | LMAN2L | Zornitza Stark Publications for gene: LMAN2L were set to PMID: 31020005; 26566883 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.763 | ATG12 |
Sangavi Sivagnanasundram gene: ATG12 was added gene: ATG12 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: ATG12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATG12 were set to 41895291 Phenotypes for gene: ATG12 were set to ATG12-related neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.761 | NDUFA5 |
Zornitza Stark gene: NDUFA5 was added gene: NDUFA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NDUFA5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA5 were set to 41916321 Phenotypes for gene: NDUFA5 were set to Complex I deficiency Penetrance for gene: NDUFA5 were set to Complete |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.760 | SLC20A2 | Zornitza Stark Publications for gene: SLC20A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.757 | SLC20A2 |
Zornitza Stark edited their review of gene: SLC20A2: Added comment: PMID 41458256: Reports a single individual a homozygous nonsense SLC20A2 variant presenting with infantile primary familial brain calcification, cerebral arterial vasculopathy and ischaemic stroke. Individual exhibited seizures, hypotonia, poor feeding, and extensive ischaemic changes. PMID 35881308: reports two siblings from a consanguineous Turkish family with a homozygous splice‑site loss‑of‑function variant NM_006749.5:c.1794+1G>A. The affected children presented with severe paediatric‑onset features resembling congenital CMV infection: growth retardation, bilateral cataracts, microcephaly, seizures, cerebral atrophy, corpus callosum hypoplasia and brain microcalcifications. Gene is classically associated with a milder mono-allelic disorder, which typically does not involve ID.; Changed rating: AMBER; Changed publications: 41458256, 35881308; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.755 | FRMD4A | Zornitza Stark Publications for gene: FRMD4A were set to 25388005; 30214071 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.752 | NPRL2 |
Lucy Spencer gene: NPRL2 was added gene: NPRL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NPRL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NPRL2 were set to 26505888; 34376795; 40804712; 30093711 Phenotypes for gene: NPRL2 were set to epilepsy, familial focal, with variable foci 2 (MIM#617116) Review for gene: NPRL2 was set to AMBER Added comment: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy; PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2 PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2 PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad Borderline amber/green for this panel Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.749 | EMX2 | Krithika Murali Publications for gene: EMX2 were set to 8528262; 9359037; 9153481; 9153481; 18409201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.745 | DIP2B | Bryony Thompson Publications for gene: DIP2B were set to 17236128 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.742 | KCNJ4 |
chirag patel gene: KCNJ4 was added gene: KCNJ4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: KCNJ4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNJ4 were set to 41830586 Phenotypes for gene: KCNJ4 were set to Neurodevelopmental disorder, MONDO:0700092, KCNJ4-related Mode of pathogenicity for gene: KCNJ4 was set to Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.741 | WDTC1 |
Lucy Spencer gene: WDTC1 was added gene: WDTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: WDTC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WDTC1 were set to 41793087 Phenotypes for gene: WDTC1 were set to Neurodevelopmental disorder MONDO:0700092, WDTC1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.740 | SLC6A17 | Lucy Spencer Publications for gene: SLC6A17 were set to 25704603; 23672601 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.736 | TSEN54 | Zornitza Stark Publications for gene: TSEN54 were set to 20301773 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.734 | MT-TW |
Zornitza Stark gene: MT-TW was added gene: MT-TW was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-TW. Mode of inheritance for gene gene: MT-TW was set to MITOCHONDRIAL Publications for gene: MT-TW were set to 7695240; 9266739; 9673981; 12776230; 15054399; 18337306; 19809478; 26524491; 23841600; 30937556 Phenotypes for gene: MT-TW were set to Mitochondrial disease (MONDO:0044970), MT-TW-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.733 | MT-TV |
Zornitza Stark gene: MT-TV was added gene: MT-TV was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-TV. Mode of inheritance for gene gene: MT-TV was set to MITOCHONDRIAL Publications for gene: MT-TV were set to 9450773; 12056939; 19252805; 15320572; 18314141; 24691472; 39468830 Phenotypes for gene: MT-TV were set to Mitochondrial disease (MONDO:0044970), MT-TV-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.732 | MT-TS2 |
Zornitza Stark gene: MT-TS2 was added gene: MT-TS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-TS2. Mode of inheritance for gene gene: MT-TS2 was set to MITOCHONDRIAL Publications for gene: MT-TS2 were set to 9792552; 10090882; 16950817; 21257182; 22369973; 22378285 Phenotypes for gene: MT-TS2 were set to Mitochondrial disease (MONDO:0044970), MT-TS2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.731 | MT-TS1 |
Zornitza Stark gene: MT-TS1 was added gene: MT-TS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-TS1. Mode of inheritance for gene gene: MT-TS1 was set to MITOCHONDRIAL Publications for gene: MT-TS1 were set to 7669057; 9778262; 14605505; 23696415; 33279600; 7581383 Phenotypes for gene: MT-TS1 were set to Mitochondrial disease (MONDO:0044970), MT-TS1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.730 | MT-TR |
Zornitza Stark gene: MT-TR was added gene: MT-TR was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-TR. Mode of inheritance for gene gene: MT-TR was set to MITOCHONDRIAL Publications for gene: MT-TR were set to 15286228; 17588757; 19809478; 22781096 Phenotypes for gene: MT-TR were set to mitochondrial disease (MONDO:0044970), MT-TR-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.729 | ASAH2 |
Zornitza Stark gene: ASAH2 was added gene: ASAH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: ASAH2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ASAH2 were set to 41808410 Phenotypes for gene: ASAH2 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.726 | ABCB7 |
Lucy Spencer gene: ABCB7 was added gene: ABCB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABCB7 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: ABCB7 were set to 11050011; 26242992 Phenotypes for gene: ABCB7 were set to Anaemia, sideroblastic, with ataxia, MIM# 301310 Review for gene: ABCB7 was set to AMBER Added comment: Some limited reports of developmental delay/ID in the literature and mentioned in the ClinGen review Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.724 | RNU6ATAC | Zornitza Stark Publications for gene: RNU6ATAC were set to 40975062 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.720 | RNPC3 | chirag patel Publications for gene: RNPC3 were set to 29866761; 32462814; 33650182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.716 | POC1A | chirag patel Publications for gene: POC1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.712 | TRIM71 | Zornitza Stark Publications for gene: TRIM71 were set to 29983323; 32168371; 30975633; 40892928 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.711 | TRIM71 |
Zornitza Stark gene: TRIM71 was added gene: TRIM71 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: TRIM71 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TRIM71 were set to 29983323; 32168371; 30975633; 40892928 Phenotypes for gene: TRIM71 were set to Congenital hydrocephalus 4 (MIM#618667) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.709 | TNK2 |
Sarah Milton gene: TNK2 was added gene: TNK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: TNK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: TNK2 were set to 27977884; 23686771; 31517310 Phenotypes for gene: TNK2 were set to late onset infantile epilepsy; Mayer-Rokitansky-Küster-Hauser syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.705 | PDS5B |
chirag patel gene: PDS5B was added gene: PDS5B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: PDS5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PDS5B were set to 10.64898/2026.02.23.26346364 Phenotypes for gene: PDS5B were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.705 | PDS5A |
chirag patel gene: PDS5A was added gene: PDS5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: PDS5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PDS5A were set to 10.64898/2026.02.23.26346364; 30158690 Phenotypes for gene: PDS5A were set to Complex neurodevelopmental disorder, MONDO:0100038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.704 | FMO4 |
chirag patel gene: FMO4 was added gene: FMO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: FMO4 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: FMO4 were set to 41714691, 28940097 Phenotypes for gene: FMO4 were set to Neurodevelopmental disorder, MONDO:0700092; FMO4 related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.703 | NRDC | Zornitza Stark Publications for gene: NRDC were set to 41449824; 28017472; 34582790; 19935654 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.701 | VWA3B |
Zornitza Stark gene: VWA3B was added gene: VWA3B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for gene: VWA3B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VWA3B were set to 26157035; 41673450; 37772257 Phenotypes for gene: VWA3B were set to Spinocerebellar ataxia, autosomal recessive 22 MIM#616948 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.700 | XPOT |
Zornitza Stark gene: XPOT was added gene: XPOT was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature preprint tags were added to gene: XPOT. Mode of inheritance for gene: XPOT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: XPOT were set to 10.64898/2026.01.28.26344748 Phenotypes for gene: XPOT were set to Syndromic disease, MONDO:0002254 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.699 | WDR59 |
Zornitza Stark gene: WDR59 was added gene: WDR59 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature founder tags were added to gene: WDR59. Mode of inheritance for gene: WDR59 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR59 were set to 41715954 Phenotypes for gene: WDR59 were set to Syndromic disease, MONDO:0002254 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.698 | WAPL |
Zornitza Stark gene: WAPL was added gene: WAPL was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature preprint tags were added to gene: WAPL. Mode of inheritance for gene: WAPL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WAPL were set to 10.64898/2026.02.23.26346364; 30158690 Phenotypes for gene: WAPL were set to complex neurodevelopmental disorder, MONDO:0100038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.697 | C17orf80 |
Zornitza Stark gene: C17orf80 was added gene: C17orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature new gene name tags were added to gene: C17orf80. Mode of inheritance for gene: C17orf80 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C17orf80 were set to 41720819 Phenotypes for gene: C17orf80 were set to Mitochondrial disease, MONDO:0044970 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.695 | RDH11 |
Lucy Spencer gene: RDH11 was added gene: RDH11 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list Mode of inheritance for gene: RDH11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RDH11 were set to 24916380; 15634683; 30731079; 18326732 Phenotypes for gene: RDH11 were set to Retinal dystrophy, juvenile cataracts, and short stature syndrome, MIM# 616108 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.694 | RAB1A | Lucy Spencer Publications for gene: RAB1A were set to PMID: 37924809 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.690 | JKAMP |
Zornitza Stark gene: JKAMP was added gene: JKAMP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: JKAMP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: JKAMP were set to 41643666 Phenotypes for gene: JKAMP were set to Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM# 621533 Review for gene: JKAMP was set to GREEN Added comment: 14 individuals from 10 families reported. All had moderate to profound neurodevelopmental delay, intellectual disability, and infantile-onset epilepsy. Six were nonverbal, and the remaining individuals spoke only a few words. Five individuals had neurodevelopmental regression. Three individuals died suddenly; death was associated with seizures or status epilepticus in two. Thirteen individuals had hypotonia, 5 had visual impairment, 5 had microcephaly, and 1 had hearing loss. Brain MRIs showed cortical or cerebral atrophy in 11, delayed myelination in 6, and diffuse demyelinating disease in 1. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.688 | RBFOX3 |
Lucy Spencer gene: RBFOX3 was added gene: RBFOX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: RBFOX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RBFOX3 were set to 35951651; 36117209; 24039908; 40011789 Phenotypes for gene: RBFOX3 were set to Neurodevelopmental disorder (MONDO:0700092), RBFOX3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.686 | TRAPPC2L | Krithika Murali Phenotypes for gene: TRAPPC2L were changed from Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 to Neurodevelopmental disorder - MONDO:0700092, TRAPPC2L-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.686 | TRAPPC2L | Krithika Murali Publications for gene: TRAPPC2L were set to 36849228; 32843486; 30120216 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.685 | TRAPPC2L | Krithika Murali Publications for gene: TRAPPC2L were set to 30120216; 32843486 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.683 | PPP1R15B | Lucy Spencer Publications for gene: PPP1R15B were set to 26159176; 26307080; 27640355 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.679 | ATP2B3 |
Bryony Thompson changed review comment from: PMIDs 25953895, 27653636, 28807751, 36207321 and 37821930 report 11 patients from 8 unrelated families with hemizygous ATP2B3 missense variants causing early‑onset cerebellar ataxia, hypotonia, developmental delay and sometimes seizures or dystonia. 2 of the patients had alternate diagnoses in PMM2 & LAMA1. Functional studies (HeLa Ca2+ assays, yeast complementation, homology modelling) demonstrate loss‑of‑function or altered pump activity. Single reports also link ATP2B3 to autism (PMID 28720891) and fetal akinesia (PMID 31680123).; to: At least 3 cases reported with ID/developmental delay without other variants detected PMIDs 25953895, 27653636, 28807751, 36207321 and 37821930 report 11 patients from 8 unrelated families with hemizygous ATP2B3 missense variants causing early‑onset cerebellar ataxia, hypotonia, developmental delay and sometimes seizures or dystonia. 2 of the patients had alternate diagnoses in PMM2 & LAMA1. Functional studies (HeLa Ca2+ assays, yeast complementation, homology modelling) demonstrate loss‑of‑function or altered pump activity. Single reports also link ATP2B3 to autism (PMID 28720891) and fetal akinesia (PMID 31680123). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.676 | NAV2 |
Zornitza Stark gene: NAV2 was added gene: NAV2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: NAV2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NAV2 were set to PMID:35218524 Phenotypes for gene: NAV2 were set to Developmental delay; cerebellar hypoplasia; cerebellar dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.675 | LRRC32 | Zornitza Stark Publications for gene: LRRC32 were set to 30976112 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.674 | RSF1 |
Rylee Peters gene: RSF1 was added gene: RSF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: RSF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RSF1 were set to 41606215 Phenotypes for gene: RSF1 were set to Neurodevelopmental disorder, MONDO:0700092, RSF1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.673 | EXOC8 |
Bryony Thompson gene: EXOC8 was added gene: EXOC8 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: EXOC8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOC8 were set to 32103185; 22700954; 36344539; 35460391 Phenotypes for gene: EXOC8 were set to neurodevelopmental disorder with microcephaly, seizures, and brain atrophy MONDO:0033662 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.672 | ARHGEF2 |
Bryony Thompson gene: ARHGEF2 was added gene: ARHGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARHGEF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ARHGEF2 were set to 28453519 Phenotypes for gene: ARHGEF2 were set to neurodevelopmental disorder with midbrain and hindbrain malformations MONDO:0056797 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.670 | EPG5 | Zornitza Stark Publications for gene: EPG5 were set to 23222957; 26917586 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.669 | EPG5 | Zornitza Stark edited their review of gene: EPG5: Added comment: Neurodevelopmental disorder with parkinsonism or other movement abnormalities (NEDPAM) is an autosomal recessive disorder characterized by mild to severe developmental delay or intellectual disability and movement abnormalities including spasticity, early onset-parkinsonism with dystonia, myoclonus, or a combination of these. Movement abnormalities may have onset from birth to adulthood in the sixth decade of life. Adolescent-onset dystonia and parkinsonism on the background of neurodevelopmental delay may be rapidly progressive, with cognitive decline. Patients may have additional features such as seizures and optic nerve atrophy. PMIDs 41053928, 36410285 and 40192014 report over 100 affected individuals.; Changed publications: 23222957, 26917586, 41053928, 36410285, 40192014; Changed phenotypes: Vici syndrome, MIM# 242840, Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.668 | RAPGEF2 |
Bryony Thompson gene: RAPGEF2 was added gene: RAPGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature STR tags were added to gene: RAPGEF2. Mode of inheritance for gene: RAPGEF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAPGEF2 were set to 41556274; 30636905 Phenotypes for gene: RAPGEF2 were set to Neurodevelopmental disorder, MONDO:0700092; amyotrophic lateral sclerosis MONDO:0004976 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.663 | CELSR1 |
Rylee Peters gene: CELSR1 was added gene: CELSR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CELSR1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CELSR1 were set to 41530147; 36453712 Review for gene: CELSR1 was set to GREEN Added comment: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls. PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.662 | TTBK1 |
Zornitza Stark gene: TTBK1 was added gene: TTBK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: TTBK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTBK1 were set to 41545183 Phenotypes for gene: TTBK1 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.661 | TMEM189 |
chirag patel gene: TMEM189 was added gene: TMEM189 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: TMEM189 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM189 were set to 41491239 Phenotypes for gene: TMEM189 were set to Neurodevelopmental disorder, MONDO:0700092, PEDS1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.659 | MAP2K4 |
Sangavi Sivagnanasundram gene: MAP2K4 was added gene: MAP2K4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAP2K4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAP2K4 were set to 41480045 Phenotypes for gene: MAP2K4 were set to Neurodevelopmental disorder, MONDO:0700092 Mode of pathogenicity for gene: MAP2K4 was set to Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.658 | CTNND2 | Zornitza Stark Publications for gene: CTNND2 were set to 25839933; 29127138; 25807484; 38604781; 25473103; 31814264 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.656 | CTNND2 |
