Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Intellectual disability syndromic and non-syndromic v1.780 CDK4 Lucy Spencer Publications for gene: CDK4 were set to 40210435
Intellectual disability syndromic and non-syndromic v1.777 SUPT6H Lucy Spencer gene: SUPT6H was added
gene: SUPT6H was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: SUPT6H was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SUPT6H were set to 41864309
Phenotypes for gene: SUPT6H were set to Neurodevelopmental disorder, MONDO:0700092, SUPT6H-related
Intellectual disability syndromic and non-syndromic v1.776 WWP1 Zornitza Stark gene: WWP1 was added
gene: WWP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: WWP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WWP1 were set to 41786693; 32699206
Phenotypes for gene: WWP1 were set to Neurodevelopmental disorder, MONDO:0700092, WWP1-related
Intellectual disability syndromic and non-syndromic v1.775 EMG1 Zornitza Stark Publications for gene: EMG1 were set to 19463982
Intellectual disability syndromic and non-syndromic v1.774 KLHL15 Zornitza Stark Publications for gene: KLHL15 were set to 25644381; 24817631
Intellectual disability syndromic and non-syndromic v1.772 GTF2E2 Zornitza Stark Publications for gene: GTF2E2 were set to PMID: 28973399
Intellectual disability syndromic and non-syndromic v1.770 GSX2 Zornitza Stark Publications for gene: GSX2 were set to 31412107
Intellectual disability syndromic and non-syndromic v1.768 OLA1 Zornitza Stark gene: OLA1 was added
gene: OLA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: OLA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OLA1 were set to 41887223
Phenotypes for gene: OLA1 were set to Neurodevelopmental disorder, MONDO:0700092, OLA1-related
Intellectual disability syndromic and non-syndromic v1.766 SUPT4H1 Sarah Milton gene: SUPT4H1 was added
gene: SUPT4H1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SUPT4H1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUPT4H1 were set to 41842694
Phenotypes for gene: SUPT4H1 were set to Syndromic disease, MONDO:0002254, SUPT4H1-related
Intellectual disability syndromic and non-syndromic v1.765 LMAN2L Zornitza Stark Publications for gene: LMAN2L were set to PMID: 31020005; 26566883
Intellectual disability syndromic and non-syndromic v1.763 ATG12 Sangavi Sivagnanasundram gene: ATG12 was added
gene: ATG12 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: ATG12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATG12 were set to 41895291
Phenotypes for gene: ATG12 were set to ATG12-related neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.761 NDUFA5 Zornitza Stark gene: NDUFA5 was added
gene: NDUFA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: NDUFA5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA5 were set to 41916321
Phenotypes for gene: NDUFA5 were set to Complex I deficiency
Penetrance for gene: NDUFA5 were set to Complete
Intellectual disability syndromic and non-syndromic v1.760 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to
Intellectual disability syndromic and non-syndromic v1.757 SLC20A2 Zornitza Stark edited their review of gene: SLC20A2: Added comment: PMID 41458256: Reports a single individual a homozygous nonsense SLC20A2 variant presenting with infantile primary familial brain calcification, cerebral arterial vasculopathy and ischaemic stroke. Individual exhibited seizures, hypotonia, poor feeding, and extensive ischaemic changes.

PMID 35881308: reports two siblings from a consanguineous Turkish family with a homozygous splice‑site loss‑of‑function variant NM_006749.5:c.1794+1G>A. The affected children presented with severe paediatric‑onset features resembling congenital CMV infection: growth retardation, bilateral cataracts, microcephaly, seizures, cerebral atrophy, corpus callosum hypoplasia and brain microcalcifications.

Gene is classically associated with a milder mono-allelic disorder, which typically does not involve ID.; Changed rating: AMBER; Changed publications: 41458256, 35881308; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.755 FRMD4A Zornitza Stark Publications for gene: FRMD4A were set to 25388005; 30214071
Intellectual disability syndromic and non-syndromic v1.752 NPRL2 Lucy Spencer gene: NPRL2 was added
gene: NPRL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NPRL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NPRL2 were set to 26505888; 34376795; 40804712; 30093711
Phenotypes for gene: NPRL2 were set to epilepsy, familial focal, with variable foci 2 (MIM#617116)
Review for gene: NPRL2 was set to AMBER
Added comment: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy;

PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes

PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2

PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2

PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad

Borderline amber/green for this panel
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.749 EMX2 Krithika Murali Publications for gene: EMX2 were set to 8528262; 9359037; 9153481; 9153481; 18409201
Intellectual disability syndromic and non-syndromic v1.745 DIP2B Bryony Thompson Publications for gene: DIP2B were set to 17236128
Intellectual disability syndromic and non-syndromic v1.742 KCNJ4 Chirag Patel gene: KCNJ4 was added
gene: KCNJ4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: KCNJ4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNJ4 were set to 41830586
Phenotypes for gene: KCNJ4 were set to Neurodevelopmental disorder, MONDO:0700092, KCNJ4-related
Mode of pathogenicity for gene: KCNJ4 was set to Other
Intellectual disability syndromic and non-syndromic v1.741 WDTC1 Lucy Spencer gene: WDTC1 was added
gene: WDTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: WDTC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDTC1 were set to 41793087
Phenotypes for gene: WDTC1 were set to Neurodevelopmental disorder MONDO:0700092, WDTC1-related
Intellectual disability syndromic and non-syndromic v1.740 SLC6A17 Lucy Spencer Publications for gene: SLC6A17 were set to 25704603; 23672601
Intellectual disability syndromic and non-syndromic v1.736 TSEN54 Zornitza Stark Publications for gene: TSEN54 were set to 20301773
Intellectual disability syndromic and non-syndromic v1.734 MT-TW Zornitza Stark gene: MT-TW was added
gene: MT-TW was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TW.
Mode of inheritance for gene gene: MT-TW was set to MITOCHONDRIAL
Publications for gene: MT-TW were set to 7695240; 9266739; 9673981; 12776230; 15054399; 18337306; 19809478; 26524491; 23841600; 30937556
Phenotypes for gene: MT-TW were set to Mitochondrial disease (MONDO:0044970), MT-TW-related
Intellectual disability syndromic and non-syndromic v1.733 MT-TV Zornitza Stark gene: MT-TV was added
gene: MT-TV was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TV.
Mode of inheritance for gene gene: MT-TV was set to MITOCHONDRIAL
Publications for gene: MT-TV were set to 9450773; 12056939; 19252805; 15320572; 18314141; 24691472; 39468830
Phenotypes for gene: MT-TV were set to Mitochondrial disease (MONDO:0044970), MT-TV-related
Intellectual disability syndromic and non-syndromic v1.732 MT-TS2 Zornitza Stark gene: MT-TS2 was added
gene: MT-TS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TS2.
Mode of inheritance for gene gene: MT-TS2 was set to MITOCHONDRIAL
Publications for gene: MT-TS2 were set to 9792552; 10090882; 16950817; 21257182; 22369973; 22378285
Phenotypes for gene: MT-TS2 were set to Mitochondrial disease (MONDO:0044970), MT-TS2-related
Intellectual disability syndromic and non-syndromic v1.731 MT-TS1 Zornitza Stark gene: MT-TS1 was added
gene: MT-TS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TS1.
Mode of inheritance for gene gene: MT-TS1 was set to MITOCHONDRIAL
Publications for gene: MT-TS1 were set to 7669057; 9778262; 14605505; 23696415; 33279600; 7581383
Phenotypes for gene: MT-TS1 were set to Mitochondrial disease (MONDO:0044970), MT-TS1-related
Intellectual disability syndromic and non-syndromic v1.730 MT-TR Zornitza Stark gene: MT-TR was added
gene: MT-TR was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TR.