Zornitza Stark edited their review of gene: CTNND2: Added comment: PMID 41502569 (preprint) reports phenotypic and molecular information for 57 individuals, 42 previously unpublished, with heterozygous CTNND2 variants. The 41 CTNND2 variants included 12 previously reported loss-of-function- and one missense variant, and 28 novel variants comprising 10 missense and 18 predicted loss-of-function changes. Eight of the novel variants occurred de novo, and 12 were inherited from a parent with a neurodevelopmental phenotype. The most common clinical features were developmental delay (90%), intellectual disability (74%), and behavioral abnormalities (79%). Functional studies revealed impaired early neurogenesis in one patient-derived line, characterized by aberrant neural rosette formation. Transcriptome analysis showed dysregulated WNT signaling, and partial rescue of these defects was achieved by modulating the WNT pathway, highlighting δ-catenin's role in early neural development. Note several of the reported missense variants in this gene have high gnomAD counts so these should be interpreted with caution. Nevertheless, large number of individuals reported now with LoF variants and NDD phenotype.; Changed rating: GREEN; Changed publications: 25839933, 29127138, 25807484, 41502569; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CTNND2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.655 | PGBD5 |
Zornitza Stark gene: PGBD5 was added gene: PGBD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PGBD5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PGBD5 were set to 41533792 Phenotypes for gene: PGBD5 were set to Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482 Review for gene: PGBD5 was set to GREEN Added comment: 10 individuals reported from 5 consanguineous families with bi-allelic variants in this gene and global developmental delay with impaired intellectual development, delayed motor skills, and motor abnormalities. Affected individuals were unable to speak or walk due to peripheral spasticity, ataxia, or hypotonia, and developed early-onset seizures. Additional features included dysmorphic facies, short stature, and brain imaging abnormalities, such as thin corpus callosum and cerebellar atrophy. Pgbd5-null mice were runted and had significantly smaller brains compared to wildtype. Mutant mice showed increased locomotor activity, reduced anxiety-like behavior, impaired motor coordination, increased susceptibility to seizures, and decreased cortical volume on brain MRI. Analysis of neurons derived from Pgbd5-null mouse brains showed reduced DNA breakage and repair in postmitotic neuronal precursors during cortical development compared to controls. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.650 | ISCA-37448-Loss |
Sarah Milton Region: ISCA-37448-Loss was added Region: ISCA-37448-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-37448-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37448-Loss were set to Chromosome 15q11.2 deletion syndrome, MIM#615656 Penetrance for Region: ISCA-37448-Loss were set to Incomplete |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.649 | SMARCA1 | Zornitza Stark Publications for gene: SMARCA1 were set to 37841849 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.645 | ISCA-46743-Gain |
Sarah Milton Region: ISCA-46743-Gain was added Region: ISCA-46743-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-46743-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Phenotypes for Region: ISCA-46743-Gain were set to Xq25 duplication syndrome, MIM#300979 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.644 | ISCA-46304-Gain |
Sarah Milton Region: ISCA-46304-Gain was added Region: ISCA-46304-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-46304-Gain was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for Region: ISCA-46304-Gain were set to PMID: 29141583, 22679399 Phenotypes for Region: ISCA-46304-Gain were set to Syndromic X-linked intellectual disability Lubs type, MONDO:0010283 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.643 | ISCA-46300-Loss |
Sarah Milton Region: ISCA-46300-Loss was added Region: ISCA-46300-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-46300-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-46300-Loss were set to Chromosome 15q24 deletion syndrome, MONDO:0013256 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.642 | ISCA-46299-Gain |
Sarah Milton Region: ISCA-46299-Gain was added Region: ISCA-46299-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-46299-Gain. Mode of inheritance for Region: ISCA-46299-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for Region: ISCA-46299-Gain were set to PMID: 22840365 Phenotypes for Region: ISCA-46299-Gain were set to Xp11.22 microduplication syndrome MIM#300705 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.640 | SPART | Zornitza Stark Publications for gene: SPART were set to PMID: 26003402; 28679690; 27112432; 20437587; 12134148; 18413476; 31314595; 28875386 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.638 | NRDC |
Rylee Peters gene: NRDC was added gene: NRDC was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: NRDC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NRDC were set to 41449824; 28017472; 34582790; 19935654 Phenotypes for gene: NRDC were set to Neurodevelopmental disorder, MONDO:0700092, NRDC-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.636 | ARCN1 | Zornitza Stark Publications for gene: ARCN1 were set to 27476655; 33154040 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.634 | YWHAZ | Zornitza Stark Publications for gene: YWHAZ were set to 36001342 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.633 | MED14 |
Zornitza Stark gene: MED14 was added gene: MED14 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: MED14 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: MED14 were set to PMID: 40597352 Phenotypes for gene: MED14 were set to Neurodevelopmental disorder (MONDO:0700092), MED14-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.632 | SPNS1 |
Zornitza Stark gene: SPNS1 was added gene: SPNS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SPNS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPNS1 were set to 40608416; 38451736 Phenotypes for gene: SPNS1 were set to Lysosomal disorder, SPNS1-related, MONDO:0002561 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.631 | MTSS1L | Zornitza Stark Publications for gene: MTSS1L were set to PMID: 36067766 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.629 | SF3B1 | Zornitza Stark Publications for gene: SF3B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.628 | VPS51 | Zornitza Stark Publications for gene: VPS51 were set to 30624672; 31207318 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.626 | SEC31A | Zornitza Stark Publications for gene: SEC31A were set to 30464055; 40508110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.623 | ISCA-46296-Loss |
Sarah Milton Region: ISCA-46296-Loss was added Region: ISCA-46296-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-46296-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-46296-Loss were set to PMID: 25217958 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.622 | LAGE3 |
Sarah Milton gene: LAGE3 was added gene: LAGE3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Victorian Clinical Genetics Services Mode of inheritance for gene: LAGE3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: LAGE3 were set to 28805828 Phenotypes for gene: LAGE3 were set to Galloway-Mowat syndrome 2, X-linked, MIM# 301006 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.621 | ZNF185 |
Lucy Spencer gene: ZNF185 was added gene: ZNF185 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF185 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: ZNF185 were set to 41404552 Phenotypes for gene: ZNF185 were set to Cerebrooculonasal syndrome MONDO:0011575, ZNF185-related Review for gene: ZNF185 was set to RED Added comment: PMID 41404552 describes a single female individual with cerebro oculo nasal syndrome and a de novo heterozygous X linked frameshift ZNF185. The proband presented with developmental delay, moderate ID, dysmorphic facial features, cleft lip/palate, nasal anomaly, CHD and anopthalmia. She was shown to have skewed X-inactivation 19:81, however it is not stated if the skewing was towards the allele with the variant. The variant in this individual (p.Gln102SerfsTer18) is NMD predicted and absent from gnomad, however there are at least 6 NMD variants present in gnomad as hemizygous (4 with over 4 hemis) all of which also have over 5 heterozygotes Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.616 | GSPT2 | Zornitza Stark Publications for gene: GSPT2 were set to 28414775 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.615 | UNC13C |
Sangavi Sivagnanasundram gene: UNC13C was added gene: UNC13C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UNC13C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UNC13C were set to 41399760 Phenotypes for gene: UNC13C were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.614 | SEPT2 |
chirag patel gene: SEPT2 was added gene: SEPT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SEPT2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SEPT2 were set to 41408595 Phenotypes for gene: SEPT2 were set to Neurodevelopmental disorder, MONDO:0700092, SEPTIN2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.613 | PCBP1 |
Sarah Milton gene: PCBP1 was added gene: PCBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PCBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PCBP1 were set to 41415500 Phenotypes for gene: PCBP1 were set to Neurodevelopmental disorder, MONDO:0700092, PCBP1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.610 | NDUFA3 |
Zornitza Stark gene: NDUFA3 was added gene: NDUFA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NDUFA3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA3 were set to 41038977; 39661167 Phenotypes for gene: NDUFA3 were set to Mitochondrial disease, MONDO:0044970,NDUFA3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.609 | MIR17HG | Zornitza Stark Publications for gene: MIR17HG were set to PMID: 25391829; 21892160 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.604 | COPB1 | Zornitza Stark Publications for gene: COPB1 were set to 33632302 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.602 | CNP |
Zornitza Stark gene: CNP was added gene: CNP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: CNP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CNP were set to 32128616; 12590258; 40396300 Phenotypes for gene: CNP were set to Leukodystrophy, hypomyelinating, 20, MIM# 619071 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.601 | PFAS |
Zornitza Stark gene: PFAS was added gene: PFAS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: PFAS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PFAS were set to 40421664 Phenotypes for gene: PFAS were set to Inborn error of metabolism, MONDO:0019052, PFAS-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.600 | ISCA-46295-Loss |
Sarah Milton Region: ISCA-46295-Loss was added Region: ISCA-46295-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-46295-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for Region: ISCA-46295-Loss were set to PMID: 19289393 Phenotypes for Region: ISCA-46295-Loss were set to Chromosome 15q13.3 microdeletion syndrome MIM#612001; intellectual disability; seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.599 | ISCA-46290-Gain |
Sarah Milton Region: ISCA-46290-Gain was added Region: ISCA-46290-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-46290-Gain was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for Region: ISCA-46290-Gain were set to 19716111; 27605428; 29707408; 16900295 Phenotypes for Region: ISCA-46290-Gain were set to Chromosome Xp11.23-p11.22 duplication syndrome MIM#300801; intellectual disability; seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.598 | ISCA-37500-Loss |
Sarah Milton Region: ISCA-37500-Loss was added Region: ISCA-37500-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37500-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37500-Loss were set to 20921022; 24352913 Phenotypes for Region: ISCA-37500-Loss were set to Chromosome 15q25 deletion syndrome MIM#614294; intellectual disability; congenital abnormalities; haematological abnormalities |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.597 | ISCA-37498-Loss |
Sarah Milton Region: ISCA-37498-Loss was added Region: ISCA-37498-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for Region: ISCA-37498-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37498-Loss were set to 11q13.2q13.4 deletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.596 | DLAT | Zornitza Stark Publications for gene: DLAT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.594 | RNU4-2 | Zornitza Stark Publications for gene: RNU4-2 were set to 38991538 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.592 | ATP9A | Zornitza Stark Publications for gene: ATP9A were set to 34379057; 34764295 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.590 | ISCA-37494-Gain |
Sarah Milton Region: ISCA-37494-Gain was added Region: ISCA-37494-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37494-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for Region: ISCA-37494-Gain were set to 25927380; 20301461; 32043567; 32112660 Phenotypes for Region: ISCA-37494-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815; intellectual disability; hypotonia; seizures; spasticity; recurrent respiratory infections |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.590 | ISCA-37493-Loss |
Sarah Milton Region: ISCA-37493-Loss was added Region: ISCA-37493-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37493-Loss. Mode of inheritance for Region: ISCA-37493-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37493-Loss were set to 28283832; 31929334; 31830750; 30853971 Phenotypes for Region: ISCA-37493-Loss were set to 1q43q44 microdeletion syndrome; intellectual disability; seizures; microcephaly; corpus callosum abnormalities |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.589 | ISCA-37486-Loss |
Sarah Milton Region: ISCA-37486-Loss was added Region: ISCA-37486-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37486-Loss. Mode of inheritance for Region: ISCA-37486-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37486-Loss were set to 19914906; 32993859; 32732550; 32597026; 32537635 Phenotypes for Region: ISCA-37486-Loss were set to Chromosome 16p11.2 deletion syndrome, MIM#611913, distal BP2-BP3; intellectual disability; autism; obesity |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.588 | ISCA-37478-Loss |
Sarah Milton Region: ISCA-37478-Loss was added Region: ISCA-37478-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37478-Loss. Mode of inheritance for Region: ISCA-37478-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37478-Loss were set to 22045295 Phenotypes for Region: ISCA-37478-Loss were set to Angelman syndrome, MIM# 105830; Prader-Willi syndrome, MIM# 176270 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.587 | ISCA-37478-Gain |
Sarah Milton Region: ISCA-37478-Gain was added Region: ISCA-37478-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37478-Gain. Mode of inheritance for Region: ISCA-37478-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37478-Gain were set to Chromosome 15q11q13 duplication syndrome, MIM#608636; autism; intellectual disability; ataxia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.584 | ISCA-37468-Loss |
Sarah Milton Region: ISCA-37468-Loss was added Region: ISCA-37468-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen,Expert Review Green SV/CNV tags were added to Region: ISCA-37468-Loss. Mode of inheritance for Region: ISCA-37468-Loss was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for Region: ISCA-37468-Loss were set to PMID: 22126752; 16385466; 20186789 Phenotypes for Region: ISCA-37468-Loss were set to Chromosome Xp11.3 deletion syndrome MIM#300578; intellectual disability; retinal dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.583 | ISCA-37446-Loss |
Sarah Milton Region: ISCA-37446-Loss was added Region: ISCA-37446-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37446-Loss. Mode of inheritance for Region: ISCA-37446-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37446-Loss were set to 18179902; 23765049; 21671380 Phenotypes for Region: ISCA-37446-Loss were set to Chromosome 22q11.2 deletion syndrome, distal MIM#611867; intellectual disability; autism; multiple congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.582 | ISCA-37446-Gain |
Sarah Milton Region: ISCA-37446-Gain was added Region: ISCA-37446-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37446-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37446-Gain were set to PMID: 18707033 Phenotypes for Region: ISCA-37446-Gain were set to Chromosome 22q11.2 microduplication syndrome MIM#608363, proximal A-D |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.582 | ISCA-37443-Loss |
Sarah Milton Region: ISCA-37443-Loss was added Region: ISCA-37443-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37443-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37443-Loss were set to PMID: 20830797; 19460468; 19610115 Phenotypes for Region: ISCA-37443-Loss were set to Chromosome 3q29 microdeletion syndrome MIM#609425; intellectual disability; autism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.581 | ISCA-37441-Loss |
Sarah Milton Region: ISCA-37441-Loss was added Region: ISCA-37441-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37441-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37441-Loss were set to PMID: 20140962 Phenotypes for Region: ISCA-37441-Loss were set to Potocki-Shaffer syndrome MIM#601224; intellectual disability; multiple exostoses; biparietal foramina |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.580 | ISCA-37440-Loss |
Sarah Milton Region: ISCA-37440-Loss was added Region: ISCA-37440-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37440-Loss was set to BIALLELIC, autosomal or pseudoautosomal Publications for Region: ISCA-37440-Loss were set to PMID: 18234729; 23794250 Phenotypes for Region: ISCA-37440-Loss were set to 2p21 deletion syndrome; Hypotonia-cystinuria syndrome, MIM# 606407 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.578 | SCYL2 | Zornitza Stark Publications for gene: SCYL2 were set to 31960134; 26203146 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.577 | SCYL2 |
Zornitza Stark gene: SCYL2 was added gene: SCYL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: SCYL2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SCYL2 were set to 31960134; 26203146 Phenotypes for gene: SCYL2 were set to Arthrogryposis multiplex congenita (AMC); Zain syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.576 | PPP5C | Zornitza Stark Publications for gene: PPP5C were set to 35361529; 25363768; 33057194 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.574 | ISCA-37439-Gain |
Sarah Milton Region: ISCA-37439-Gain was added Region: ISCA-37439-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37439-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for Region: ISCA-37439-Gain were set to PMID: 20004760 Phenotypes for Region: ISCA-37439-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.573 | ISCA-37434-Loss |
Sarah Milton Region: ISCA-37434-Loss was added Region: ISCA-37434-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37434-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37434-Loss were set to PMID: 12974736; 18245432 Phenotypes for Region: ISCA-37434-Loss were set to Chromosome 1p36 deletion syndrome MIM#607872; intellectual disability; hypotonia; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.571 | ISCA-37433-Loss |
Sarah Milton Region: ISCA-37433-Loss was added Region: ISCA-37433-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37433-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for Region: ISCA-37433-Loss were set to DiGeorge syndrome MIM#188400 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.570 | ISCA-37433-Gain |
Sarah Milton Region: ISCA-37433-Gain was added Region: ISCA-37433-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37433-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37433-Gain were set to PMID: 18707033 Phenotypes for Region: ISCA-37433-Gain were set to Chromosome 22q11.2 microduplication syndrome MIM#608363 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.569 | ISCA-37432-Loss |
Sarah Milton Region: ISCA-37432-Loss was added Region: ISCA-37432-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37432-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37432-Loss were set to PMID: 19844256 Phenotypes for Region: ISCA-37432-Loss were set to Chromosome 17q12 deletion syndrome MIM#614527; Renal cysts and diabetes (RCAD) syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.568 | ISCA-37432-Gain |
Sarah Milton Region: ISCA-37432-Gain was added Region: ISCA-37432-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37432-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37432-Gain were set to PMID: 19844256 Phenotypes for Region: ISCA-37432-Gain were set to Chromosome 17q12 duplication syndrome 614526; intellectual disability; seizures; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.567 | ISCA-37431-Loss |
Sarah Milton Region: ISCA-37431-Loss was added Region: ISCA-37431-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37431-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37431-Loss were set to 12660952; 14729829 Phenotypes for Region: ISCA-37431-Loss were set to Chromosome 17q11.2 deletion syndrome, MIM#613675; NF1 deletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.566 | ISCA-37430-Loss |
Sarah Milton Region: ISCA-37430-Loss was added Region: ISCA-37430-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37430-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37430-Loss were set to Miller-Dieker lissencephaly syndrome, MIM# 247200 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.564 | CDK4 |
Zornitza Stark gene: CDK4 was added gene: CDK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services Mode of inheritance for gene: CDK4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CDK4 were set to 40210435 Phenotypes for gene: CDK4 were set to Neurodevelopmental disorder, MONDO:0700092; {Melanoma, cutaneous malignant, 3} MIM#609048 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.563 | MAU2 |
Lucy Spencer gene: MAU2 was added gene: MAU2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: MAU2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: MAU2 were set to 41332805; 37962004; 32433956 Phenotypes for gene: MAU2 were set to Cornelia de Lange syndrome MONDO:0016033, MAU2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.561 | TMEM251 |
Zornitza Stark gene: TMEM251 was added gene: TMEM251 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM251 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM251 were set to 40171858; 33252156 Phenotypes for gene: TMEM251 were set to Dysostosis multiplex, Ain-Naz type MIM@619345 Review for gene: TMEM251 was set to GREEN Added comment: PMID 40171858: reports 2 siblings from an Iranian consanguineous family and six previously reported families (8 patients, 7 unrelated families) with biallelic loss‑of‑function LYSET variants presenting with MLII‑like mucolipidosis; core features include dysostosis multiplex, coarse facial features, hepatomegaly, joint contractures, developmental delay; mouse knockout recapitulates the phenotype, supporting gene‑disease causality. HGNC approved name is LYSET. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.557 | NOP58 |
Zornitza Stark gene: NOP58 was added gene: NOP58 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: NOP58 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NOP58 were set to 41383020 Phenotypes for gene: NOP58 were set to Neurodevelopmental disorder, MONDO:0700092, NOP58-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.556 | EMC10 | Zornitza Stark Publications for gene: EMC10 were set to PMID: 32869858; 33531666 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.553 | UNC13A | Zornitza Stark Publications for gene: UNC13A were set to 27648472; 28192369 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.552 | WDR83 |
chirag patel gene: WDR83 was added gene: WDR83 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR83 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: WDR83 were set to 41381792 Phenotypes for gene: WDR83 were set to Neurodevelopmental disorder, MONDO:0700092, WDR83-related Mode of pathogenicity for gene: WDR83 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.551 | NDUFB7 |
Zornitza Stark gene: NDUFB7 was added gene: NDUFB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: NDUFB7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFB7 were set to 33502047; 27626371; 40025060 Phenotypes for gene: NDUFB7 were set to Mitochondrial complex I deficiency nuclear type 39 (MC1DN39), MIM#620135 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.550 | FIBP | Zornitza Stark Publications for gene: FIBP were set to 26660953; 27183861 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.548 | FIBP | Zornitza Stark edited their review of gene: FIBP: Added comment: Beyond the two families previously reviewed (PMIDs 26660953; 27183861), four additional studies (PMIDs 36919607, 37218527, 37876348, 40099975) contribute four new unrelated families (total six unrelated families, nine patients) with a consistent autosomal‑recessive overgrowth syndrome. All six families have biallelic loss‑of‑function FIBP variants (nonsense or frameshift leading to NMD). Detailed clinical descriptions include overgrowth, macrocephaly, facial dysmorphism, developmental delay/intellectual disability, renal dysplasia and, in two families, early‑onset tumor predisposition. Segregation analyses confirm recessive inheritance in every case. Functional work (RT‑qPCR, fibroblast proliferation assays, mouse embryonic expression) demonstrates reduced FIBP expression and increased cell proliferation, supporting pathogenicity.; Changed publications: 40099975, 37876348, 36919607, 27183861, 26660953 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.548 | DPH2 | Zornitza Stark Publications for gene: DPH2 were set to 32576952; 27421267 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.546 | WASHC3 | Zornitza Stark Publications for gene: WASHC3 were set to DOI: https://doi.org/10.1016/j.gimo.2024.101915 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.545 | SEC24C |
Zornitza Stark gene: SEC24C was added gene: SEC24C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: SEC24C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SEC24C were set to 40131364 Phenotypes for gene: SEC24C were set to Neurodevelopmental disorder, MONDO:0700092, SEC24C-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.543 | ZIC2_HPE5_GCN |
Bryony Thompson STR: ZIC2_HPE5_GCN was added STR: ZIC2_HPE5_GCN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list paediatric-onset tags were added to STR: ZIC2_HPE5_GCN. Mode of inheritance for STR: ZIC2_HPE5_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ZIC2_HPE5_GCN were set to 11285244; 33811808 Phenotypes for STR: ZIC2_HPE5_GCN were set to Holoprosencephaly 5 MIM#609637 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.542 | RSPRY1 | Zornitza Stark Publications for gene: RSPRY1 were set to 26365341 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.540 | USMG5 |
Zornitza Stark gene: USMG5 was added gene: USMG5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: USMG5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: USMG5 were set to 29917077; 30240627; 40014158 Phenotypes for gene: USMG5 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 6 MIM#618683 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.538 | PRMT1 |
Zornitza Stark gene: PRMT1 was added gene: PRMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: PRMT1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: PRMT1 were set to 39937650 Phenotypes for gene: PRMT1 were set to Neurodevelopmental disorder, MONDO:0700092, PRMT1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.537 | EXOSC4 |
Zornitza Stark gene: EXOSC4 was added gene: EXOSC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: EXOSC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOSC4 were set to 39009343; 37961665; 36344539 Phenotypes for gene: EXOSC4 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.536 | KDM2A | Zornitza Stark Publications for gene: KDM2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.533 | SELENOI | Zornitza Stark Publications for gene: SELENOI were set to 28052917 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.531 | TRMT1L |
Zornitza Stark gene: TRMT1L was added gene: TRMT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: TRMT1L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRMT1L were set to 39786990 Phenotypes for gene: TRMT1L were set to Neurodevelopmental disorder, MONDO:0700092, TRMT1L-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.530 | SPAG9 |
Zornitza Stark gene: SPAG9 was added gene: SPAG9 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: SPAG9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPAG9 were set to 39846792 Phenotypes for gene: SPAG9 were set to Neurodevelopmental disorder, MONDO:0700092, SPAG9-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.529 | NUBP2 |
Zornitza Stark gene: NUBP2 was added gene: NUBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: NUBP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NUBP2 were set to 39867373 Phenotypes for gene: NUBP2 were set to Neurodevelopmental disorder, MONDO:0700092 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.525 | KIF21A | Zornitza Stark Publications for gene: KIF21A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.524 | BAZ2B | Zornitza Stark Publications for gene: BAZ2B were set to 31999386 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.522 | ISCA-37431-Gain |
Sarah Milton Region: ISCA-37431-Gain was added Region: ISCA-37431-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37431-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37431-Gain were set to 22241097 Phenotypes for Region: ISCA-37431-Gain were set to Chromosome 17q11.2 duplication syndrome, 1.4-Mb MIM#618874; NF1 microduplication; intellectual disability; micro- and macrocephaly; seizures; dysmorphic features |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.521 | ISCA-37430-Gain |
Sarah Milton Region: ISCA-37430-Gain was added Region: ISCA-37430-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37430-Gain. Mode of inheritance for Region: ISCA-37430-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37430-Gain were set to Chromosome 17p13.3 duplication syndrome, centromeric, MIM#613215; intellectual disability |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.520 | ISCA-37429-Loss |
Sarah Milton Region: ISCA-37429-Loss was added Region: ISCA-37429-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37429-Loss. Mode of inheritance for Region: ISCA-37429-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37429-Loss were set to Wolf-Hirschhorn syndrome, MIM# 194190; intellectual disability; growth retardation; seizures; dysmorphic features |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.519 | ISCA-37425-Loss |
Sarah Milton Region: ISCA-37425-Loss was added Region: ISCA-37425-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37425-Loss. Mode of inheritance for Region: ISCA-37425-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37425-Loss were set to 23190751; 19596467 Phenotypes for Region: ISCA-37425-Loss were set to Sotos syndrome, chromosome 5q35 deletion; intellectual disability; overgrowth |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.518 | ISCA-37425-Gain |
Sarah Milton Region: ISCA-37425-Gain was added Region: ISCA-37425-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37425-Gain. Mode of inheritance for Region: ISCA-37425-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37425-Gain were set to 24819041 Phenotypes for Region: ISCA-37425-Gain were set to Chromosome 5q35 duplication syndrome; microcephaly; failure to thrive; seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.517 | ISCA-37424-Loss |
Sarah Milton Region: ISCA-37424-Loss was added Region: ISCA-37424-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37424-Loss. Mode of inheritance for Region: ISCA-37424-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37424-Loss were set to 20345475; 25846706 Phenotypes for Region: ISCA-37424-Loss were set to Chromosome 10q22.3q23.2 deletion syndrome (LCR-3/4-flanked); intellectual disability; autism; macrocephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.517 | ISCA-37423-Loss |
Sarah Milton Region: ISCA-37423-Loss was added Region: ISCA-37423-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37423-Loss. Mode of inheritance for Region: ISCA-37423-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37423-Loss were set to 23696316; 23011633; 20969981 Phenotypes for Region: ISCA-37423-Loss were set to 8p23.1 deletion syndrome; congenital heart disease; developmental delay |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.512 | MT-TE |
Zornitza Stark gene: MT-TE was added gene: MT-TE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-TE. Mode of inheritance for gene gene: MT-TE was set to MITOCHONDRIAL Publications for gene: MT-TE were set to 8155739; 21194154; 17715279; 23334599; 7726155; 7726154; 9353617; 15048886; 15670724; 23847141; 23334599; 17266923; 17056256 Phenotypes for gene: MT-TE were set to Mitochondrial disease (MONDO:0044970), MT-TE-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.510 | ISCA-37423-Gain |
Sarah Milton Region: ISCA-37423-Gain was added Region: ISCA-37423-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37423-Gain. Mode of inheritance for Region: ISCA-37423-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37423-Gain were set to 26097203; 25520754 Phenotypes for Region: ISCA-37423-Gain were set to 8p23.1 duplication syndrome; intellectual disability; congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.509 | ISCA-37421-Loss |
Sarah Milton Region: ISCA-37421-Loss was added Region: ISCA-37421-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37421-Loss. Mode of inheritance for Region: ISCA-37421-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37421-Loss were set to 32655619 Phenotypes for Region: ISCA-37421-Loss were set to Chromosome 1q21.1 deletion syndrome, MIM# 612474; intellectual disability; microcephaly; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.508 | DNAJA3 |
Zornitza Stark gene: DNAJA3 was added gene: DNAJA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: DNAJA3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAJA3 were set to 34750646; 30770860 Phenotypes for gene: DNAJA3 were set to Mitochondrial disease, MONDO:0044970, DNAJA3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.505 | ISCA-37418-Loss | Zornitza Stark Publications for Region: ISCA-37418-Loss were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.504 | ISCA-37421-Gain |
Sarah Milton Region: ISCA-37421-Gain was added Region: ISCA-37421-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37421-Gain. Mode of inheritance for Region: ISCA-37421-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37421-Gain were set to 32655619 Phenotypes for Region: ISCA-37421-Gain were set to Chromosome 1q21.1 duplication syndrome, MIM# 612475; intellectual disability; autism; macrocephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.503 | ISCA-37418-Loss |
Sarah Milton Region: ISCA-37418-Loss was added Region: ISCA-37418-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen,NHS GMS Mode of inheritance for Region: ISCA-37418-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phenotypes for Region: ISCA-37418-Loss were set to Potocki-Lupski syndrome; Smith-Magenis syndrome; moderate intellectual disability, delayed speech and language skills, distinctive facial features, sleep disturbances, and behavioral problems; 182290; Structural cardiovascular anomalies (dilated aortic root, bicommissural aortic valve, atrial/ventricular and septal defects) and sleep disturbance; hypotonia, failure to thrive, mental retardation, pervasive developmental disorders, congenital anomalies; Dental abnormalities; hypotonia, poor feeding, failure to thrive, developmental delay particularly cognitive and language deficity, mild-moderate intellectual deficit, and neuropsychiatric disorders |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.502 | ISCA-37418-Gain |
Sarah Milton Region: ISCA-37418-Gain was added Region: ISCA-37418-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for Region: ISCA-37418-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37418-Gain were set to Potocki-Lupski syndrome, MIM# 610883; intellectual disability; hypotonia; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.501 | ISCA-37415-Gain |
Sarah Milton Region: ISCA-37415-Gain was added Region: ISCA-37415-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37415-Gain. Mode of inheritance for Region: ISCA-37415-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37415-Gain were set to 30287593 Phenotypes for Region: ISCA-37415-Gain were set to 16p13.11 microduplication syndrome; intellectual disability; autism; aortopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.500 | ISCA-37411-Loss |
Sarah Milton Region: ISCA-37411-Loss was added Region: ISCA-37411-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37411-Loss. Mode of inheritance for Region: ISCA-37411-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for Region: ISCA-37411-Loss were set to 19372089; 20979196 Phenotypes for Region: ISCA-37411-Loss were set to Chromosome 15q13.3 microdeletion syndrome, MIM# 612001; intellectual disability; epilepsy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.499 | ISCA-37406-Loss |
Sarah Milton Region: ISCA-37406-Loss was added Region: ISCA-37406-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37406-Loss. Mode of inheritance for Region: ISCA-37406-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37406-Loss were set to 20101707; 17473832; 16783566 Phenotypes for Region: ISCA-37406-Loss were set to Chromosome 16p13.3 deletion syndrome, Rubinstein-Taybi deletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.499 | ISCA-37405-Loss |
Sarah Milton Region: ISCA-37405-Loss was added Region: ISCA-37405-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37405-Loss. Mode of inheritance for Region: ISCA-37405-Loss was set to BIALLELIC, autosomal or pseudoautosomal Publications for Region: ISCA-37405-Loss were set to 29146700 Phenotypes for Region: ISCA-37405-Loss were set to Nephronophthisis 1, juvenile, MIM# 256100; Joubert syndrome 4, MIM# 609583; Senior-Loken syndrome 1, MIM# 266900 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.498 | ISCA-37404-Loss |
Sarah Milton Region: ISCA-37404-Loss was added Region: ISCA-37404-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37404-Loss. Mode of inheritance for Region: ISCA-37404-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for Region: ISCA-37404-Loss were set to 20301323; 20301505 Phenotypes for Region: ISCA-37404-Loss were set to Angelman syndrome, MIM# 105830; Prader-Willi syndrome, MIM# 176270 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.497 | CTNND2 | Zornitza Stark Publications for gene: CTNND2 were set to 25839933; 29127138; 25807484 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.495 | PRMT9 | Lucy Spencer Publications for gene: PRMT9 were set to PMID: 38561334 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.491 | ESRRG |