Mode of inheritance for gene gene: MT-TR was set to MITOCHONDRIAL
Publications for gene: MT-TR were set to 15286228; 17588757; 19809478; 22781096
Phenotypes for gene: MT-TR were set to mitochondrial disease (MONDO:0044970), MT-TR-related
Intellectual disability syndromic and non-syndromic v1.729 ASAH2 Zornitza Stark gene: ASAH2 was added
gene: ASAH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: ASAH2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ASAH2 were set to 41808410
Phenotypes for gene: ASAH2 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.726 ABCB7 Lucy Spencer gene: ABCB7 was added
gene: ABCB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABCB7 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ABCB7 were set to 11050011; 26242992
Phenotypes for gene: ABCB7 were set to Anaemia, sideroblastic, with ataxia, MIM# 301310
Review for gene: ABCB7 was set to AMBER
Added comment: Some limited reports of developmental delay/ID in the literature and mentioned in the ClinGen review
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.724 RNU6ATAC Zornitza Stark Publications for gene: RNU6ATAC were set to 40975062
Intellectual disability syndromic and non-syndromic v1.720 RNPC3 Chirag Patel Publications for gene: RNPC3 were set to 29866761; 32462814; 33650182
Intellectual disability syndromic and non-syndromic v1.716 POC1A Chirag Patel Publications for gene: POC1A were set to
Intellectual disability syndromic and non-syndromic v1.712 TRIM71 Zornitza Stark Publications for gene: TRIM71 were set to 29983323; 32168371; 30975633; 40892928
Intellectual disability syndromic and non-syndromic v1.711 TRIM71 Zornitza Stark gene: TRIM71 was added
gene: TRIM71 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: TRIM71 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TRIM71 were set to 29983323; 32168371; 30975633; 40892928
Phenotypes for gene: TRIM71 were set to Congenital hydrocephalus 4 (MIM#618667)
Intellectual disability syndromic and non-syndromic v1.709 TNK2 Sarah Milton gene: TNK2 was added
gene: TNK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: TNK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: TNK2 were set to 27977884; 23686771; 31517310
Phenotypes for gene: TNK2 were set to late onset infantile epilepsy; Mayer-Rokitansky-Küster-Hauser syndrome
Intellectual disability syndromic and non-syndromic v1.705 PDS5B Chirag Patel gene: PDS5B was added
gene: PDS5B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PDS5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PDS5B were set to 10.64898/2026.02.23.26346364
Phenotypes for gene: PDS5B were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.705 PDS5A Chirag Patel gene: PDS5A was added
gene: PDS5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PDS5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PDS5A were set to 10.64898/2026.02.23.26346364; 30158690
Phenotypes for gene: PDS5A were set to Complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.704 FMO4 Chirag Patel gene: FMO4 was added
gene: FMO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: FMO4 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: FMO4 were set to 41714691, 28940097
Phenotypes for gene: FMO4 were set to Neurodevelopmental disorder, MONDO:0700092; FMO4 related
Intellectual disability syndromic and non-syndromic v1.703 NRDC Zornitza Stark Publications for gene: NRDC were set to 41449824; 28017472; 34582790; 19935654
Intellectual disability syndromic and non-syndromic v1.701 VWA3B Zornitza Stark gene: VWA3B was added
gene: VWA3B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: VWA3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VWA3B were set to 26157035; 41673450; 37772257
Phenotypes for gene: VWA3B were set to Spinocerebellar ataxia, autosomal recessive 22 MIM#616948
Intellectual disability syndromic and non-syndromic v1.700 XPOT Zornitza Stark gene: XPOT was added
gene: XPOT was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
preprint tags were added to gene: XPOT.
Mode of inheritance for gene: XPOT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: XPOT were set to 10.64898/2026.01.28.26344748
Phenotypes for gene: XPOT were set to Syndromic disease, MONDO:0002254
Intellectual disability syndromic and non-syndromic v1.699 WDR59 Zornitza Stark gene: WDR59 was added
gene: WDR59 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
founder tags were added to gene: WDR59.
Mode of inheritance for gene: WDR59 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR59 were set to 41715954
Phenotypes for gene: WDR59 were set to Syndromic disease, MONDO:0002254
Intellectual disability syndromic and non-syndromic v1.698 WAPL Zornitza Stark gene: WAPL was added
gene: WAPL was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
preprint tags were added to gene: WAPL.
Mode of inheritance for gene: WAPL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WAPL were set to 10.64898/2026.02.23.26346364; 30158690
Phenotypes for gene: WAPL were set to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.697 C17orf80 Zornitza Stark gene: C17orf80 was added
gene: C17orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
new gene name tags were added to gene: C17orf80.
Mode of inheritance for gene: C17orf80 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C17orf80 were set to 41720819
Phenotypes for gene: C17orf80 were set to Mitochondrial disease, MONDO:0044970
Intellectual disability syndromic and non-syndromic v1.695 RDH11 Lucy Spencer gene: RDH11 was added
gene: RDH11 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list
Mode of inheritance for gene: RDH11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RDH11 were set to 24916380; 15634683; 30731079; 18326732
Phenotypes for gene: RDH11 were set to Retinal dystrophy, juvenile cataracts, and short stature syndrome, MIM# 616108
Intellectual disability syndromic and non-syndromic v1.694 RAB1A Lucy Spencer Publications for gene: RAB1A were set to PMID: 37924809
Intellectual disability syndromic and non-syndromic v1.690 JKAMP Zornitza Stark gene: JKAMP was added
gene: JKAMP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: JKAMP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: JKAMP were set to 41643666
Phenotypes for gene: JKAMP were set to Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM# 621533
Review for gene: JKAMP was set to GREEN
Added comment: 14 individuals from 10 families reported. All had moderate to profound neurodevelopmental delay, intellectual disability, and infantile-onset epilepsy. Six were nonverbal, and the remaining individuals spoke only a few words. Five individuals had neurodevelopmental regression. Three individuals died suddenly; death was associated with seizures or status epilepticus in two. Thirteen individuals had hypotonia, 5 had visual impairment, 5 had microcephaly, and 1 had hearing loss. Brain MRIs showed cortical or cerebral atrophy in 11, delayed myelination in 6, and diffuse demyelinating disease in 1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.688 RBFOX3 Lucy Spencer gene: RBFOX3 was added
gene: RBFOX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: RBFOX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RBFOX3 were set to 35951651; 36117209; 24039908; 40011789
Phenotypes for gene: RBFOX3 were set to Neurodevelopmental disorder (MONDO:0700092), RBFOX3-related
Intellectual disability syndromic and non-syndromic v1.686 TRAPPC2L Krithika Murali Phenotypes for gene: TRAPPC2L were changed from Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 to Neurodevelopmental disorder - MONDO:0700092, TRAPPC2L-related
Intellectual disability syndromic and non-syndromic v1.686 TRAPPC2L Krithika Murali Publications for gene: TRAPPC2L were set to 36849228; 32843486; 30120216
Intellectual disability syndromic and non-syndromic v1.685 TRAPPC2L Krithika Murali Publications for gene: TRAPPC2L were set to 30120216; 32843486
Intellectual disability syndromic and non-syndromic v1.683 PPP1R15B Lucy Spencer Publications for gene: PPP1R15B were set to 26159176; 26307080; 27640355
Intellectual disability syndromic and non-syndromic v1.679 ATP2B3 Bryony Thompson changed review comment from: PMIDs 25953895, 27653636, 28807751, 36207321 and 37821930 report 11 patients from 8 unrelated families with hemizygous ATP2B3 missense variants causing early‑onset cerebellar ataxia, hypotonia, developmental delay and sometimes seizures or dystonia. 2 of the patients had alternate diagnoses in PMM2 & LAMA1. Functional studies (HeLa Ca2+ assays, yeast complementation, homology modelling) demonstrate loss‑of‑function or altered pump activity. Single reports also link ATP2B3 to autism (PMID 28720891) and fetal akinesia (PMID 31680123).; to: At least 3 cases reported with ID/developmental delay without other variants detected
PMIDs 25953895, 27653636, 28807751, 36207321 and 37821930 report 11 patients from 8 unrelated families with hemizygous ATP2B3 missense variants causing early‑onset cerebellar ataxia, hypotonia, developmental delay and sometimes seizures or dystonia. 2 of the patients had alternate diagnoses in PMM2 & LAMA1. Functional studies (HeLa Ca2+ assays, yeast complementation, homology modelling) demonstrate loss‑of‑function or altered pump activity. Single reports also link ATP2B3 to autism (PMID 28720891) and fetal akinesia (PMID 31680123).
Intellectual disability syndromic and non-syndromic v1.676 NAV2 Zornitza Stark gene: NAV2 was added
gene: NAV2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: NAV2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAV2 were set to PMID:35218524
Phenotypes for gene: NAV2 were set to Developmental delay; cerebellar hypoplasia; cerebellar dysplasia
Intellectual disability syndromic and non-syndromic v1.675 LRRC32 Zornitza Stark Publications for gene: LRRC32 were set to 30976112
Intellectual disability syndromic and non-syndromic v1.674 RSF1 Rylee Peters gene: RSF1 was added
gene: RSF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: RSF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RSF1 were set to 41606215
Phenotypes for gene: RSF1 were set to Neurodevelopmental disorder, MONDO:0700092, RSF1-related
Intellectual disability syndromic and non-syndromic v1.673 EXOC8 Bryony Thompson gene: EXOC8 was added
gene: EXOC8 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: EXOC8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOC8 were set to 32103185; 22700954; 36344539; 35460391
Phenotypes for gene: EXOC8 were set to neurodevelopmental disorder with microcephaly, seizures, and brain atrophy MONDO:0033662
Intellectual disability syndromic and non-syndromic v1.672 ARHGEF2 Bryony Thompson gene: ARHGEF2 was added
gene: ARHGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARHGEF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ARHGEF2 were set to 28453519
Phenotypes for gene: ARHGEF2 were set to neurodevelopmental disorder with midbrain and hindbrain malformations MONDO:0056797
Intellectual disability syndromic and non-syndromic v1.670 EPG5 Zornitza Stark Publications for gene: EPG5 were set to 23222957; 26917586
Intellectual disability syndromic and non-syndromic v1.669 EPG5 Zornitza Stark edited their review of gene: EPG5: Added comment: Neurodevelopmental disorder with parkinsonism or other movement abnormalities (NEDPAM) is an autosomal recessive disorder characterized by mild to severe developmental delay or intellectual disability and movement abnormalities including spasticity, early onset-parkinsonism with dystonia, myoclonus, or a combination of these. Movement abnormalities may have onset from birth to adulthood in the sixth decade of life. Adolescent-onset dystonia and parkinsonism on the background of neurodevelopmental delay may be rapidly progressive, with cognitive decline. Patients may have additional features such as seizures and optic nerve atrophy. PMIDs 41053928, 36410285 and 40192014 report over 100 affected individuals.; Changed publications: 23222957, 26917586, 41053928, 36410285, 40192014; Changed phenotypes: Vici syndrome, MIM# 242840, Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506
Intellectual disability syndromic and non-syndromic v1.668 RAPGEF2 Bryony Thompson gene: RAPGEF2 was added
gene: RAPGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
STR tags were added to gene: RAPGEF2.
Mode of inheritance for gene: RAPGEF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAPGEF2 were set to 41556274; 30636905
Phenotypes for gene: RAPGEF2 were set to Neurodevelopmental disorder, MONDO:0700092; amyotrophic lateral sclerosis MONDO:0004976
Intellectual disability syndromic and non-syndromic v1.663 CELSR1 Rylee Peters gene: CELSR1 was added
gene: CELSR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELSR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CELSR1 were set to 41530147; 36453712
Review for gene: CELSR1 was set to GREEN
Added comment: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls.

PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.662 TTBK1 Zornitza Stark gene: TTBK1 was added
gene: TTBK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: TTBK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTBK1 were set to 41545183
Phenotypes for gene: TTBK1 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.661 TMEM189 Chirag Patel gene: TMEM189 was added
gene: TMEM189 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: TMEM189 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM189 were set to 41491239
Phenotypes for gene: TMEM189 were set to Neurodevelopmental disorder, MONDO:0700092, PEDS1-related
Intellectual disability syndromic and non-syndromic v1.659 MAP2K4 Sangavi Sivagnanasundram gene: MAP2K4 was added
gene: MAP2K4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAP2K4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAP2K4 were set to 41480045
Phenotypes for gene: MAP2K4 were set to Neurodevelopmental disorder, MONDO:0700092
Mode of pathogenicity for gene: MAP2K4 was set to Other
Intellectual disability syndromic and non-syndromic v1.658 CTNND2 Zornitza Stark Publications for gene: CTNND2 were set to 25839933; 29127138; 25807484; 38604781; 25473103; 31814264
Intellectual disability syndromic and non-syndromic v1.656 CTNND2 Zornitza Stark edited their review of gene: CTNND2: Added comment: PMID 41502569 (preprint) reports phenotypic and molecular information for 57 individuals, 42 previously unpublished, with heterozygous CTNND2 variants. The 41 CTNND2 variants included 12 previously reported loss-of-function- and one missense variant, and 28 novel variants comprising 10 missense and 18 predicted loss-of-function changes. Eight of the novel variants occurred de novo, and 12 were inherited from a parent with a neurodevelopmental phenotype. The most common clinical features were developmental delay (90%), intellectual disability (74%), and behavioral abnormalities (79%). Functional studies revealed impaired early neurogenesis in one patient-derived line, characterized by aberrant neural rosette formation. Transcriptome analysis showed dysregulated WNT signaling, and partial rescue of these defects was achieved by modulating the WNT pathway, highlighting δ-catenin's role in early neural development.

Note several of the reported missense variants in this gene have high gnomAD counts so these should be interpreted with caution. Nevertheless, large number of individuals reported now with LoF variants and NDD phenotype.; Changed rating: GREEN; Changed publications: 25839933, 29127138, 25807484, 41502569; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CTNND2-related
Intellectual disability syndromic and non-syndromic v1.655 PGBD5 Zornitza Stark gene: PGBD5 was added
gene: PGBD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PGBD5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PGBD5 were set to 41533792
Phenotypes for gene: PGBD5 were set to Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482
Review for gene: PGBD5 was set to GREEN
Added comment: 10 individuals reported from 5 consanguineous families with bi-allelic variants in this gene and global developmental delay with impaired intellectual development, delayed motor skills, and motor abnormalities. Affected individuals were unable to speak or walk due to peripheral spasticity, ataxia, or hypotonia, and developed early-onset seizures. Additional features included dysmorphic facies, short stature, and brain imaging abnormalities, such as thin corpus callosum and cerebellar atrophy.

Pgbd5-null mice were runted and had significantly smaller brains compared to wildtype. Mutant mice showed increased locomotor activity, reduced anxiety-like behavior, impaired motor coordination, increased susceptibility to seizures, and decreased cortical volume on brain MRI. Analysis of neurons derived from Pgbd5-null mouse brains showed reduced DNA breakage and repair in postmitotic neuronal precursors during cortical development compared to controls.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.650 ISCA-37448-Loss Sarah Milton Region: ISCA-37448-Loss was added
Region: ISCA-37448-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-37448-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37448-Loss were set to Chromosome 15q11.2 deletion syndrome, MIM#615656
Penetrance for Region: ISCA-37448-Loss were set to Incomplete
Intellectual disability syndromic and non-syndromic v1.649 SMARCA1 Zornitza Stark Publications for gene: SMARCA1 were set to 37841849
Intellectual disability syndromic and non-syndromic v1.645 ISCA-46743-Gain Sarah Milton Region: ISCA-46743-Gain was added
Region: ISCA-46743-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46743-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for Region: ISCA-46743-Gain were set to Xq25 duplication syndrome, MIM#300979
Intellectual disability syndromic and non-syndromic v1.644 ISCA-46304-Gain Sarah Milton Region: ISCA-46304-Gain was added
Region: ISCA-46304-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46304-Gain was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for Region: ISCA-46304-Gain were set to PMID: 29141583, 22679399
Phenotypes for Region: ISCA-46304-Gain were set to Syndromic X-linked intellectual disability Lubs type, MONDO:0010283
Intellectual disability syndromic and non-syndromic v1.643 ISCA-46300-Loss Sarah Milton Region: ISCA-46300-Loss was added
Region: ISCA-46300-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46300-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-46300-Loss were set to Chromosome 15q24 deletion syndrome, MONDO:0013256
Intellectual disability syndromic and non-syndromic v1.642 ISCA-46299-Gain Sarah Milton Region: ISCA-46299-Gain was added
Region: ISCA-46299-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-46299-Gain.