Zornitza Stark gene: ESRRG was added gene: ESRRG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: ESRRG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ESRRG were set to 41265451 Phenotypes for gene: ESRRG were set to Movement disorder, MONDO:0005395, ESRRG-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.490 | ELMSAN1 |
Zornitza Stark gene: ELMSAN1 was added gene: ELMSAN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature new gene name tags were added to gene: ELMSAN1. Mode of inheritance for gene: ELMSAN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ELMSAN1 were set to Neurodevelopmental disorder, MONDO:0700092, ELMSAN1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.489 | SUCO |
Zornitza Stark gene: SUCO was added gene: SUCO was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SUCO were set to 29620724; 20440000; 41282771 Phenotypes for gene: SUCO were set to Syndromic disease (MONDO:0002254), SUCO-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.488 | GTF2H4 |
Zornitza Stark gene: GTF2H4 was added gene: GTF2H4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature Mode of inheritance for gene: GTF2H4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTF2H4 were set to 40924495; 40924475 Phenotypes for gene: GTF2H4 were set to Xeroderma pigmentosum, complementation group J, MIM# 621435 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.486 | ISCA-37404-Gain |
Sarah Milton Region: ISCA-37404-Gain was added Region: ISCA-37404-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37404-Gain. Mode of inheritance for Region: ISCA-37404-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37404-Gain were set to 24239951; 24075935 Phenotypes for Region: ISCA-37404-Gain were set to Chromosome 15q11q13 duplication syndrome; {Autism susceptibility 4} 608636; intellectual disability; seizures; ataxia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.485 | ISCA-37400-Loss |
Sarah Milton Region: ISCA-37400-Loss was added Region: ISCA-37400-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37400-Loss. Mode of inheritance for Region: ISCA-37400-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37400-Loss were set to Chromosome 16p11.2 deletion syndrome, proximal, MIM# 611913; autism; intellectual disability; seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.484 | ISCA-37400-Gain |
Sarah Milton Region: ISCA-37400-Gain was added Region: ISCA-37400-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37400-Gain. Mode of inheritance for Region: ISCA-37400-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37400-Gain were set to 21841781; 18184952; 21731881 Phenotypes for Region: ISCA-37400-Gain were set to Chromosome 16p11.2 duplication syndrome, MIM# 614671; intellectual disability; autism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.484 | ISCA-37397-Loss |
Sarah Milton Region: ISCA-37397-Loss was added Region: ISCA-37397-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37397-Loss. Mode of inheritance for Region: ISCA-37397-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37397-Loss were set to 21671380; 23765049; 18179902 Phenotypes for Region: ISCA-37397-Loss were set to Chromosome 22q11.2 deletion syndrome, distal, MIM#611867; intellectual disability; seizures; growth retardation; multiple congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.483 | ISCA-37397-Gain |
Sarah Milton Region: ISCA-37397-Gain was added Region: ISCA-37397-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37397-Gain. Mode of inheritance for Region: ISCA-37397-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37397-Gain were set to 21671380; 31479204 Phenotypes for Region: ISCA-37397-Gain were set to Chromosome 22q11.2 microduplication syndrome, MIM#608363, distal; intellectual disability; dysmorphic features; congenital anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.482 | ISCA-37396-Loss |
Sarah Milton Region: ISCA-37396-Loss was added Region: ISCA-37396-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list SV/CNV tags were added to Region: ISCA-37396-Loss. Mode of inheritance for Region: ISCA-37396-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37396-Loss were set to 22180641; 19557438; 19233321; 22359776 Phenotypes for Region: ISCA-37396-Loss were set to Chromosome 15q24 deletion syndrome, MIM#613406; intellectual disability; facial dysmorphisms; congenital malformations of the hands and feet, eye, and genitalia; joint laxity; and growth retardation and failure to thrive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.481 | ISCA-37394-Loss |
Sarah Milton Region: ISCA-37394-Loss was added Region: ISCA-37394-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37394-Loss. Mode of inheritance for Region: ISCA-37394-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37394-Loss were set to 20691407 Phenotypes for Region: ISCA-37394-Loss were set to Chromosome 2q37 deletion syndrome, MIM# 600430; brachydactyly; intellectual disability |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.480 | ISCA-37393-Gain |
Sarah Milton Region: ISCA-37393-Gain was added Region: ISCA-37393-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37393-Gain. Mode of inheritance for Region: ISCA-37393-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for Region: ISCA-37393-Gain were set to Cat eye syndrome, MIM# 115470; coloboma; anal atresia; heart and renal malformations |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.479 | ISCA-37392-Loss |
Sarah Milton Region: ISCA-37392-Loss was added Region: ISCA-37392-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37392-Loss. Mode of inheritance for Region: ISCA-37392-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37392-Loss were set to 20301427 Phenotypes for Region: ISCA-37392-Loss were set to Williams-Beuren syndrome, MIM# 194050; intellectual disability; growth retardation; cardiovascular disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.478 | ISCA-37392-Gain |
Sarah Milton Region: ISCA-37392-Gain was added Region: ISCA-37392-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37392-Gain. Mode of inheritance for Region: ISCA-37392-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37392-Gain were set to 33187326; 27615053; 26610320 Phenotypes for Region: ISCA-37392-Gain were set to Chromosome 7q11.23 duplication syndrome, MIM# 609757; intellectual disability; hypotonia; macrocephaly; seizures; aortic dilatation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.478 | ISCA-37390-Loss |
Sarah Milton Region: ISCA-37390-Loss was added Region: ISCA-37390-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review SV/CNV tags were added to Region: ISCA-37390-Loss. Mode of inheritance for Region: ISCA-37390-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for Region: ISCA-37390-Loss were set to 16953888 Phenotypes for Region: ISCA-37390-Loss were set to Cri-du-chat syndrome MIM#123450; intellectual disability; microcephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.477 | MT-ND4 |
Zornitza Stark gene: MT-ND4 was added gene: MT-ND4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-ND4. Mode of inheritance for gene gene: MT-ND4 was set to MITOCHONDRIAL Publications for gene: MT-ND4 were set to 12707444; 16120329; 15576045; 20502985; 27761019; 32445240; 32659360; 3201231 Phenotypes for gene: MT-ND4 were set to Mitochondrial disease (MONDO:0044970), MT-ND4-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.476 | MT-CO2 |
Zornitza Stark gene: MT-CO2 was added gene: MT-CO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-CO2. Mode of inheritance for gene gene: MT-CO2 was set to MITOCHONDRIAL Publications for gene: MT-CO2 were set to 34325999; 30315213; 28521807; 10205264; 10486321; 11558799; 18245391; 23616164; 31167410; 23965802; 30030519 Phenotypes for gene: MT-CO2 were set to Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.475 | MT-ATP6 |
Zornitza Stark gene: MT-ATP6 was added gene: MT-ATP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list mtDNA tags were added to gene: MT-ATP6. Mode of inheritance for gene gene: MT-ATP6 was set to MITOCHONDRIAL Publications for gene: MT-ATP6 were set to 40112238 Phenotypes for gene: MT-ATP6 were set to Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.470 | ABI2 |
Zornitza Stark gene: ABI2 was added gene: ABI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ABI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ABI2 were set to 40475134 Phenotypes for gene: ABI2 were set to Neurodevelopmental disorder, MONDO:0700092, ABI2-related Review for gene: ABI2 was set to AMBER Added comment: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.468 | NUDT2 | Zornitza Stark edited their review of gene: NUDT2: Added comment: PMID 38141063 reports 18 individuals from 10 unrelated families with biallelic loss‑of‑function NUDT2 variants presenting with early‑onset neurodevelopmental disorder characterized by hypotonia, motor delay, gait disturbance, mild intellectual disability, peripheral neuropathy, corpus callosum abnormalities and progressive basal ganglia signal abnormalities.; Changed publications: 27431290, 30059600, 33058507, 38141063 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.468 | KARS |
Zornitza Stark changed review comment from: Sources: Expert list; to: Infantile-onset progressive leukoencephalopathy with or without deafness (LEPID) is a complex neurodegenerative disorder with onset of symptoms in infancy or early childhood. Most individuals present with sensorineural deafness or hypoacousia and global developmental delay. Affected individuals show episodic regression with progressive motor deterioration resulting in spastic tetraplegia and loss of ambulation, as well as impaired intellectual development with poor or absent speech. Additional more variable features may include poor overall growth with microcephaly, seizures, visual loss, microcytic anaemia, and hepatic enlargement or abnormal liver enzymes. Brain imaging shows deep white matter abnormalities consistent with a progressive leukoencephalopathy. Calcifications of the brain and spinal cord are a feature. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.452 | EN2 |
chirag patel gene: EN2 was added gene: EN2 was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen disputed tags were added to gene: EN2. Mode of inheritance for gene: EN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EN2 were set to Complex neurodevelopmental disorder, MONDO:0100038 Review for gene: EN2 was set to RED Added comment: ClinGen DISPUTED - Feb 2021 https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_91eb2fc6-864c-4a4a-9b2d-0b2bdd695999-2021-02-16T170000.000Z?page=1&size=25&search= Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.446 | COX4I1 |
Lucy Spencer gene: COX4I1 was added gene: COX4I1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list Mode of inheritance for gene: COX4I1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COX4I1 were set to 28766551; 22592081; 31290619; 40095452; 41203052 Phenotypes for gene: COX4I1 were set to Mitochondrial complex IV deficiency, nuclear type 16, MIM#619060 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.444 | COQ5 | Zornitza Stark Publications for gene: COQ5 were set to 29044765 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.441 | CUL1 |
Zornitza Stark gene: CUL1 was added gene: CUL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: CUL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CUL1 were set to PMID: 41189326 Phenotypes for gene: CUL1 were set to Neurodevelopmental disorder, MONDO:0700092, CUL1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.439 | SEC31A | Zornitza Stark Publications for gene: SEC31A were set to 30464055 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.433 | CACNA1A | Zornitza Stark Publications for gene: CACNA1A were set to 27476654; 33985586 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.430 | EXOSC10 |
Zornitza Stark gene: EXOSC10 was added gene: EXOSC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature Mode of inheritance for gene: EXOSC10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EXOSC10 were set to 41132091 Phenotypes for gene: EXOSC10 were set to Microcephaly, MONDO:0001149, EXOSC10-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.429 | RPS6KC1 |
Rylee Peters gene: RPS6KC1 was added gene: RPS6KC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: RPS6KC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RPS6KC1 were set to 41130203 Phenotypes for gene: RPS6KC1 were set to Complex neurodevelopmental disorder, MONDO:0100038, RPS6KC1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.425 | KLHL13 |
Krithika Murali gene: KLHL13 was added gene: KLHL13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KLHL13 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: KLHL13 were set to PMID: 41159445 Phenotypes for gene: KLHL13 were set to Neurodevelopmental disorder, MONDO:0700092, KLHL13-related Review for gene: KLHL13 was set to GREEN Added comment: PMID: 41159445 Akhther et al 2025 (pre-print) report 8 affected individuals from 4 unrelated famlies with hemizygous/heterozygous KLHL13 variants and an X-linked neurodevelopmental disorder with the following phenotypic features including mild-severe ID, developmental delay, macrocephaly, hypotonia, unsteady gait, facial dysmrophism and behavioural issues. Functional studies support LoF disease mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.420 | BAIAP2 |
Bryony Thompson gene: BAIAP2 was added gene: BAIAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: BAIAP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BAIAP2 were set to 41133935; 38149472 Phenotypes for gene: BAIAP2 were set to BAIAP2-related complex neurodevelopmental disorder MONDO:0100038 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.418 | QSER1 |
Zornitza Stark gene: QSER1 was added gene: QSER1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature,Literature Mode of inheritance for gene: QSER1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: QSER1 were set to PMID: 41139957 Phenotypes for gene: QSER1 were set to Neurodevelopmental disorder, MONDO:0700092, QSER1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.416 | CCNK |
Sangavi Sivagnanasundram gene: CCNK was added gene: CCNK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCNK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CCNK were set to 41101726; 37597256; 30122539 Phenotypes for gene: CCNK were set to CCNK-related neurodevelopmental disorder-severe intellectual disability-facial dysmorphism syndrome MONDO:0035775 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.414 | SRRM1 |
Zornitza Stark gene: SRRM1 was added gene: SRRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SRRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SRRM1 were set to 41145827 Phenotypes for gene: SRRM1 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM1-related Review for gene: SRRM1 was set to GREEN Added comment: PMID 41145827 reports three individuals from three unrelated families with heterozygous truncating SRRM1 variants presenting with a neurodevelopmental disorder characterised by developmental delay, intellectual disability, short stature, behavioural and skeletal anomalies, and facial dysmorphism. Two variants are confirmed de novo and functional assays in neuronal‑like cells and Drosophila support haploinsufficiency as a disease mechanism. Serine/arginine repetitive matrix protein 1 (SRRM1) is a key component of spliceosomes and plays various roles in messenger RNA processing. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.408 | OTUD7A | Zornitza Stark Publications for gene: OTUD7A were set to 31997314; 29395075; 29395074; 33381903 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.406 | AUTS2 | Zornitza Stark Publications for gene: AUTS2 were set to 23332918; 25205402; 31474318; 39953909 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.405 | AUTS2 | Zornitza Stark Publications for gene: AUTS2 were set to 23332918; 25205402; 31474318 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.404 | SLC31A1 | Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.403 | SLC31A1 | Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.403 | SLC31A1 | Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.402 | SLC31A1 | Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.399 | SLC27A3 |
Sarah Milton gene: SLC27A3 was added gene: SLC27A3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLC27A3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC27A3 were set to PMID: 41054338 Phenotypes for gene: SLC27A3 were set to Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.398 | DIP2B_FRA12A_CGG | Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.396 | SSPO |
Sarah Milton gene: SSPO was added gene: SSPO was added to Intellectual disability syndromic and non-syndromic. Sources: Literature new gene name tags were added to gene: SSPO. Mode of inheritance for gene: SSPO was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SSPO were set to PMID: 41077560 Phenotypes for gene: SSPO were set to Neurodevelopmental disorder, MONDO:0700092, SSPOP-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.395 | PPFIA2 |
Zornitza Stark gene: PPFIA2 was added gene: PPFIA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: PPFIA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PPFIA2 were set to 41044885 Phenotypes for gene: PPFIA2 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA2 related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.394 | EIPR1 |
Zornitza Stark gene: EIPR1 was added gene: EIPR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: EIPR1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIPR1 were set to 41058046 Phenotypes for gene: EIPR1 were set to Mendelian neurodevelopmental disorder MONDO:0100500, EIPR1-related Penetrance for gene: EIPR1 were set to unknown |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.393 | BRSK1 |
Zornitza Stark gene: BRSK1 was added gene: BRSK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature Mode of inheritance for gene: BRSK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BRSK1 were set to 41035394 Phenotypes for gene: BRSK1 were set to Neurodevelopmental disorder, MONDO:0700092, BRSK1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.392 | KLHL20 | Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.391 | KLHL20 | Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder (MONDO:0700092), KLHL20-related to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.390 | KLHL20 | Zornitza Stark reviewed gene: KLHL20: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.384 | CDKL1 | Zornitza Stark commented on gene: CDKL1: PMID 40088891 reports two unrelated individuals with de novo heterozygous CDKL1 missense variants (p.Val115Ala, p.Arg169Cys) presenting with childhood‑onset neurodevelopmental disorder, developmental delay and seizures; Drosophila rescue assays show dominant‑negative activity of the variants. However, note that the variants are present at low frequency in gnomAD v4, p.Val115Ala: 2 individuals, p.Arg169Cys: 13 individuals. Some supportive functional data presented. Upgrade to Amber but not Green due to pop counts. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.382 | TBCB | Zornitza Stark Phenotypes for gene: TBCB were changed from Neurodevelopmental disorder, MONDO:0700092, TBCB-related to Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.381 | TBCB | Zornitza Stark reviewed gene: TBCB: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.380 | TBX2 |
Krithika Murali gene: TBX2 was added gene: TBX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TBX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TBX2 were set to PMID: 36733940 Phenotypes for gene: TBX2 were set to Vertebral anomalies and variable endocrine and T-cell dysfunction - MIM#618223 Review for gene: TBX2 was set to AMBER Added comment: PMID: 36733940 Rafeeq et al 2022 report a novel de novo nonsense variant (c.529A>T; p.Lys177*; NM_005994.4) in a child with chondrodysplasia. Skeletal features included spinal deformities, short limbs, metaphyseal and epiphyseal dysplasia, and bilateral developmental dislocation of the hip (DDH). Global developmental delay was also noted in this child. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.378 | EIF3B |