Mode of inheritance for Region: ISCA-46299-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-46299-Gain were set to PMID: 22840365
Phenotypes for Region: ISCA-46299-Gain were set to Xp11.22 microduplication syndrome MIM#300705
Intellectual disability syndromic and non-syndromic v1.640 SPART Zornitza Stark Publications for gene: SPART were set to PMID: 26003402; 28679690; 27112432; 20437587; 12134148; 18413476; 31314595; 28875386
Intellectual disability syndromic and non-syndromic v1.638 NRDC Rylee Peters gene: NRDC was added
gene: NRDC was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: NRDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NRDC were set to 41449824; 28017472; 34582790; 19935654
Phenotypes for gene: NRDC were set to Neurodevelopmental disorder, MONDO:0700092, NRDC-related
Intellectual disability syndromic and non-syndromic v1.636 ARCN1 Zornitza Stark Publications for gene: ARCN1 were set to 27476655; 33154040
Intellectual disability syndromic and non-syndromic v1.634 YWHAZ Zornitza Stark Publications for gene: YWHAZ were set to 36001342
Intellectual disability syndromic and non-syndromic v1.633 MED14 Zornitza Stark gene: MED14 was added
gene: MED14 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: MED14 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: MED14 were set to PMID: 40597352
Phenotypes for gene: MED14 were set to Neurodevelopmental disorder (MONDO:0700092), MED14-related
Intellectual disability syndromic and non-syndromic v1.632 SPNS1 Zornitza Stark gene: SPNS1 was added
gene: SPNS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: SPNS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPNS1 were set to 40608416; 38451736
Phenotypes for gene: SPNS1 were set to Lysosomal disorder, SPNS1-related, MONDO:0002561
Intellectual disability syndromic and non-syndromic v1.631 MTSS1L Zornitza Stark Publications for gene: MTSS1L were set to PMID: 36067766
Intellectual disability syndromic and non-syndromic v1.629 SF3B1 Zornitza Stark Publications for gene: SF3B1 were set to
Intellectual disability syndromic and non-syndromic v1.628 VPS51 Zornitza Stark Publications for gene: VPS51 were set to 30624672; 31207318
Intellectual disability syndromic and non-syndromic v1.626 SEC31A Zornitza Stark Publications for gene: SEC31A were set to 30464055; 40508110
Intellectual disability syndromic and non-syndromic v1.623 ISCA-46296-Loss Sarah Milton Region: ISCA-46296-Loss was added
Region: ISCA-46296-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46296-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-46296-Loss were set to PMID: 25217958
Intellectual disability syndromic and non-syndromic v1.622 LAGE3 Sarah Milton gene: LAGE3 was added
gene: LAGE3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: LAGE3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: LAGE3 were set to 28805828
Phenotypes for gene: LAGE3 were set to Galloway-Mowat syndrome 2, X-linked, MIM# 301006
Intellectual disability syndromic and non-syndromic v1.621 ZNF185 Lucy Spencer gene: ZNF185 was added
gene: ZNF185 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF185 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: ZNF185 were set to 41404552
Phenotypes for gene: ZNF185 were set to Cerebrooculonasal syndrome MONDO:0011575, ZNF185-related
Review for gene: ZNF185 was set to RED
Added comment: PMID 41404552 describes a single female individual with cerebro oculo nasal syndrome and a de novo heterozygous X linked frameshift ZNF185. The proband presented with developmental delay, moderate ID, dysmorphic facial features, cleft lip/palate, nasal anomaly, CHD and anopthalmia. She was shown to have skewed X-inactivation 19:81, however it is not stated if the skewing was towards the allele with the variant. The variant in this individual (p.Gln102SerfsTer18) is NMD predicted and absent from gnomad, however there are at least 6 NMD variants present in gnomad as hemizygous (4 with over 4 hemis) all of which also have over 5 heterozygotes
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.616 GSPT2 Zornitza Stark Publications for gene: GSPT2 were set to 28414775
Intellectual disability syndromic and non-syndromic v1.615 UNC13C Sangavi Sivagnanasundram gene: UNC13C was added
gene: UNC13C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UNC13C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UNC13C were set to 41399760
Phenotypes for gene: UNC13C were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.614 SEPT2 Chirag Patel gene: SEPT2 was added
gene: SEPT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: SEPT2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SEPT2 were set to 41408595
Phenotypes for gene: SEPT2 were set to Neurodevelopmental disorder, MONDO:0700092, SEPTIN2-related
Intellectual disability syndromic and non-syndromic v1.613 PCBP1 Sarah Milton gene: PCBP1 was added
gene: PCBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PCBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PCBP1 were set to 41415500
Phenotypes for gene: PCBP1 were set to Neurodevelopmental disorder, MONDO:0700092, PCBP1-related
Intellectual disability syndromic and non-syndromic v1.610 NDUFA3 Zornitza Stark gene: NDUFA3 was added
gene: NDUFA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: NDUFA3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA3 were set to 41038977; 39661167
Phenotypes for gene: NDUFA3 were set to Mitochondrial disease, MONDO:0044970,NDUFA3-related
Intellectual disability syndromic and non-syndromic v1.609 MIR17HG Zornitza Stark Publications for gene: MIR17HG were set to PMID: 25391829; 21892160
Intellectual disability syndromic and non-syndromic v1.604 COPB1 Zornitza Stark Publications for gene: COPB1 were set to 33632302
Intellectual disability syndromic and non-syndromic v1.602 CNP Zornitza Stark gene: CNP was added
gene: CNP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: CNP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CNP were set to 32128616; 12590258; 40396300
Phenotypes for gene: CNP were set to Leukodystrophy, hypomyelinating, 20, MIM# 619071
Intellectual disability syndromic and non-syndromic v1.601 PFAS Zornitza Stark gene: PFAS was added
gene: PFAS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: PFAS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PFAS were set to 40421664
Phenotypes for gene: PFAS were set to Inborn error of metabolism, MONDO:0019052, PFAS-related
Intellectual disability syndromic and non-syndromic v1.600 ISCA-46295-Loss Sarah Milton Region: ISCA-46295-Loss was added
Region: ISCA-46295-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-46295-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for Region: ISCA-46295-Loss were set to PMID: 19289393
Phenotypes for Region: ISCA-46295-Loss were set to Chromosome 15q13.3 microdeletion syndrome MIM#612001; intellectual disability; seizures
Intellectual disability syndromic and non-syndromic v1.599 ISCA-46290-Gain Sarah Milton Region: ISCA-46290-Gain was added
Region: ISCA-46290-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-46290-Gain was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for Region: ISCA-46290-Gain were set to 19716111; 27605428; 29707408; 16900295
Phenotypes for Region: ISCA-46290-Gain were set to Chromosome Xp11.23-p11.22 duplication syndrome MIM#300801; intellectual disability; seizures
Intellectual disability syndromic and non-syndromic v1.598 ISCA-37500-Loss Sarah Milton Region: ISCA-37500-Loss was added
Region: ISCA-37500-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37500-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37500-Loss were set to 20921022; 24352913
Phenotypes for Region: ISCA-37500-Loss were set to Chromosome 15q25 deletion syndrome MIM#614294; intellectual disability; congenital abnormalities; haematological abnormalities
Intellectual disability syndromic and non-syndromic v1.597 ISCA-37498-Loss Sarah Milton Region: ISCA-37498-Loss was added
Region: ISCA-37498-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-37498-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37498-Loss were set to 11q13.2q13.4 deletion syndrome
Intellectual disability syndromic and non-syndromic v1.596 DLAT Zornitza Stark Publications for gene: DLAT were set to
Intellectual disability syndromic and non-syndromic v1.594 RNU4-2 Zornitza Stark Publications for gene: RNU4-2 were set to 38991538
Intellectual disability syndromic and non-syndromic v1.592 ATP9A Zornitza Stark Publications for gene: ATP9A were set to 34379057; 34764295
Intellectual disability syndromic and non-syndromic v1.590 ISCA-37494-Gain Sarah Milton Region: ISCA-37494-Gain was added
Region: ISCA-37494-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37494-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37494-Gain were set to 25927380; 20301461; 32043567; 32112660
Phenotypes for Region: ISCA-37494-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815; intellectual disability; hypotonia; seizures; spasticity; recurrent respiratory infections
Intellectual disability syndromic and non-syndromic v1.590 ISCA-37493-Loss Sarah Milton Region: ISCA-37493-Loss was added
Region: ISCA-37493-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37493-Loss.