Zornitza Stark gene: EIF3B was added gene: EIF3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF3B were set to 41033306 Phenotypes for gene: EIF3B were set to Syndromic disease (MONDO:0002254), EIF3B-related Review for gene: EIF3B was set to GREEN Added comment: Fourteen individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.376 | EIF3A |
Zornitza Stark gene: EIF3A was added gene: EIF3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: EIF3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF3A were set to 41033306 Phenotypes for gene: EIF3A were set to Syndromic disease (MONDO:0002254), EIF3A-related Added comment: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.373 | MDGA2 |
Zornitza Stark gene: MDGA2 was added gene: MDGA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MDGA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MDGA2 were set to https://doi.org/10.1101/2025.08.28.25330873; 40168357; 27608760 Phenotypes for gene: MDGA2 were set to MDGA2-related neurodevelopmental disorder MONDO:0700092 Review for gene: MDGA2 was set to GREEN Added comment: Affected individuals present with a broad neurodevelopmental impairment-like phenotype. Pre-print - https://doi.org/10.1101/2025.08.28.25330873 Individuals with developmental and epileptic encephalopathy (DEE) 8 individuals from 6 consanguineous families exhibiting infantile hypotonia, severe neurodevelopmental delay, intractable seizures, progressive brain atrophy, and consistent dysmorphic features. 7 different biallelic LoF variants were identified p.Tyr913Ter, p.Arg404Ter, p.Leu920Ter, c.421-1G>A, p.Lys391SerfsTer7 and c.421-96_595+99del - all variants are rare or absent in gnomAD v4.1 In vitro functional studies of three nonsense variants in mammalian expression systems and hippocampal cultured neurons that resulted in impaired MDGA2 membrane trafficking are supportive of a loss-of-function mechanism. PMID: 40168357, 27608760 A knockout mouse model showed that MGAD2-deficient mice presented with autism-like behaviours (social deficits, repetitive behaviour, and cognitive impairment). The mice also showed abnormalities in excitatory synapses. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.371 | DBX1 |
Zornitza Stark gene: DBX1 was added gene: DBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DBX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DBX1 were set to 40995053 Phenotypes for gene: DBX1 were set to central hypoventilation syndrome, congenital MONDO:0800031 Review for gene: DBX1 was set to RED Added comment: Single individual reported with congenital central hypoventilation syndrome (atypical CCHS) with central hypotonia, global developmental delay, seizures, autoaggressive behaviour. Consanguineous parents, hmz frameshift variant c.340_341delGC, absent from gnomAD. Mouse Dbx1 knockout is lethal indicating essential role in respiration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.369 | NFXL1 |
Zornitza Stark gene: NFXL1 was added gene: NFXL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NFXL1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NFXL1 were set to 40430072; 41024252 Phenotypes for gene: NFXL1 were set to Syndromic disease (MONDO:0002254), NFXL1-related Review for gene: NFXL1 was set to AMBER Added comment: PMID: 40430072 2 siblings with psychosis and schizophrenia, homozygous for Cys441Tyr. Some modelling suggested a deleterious affect but no functional studies performed. PMID: 41024252 8 patients from 7 families with joint hyperlaxity, with or without short stature and renal disease. 6 families were homozygous for p.(Cys539Trpfs*64) while the other two were homozygous for p.(Lys681*). Paper described both as founder variants but they are rare/absent in gnomad. Joint hyperlaxity (7), chronic kidney disease/FSGS (2) small echogenic kidneys (3), acute kidney injury (1), dysmorphic features (6), short stature (6), speech delay (3). One patient also had epilepsy, developmental delay and spasticity however c.728+1G>A in WDR45 explained this part of her phenotype. Other patients also had more severe outlying symptoms with no other explanation mentioned: 1 with developmental delay, hearing loss, brain malformations, skeletal abnormalities, and another a 3 year old who passed away following a complex medical course including blue sclera, proximal tibial fracture, severe respiratory distress due to a chest infection, and acute kidney injury. Amber given the variable phenotype findings of the reported patients and only 2 homozygous variants identified so far. Extent of associated DD/ID currently unclear but adding on this panel as it is often ordered in children with multi-system features suggestive of an underlying syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.366 | CDK9 |
Zornitza Stark gene: CDK9 was added gene: CDK9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDK9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CDK9 were set to 33640901; 30237576; 26633546 Phenotypes for gene: CDK9 were set to multiple congenital anomalies/dysmorphic syndrome-variable intellectual disability syndrome MONDO:0015160; CHARGE-like syndrome with retinal dystrophy Review for gene: CDK9 was set to AMBER Added comment: Two independent reports: 1) A boy with a phenotype resembling CHARGE syndrome (multiple anomalies involving the eyes, ears, cleft lip, and palate, and intellectual disability) with retinal dystrophy (p.A288T/p.R303C), 2) 4 consanguineous families homozygous for p.R225C, including a set of cousins. CDK9 variants demonstrated decreased kinase activity. One of the studies suggested the extent the kinase activity is reduced may account for the absence/presence of the CHARGE-like phenotype with retinal dystrophy One additional family with retinal dystrophy only. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.365 | AGTPBP1 |
chirag patel Phenotypes for gene: AGTPBP1 were changed from Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy; Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 to Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650 Publications for gene AGTPBP1 were changed from 30420557, 28600779, 30976113, 38153683, 28325758 to 30420557, 28600779, 30976113, 38153683, 28325758 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.363 | ALS2 |
chirag patel Source Genetic Health Queensland was removed from ALS2. Source ClinGen was added to ALS2. Phenotypes for gene: ALS2 were changed from Spastic paralysis, infantile onset ascending, MIM#607225 to ALS2-related motor neuron disease, MONDO:0100227 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.357 | DDOST | Bryony Thompson Publications for gene: DDOST were set to 22305527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.352 | HYPK | Zornitza Stark Publications for gene: HYPK were set to Clinical Genetics Early View | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | BCAT1 |
Lucy Spencer gene: BCAT1 was added gene: BCAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BCAT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BCAT1 were set to 41029903 Phenotypes for gene: BCAT1 were set to Neurodevelopmental disorder (MONDO:0700092), BCAT1-related Review for gene: BCAT1 was set to RED Added comment: PMID: 41029903 One patient with a suspected neurometabolic disorder; congenital blindness and suspected Leber Congenital Amaurosis, microcephaly, failure to thrive, profound global developmental delay and extensive delayed myelination on MRI. AT 10 he was non-verbal and non-ambulatory with regression of motor skills and -3SD for height and weight. Compound heterozygous for Phe264Leu (539 hets but no homs in gnomad v4) and Glu348Lys (over 8000 hets and 24 homs in gnomad v4). in compound heterozygous iPSCs a severe 75% reduction in BCAT1 protein levels was seen, but mRNA levels were normal suggesting the variants affect protein stability or increased degradation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | RNU6ATAC |
Lucy Spencer gene: RNU6ATAC was added gene: RNU6ATAC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU6ATAC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNU6ATAC were set to 40975062 Phenotypes for gene: RNU6ATAC were set to Neurodevelopmental disorder (MONDO:0700092), RNU6ATAC-related Review for gene: RNU6ATAC was set to RED Added comment: PMID: 40975062 1 patient compound heterozygous for n.36T>G and n.28C>T. Has short stature, microcephaly, hypotonia, neurodevelopmental delay, ID, seizures, ataxia, ventriculomegaly, syndactyly, nystagmus and oculomotor apraxia. Identified in a cohort of individuals with an excess of significant intron retention outliers in minor intron containing genes which are usually removed by the minor spliceosome of which RNU6ATAC is a part (as is RNU4ATAC). Proband had no candidate variants in RNU4ATAC or RNU12. Both RNU6ATAC variants are in a highly conserved 39bp region, and affect nucleotides predicted to be important for binding to U4ATAC. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | PTBP1 |
Lucy Spencer gene: PTBP1 was added gene: PTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTBP1 were set to 40965981 Phenotypes for gene: PTBP1 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP1-related Review for gene: PTBP1 was set to GREEN Added comment: PMID: 40965981 27 individuals with abnormal prenatal ultrasound in thirteen (48%) including short femora, IUGR, hydramnios, increased nuchal translucency, asymmetry of heart cavities, and bilateral hydronephrosis. Skeletal anomalies were seen in 24 (89%), short stature/limbs in 63%, facial dysmorphism 25 (93%), developmental delay in 78%, behavioral problems in 30% and ID in 26% generally mild/moderate, 43% had variable brain MRI abnormalities. additional features included skin, nail, and hair anomalies (52%), dental anomalies (37%), ophthalmological findings (44%), and cardiovascular defects (22%). Variants a mix of missense and startloss, and were confirmed de novo in 23/17 cases. Various functional studies showed reduced nuclear localization and enhanced cytoplasmic retention, with start-loss variants also leading to increased protein stability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.350 | PTBP2 |
Lucy Spencer gene: PTBP2 was added gene: PTBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTBP2 were set to 40965981 Phenotypes for gene: PTBP2 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP2-related Review for gene: PTBP2 was set to AMBER Added comment: PMID: 40965981 2 males with developmental delay, ID, autistic features. 1 had some dysmorphic features and tonic-clonic seizures. both probands had a de novo variant in PTBP2 NM_021190.4:c.2T>C (p.Met1?) and NM_021190.4:c.41G>C (p.Arg14Thr), absent from gnomad. Transfection of the variants in transfection in NIH-3T3 cells showed the missense had cytoplasmic retention and colocalization with processing bodies, and that there were 2 alternative downstream start sites Met32 and Met35 that may be used instead. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.346 | SF1 |
Sarah Milton gene: SF1 was added gene: SF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SF1 were set to PMID: 40987292 Phenotypes for gene: SF1 were set to Neurodevelopmental disorder, MONDO:0700092, SF1-related Review for gene: SF1 was set to GREEN Added comment: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15). Variant types included missense and high impact LOF (nonsense and frameshift). Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets. pLI for SF1 is 1 with overall few LOF variants in gene. Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.342 | SYNE2 |
chirag patel gene: SYNE2 was added gene: SYNE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SYNE2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SYNE2 were set to 34573277 Phenotypes for gene: SYNE2 were set to Neurodevelopmental disorder, MONDO:0700092, SYNE2 related Review for gene: SYNE2 was set to RED Added comment: 1 individual with autism spectrum disorder, developmental delay and intellectual disability (from a cohort of 410 trios with neurodevelopmental disorders). Trio WES found compound heterozygous variants in SYNE2 [c.2483T>G; p.(Val828Gly) and c.2362G>A; p.(Glu788Lys)]. Both variants are rare, predicted to be highly damaging using in silico tools, and located in the nesprin-2 giant spectrin repeat domain. Both parents and the healthy brother were heterozygous. Expression and functional testing in patient lymphoblastoid cell lines showed a significant reduction of nesprin-2 giant protein levels, however SYNE2 transcription and the nuclear envelope localisation of the mutant proteins was unaffected as compared to parental control cells. SYNE 1-4 genes encode for nesprins (nuclear envelope spectrin repeat proteins) which play fundamental roles in nuclear architecture and positioning, directed cell migration, cellular signalling, ciliogenesis, and mechanobiology. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | INTS6 |
Sarah Milton changed review comment from: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature; to: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | INTS6 |
Sarah Milton gene: INTS6 was added gene: INTS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: INTS6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: INTS6 were set to PMID: 40966122 Phenotypes for gene: INTS6 were set to Neurodevelopmental disorder, MONDO:0700092, INTS6-related Review for gene: INTS6 was set to GREEN Added comment: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing. PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site. Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset. 21 variants were confirmed to be de novo. All variants either absent in gnomad v4 or had 1 heterozygote only. pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene. Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.340 | RNU2-2P | Zornitza Stark Publications for gene: RNU2-2P were set to 40210679; 40442284 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.338 | CRNKL1 | Zornitza Stark Publications for gene: CRNKL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.335 | MRPS36 |
Krithika Murali gene: MRPS36 was added gene: MRPS36 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MRPS36 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MRPS36 were set to PMID: 41018056; 38685873 Phenotypes for gene: MRPS36 were set to Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related Review for gene: MRPS36 was set to AMBER Added comment: 3 individuals from 2 unrelated families reported with biallelic MRPS36 variants (current HGNC is KGD4). Gene encodes E4 subunit of OGDHC complex. Individuals present with a phenotype consistent with Leigh syndrome including seizures, hypotonia, dystonia, brain imaging anomalies, persistent lactic acidosis. GDD, ID and cardiomyopathy also reported. Patient-derived fibroblast studies demonstrates reduced OGDHC enzymatic activity, however, this functional evidence is not gene or variant-specific. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.333 | GTF2I | Zornitza Stark Publications for gene: GTF2I were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.329 | BBOX1 |
Zornitza Stark gene: BBOX1 was added gene: BBOX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BBOX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BBOX1 were set to 41022783 Phenotypes for gene: BBOX1 were set to Carnitine deficiency, MONDO:0017716, BBOX1-related Review for gene: BBOX1 was set to AMBER Added comment: Three individuals from two unrelated families reported, presenting with myopathy, neurodevelopmental delay, and later-onset psychiatric manifestations. C. elegans knockout and patient-variant models show embryonic lethality rescued by L‑carnitine supplementation Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.327 | INPP4A | Zornitza Stark Publications for gene: INPP4A were set to 31978615; 31938306; 25338135; 20011524 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.325 | B9D1 | Zornitza Stark Publications for gene: B9D1 were set to 24886560; 21493627 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.313 | AP2S1 | Zornitza Stark Publications for gene: AP2S1 were set to 33057194 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.307 | GNAI2 | Zornitza Stark Publications for gene: GNAI2 were set to 31036916 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.305 | TRPC5 | Zornitza Stark Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.302 | TMEM167A |
chirag patel gene: TMEM167A was added gene: TMEM167A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM167A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM167A were set to PMID: 40924476 Phenotypes for gene: TMEM167A were set to Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related Review for gene: TMEM167A was set to GREEN Added comment: 6 individuals from 6 unrelated families (4/6 consanguineous) presenting with neonatal diabetes onset <4mths (6/6), severe microcephaly (6/6), epilepsy (5/6), and developmental delay (4/6). Whole genome sequencing identified biallelic variants in TMEM167A gene. Variants were homozygous in 5/6 families, and variant types were missense (4), frameshift (1), and splice (1), and all variants were rare/unreported in gnomAD. Segregation studies not reported in paper. Microcephaly, epilepsy and diabetes syndrome has 2 known associated genes (IER3IP1 and YIPF5) which encode proteins involved in endoplasmic reticulum to Golgi trafficking. TMEM167A is highly expressed in developing and adult human pancreas and brain. Both TMEM167A depletion in EndoC-βH1 cells and knock‑in of p.Val59Glu variant in iPSC-derived β cells sensitized β cells to ER stress. The p.Val59Glu variant impaired proinsulin trafficking to the Golgi and induced iPSC-β cell dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.301 | RAB11A | Zornitza Stark Publications for gene: RAB11A were set to 29100083 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.296 | ZNF865 |
Sangavi Sivagnanasundram gene: ZNF865 was added gene: ZNF865 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF865 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNF865 were set to 40936200 Phenotypes for gene: ZNF865 were set to ZNF865‑associated neurodevelopmental disorder MONDO:0700092 Review for gene: ZNF865 was set to AMBER Added comment: PMID: 40936200 18 patients reported with DD, hypotonia and six individuals were reported with some dysmorphic features (frontal bossing, a broad nasal bridge, hypertelorism, and low-set ears) All 18 individuals were reported with de novo truncating variants in ZNF865. All variants were rare/absent in gnomAD v4.1. The mechanism of disease for this gene is unknown. No pathogenic SNVs have been reported in ClinVar at this stage however there are reports of VUS’s and pathogenic CNVs. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.296 | SNAPIN |
Lucy Spencer gene: SNAPIN was added gene: SNAPIN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNAPIN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNAPIN were set to 40930097; 26539891 Phenotypes for gene: SNAPIN were set to Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related Review for gene: SNAPIN was set to GREEN Added comment: PMID: 40930097 6 patients from 5 families with neuroanatomical, craniofacial, and skeletal anomalies on prenatal ultrasound/MRI, all homozygous for variants in SNAPIN. 2 stopgain, 1 canonical splice, 5 missense. common phenotypes: ventriculomegaly 5/6, cerebellar hypoplasia/atrophy 5/6, clubfeet 4/6, corpus callosum agenesis 4/6, flexion contractures 4/6, microcephaly 3/6, micrognathia/retrognathia 4/6. The patients with the nonsense or splice variants did not survive the perinatal period, while those with missense survived into early childhood. This paper also mentions a 7th patient reported in PMID: 26539891, who has ID, microcephaly, cortical atrophy, bulbar and cerebellar hypoplasia, sensorineural polyneuropathy, and hypotonia. They are homozygous for a missense variant Asn55Tyr. Of note, the other paper report this as Arg55Trp and one of their patients also has this variant, based off the transcript information provided in both papers Arg55Trp is correct. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.295 | SKOR2 |
Zornitza Stark gene: SKOR2 was added gene: SKOR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SKOR2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SKOR2 were set to 40890458; 29997391; 21937600 Phenotypes for gene: SKOR2 were set to complex neurodevelopmental disorder with motor features MONDO:0100516 Review for gene: SKOR2 was set to GREEN Added comment: 3 unrelated families with consistent phenotypes and a supportive mouse model: PMID: 40890458 - 2 unrelated consanguineous Iranian families with a combination of learning disability, facial dysmorphisms, and motor and speech impairments with homozygous variants (c.374 G>C: p.Arg125Pro & c.1271_1274del: p.K424Rfs*71). The homozygous missense variant segregated with disease in 8 individuals (no unaffected individuals tested were homozygous). PMID: 29997391 - proband with neurodevelopmental delay, hypotonia, ataxia, cerebellar dysplasia from a consanguineous Turkish family with a homozygous null variant (NM_001278063.1:c.2750C>G; p.Ser917*). None of the 4 healthy siblings were homozygous for the variant. PMID: 21937600 - Skor2 -/- mouse model had defective Purkinje cell development, a severe reduction of granule cell proliferation and a malformed cerebellum. Mouse had unstable gait. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.293 | GBX1 |
Zornitza Stark gene: GBX1 was added gene: GBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GBX1 were set to 40519143 Phenotypes for gene: GBX1 were set to Neurodevelopmental disorder, MONDO:0700092, GBX1-related Review for gene: GBX1 was set to RED Added comment: Single individual with de novo LoF variant with DD and focal epilepsy. Zebrafish model had abnormal morphology of the interocular area. Furthermore, the zebrafish larvae exhibited an increased susceptibility to neurophysiological abnormalities associated with epileptiform activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.291 | MTERF3 |
Zornitza Stark gene: MTERF3 was added gene: MTERF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MTERF3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MTERF3 were set to 40543543 Phenotypes for gene: MTERF3 were set to Mitochondrial disease (MONDO:0044970), MTERF3-related Review for gene: MTERF3 was set to AMBER Added comment: Two individuals reported from unrelated families, presenting with DD/ID, intermittent hypoglycaemia and metabolic acidosis. Genetic testing identified compound heterozygous variants c.635dup p.(Asn212Lysfs*7) and c.1055C > T p.(Pro352Leu) in Patient 1, and a homozygous variant c.943A > Gp.(Met315Val) in Patient 2. Patient's fibroblasts and MTERF3 knockdown cells showed impaired mitochondrial respiration and reduced levels of OXPHOS complexes I, III, and IV. Transcription of MT-ND5, ND6, COII, and COIII was reduced, while other mitochondrial genes were upregulated. Wild-type MTERF3 expression restored these defects, but the variant Pro352Leu from patient failed to rescue mitochondrial dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.289 | ATP5A1 |
Zornitza Stark gene: ATP5A1 was added gene: ATP5A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ATP5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP5A1 were set to 34483339; 34954817; 40859057 Phenotypes for gene: ATP5A1 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD Review for gene: ATP5A1 was set to GREEN Added comment: At least 12 individuals reported with de novo missense variants in this gene, several recurrent. PMIDs: 34483339, 34954817: 6xde novo patients 4 with Arg207His, 1 Arg182Gln 1 Ser346Phe. All Arg207His patients were neonates with failure to thrive, hyperammonemia, lactic acidosis, and respiratory defects in fibroblasts, major symptoms remitted with treatment by late infancy, and at age 14mo to 3yrs growth and development were normal. Other 2 patients are 17yo with ID, ataxia, spastic paraparesis and dystonia, and a 12yo with psychomotor retardation, spastic tetraparesis, generalised dystonia, absent speech, swallowing problems, and increased blood lactate concentrations. And an internal VCGS patient Arg182Gln (variant also seen in a different patient above) with ID, muscular hypotonia, clinodactyly of the 5th finger, and dysmorphic facial features, proteomics showed decreased ATP5F1A and a complex V deficiency. There is also an alternative change at this residue in the DECIPHER cohort Arg182Pro de novo in an individual with a neurodevelopmental disorder. PMID: 40672495: 6x de novo individuals - 4 variants p.Arg182Gln, p.Ser346Phe, p.Pro331Leu, and p.Leu109Ser - with complex but overlapping neurological phenotypes including developmental delays, intellectual disability, pyramidal tract dysfunction, and dystonia. In vivo functional studies in C. elegans were performed for three of the variants, showing growth defects and disruption of mitochondrial function (measured by mitochondrial stress). Authors suggest a dominant negative mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.285 | COMMD9 |
Krithika Murali gene: COMMD9 was added gene: COMMD9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COMMD9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COMMD9 were set to PMID: 40601774 Phenotypes for gene: COMMD9 were set to Neurodevelopmental disorder, MONDO:0700092, COMMD9-related Review for gene: COMMD9 was set to RED Added comment: PMID: 40601774 report a cohort ascertained through GeneMatcher with phenotypic features overlapping with Ritscher-Schinzel syndrome. Homozygous fs variant in COMMD9 [NM_014186.3:c.208_209del, p.Leu70Glyfs*5] identified in a 4 yo M with dev delay, dysmorphism, skeletal changes including brachydactyly and radioulnar dysostosis, hypotonia, MRI-B anomalies - dysgyria, dilated lateral ventricles, deep white matter periventricular demyelination, thin corpus callosum, cerebellar vermis hypoplasia and malrotation. Consanguineous parents confirmed to be heterozygous carriers. No information provided regarding segregation of these variants in unaffected siblings. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.283 | TBCB |
Krithika Murali gene: TBCB was added gene: TBCB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TBCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBCB were set to PMID: 40856104 Phenotypes for gene: TBCB were set to Neurodevelopmental disorder, MONDO:0700092, TBCB-related Review for gene: TBCB was set to AMBER Added comment: PMID: 40856104 Bratman, S. et al 2025 (Genetics in Medicine) report 10 individuals from 8 unrelated families of Ashkenazi Jewish descent with a homozygous missense founder variant in TBCB (c.589T>A, p.Tyr197Asn) identified through exome sequencing. This variant is present at 1.3% carrier frequency in the AJ population in gnomAD v4 with 0 homozygotes. Variant is reasonably well-conserved, REVEL 0.9 and in the Cap-Gly domain. No other homozygous missense variants in this region in gnomAD v4 and homozygous variants rare, overall. Phenotypic features included: - Motor/speech delays in infancy (almost all) - ASD (8/10) - ADHD (5/10) - Mild ID - formal cognitive evaluation (5/8). - Spastic paraparesis in late childhood (9-12y) with slowly progressive gait difficulties and lower limb spasticity. Urinary abnormalities were not reported. - Brain MRI was performed on five individuals - three displayed a thin corpus callosum, and two had decreased white matter. No prenatal features reported. Supportive Drosophilia models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.281 | COMMD4 |
Lucy Spencer gene: COMMD4 was added gene: COMMD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: COMMD4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COMMD4 were set to 40601774 Phenotypes for gene: COMMD4 were set to Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related Review for gene: COMMD4 was set to RED Added comment: PMID: 40601774 3 siblings with Ritscher-Schinzel syndrome and a homozygous missense in COMMD4 NM_017828.5:c.122T>G; p.Leu41Arg. All three individuals died in infancy and the authors suggest there could be a dual diagnosis to explain the severity. This variant was expressed in a H4 neuroglioma cell line with COMMD4 knocked out, and showed an enhanced degradative turnover compared to WT when treated with cyclohexamide. Western blot in HEK293T cells showed a decrease in the steady-state abundance of COMMD4. Knock out of COMMD4 protein leads to destabilization of the Commander complex. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.280 | TMEM184B |
Lucy Spencer gene: TMEM184B was added gene: TMEM184B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMEM184B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: TMEM184B were set to 39006436 Phenotypes for gene: TMEM184B were set to Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related Review for gene: TMEM184B was set to GREEN Added comment: A cohort of 6 patients with developmental delay (5/6), corpus callosum hypoplasia (4/6), microcephaly (1/6), seizures (3/6), and ID (2/6). 2 patients also had gastrointestinal motility disruption. All 6 have de novo variants in TMEM184B, 5 missense 1 canonical splice. 1 of the missense variants has 35 hets in gnomad but the rest are absent. The authors also say they are aware of a 7th patient with overlapping features by personal communication. A knockout zebrafish model showed a dose dependent reduction in head size and body length in larvae. Knock-in of 2 of the missense variants also showed head size and body length reduction, but the other missense did not. However the other three missense failed to rescue the phenotype of a knockout zebrafish while WT and a negative control did. The authors suggest the first 2 variants are dominant negative while the latter three and loss of function. The splice variant was shown to cause exon 7 skipping which is out of frame. Transfection of the missense and splice variants in HEK293T cells showed that all but 1 had reduced TMEM184B protein levels. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.280 | POLR3D |
Zornitza Stark gene: POLR3D was added gene: POLR3D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: POLR3D was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLR3D were set to 37915380 Phenotypes for gene: POLR3D were set to Leukodystrophy, MONDO:0019046, POLR3D-related Review for gene: POLR3D was set to RED Added comment: PMID 37915380: single individual with compound het variants in POLR3D and childhood onset leukodystrophy manifesting as DD/ID. Additional neurological features included cerebellar signs (e.g., dysarthria, ataxia, and intention tremor) and dysphagia, while non-neurological features included hypodontia, hypogonadotropic hypogonadism, and dysmorphic facial features. Her MRI was notable for diffuse hypomyelination with myelin preservation of early myelinating structures, characteristic of POLR3-related leukodystrophy. Exome sequencing revealed the biallelic variants in POLR3D, a missense variant (c.541C > T, p.P181S) and an intronic splice site variant (c.656-6G > A, p.?). Functional studies of the patient's fibroblasts demonstrated significantly decreased RNA-level expression of POLR3D, along with reduced expression of other Pol III subunit genes. Notably, Pol III transcription was also shown to be aberrant, with a significant decrease in 7SK RNA and several distinct tRNA genes analyzed. Affinity purification coupled to mass spectrometry of the POLR3D p.P181S variant showed normal assembly of Pol III subunits yet altered interaction of Pol III with the PAQosome chaperone complex, indicating the missense variant is likely to alter complex maturation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.278 | HS6ST2 |
Bryony Thompson gene: HS6ST2 was added gene: HS6ST2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HS6ST2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: HS6ST2 were set to 40686562; 30471091; 36993824; 38015989 Phenotypes for gene: HS6ST2 were set to X-linked syndromic intellectual disability MONDO:0020119 Review for gene: HS6ST2 was set to GREEN Added comment: 4 males with a neurodevelopmental phenotype from 3 families (1 set monozygotic twins) hemizygous for rare missense variants and a supporting mouse model. PMID: 40686562 - a Chinese male child with a syndromic neurodevelopmental phenotype hemizygous c.764C>A (p.Pro255Glu) and in vitro assays showing the variant alters function. Parents were unaffected and variant was maternally inherited. PMID: 38015989 - knockout mouse model impairs dendritic spines of hippocampal neurons, and affects memory. PMID: 36993824 - an Iranian male child with a syndromic neurodevelopmental phenotype hemizygouc.979C>T p.Pro327Ser. PMID: 30471091 - Italian monozygotic male twins with a syndromic neurodevelopmental phenotype hemizygous c.916G>C (p.G306R - inherited from unaffected mother) and functional assay showing altered enzyme activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.277 | FSCN1 |
Zornitza Stark gene: FSCN1 was added gene: FSCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FSCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FSCN1 were set to 40874942 Phenotypes for gene: FSCN1 were set to Neurodevelopmental disorder, MONDO:0700092, FSCN1-related Review for gene: FSCN1 was set to RED Added comment: Two individuals reported from an Iranian cohort with same missense variant, c.665C>A; p.Ala222Asp plus other circumstantial data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.276 | TTC1 |
Zornitza Stark gene: TTC1 was added gene: TTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TTC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC1 were set to 40879651 Phenotypes for gene: TTC1 were set to Pontocerebellar hypoplasia, MONDO:0020135, TTC1-related Review for gene: TTC1 was set to RED Added comment: Four individuals from two families reported with the same homozygous missense variant, NM_003314.3: c.784 T > G, p.Phe262Val. No other supporting data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.274 | MAEA |
Zornitza Stark gene: MAEA was added gene: MAEA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MAEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAEA were set to 40880485 Phenotypes for gene: MAEA were set to Neurodevelopmental disorder, MONDO:0700092, MAEA-related Review for gene: MAEA was set to AMBER Added comment: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.273 | CSMD2 |
Krithika Murali changed review comment from: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature; to: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. In addition, no information about unaffected/affected siblings and segregation testing has been provided Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.273 | CDK6 | Zornitza Stark Publications for gene: CDK6 were set to 23918663 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.272 | CSMD2 |
Krithika Murali gene: CSMD2 was added gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688 Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related Review for gene: CSMD2 was set to RED Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.272 | CSMD2 |
Krithika Murali gene: CSMD2 was added gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688 Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related Review for gene: CSMD2 was set to RED Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project. Phenotypic features - age of onset 1.5-10 years old - complex partial seizures (4), secondary GTCS (2) - Normal MRI-B (3), focal cortical dysplasia (1) - mild ID (1). The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism. Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter. CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.267 | WDR18 |
Krithika Murali gene: WDR18 was added gene: WDR18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WDR18 were set to PMID: 40677927 Phenotypes for gene: WDR18 were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: WDR18 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.266 | MIS18BP1 |
Krithika Murali gene: MIS18BP1 was added gene: MIS18BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MIS18BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MIS18BP1 were set to PMID: 40677927 Phenotypes for gene: MIS18BP1 were set to Cornelia de Lange syndrome (MONDO:0016033) Review for gene: MIS18BP1 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.265 | HYPK |
Zornitza Stark gene: HYPK was added gene: HYPK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HYPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: HYPK were set to Clinical Genetics Early View Phenotypes for gene: HYPK were set to Neurodevelopmental disorder, MONDO:0700092, HYPK-related Review for gene: HYPK was set to RED Added comment: Single case report - Patel, R. et al 2025 Clinical Genetics Early View Male proband with developmental delay, autism and facial dysmorphism with a de novo missense HYPK variant (p. R70I). Variant-specific biochemical analyses demonstrates enhanced inhibitory activity of HYPK on NatA-mediated N-terminal protein acetylation. GestaltMatcher analysis indicates that the proband's facial phenotype closely resembles Ogden syndrome (NAA10) and some resemblance to NAA15-NDS - both associated genes are also involved in the N-terminal acetylation pathway. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.264 | DDX39A |
Zornitza Stark gene: DDX39A was added gene: DDX39A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DDX39A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDX39A were set to 40726340 Phenotypes for gene: DDX39A were set to Neurodevelopmental disorder, MONDO:0700092, DDX39A-related Review for gene: DDX39A was set to RED Added comment: PMID: 40726340 Ahmed et al 2025 (Clinical Genetics) report a 7 month old F with GDD, seizures, microcephaly, hypotonia, corpus callosum thinning and homozygous missense variant (p.Lys137Gln) in DDX39A on trio WES with both non-consanguineous parents confirmed to be heterozygous carriers. DDX39A is involved in mRNA splicing and export. Patient-derived fibroblast studies showed that mutant protein resulted in aberrant nuclear clumping and failure to interact with the TREX complex. Of note, closely-related paralogue DDX39B is also a component of the TREX complex and has a definitive monoallelic association with neurodevelopmental disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.263 | ARID3A |
Zornitza Stark gene: ARID3A was added gene: ARID3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARID3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARID3A were set to 40677927 Phenotypes for gene: ARID3A were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: ARID3A was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.262 | PIK3C3 |
Zornitza Stark gene: PIK3C3 was added gene: PIK3C3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PIK3C3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PIK3C3 were set to 40677927 Phenotypes for gene: PIK3C3 were set to Cornelia de Lange syndrome - MONDO:0016033 Review for gene: PIK3C3 was set to RED Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing. In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals: - ARID3A (missense variant, REVEL 0.72) - PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS) - MCM7 (LoF variant, gene linked with cohesin complex) - MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60) - WDR18 (missense variant, weak in silico, REVEL 0.268) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.260 | GLYAT |