Mode of inheritance for Region: ISCA-37493-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37493-Loss were set to 28283832; 31929334; 31830750; 30853971
Phenotypes for Region: ISCA-37493-Loss were set to 1q43q44 microdeletion syndrome; intellectual disability; seizures; microcephaly; corpus callosum abnormalities
Intellectual disability syndromic and non-syndromic v1.589 ISCA-37486-Loss Sarah Milton Region: ISCA-37486-Loss was added
Region: ISCA-37486-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37486-Loss.
Mode of inheritance for Region: ISCA-37486-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37486-Loss were set to 19914906; 32993859; 32732550; 32597026; 32537635
Phenotypes for Region: ISCA-37486-Loss were set to Chromosome 16p11.2 deletion syndrome, MIM#611913, distal BP2-BP3; intellectual disability; autism; obesity
Intellectual disability syndromic and non-syndromic v1.588 ISCA-37478-Loss Sarah Milton Region: ISCA-37478-Loss was added
Region: ISCA-37478-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37478-Loss.
Mode of inheritance for Region: ISCA-37478-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37478-Loss were set to 22045295
Phenotypes for Region: ISCA-37478-Loss were set to Angelman syndrome, MIM# 105830; Prader-Willi syndrome, MIM# 176270
Intellectual disability syndromic and non-syndromic v1.587 ISCA-37478-Gain Sarah Milton Region: ISCA-37478-Gain was added
Region: ISCA-37478-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37478-Gain.
Mode of inheritance for Region: ISCA-37478-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37478-Gain were set to Chromosome 15q11q13 duplication syndrome, MIM#608636; autism; intellectual disability; ataxia
Intellectual disability syndromic and non-syndromic v1.584 ISCA-37468-Loss Sarah Milton Region: ISCA-37468-Loss was added
Region: ISCA-37468-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen,Expert Review Green
SV/CNV tags were added to Region: ISCA-37468-Loss.
Mode of inheritance for Region: ISCA-37468-Loss was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37468-Loss were set to PMID: 22126752; 16385466; 20186789
Phenotypes for Region: ISCA-37468-Loss were set to Chromosome Xp11.3 deletion syndrome MIM#300578; intellectual disability; retinal dystrophy
Intellectual disability syndromic and non-syndromic v1.583 ISCA-37446-Loss Sarah Milton Region: ISCA-37446-Loss was added
Region: ISCA-37446-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37446-Loss.
Mode of inheritance for Region: ISCA-37446-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37446-Loss were set to 18179902; 23765049; 21671380
Phenotypes for Region: ISCA-37446-Loss were set to Chromosome 22q11.2 deletion syndrome, distal MIM#611867; intellectual disability; autism; multiple congenital anomalies
Intellectual disability syndromic and non-syndromic v1.582 ISCA-37446-Gain Sarah Milton Region: ISCA-37446-Gain was added
Region: ISCA-37446-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37446-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37446-Gain were set to PMID: 18707033
Phenotypes for Region: ISCA-37446-Gain were set to Chromosome 22q11.2 microduplication syndrome MIM#608363, proximal A-D
Intellectual disability syndromic and non-syndromic v1.582 ISCA-37443-Loss Sarah Milton Region: ISCA-37443-Loss was added
Region: ISCA-37443-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37443-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37443-Loss were set to PMID: 20830797; 19460468; 19610115
Phenotypes for Region: ISCA-37443-Loss were set to Chromosome 3q29 microdeletion syndrome MIM#609425; intellectual disability; autism
Intellectual disability syndromic and non-syndromic v1.581 ISCA-37441-Loss Sarah Milton Region: ISCA-37441-Loss was added
Region: ISCA-37441-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37441-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37441-Loss were set to PMID: 20140962
Phenotypes for Region: ISCA-37441-Loss were set to Potocki-Shaffer syndrome MIM#601224; intellectual disability; multiple exostoses; biparietal foramina
Intellectual disability syndromic and non-syndromic v1.580 ISCA-37440-Loss Sarah Milton Region: ISCA-37440-Loss was added
Region: ISCA-37440-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37440-Loss was set to BIALLELIC, autosomal or pseudoautosomal
Publications for Region: ISCA-37440-Loss were set to PMID: 18234729; 23794250
Phenotypes for Region: ISCA-37440-Loss were set to 2p21 deletion syndrome; Hypotonia-cystinuria syndrome, MIM# 606407
Intellectual disability syndromic and non-syndromic v1.578 SCYL2 Zornitza Stark Publications for gene: SCYL2 were set to 31960134; 26203146
Intellectual disability syndromic and non-syndromic v1.577 SCYL2 Zornitza Stark gene: SCYL2 was added
gene: SCYL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: SCYL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCYL2 were set to 31960134; 26203146
Phenotypes for gene: SCYL2 were set to Arthrogryposis multiplex congenita (AMC); Zain syndrome
Intellectual disability syndromic and non-syndromic v1.576 PPP5C Zornitza Stark Publications for gene: PPP5C were set to 35361529; 25363768; 33057194
Intellectual disability syndromic and non-syndromic v1.574 ISCA-37439-Gain Sarah Milton Region: ISCA-37439-Gain was added
Region: ISCA-37439-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37439-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37439-Gain were set to PMID: 20004760
Phenotypes for Region: ISCA-37439-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815
Intellectual disability syndromic and non-syndromic v1.573 ISCA-37434-Loss Sarah Milton Region: ISCA-37434-Loss was added
Region: ISCA-37434-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37434-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37434-Loss were set to PMID: 12974736; 18245432
Phenotypes for Region: ISCA-37434-Loss were set to Chromosome 1p36 deletion syndrome MIM#607872; intellectual disability; hypotonia; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.571 ISCA-37433-Loss Sarah Milton Region: ISCA-37433-Loss was added
Region: ISCA-37433-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37433-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for Region: ISCA-37433-Loss were set to DiGeorge syndrome MIM#188400
Intellectual disability syndromic and non-syndromic v1.570 ISCA-37433-Gain Sarah Milton Region: ISCA-37433-Gain was added
Region: ISCA-37433-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37433-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37433-Gain were set to PMID: 18707033
Phenotypes for Region: ISCA-37433-Gain were set to Chromosome 22q11.2 microduplication syndrome MIM#608363
Intellectual disability syndromic and non-syndromic v1.569 ISCA-37432-Loss Sarah Milton Region: ISCA-37432-Loss was added
Region: ISCA-37432-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37432-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37432-Loss were set to PMID: 19844256
Phenotypes for Region: ISCA-37432-Loss were set to Chromosome 17q12 deletion syndrome MIM#614527; Renal cysts and diabetes (RCAD) syndrome
Intellectual disability syndromic and non-syndromic v1.568 ISCA-37432-Gain Sarah Milton Region: ISCA-37432-Gain was added
Region: ISCA-37432-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37432-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37432-Gain were set to PMID: 19844256
Phenotypes for Region: ISCA-37432-Gain were set to Chromosome 17q12 duplication syndrome 614526; intellectual disability; seizures; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.567 ISCA-37431-Loss Sarah Milton Region: ISCA-37431-Loss was added
Region: ISCA-37431-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37431-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37431-Loss were set to 12660952; 14729829
Phenotypes for Region: ISCA-37431-Loss were set to Chromosome 17q11.2 deletion syndrome, MIM#613675; NF1 deletion syndrome
Intellectual disability syndromic and non-syndromic v1.566 ISCA-37430-Loss Sarah Milton Region: ISCA-37430-Loss was added
Region: ISCA-37430-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37430-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37430-Loss were set to Miller-Dieker lissencephaly syndrome, MIM# 247200
Intellectual disability syndromic and non-syndromic v1.564 CDK4 Zornitza Stark gene: CDK4 was added
gene: CDK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: CDK4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDK4 were set to 40210435
Phenotypes for gene: CDK4 were set to Neurodevelopmental disorder, MONDO:0700092; {Melanoma, cutaneous malignant, 3} MIM#609048
Intellectual disability syndromic and non-syndromic v1.563 MAU2 Lucy Spencer gene: MAU2 was added
gene: MAU2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: MAU2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAU2 were set to 41332805; 37962004; 32433956
Phenotypes for gene: MAU2 were set to Cornelia de Lange syndrome MONDO:0016033, MAU2-related
Intellectual disability syndromic and non-syndromic v1.561 TMEM251 Zornitza Stark gene: TMEM251 was added
gene: TMEM251 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM251 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM251 were set to 40171858; 33252156
Phenotypes for gene: TMEM251 were set to Dysostosis multiplex, Ain-Naz type MIM@619345
Review for gene: TMEM251 was set to GREEN
Added comment: PMID 40171858: reports 2 siblings from an Iranian consanguineous family and six previously reported families (8 patients, 7 unrelated families) with biallelic loss‑of‑function LYSET variants presenting with MLII‑like mucolipidosis; core features include dysostosis multiplex, coarse facial features, hepatomegaly, joint contractures, developmental delay; mouse knockout recapitulates the phenotype, supporting gene‑disease causality.