Zornitza Stark gene: GLYAT was added gene: GLYAT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GLYAT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GLYAT were set to 40747359 Phenotypes for gene: GLYAT were set to Neurodevelopmental disorder, MONDO:0700092, GLYAT-related Review for gene: GLYAT was set to RED Added comment: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.258 | C1orf109 |
Zornitza Stark gene: C1orf109 was added gene: C1orf109 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: C1orf109 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: C1orf109 were set to 40760247 Phenotypes for gene: C1orf109 were set to Neurodevelopmental disorder, MONDO:0700092, C1orf109-related Review for gene: C1orf109 was set to GREEN Added comment: Cohort of 11 unrelated families, encompassing 18 individuals with bi-allelic variants in C1orf109, 17 liveborn. Affected individuals presented with moderate-to-severe or severe global developmental delay/intellectual disability (17 of 17) and never achieved developmental milestones. Microcephaly and seizures were other common features. Reduced ribosome activity demonstrated during early brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.256 | ASAP2 |
Zornitza Stark gene: ASAP2 was added gene: ASAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ASAP2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ASAP2 were set to 40770811; 28191890; 33057194; 35982160 Phenotypes for gene: ASAP2 were set to Neurodevelopmental disorder, MONDO:0700092, ASAP2-related Review for gene: ASAP2 was set to AMBER Added comment: One individual reported with compound het missense variants. Identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811. Another individual with biallelic variants identified in the DDD cohort. Several others found with de novo variants through retrospective literature review of large cohort studies reporting multiple gene candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of ASAP2 in brain development. Rated AMBER as only two families with bi-allelic variants and minimal information on the cases with mono-allelic variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.254 | RTF1 |
Zornitza Stark gene: RTF1 was added gene: RTF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RTF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RTF1 were set to 40770811; 33057194; 35982160; 31038196 Phenotypes for gene: RTF1 were set to Neurodevelopmental disorder, MONDO:0700092, RTF1-related Review for gene: RTF1 was set to GREEN Added comment: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.253 | MED29 |
Sarah Milton gene: MED29 was added gene: MED29 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: MED29 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MED29 were set to PMID: 40745490 Phenotypes for gene: MED29 were set to Pontocerebellar hypoplasia, MONDO:0020135, MED29-related Review for gene: MED29 was set to AMBER Added comment: MED29 encodes part of the mediator (MED) complex which has role in RNA polymerase II (Poll II) gene transcription. PMID: 40745490 describes 2 siblings from one consanguineous family affected with pontocerebellar hypoplasia, profound GDD, severe microcephaly, cataracts and variable seizures. Both shared the same homozygous missense variant with presumed LOF mechanism. No homozygous LOF variants in gnomAD v4. Extensive functional studies performed with morpholino knockdown of MED29 having marked reduction of GABAergic neurons and abnormal touch response. Studies of hippocampal neurons from mice with knockdown MED29 showed impaired development. Mouse embryos that had knockdown of MED29 during development demonstrated abnormal neuronal migration. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.253 | CCDC93 |
Sarah Milton gene: CCDC93 was added gene: CCDC93 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC93 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC93 were set to PMID: 40601774 Phenotypes for gene: CCDC93 were set to Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related Review for gene: CCDC93 was set to AMBER Added comment: CCDC93 encodes the coiled coil domain containing subunit of commander complex involved in recycling of integral membrane proteins. PMID: 40601774 describes 1 affected individual with compound heterozygous variants in CCDC93 who presented with Ritscher Schinzel like phenotype. Features included hypoplasia of cerebellar hemispheres, hypoplasia of the brainstem and of the corpus callosum, distinctive facial features and multiple small renal cysts. Variants were missense and nonsense. No homozygous LOF variants in gnomAD v4. Some supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.252 | SCN3B |
Sarah Milton gene: SCN3B was added gene: SCN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SCN3B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SCN3B were set to PMID: 40879121 Phenotypes for gene: SCN3B were set to Neurodevelopmental disorder, MONDO:0700092, SCN3B-related Review for gene: SCN3B was set to AMBER Added comment: SCN3B Encodes b3 auxiliary subunit of the sodium channel. 4 affected individuals from 2 consanguineous families reported in PMID: 40879121 with biallelic variants in this gene with neurodevelopmental phenotypes. Presentation included GDD, ID of variable severity, autism, seizures. One variant was nonsense, one canonical splice site in the penultimate exon. No homozygous LOF variants in gnomAD v4. Some functional studies performed with loss of function of channel demonstrated for one variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.252 | XPO1 |
Sangavi Sivagnanasundram gene: XPO1 was added gene: XPO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: XPO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: XPO1 were set to 40819229 Phenotypes for gene: XPO1 were set to Neurodevelopmental disorder, XPO1-related, MONDO:0700092 Review for gene: XPO1 was set to GREEN Added comment: Established gene-disease association 22 probands with de novo XPO1 variants presenting with phenotypes associated with NDD (DD, ID, motor delay, behavioral problems, facial dysmorphisms, microcephaly and organ anomalies) along with supportive Drosophila knockdown model reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.252 | ZNF496 |
Zornitza Stark gene: ZNF496 was added gene: ZNF496 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZNF496 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZNF496 were set to 40806714 Phenotypes for gene: ZNF496 were set to Neurodevelopmental disorder, MONDO:0700092, ZNF496-related Review for gene: ZNF496 was set to RED Added comment: Single individual with NDD and de novo LoF variant, no other supportive data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.251 | TRIM74 |
Sangavi Sivagnanasundram gene: TRIM74 was added gene: TRIM74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRIM74 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRIM74 were set to 40735933 Phenotypes for gene: TRIM74 were set to Neurodevelopmental disorder, TRIM74-related, MONDO:0700092 Review for gene: TRIM74 was set to RED Added comment: Only one reported case with DD. PMID: 40735933 5yr M presenting from non consanguineous parents with global developmental delay, hypotonia, seizures, and diffuse cerebral atrophy with mega cisterna magna. Parents of the proband were found to be carriers of the variant. Homozygous variant c.562C > T (p.Pro121Leu) - NFE AF 0.0188% - rare enough for AR Supportive functional analysis on human fibroblast showed protein function disruption leading to protein aggregation, proteostasis collapse, and cell death. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.248 | TMPRSS7 |
Zornitza Stark gene: TMPRSS7 was added gene: TMPRSS7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TMPRSS7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMPRSS7 were set to 40796295 Phenotypes for gene: TMPRSS7 were set to Neurodevelopmental disorder, TMPRSS7-related Review for gene: TMPRSS7 was set to RED Added comment: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.247 | PPP1R2 |
Zornitza Stark gene: PPP1R2 was added gene: PPP1R2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PPP1R2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PPP1R2 were set to 40597352; 26558779 Phenotypes for gene: PPP1R2 were set to Neurodevelopmental disorder, PPP1R2-related Review for gene: PPP1R2 was set to RED Added comment: Single individual reported with homozygous splicing variant c.403 + 3 A >T. Abnormal splicing demonstrated but leaky. Clinical features included pre and postnatal growth restriction, ventricular septal defect, dysmorphic features (proptosis, long eye lashes, thick eyebrows, low-set ears), microcephaly, sensorineural hearing loss, cortical cataracts, retinal defects, intellectual disability with limited speech, and autism spectrum disorder. Note mouse model is embryonically lethal, leading the authors to speculate survival may be due to fraction of normally spliced transcripts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.245 | BORCS5 |
Zornitza Stark gene: BORCS5 was added gene: BORCS5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BORCS5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BORCS5 were set to 40385417 Phenotypes for gene: BORCS5 were set to Lysosomal storage disease, MONDO:0002561, BORCS5-related Review for gene: BORCS5 was set to GREEN Added comment: preprint PMID 40385417, describing 12 individuals from 7 families with a spectrum of abnormalities (osteopetrosis not mentioned), suggestive of lysosomal disorder. Homozygous loss-of-function variants presented with prenatally lethal arthrogryposis multiplex congenita, brain malformations, and neuropathological evidence of diffuse neuroaxonal dystrophy. Individuals with missense variants presented differently, with microcephaly, developmental epileptic encephalopathy, intellectual disability, optic atrophy, spasticity, and progressive movement disorders. In this group, brain MRI showed diffuse hypomyelination and progressive global cerebral atrophy, consistent with neurodegeneration. Borcs5 knockout in zebrafish exhibited microcephaly, motor deficits, and seizures, mirroring the patients' clinical presentation. At the cellular level, BORCS5 loss-of-function but not missense variants, resulted in lower protein expression and impaired BORC assembly, paralleled by perinuclear lysosomal clustering. However, both loss-of-function and missense BORCS5 variants were associated with reduced total lysosomal proteolysis, reduced activity of the lysosomal hydrolases glucocerebrosidase and cathepsin B, and presence of multilamellar bodies, indicating lysosomal dysfunction. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.244 | ARNTL |
Sarah Milton gene: ARNTL was added gene: ARNTL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ARNTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ARNTL were set to PMID: 40720646 Phenotypes for gene: ARNTL were set to Neurodevelopmental disorder, MONDO:0700092, BMAL1-related Review for gene: ARNTL was set to GREEN Added comment: Note has new HGNC approved name - BMAL1 BMAL1 encodes a transcription factor that plays a role in the mammalian molecular clock, binds to promoter of PER and CRY family genes to promote transcription. Other circardian genes have sleep phase disorder assoc but not neurodevelopmental phenotype. 10 affected individuals described in PMID: 40455867 with variable developmental delay/ID from average IQ to severe ID, seizures in 50%, autism, some had sleep disturbance and marfanoid habitus. Variants were LOF & missense and very rare or absent in gnomAD v4. 5 confirmed de novo, 2 confirmed inherited (one from apparently unaffected mother). Functional studies using luciferase reporter assay of downstream target PER showed reduced luminescence for most variants with presumed LOF mechanism. One variant p.(Ile201Thr) led to increased luminescence with author's postulating GOF mechanism for this variant. Drosophilia studies for 2 of the variants demonstrated altered circadian rhythm. ?needs more studies to further define mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.244 | MAN2A2 | Zornitza Stark Publications for gene: MAN2A2 were set to 36357165 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.241 | CCDC186 |
Zornitza Stark gene: CCDC186 was added gene: CCDC186 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CCDC186 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC186 were set to 33259146; 37569695; 40633195 Phenotypes for gene: CCDC186 were set to Neurodevelopmental disorder, MONDO:0700092, CCDC186-related Review for gene: CCDC186 was set to GREEN Added comment: At least 3 unrelated families reported with bi-allelic LoF variants and a neurodevelopmental phenotype comprising ID and seizures, plus other more variable features. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.240 | PCLO | Zornitza Stark Publications for gene: PCLO were set to 25832664 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.237 | TAF13 | Zornitza Stark Publications for gene: TAF13 were set to 28257693 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.235 | FAAH2 | Zornitza Stark Publications for gene: FAAH2 were set to 25885783 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.220 | TBC1D32 |
Zornitza Stark gene: TBC1D32 was added gene: TBC1D32 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: TBC1D32 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBC1D32 were set to 24285566; 32573025; 32060556; 31130284; 36826837; 40319332 Phenotypes for gene: TBC1D32 were set to Orofacial digital syndrome type IX, MIM#258865 Review for gene: TBC1D32 was set to GREEN Added comment: Multiple affected individuals reported from unrelated families. Midline brain abnormalities are a feature and DD/ID is variable. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.218 | RNU5B-1 | Zornitza Stark Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.216 | RNU2-2P | Zornitza Stark Publications for gene: RNU2-2P were set to 40210679 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.213 | ST5 |
Rylee Peters gene: ST5 was added gene: ST5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ST5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ST5 were set to 40717498 Phenotypes for gene: ST5 were set to Neurodevelopmental disorder (MONDO:0700092), DENND2B-related Review for gene: ST5 was set to GREEN Added comment: HGNC: DENND2B Cohort of 11 individuals all with a history of motor and/or language developmental delay, intellectual disability in 6/11 (mild to severe), brain structure/function abnormalities were reported in 9/11 patients (7/11 seizures; 5/9 abnormal findings on brain MRI), muscle weakness/hypotonia in 8/9, psychosis in 4/10 patients, symptoms of catatonia in 4/10, other psychiatric/behavioural concerns (anxiety, attention deficit, autism or autistic features) in 10/10. Total of 10 variants including 2x frameshift/nonsense, 6x missense, 1x splice, 1x single amino acid deletion – all absent from v4 and de novo except 1 inherited from a father with cognitive and psychiatric symptoms and the inframe del which has 2 hets in gnomAD and is inherited an unaffected father (no formal assessment). In vivo zebrafish modelling measuring cilia length suggests that patient variants tested (9/10 excluding the splice variant) did not induce cilia length shortening, which is consistent with KO models and therefore a loss of function effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.213 | BLOC1S1 |
Rylee Peters changed review comment from: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211 11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1. The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy (in some cases), and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy. Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.; to: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211 11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1. The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy, and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy. Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.211 | KDM2B | Zornitza Stark Publications for gene: KDM2B were set to 36322151 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.209 | SNW1 |
Lucy Spencer gene: SNW1 was added gene: SNW1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SNW1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SNW1 were set to 40608414 Phenotypes for gene: SNW1 were set to Neurodevelopmental disorder (MONDO:0700092), SNW1-related Review for gene: SNW1 was set to GREEN Added comment: cohort of 9 patients with moderate to profound ID, microcephaly, seizures (7/9), facial dysmorphism, and brain malformations (6/9 - corpus callosum hypoplasia, Dandy-Walker malformation). 3 splice, 1 frameshift, 2 missense, 3 in frame deletions, 1 start loss. all but 1 de novo (the last parents not available). SNW1 is a core component of the spliceosome and facilitates the conformational changes of the spliceosome. Expression of variants in HEK293 cells showed some decreased SNW1 expression while others increased it (including the frameshift), and only the frameshift variant was mislocalised/in the cytoplasm instead of the nucleus. Several of the variants caused loss of binding to PPIL1 or other proteins which SNW1 usually recruits to the spliceosome. All variants in this study were found to either affect protein expression or localization or influence interactions with other proteins in the spliceosome complex suggesting loss of function. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.208 | CHTF18 |
Sangavi Sivagnanasundram gene: CHTF18 was added gene: CHTF18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CHTF18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHTF18 were set to 40717333 Phenotypes for gene: CHTF18 were set to complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465 Review for gene: CHTF18 was set to AMBER Added comment: Only two individuals reported with ID/DD: 1 - 9M with DD, autism and seizures. De novo variant identified - p.Leu355Val 2 - 23month F with congenital bilateral ventriculomegaly status post ventriculoperitoneal shunt placement, epilepsy, right eye optic nerve hypoplasia, hypotonic cerebral palsy complicated by left hip subluxation, and G-tube dependence. De novo variant identified - p.His645Pro 3 - 3F presenting with global DD, hypotonia, seizure and abnormal brain MRI. De novo variant identified - p.Leu676Arg Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.208 | SV2A | Zornitza Stark Publications for gene: SV2A were set to PMID: 37985816 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.206 | RNU5A-1 |
Zornitza Stark gene: RNU5A-1 was added gene: RNU5A-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RNU5A-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RNU5A-1 were set to 40379786 Phenotypes for gene: RNU5A-1 were set to Neurodevelopmental disorder (MONDO:0700092), RNU5A-1 related Review for gene: RNU5A-1 was set to AMBER Added comment: PMID: 40379786 (2025) - three unrelated individuals with de novo variants in the RNU5A-1 gene (classified as VUS) and a neurodevelopmental disorder. Six individuals with rare de novo variants were identified in total but clinical details were only available for 3/6. Of these three individuals, two harboured the same variant (n.40_41insA) on the maternal allele, while the third individual harboured a different variant (n.39del) but also on the 5′ loop I domain of RNU5A-1. Clinical data showed neurodevelopmental abnormalities (mild ID (2), severe ID (1), epilepsy (2), brain MRI abnormalities (1)) with variable congenital malformations. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.204 | BSN |