HGNC approved name is LYSET.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.557 NOP58 Zornitza Stark gene: NOP58 was added
gene: NOP58 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: NOP58 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NOP58 were set to 41383020
Phenotypes for gene: NOP58 were set to Neurodevelopmental disorder, MONDO:0700092, NOP58-related
Intellectual disability syndromic and non-syndromic v1.556 EMC10 Zornitza Stark Publications for gene: EMC10 were set to PMID: 32869858; 33531666
Intellectual disability syndromic and non-syndromic v1.553 UNC13A Zornitza Stark Publications for gene: UNC13A were set to 27648472; 28192369
Intellectual disability syndromic and non-syndromic v1.552 WDR83 Chirag Patel gene: WDR83 was added
gene: WDR83 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR83 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: WDR83 were set to 41381792
Phenotypes for gene: WDR83 were set to Neurodevelopmental disorder, MONDO:0700092, WDR83-related
Mode of pathogenicity for gene: WDR83 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v1.551 NDUFB7 Zornitza Stark gene: NDUFB7 was added
gene: NDUFB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: NDUFB7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFB7 were set to 33502047; 27626371; 40025060
Phenotypes for gene: NDUFB7 were set to Mitochondrial complex I deficiency nuclear type 39 (MC1DN39), MIM#620135
Intellectual disability syndromic and non-syndromic v1.550 FIBP Zornitza Stark Publications for gene: FIBP were set to 26660953; 27183861
Intellectual disability syndromic and non-syndromic v1.548 FIBP Zornitza Stark edited their review of gene: FIBP: Added comment: Beyond the two families previously reviewed (PMIDs 26660953; 27183861), four additional studies (PMIDs 36919607, 37218527, 37876348, 40099975) contribute four new unrelated families (total six unrelated families, nine patients) with a consistent autosomal‑recessive overgrowth syndrome. All six families have biallelic loss‑of‑function FIBP variants (nonsense or frameshift leading to NMD). Detailed clinical descriptions include overgrowth, macrocephaly, facial dysmorphism, developmental delay/intellectual disability, renal dysplasia and, in two families, early‑onset tumor predisposition. Segregation analyses confirm recessive inheritance in every case. Functional work (RT‑qPCR, fibroblast proliferation assays, mouse embryonic expression) demonstrates reduced FIBP expression and increased cell proliferation, supporting pathogenicity.; Changed publications: 40099975, 37876348, 36919607, 27183861, 26660953
Intellectual disability syndromic and non-syndromic v1.548 DPH2 Zornitza Stark Publications for gene: DPH2 were set to 32576952; 27421267
Intellectual disability syndromic and non-syndromic v1.546 WASHC3 Zornitza Stark Publications for gene: WASHC3 were set to DOI: https://doi.org/10.1016/j.gimo.2024.101915
Intellectual disability syndromic and non-syndromic v1.545 SEC24C Zornitza Stark gene: SEC24C was added
gene: SEC24C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: SEC24C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SEC24C were set to 40131364
Phenotypes for gene: SEC24C were set to Neurodevelopmental disorder, MONDO:0700092, SEC24C-related
Intellectual disability syndromic and non-syndromic v1.543 ZIC2_HPE5_GCN Bryony Thompson STR: ZIC2_HPE5_GCN was added
STR: ZIC2_HPE5_GCN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
paediatric-onset tags were added to STR: ZIC2_HPE5_GCN.
Mode of inheritance for STR: ZIC2_HPE5_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ZIC2_HPE5_GCN were set to 11285244; 33811808
Phenotypes for STR: ZIC2_HPE5_GCN were set to Holoprosencephaly 5 MIM#609637
Intellectual disability syndromic and non-syndromic v1.542 RSPRY1 Zornitza Stark Publications for gene: RSPRY1 were set to 26365341
Intellectual disability syndromic and non-syndromic v1.540 USMG5 Zornitza Stark gene: USMG5 was added
gene: USMG5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: USMG5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: USMG5 were set to 29917077; 30240627; 40014158
Phenotypes for gene: USMG5 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 6 MIM#618683
Intellectual disability syndromic and non-syndromic v1.538 PRMT1 Zornitza Stark gene: PRMT1 was added
gene: PRMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PRMT1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PRMT1 were set to 39937650
Phenotypes for gene: PRMT1 were set to Neurodevelopmental disorder, MONDO:0700092, PRMT1-related
Intellectual disability syndromic and non-syndromic v1.537 EXOSC4 Zornitza Stark gene: EXOSC4 was added
gene: EXOSC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: EXOSC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOSC4 were set to 39009343; 37961665; 36344539
Phenotypes for gene: EXOSC4 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.536 KDM2A Zornitza Stark Publications for gene: KDM2A were set to
Intellectual disability syndromic and non-syndromic v1.533 SELENOI Zornitza Stark Publications for gene: SELENOI were set to 28052917
Intellectual disability syndromic and non-syndromic v1.531 TRMT1L Zornitza Stark gene: TRMT1L was added
gene: TRMT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: TRMT1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRMT1L were set to 39786990
Phenotypes for gene: TRMT1L were set to Neurodevelopmental disorder, MONDO:0700092, TRMT1L-related
Intellectual disability syndromic and non-syndromic v1.530 SPAG9 Zornitza Stark gene: SPAG9 was added
gene: SPAG9 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: SPAG9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPAG9 were set to 39846792
Phenotypes for gene: SPAG9 were set to Neurodevelopmental disorder, MONDO:0700092, SPAG9-related
Intellectual disability syndromic and non-syndromic v1.529 NUBP2 Zornitza Stark gene: NUBP2 was added
gene: NUBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: NUBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NUBP2 were set to 39867373
Phenotypes for gene: NUBP2 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.525 KIF21A Zornitza Stark Publications for gene: KIF21A were set to
Intellectual disability syndromic and non-syndromic v1.524 BAZ2B Zornitza Stark Publications for gene: BAZ2B were set to 31999386
Intellectual disability syndromic and non-syndromic v1.522 ISCA-37431-Gain Sarah Milton Region: ISCA-37431-Gain was added
Region: ISCA-37431-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37431-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37431-Gain were set to 22241097
Phenotypes for Region: ISCA-37431-Gain were set to Chromosome 17q11.2 duplication syndrome, 1.4-Mb MIM#618874; NF1 microduplication; intellectual disability; micro- and macrocephaly; seizures; dysmorphic features
Intellectual disability syndromic and non-syndromic v1.521 ISCA-37430-Gain Sarah Milton Region: ISCA-37430-Gain was added
Region: ISCA-37430-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37430-Gain.
Mode of inheritance for Region: ISCA-37430-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37430-Gain were set to Chromosome 17p13.3 duplication syndrome, centromeric, MIM#613215; intellectual disability
Intellectual disability syndromic and non-syndromic v1.520 ISCA-37429-Loss Sarah Milton Region: ISCA-37429-Loss was added
Region: ISCA-37429-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37429-Loss.
Mode of inheritance for Region: ISCA-37429-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37429-Loss were set to Wolf-Hirschhorn syndrome, MIM# 194190; intellectual disability; growth retardation; seizures; dysmorphic features
Intellectual disability syndromic and non-syndromic v1.519 ISCA-37425-Loss Sarah Milton Region: ISCA-37425-Loss was added
Region: ISCA-37425-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37425-Loss.
Mode of inheritance for Region: ISCA-37425-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37425-Loss were set to 23190751; 19596467
Phenotypes for Region: ISCA-37425-Loss were set to Sotos syndrome, chromosome 5q35 deletion; intellectual disability; overgrowth
Intellectual disability syndromic and non-syndromic v1.518 ISCA-37425-Gain Sarah Milton Region: ISCA-37425-Gain was added
Region: ISCA-37425-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37425-Gain.
Mode of inheritance for Region: ISCA-37425-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37425-Gain were set to 24819041
Phenotypes for Region: ISCA-37425-Gain were set to Chromosome 5q35 duplication syndrome; microcephaly; failure to thrive; seizures
Intellectual disability syndromic and non-syndromic v1.517 ISCA-37424-Loss Sarah Milton Region: ISCA-37424-Loss was added
Region: ISCA-37424-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37424-Loss.
Mode of inheritance for Region: ISCA-37424-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37424-Loss were set to 20345475; 25846706
Phenotypes for Region: ISCA-37424-Loss were set to Chromosome 10q22.3q23.2 deletion syndrome (LCR-3/4-flanked); intellectual disability; autism; macrocephaly
Intellectual disability syndromic and non-syndromic v1.517 ISCA-37423-Loss Sarah Milton Region: ISCA-37423-Loss was added
Region: ISCA-37423-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37423-Loss.
Mode of inheritance for Region: ISCA-37423-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37423-Loss were set to 23696316; 23011633; 20969981
Phenotypes for Region: ISCA-37423-Loss were set to 8p23.1 deletion syndrome; congenital heart disease; developmental delay
Intellectual disability syndromic and non-syndromic v1.512 MT-TE Zornitza Stark gene: MT-TE was added
gene: MT-TE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TE.
Mode of inheritance for gene gene: MT-TE was set to MITOCHONDRIAL
Publications for gene: MT-TE were set to 8155739; 21194154; 17715279; 23334599; 7726155; 7726154; 9353617; 15048886; 15670724; 23847141; 23334599; 17266923; 17056256
Phenotypes for gene: MT-TE were set to Mitochondrial disease (MONDO:0044970), MT-TE-related
Intellectual disability syndromic and non-syndromic v1.510 ISCA-37423-Gain Sarah Milton Region: ISCA-37423-Gain was added
Region: ISCA-37423-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37423-Gain.
Mode of inheritance for Region: ISCA-37423-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37423-Gain were set to 26097203; 25520754
Phenotypes for Region: ISCA-37423-Gain were set to 8p23.1 duplication syndrome; intellectual disability; congenital heart disease
Intellectual disability syndromic and non-syndromic v1.509 ISCA-37421-Loss Sarah Milton Region: ISCA-37421-Loss was added
Region: ISCA-37421-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37421-Loss.
Mode of inheritance for Region: ISCA-37421-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37421-Loss were set to 32655619
Phenotypes for Region: ISCA-37421-Loss were set to Chromosome 1q21.1 deletion syndrome, MIM# 612474; intellectual disability; microcephaly; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.508 DNAJA3 Zornitza Stark gene: DNAJA3 was added
gene: DNAJA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: DNAJA3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAJA3 were set to 34750646; 30770860
Phenotypes for gene: DNAJA3 were set to Mitochondrial disease, MONDO:0044970, DNAJA3-related
Intellectual disability syndromic and non-syndromic v1.505 ISCA-37418-Loss Zornitza Stark Publications for Region: ISCA-37418-Loss were set to
Intellectual disability syndromic and non-syndromic v1.504 ISCA-37421-Gain Sarah Milton Region: ISCA-37421-Gain was added
Region: ISCA-37421-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37421-Gain.
Mode of inheritance for Region: ISCA-37421-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37421-Gain were set to 32655619
Phenotypes for Region: ISCA-37421-Gain were set to Chromosome 1q21.1 duplication syndrome, MIM# 612475; intellectual disability; autism; macrocephaly
Intellectual disability syndromic and non-syndromic v1.503 ISCA-37418-Loss Sarah Milton Region: ISCA-37418-Loss was added
Region: ISCA-37418-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen,NHS GMS
Mode of inheritance for Region: ISCA-37418-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for Region: ISCA-37418-Loss were set to Potocki-Lupski syndrome; Smith-Magenis syndrome; moderate intellectual disability, delayed speech and language skills, distinctive facial features, sleep disturbances, and behavioral problems; 182290; Structural cardiovascular anomalies (dilated aortic root, bicommissural aortic valve, atrial/ventricular and septal defects) and sleep disturbance; hypotonia, failure to thrive, mental retardation, pervasive developmental disorders, congenital anomalies; Dental abnormalities; hypotonia, poor feeding, failure to thrive, developmental delay particularly cognitive and language deficity, mild-moderate intellectual deficit, and neuropsychiatric disorders
Intellectual disability syndromic and non-syndromic v1.502 ISCA-37418-Gain Sarah Milton Region: ISCA-37418-Gain was added
Region: ISCA-37418-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37418-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37418-Gain were set to Potocki-Lupski syndrome, MIM# 610883; intellectual disability; hypotonia; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.501 ISCA-37415-Gain Sarah Milton Region: ISCA-37415-Gain was added
Region: ISCA-37415-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37415-Gain.
Mode of inheritance for Region: ISCA-37415-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37415-Gain were set to 30287593
Phenotypes for Region: ISCA-37415-Gain were set to 16p13.11 microduplication syndrome; intellectual disability; autism; aortopathy
Intellectual disability syndromic and non-syndromic v1.500 ISCA-37411-Loss Sarah Milton Region: ISCA-37411-Loss was added
Region: ISCA-37411-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37411-Loss.
Mode of inheritance for Region: ISCA-37411-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for Region: ISCA-37411-Loss were set to 19372089; 20979196
Phenotypes for Region: ISCA-37411-Loss were set to Chromosome 15q13.3 microdeletion syndrome, MIM# 612001; intellectual disability; epilepsy
Intellectual disability syndromic and non-syndromic v1.499 ISCA-37406-Loss Sarah Milton Region: ISCA-37406-Loss was added
Region: ISCA-37406-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37406-Loss.
Mode of inheritance for Region: ISCA-37406-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37406-Loss were set to 20101707; 17473832; 16783566
Phenotypes for Region: ISCA-37406-Loss were set to Chromosome 16p13.3 deletion syndrome, Rubinstein-Taybi deletion syndrome
Intellectual disability syndromic and non-syndromic v1.499 ISCA-37405-Loss Sarah Milton Region: ISCA-37405-Loss was added
Region: ISCA-37405-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37405-Loss.
Mode of inheritance for Region: ISCA-37405-Loss was set to BIALLELIC, autosomal or pseudoautosomal
Publications for Region: ISCA-37405-Loss were set to 29146700
Phenotypes for Region: ISCA-37405-Loss were set to Nephronophthisis 1, juvenile, MIM# 256100; Joubert syndrome 4, MIM# 609583; Senior-Loken syndrome 1, MIM# 266900
Intellectual disability syndromic and non-syndromic v1.498 ISCA-37404-Loss Sarah Milton Region: ISCA-37404-Loss was added
Region: ISCA-37404-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37404-Loss.
Mode of inheritance for Region: ISCA-37404-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37404-Loss were set to 20301323; 20301505
Phenotypes for Region: ISCA-37404-Loss were set to Angelman syndrome, MIM# 105830; Prader-Willi syndrome, MIM# 176270
Intellectual disability syndromic and non-syndromic v1.497 CTNND2 Zornitza Stark Publications for gene: CTNND2 were set to 25839933; 29127138; 25807484
Intellectual disability syndromic and non-syndromic v1.495 PRMT9 Lucy Spencer Publications for gene: PRMT9 were set to PMID: 38561334
Intellectual disability syndromic and non-syndromic v1.491 ESRRG Zornitza Stark gene: ESRRG was added
gene: ESRRG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: ESRRG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ESRRG were set to 41265451
Phenotypes for gene: ESRRG were set to Movement disorder, MONDO:0005395, ESRRG-related
Intellectual disability syndromic and non-syndromic v1.490 ELMSAN1 Zornitza Stark gene: ELMSAN1 was added
gene: ELMSAN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
new gene name tags were added to gene: ELMSAN1.