Zornitza Stark gene: BSN was added gene: BSN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Mode of inheritance for gene: BSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BSN were set to 40393460 Phenotypes for gene: BSN were set to Neurodevelopmental disorder (MONDO:0700092), BSN-related Review for gene: BSN was set to GREEN Added comment: Guzman et al 2025: Described 12 additional patients with missense (3/12) and premature termination variants (9/12) which included de novo and inherited variants, suggesting incomplete penetrance. They assessed all reported patients (n=29) which revealed common clinical characteristics including epilepsy(13/29), febrile seizures (7/29), generalised tonic-clonic seizures (5/29), and focal-onset seizures (3/29). Behavioural phenotypes were present in almost half of all individuals (14/29), which included ADHD (7/29) and autistic behaviour (5/29). Additional common features included developmental delay (11/29), obesity (10/29), and delayed speech (8/29). In adults with BSN PTVs, milder features were common, suggesting phenotypic variability, including a range of individuals without obvious neurodevelopmental features (7/29). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.198 | PDE1B |
Zornitza Stark gene: PDE1B was added gene: PDE1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PDE1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDE1B were set to 40492975 Phenotypes for gene: PDE1B were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related Review for gene: PDE1B was set to GREEN Added comment: PMID:40492975 reported seven individuals from five unrelated families identified with biallelic PDE1B variants. Three truncating (p.Gln45Ter, p.Gln86Ter, p.Ser298Alafs*6) and three splicing variants (c.594 + 2 T>G, c.735 + 5G>A, c.837-1G>C) were identified from these patients in total. They presented with an early-onset movement disorder characterised by hypotonia in infancy, progressing to ataxia and dystonia in early childhood, with motor and speech delay, and intellectual disability. Functional evidence is also available for these variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.195 | FASTKD5 |
chirag patel gene: FASTKD5 was added gene: FASTKD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FASTKD5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FASTKD5 were set to PMID: 40499538 Phenotypes for gene: FASTKD5 were set to Leigh syndrome MONDO:0009723 Review for gene: FASTKD5 was set to GREEN Added comment: 3 unrelated individuals with Leigh syndrome (1 x severe/early-onset/fatal, 1 x milder/childhood-onset, 1 x adult-onset). WES identified compound heterozygous variants in FASTKD5 gene (3 x missense variants, 2 x frameshift variants leading to a premature stop codon). The FASTKD5 gene codes for a mitochondrial protein essential for processing mRNAs at non-canonical cleavage sites in the primary mitochondrial transcript. Analysis of fibroblasts from two subjects showed reduced steady-state levels of FASTKD5 protein by immunoblot, reduced translation of the cytochrome c oxidase subunit 1, impaired assembly of complex IV, and a consequent decrease in cytochrome c oxidase enzymatic activity. The extent of these deficiencies appeared to correlate with the severity of the clinical phenotype. Expression of a wild-type FASTKD5 cDNA, but not cDNAs expressing the missense variants, rescued all the molecular defects in the subjects' fibroblasts, demonstrating that the alleles are pathogenic. 2/3 missense variants resulted in near complete loss of function, while one was hypomorphic, resulting from impaired protein stability. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.193 | NDUFA4 |
Sarah Milton gene: NDUFA4 was added gene: NDUFA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NDUFA4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NDUFA4 were set to PMID: 39967265 Phenotypes for gene: NDUFA4 were set to Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065 Review for gene: NDUFA4 was set to GREEN Added comment: HGNC symbol now COXFA4 Around 10 patients reported in literature thus far with most having developmental delay. Association with hypertrophic cardiomyopathy reported in 3 siblings from a family in PMID: 39967265 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.190 | LONP1 | Zornitza Stark Publications for gene: LONP1 were set to 31636596 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.185 | LGI1 |
Krithika Murali gene: LGI1 was added gene: LGI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: LGI1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LGI1 were set to PMID:40455867 Phenotypes for gene: LGI1 were set to Developmental and epileptic encephalopathy MONDO:0100062, LGI1-related Review for gene: LGI1 was set to GREEN Added comment: PMID: 40455867 report patients with biallelic variants in 6 individuals from 4 consanguineous families with a more severe DEE phenotype. All indivduals had seizures, global dev delay/ID and generalised hypotonia. Four out of five exhibited spasticity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.183 | WDR91 |
Bryony Thompson gene: WDR91 was added gene: WDR91 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WDR91 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR91 were set to 32732226; 38041506; 34791078; 40550703; 28860274; 34028500; ClinVar: SCV000965687.1 Phenotypes for gene: WDR91 were set to Complex neurodevelopmental disorder MONDO:0100038 Review for gene: WDR91 was set to GREEN Added comment: Homozygous LoF variants were identified in at least 5 families with a mainly neurodevelopmental disorder phenotype. Also, supporting mouse models 1. Brain malformation 2. Severe developmental delay, microcephaly, severe microlissencephaly, agenesis of corpus callosum, epilepsy, spastic tetraparesis, laryngomalacia, bicuspid aortic valve, congenital hip dislocation, growth retardation, dysmorphisms 3. Severe microcephaly, dysmorphic features, and organomegaly, along with early onset psychomotor delay, hypotonia, sensorineural hearing impairment, and visual impairment 4. Hygroma, macrocephaly, abnormal ears, unilateral simian crease, hydrocephaly, cerebellar hypoplasia, interventricular communication 5. Neurodevelopmental disorder with brain malformations and multiple congenital anomalies Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.178 | NSUN3 |
Zornitza Stark gene: NSUN3 was added gene: NSUN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: NSUN3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NSUN3 were set to 27356879; 32488845; 40465263 Phenotypes for gene: NSUN3 were set to Combined oxidative phosphorylation deficiency 48, MIM# 619012 Review for gene: NSUN3 was set to GREEN Added comment: Six families reported. DD/ID can be part of the phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.177 | SREK1 |
Sangavi Sivagnanasundram gene: SREK1 was added gene: SREK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SREK1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SREK1 were set to 40549565 Phenotypes for gene: SREK1 were set to Prader-Willi-like syndrome, SREK1-related MONDO:0008300 Review for gene: SREK1 was set to AMBER Added comment: Three Pakistani probands from three consanguineous families identified with biallelic variants in SREK1. Affected individuals presented with hyperphagic obesity and neurodevelopmental delay. They also presented with psychological and behavioural issues and were phenotypically similar to Prader-Willi affected individuals. ID/DD is a feature in the affected individuals. Further testing was conducted using human induced pluripotent stem cell (iPSC) -derived neurons followed by RNA sequencing conducted on the neurons. The results of the assay was suggestive that variants located in the RNA recognition domain (residues 19–96 and 173–256) of SREK1 downregulation of SNORD115 and SNORD116 leading to Prader-Willi-like phenotype however proper validation and controls weren't used. No relevant mouse models were identified on IMPC (international mouse phenotype consortium) to further support gene-disease association there gene reviewed as Amber. Variants identified in SREK1 - AF's from gnomADv4.1 P95L - absent in gnomAD v4.1 T194M - EAS PopMax AF - 0.03787% (47 hets) E601K - SAS PopMax AF - 0.01319% (12 hets) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.176 | ADAM23 |
Sarah Milton gene: ADAM23 was added gene: ADAM23 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ADAM23 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADAM23 were set to PMID: 40455867 Phenotypes for gene: ADAM23 were set to Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related Review for gene: ADAM23 was set to AMBER Added comment: ADAM23 encodes a transmembrane protein receptor which is a receptor for LGI1. LGI1/ADAM22/ADAM23 form a complex that regulates excitatory synaptic transmission and neuronal excitability in the brain. 1 affected individual described in PMID: 40455867 with severe neonatal seizures, joint contractures, absent reflexes. Noted to have a homozygous NMD predicted variant in ADAM23. Also had a de novo missense variant in PRKD1. Knockout ADAM23 mice show early lethal epilepsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.176 | SMARCC1 |
Gemma Edwards gene: SMARCC1 was added gene: SMARCC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMARCC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMARCC1 were set to 29983323; 37285932 Phenotypes for gene: SMARCC1 were set to SMARCC1-associated developmental dysgenesis syndrome (MONDO:0700123) Review for gene: SMARCC1 was set to GREEN Added comment: Phenotype expansion since original literature. ClinGen - "SMARCC1-associated developmental dysgenesis syndrome is characterized by developmental delay, cerebral ventriculomegaly, aqueductal stenosis, and other associated structural brain and cardiac defects". See cases in PMIDs 29983323, 37285932. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.175 | IKZF2 |
Zornitza Stark gene: IKZF2 was added gene: IKZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: IKZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: IKZF2 were set to 37316189 Phenotypes for gene: IKZF2 were set to Immunodysregulation, craniofacial anomalies, hearing impairment, athelia, and developmental delay, MIM# 621234 Review for gene: IKZF2 was set to AMBER Added comment: PMID 37316189: two individuals with de novo variants and syndromic immunodysregulation, including craniofacial anomalies, hearing impairment, athelia, and developmental delay. Note that variants in this gene are also associated with non-syndromic immune dysregulation and non-syndromic HL. Genotype-phenotype correlation unclear. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.173 | ANKS1B |
Lilian Rudd gene: ANKS1B was added gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature SV/CNV tags were added to gene: ANKS1B. Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANKS1B were set to PMID: 31388001; 38129387 Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related Review for gene: ANKS1B was set to GREEN Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model. Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.171 | KCNA6 |
Zornitza Stark gene: KCNA6 was added gene: KCNA6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: KCNA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCNA6 were set to 36318112; 40472070 Phenotypes for gene: KCNA6 were set to Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related Review for gene: KCNA6 was set to GREEN Added comment: PMID 36318112: four individuals with de novo variants in this gene and NDD/epilepsy phenotype. Supportive functional data. Additional individual in PMID 40472070 with de novo variant and epilepsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.168 | ZBTB7B |
Zornitza Stark gene: ZBTB7B was added gene: ZBTB7B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: ZBTB7B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ZBTB7B were set to 40392549 Phenotypes for gene: ZBTB7B were set to Inborn error of immunity, MONDO:0003778, ZBTB7B-related Review for gene: ZBTB7B was set to AMBER Added comment: Single patient presented with a complex syndromic phenotype including CID, severe atopy, severe fibroinflammatory interstitial lung disease, corneal vascularization and scarring, sensorineural hearing loss, global developmental delay, and growth failure. K360N variant is not found in unaffected individuals; functional investigations indicate that K360N exhibits damaging multimorphic effects; and the causal relationship between K360N and the clinical phenotype was confirmed through gene transfer experiments in both T cells and pulmonary fibroblasts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.164 | PTPN1 |
Zornitza Stark gene: PTPN1 was added gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PTPN1 were set to 39986310 Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related Review for gene: PTPN1 was set to GREEN Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.162 | WSB2 |
Krithika Murali gene: WSB2 was added gene: WSB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: WSB2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WSB2 were set to PMID:40374945 Phenotypes for gene: WSB2 were set to Complex neurodevelopmental disorder, MONDO:0100038, WSB2-related Review for gene: WSB2 was set to GREEN Added comment: PMID: 40374945 describe 5 individuals from 4 unrelated families with biallelic WSB2 variants and a complex neurodevelopmental disorder. Phenotypic features include: - Dev delay (all) - Brain anomalies (4/5 including callosal anomalies and cerebellar hypoplasia) - Dysmorphic feature - IUGR/oligohydramnios (3/5) - Hypotonia (all) - Microcephaly (3/5) - Seizures (3/5) Includes two siblings with biallelic missense variants and shared phenotype. 3 unaffected siblings were heterozygous for the variant or hmz wt. Phenotypic features associated with hmz nonsense/fs variants were more severe than missense. Supportive mouse model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.161 | NKAP | Zornitza Stark Mode of inheritance for gene: NKAP was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.160 | PRR12 | Zornitza Stark Publications for gene: PRR12 were set to 29556724 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.159 | RREB1 | Zornitza Stark Publications for gene: RREB1 were set to 32938917; 38332451 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.158 | TAF1C | Zornitza Stark Publications for gene: TAF1C were set to 32779182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.155 | TM2D3 |
Zornitza Stark gene: TM2D3 was added gene: TM2D3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TM2D3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TM2D3 were set to 40449487 Phenotypes for gene: TM2D3 were set to Neurodevelopmental disorder, MONDO:0700092, TM2D3-related Review for gene: TM2D3 was set to GREEN Added comment: Four individuals from 4 unrelated families identified with biallelic variants in this gene. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.153 | SLK |
Zornitza Stark gene: SLK was added gene: SLK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SLK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLK were set to 40347834 Phenotypes for gene: SLK were set to Neurodevelopmental disorder, MONDO:0700092, SLK-related Review for gene: SLK was set to GREEN Added comment: Three affected individuals from three unrelated families reported. Two of the families were consanguineous and homozygous LoF variants were present in the probands. Third individual had compound het missense variants. Functional data from a Drosophila model and transdifferentiated neurons. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.148 | MYCBP2 | Zornitza Stark edited their review of gene: MYCBP2: Added comment: Concerns about LoF variants in population datasets as well as in individuals undergoing diagnostic testing for a wide variety of unrelated phenotypes: downgrade to RED.; Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.148 | BBIP1 | Zornitza Stark Publications for gene: BBIP1 were set to 24026985 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.141 | SMAD6 |
Boris Keren gene: SMAD6 was added gene: SMAD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMAD6 were set to PMID: 32499606 Penetrance for gene: SMAD6 were set to Incomplete Review for gene: SMAD6 was set to GREEN Added comment: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | FBXO22 |
Sarah Milton gene: FBXO22 was added gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXO22 were set to PMID: 40215970 Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related Review for gene: FBXO22 was set to GREEN Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases. 14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4). Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies. Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | GAP43 |
Zornitza Stark gene: GAP43 was added gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GAP43 were set to 39738362 Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related Review for gene: GAP43 was set to RED Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities. The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.130 | LSM1 | Zornitza Stark Publications for gene: LSM1 were set to PMID: 31010896 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.127 | RNU2-2P | Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Previously referred to as RNU2-2P Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.125 | BRF2 |
Zornitza Stark gene: BRF2 was added gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRF2 were set to 40229899 Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related Review for gene: BRF2 was set to GREEN Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.121 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | PCNA |
Sangavi Sivagnanasundram gene: PCNA was added gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCNA were set to 24911150, 33426167, 36990216 Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309 Review for gene: PCNA was set to AMBER Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778 Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown. Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | EIF3K |
Sangavi Sivagnanasundram gene: EIF3K was added gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3K were set to 40219605 Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092 Review for gene: EIF3K was set to RED Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported. Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%). The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype. The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID: 40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.115 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.113 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.111 | FMR1_FXS_CGG |
Bryony Thompson STR: FMR1_FXS_CGG was added STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184 Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624 Review for STR: FMR1_FXS_CGG was set to GREEN STR: FMR1_FXS_CGG was marked as clinically relevant STR: FMR1_FXS_CGG was marked as current diagnostic Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.106 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.104 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.101 | EEF1D | Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 |
Sarah Milton gene: CDKL1 was added gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL1 were set to PMID: 40088891 Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related Mode of pathogenicity for gene: CDKL1 was set to Other Review for gene: CDKL1 was set to AMBER Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4). Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL2 |
Sarah Milton gene: CDKL2 was added gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL2 were set to PMID: 40088891 Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related Penetrance for gene: CDKL2 were set to Complete Mode of pathogenicity for gene: CDKL2 was set to Other Review for gene: CDKL2 was set to AMBER Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion. 2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging. Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5) Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||