Mode of inheritance for gene: ELMSAN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ELMSAN1 were set to Neurodevelopmental disorder, MONDO:0700092, ELMSAN1-related
Intellectual disability syndromic and non-syndromic v1.489 SUCO Zornitza Stark gene: SUCO was added
gene: SUCO was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000; 41282771
Phenotypes for gene: SUCO were set to Syndromic disease (MONDO:0002254), SUCO-related
Intellectual disability syndromic and non-syndromic v1.488 GTF2H4 Zornitza Stark gene: GTF2H4 was added
gene: GTF2H4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: GTF2H4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF2H4 were set to 40924495; 40924475
Phenotypes for gene: GTF2H4 were set to Xeroderma pigmentosum, complementation group J, MIM# 621435
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37404-Gain Sarah Milton Region: ISCA-37404-Gain was added
Region: ISCA-37404-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37404-Gain.
Mode of inheritance for Region: ISCA-37404-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37404-Gain were set to 24239951; 24075935
Phenotypes for Region: ISCA-37404-Gain were set to Chromosome 15q11q13 duplication syndrome; {Autism susceptibility 4} 608636; intellectual disability; seizures; ataxia
Intellectual disability syndromic and non-syndromic v1.485 ISCA-37400-Loss Sarah Milton Region: ISCA-37400-Loss was added
Region: ISCA-37400-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37400-Loss.
Mode of inheritance for Region: ISCA-37400-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37400-Loss were set to Chromosome 16p11.2 deletion syndrome, proximal, MIM# 611913; autism; intellectual disability; seizures
Intellectual disability syndromic and non-syndromic v1.484 ISCA-37400-Gain Sarah Milton Region: ISCA-37400-Gain was added
Region: ISCA-37400-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37400-Gain.
Mode of inheritance for Region: ISCA-37400-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37400-Gain were set to 21841781; 18184952; 21731881
Phenotypes for Region: ISCA-37400-Gain were set to Chromosome 16p11.2 duplication syndrome, MIM# 614671; intellectual disability; autism
Intellectual disability syndromic and non-syndromic v1.484 ISCA-37397-Loss Sarah Milton Region: ISCA-37397-Loss was added
Region: ISCA-37397-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37397-Loss.
Mode of inheritance for Region: ISCA-37397-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37397-Loss were set to 21671380; 23765049; 18179902
Phenotypes for Region: ISCA-37397-Loss were set to Chromosome 22q11.2 deletion syndrome, distal, MIM#611867; intellectual disability; seizures; growth retardation; multiple congenital anomalies
Intellectual disability syndromic and non-syndromic v1.483 ISCA-37397-Gain Sarah Milton Region: ISCA-37397-Gain was added
Region: ISCA-37397-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37397-Gain.
Mode of inheritance for Region: ISCA-37397-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37397-Gain were set to 21671380; 31479204
Phenotypes for Region: ISCA-37397-Gain were set to Chromosome 22q11.2 microduplication syndrome, MIM#608363, distal; intellectual disability; dysmorphic features; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.482 ISCA-37396-Loss Sarah Milton Region: ISCA-37396-Loss was added
Region: ISCA-37396-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37396-Loss.
Mode of inheritance for Region: ISCA-37396-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37396-Loss were set to 22180641; 19557438; 19233321; 22359776
Phenotypes for Region: ISCA-37396-Loss were set to Chromosome 15q24 deletion syndrome, MIM#613406; intellectual disability; facial dysmorphisms; congenital malformations of the hands and feet, eye, and genitalia; joint laxity; and growth retardation and failure to thrive
Intellectual disability syndromic and non-syndromic v1.481 ISCA-37394-Loss Sarah Milton Region: ISCA-37394-Loss was added
Region: ISCA-37394-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37394-Loss.
Mode of inheritance for Region: ISCA-37394-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37394-Loss were set to 20691407
Phenotypes for Region: ISCA-37394-Loss were set to Chromosome 2q37 deletion syndrome, MIM# 600430; brachydactyly; intellectual disability
Intellectual disability syndromic and non-syndromic v1.480 ISCA-37393-Gain Sarah Milton Region: ISCA-37393-Gain was added
Region: ISCA-37393-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37393-Gain.
Mode of inheritance for Region: ISCA-37393-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37393-Gain were set to Cat eye syndrome, MIM# 115470; coloboma; anal atresia; heart and renal malformations
Intellectual disability syndromic and non-syndromic v1.479 ISCA-37392-Loss Sarah Milton Region: ISCA-37392-Loss was added
Region: ISCA-37392-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37392-Loss.
Mode of inheritance for Region: ISCA-37392-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37392-Loss were set to 20301427
Phenotypes for Region: ISCA-37392-Loss were set to Williams-Beuren syndrome, MIM# 194050; intellectual disability; growth retardation; cardiovascular disease
Intellectual disability syndromic and non-syndromic v1.478 ISCA-37392-Gain Sarah Milton Region: ISCA-37392-Gain was added
Region: ISCA-37392-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37392-Gain.
Mode of inheritance for Region: ISCA-37392-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37392-Gain were set to 33187326; 27615053; 26610320
Phenotypes for Region: ISCA-37392-Gain were set to Chromosome 7q11.23 duplication syndrome, MIM# 609757; intellectual disability; hypotonia; macrocephaly; seizures; aortic dilatation
Intellectual disability syndromic and non-syndromic v1.478 ISCA-37390-Loss Sarah Milton Region: ISCA-37390-Loss was added
Region: ISCA-37390-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37390-Loss.
Mode of inheritance for Region: ISCA-37390-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37390-Loss were set to 16953888
Phenotypes for Region: ISCA-37390-Loss were set to Cri-du-chat syndrome MIM#123450; intellectual disability; microcephaly
Intellectual disability syndromic and non-syndromic v1.477 MT-ND4 Zornitza Stark gene: MT-ND4 was added
gene: MT-ND4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-ND4.
Mode of inheritance for gene gene: MT-ND4 was set to MITOCHONDRIAL
Publications for gene: MT-ND4 were set to 12707444; 16120329; 15576045; 20502985; 27761019; 32445240; 32659360; 3201231
Phenotypes for gene: MT-ND4 were set to Mitochondrial disease (MONDO:0044970), MT-ND4-related
Intellectual disability syndromic and non-syndromic v1.476 MT-CO2 Zornitza Stark gene: MT-CO2 was added
gene: MT-CO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-CO2.
Mode of inheritance for gene gene: MT-CO2 was set to MITOCHONDRIAL
Publications for gene: MT-CO2 were set to 34325999; 30315213; 28521807; 10205264; 10486321; 11558799; 18245391; 23616164; 31167410; 23965802; 30030519
Phenotypes for gene: MT-CO2 were set to Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related
Intellectual disability syndromic and non-syndromic v1.475 MT-ATP6 Zornitza Stark gene: MT-ATP6 was added
gene: MT-ATP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-ATP6.
Mode of inheritance for gene gene: MT-ATP6 was set to MITOCHONDRIAL
Publications for gene: MT-ATP6 were set to 40112238
Phenotypes for gene: MT-ATP6 were set to Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related
Intellectual disability syndromic and non-syndromic v1.470 ABI2 Zornitza Stark gene: ABI2 was added
gene: ABI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ABI2 were set to 40475134
Phenotypes for gene: ABI2 were set to Neurodevelopmental disorder, MONDO:0700092, ABI2-related
Review for gene: ABI2 was set to AMBER
Added comment: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.468 NUDT2 Zornitza Stark edited their review of gene: NUDT2: Added comment: PMID 38141063 reports 18 individuals from 10 unrelated families with biallelic loss‑of‑function NUDT2 variants presenting with early‑onset neurodevelopmental disorder characterized by hypotonia, motor delay, gait disturbance, mild intellectual disability, peripheral neuropathy, corpus callosum abnormalities and progressive basal ganglia signal abnormalities.; Changed publications: 27431290, 30059600, 33058507, 38141063
Intellectual disability syndromic and non-syndromic v1.468 KARS Zornitza Stark changed review comment from: Sources: Expert list; to: Infantile-onset progressive leukoencephalopathy with or without deafness (LEPID) is a complex neurodegenerative disorder with onset of symptoms in infancy or early childhood. Most individuals present with sensorineural deafness or hypoacousia and global developmental delay. Affected individuals show episodic regression with progressive motor deterioration resulting in spastic tetraplegia and loss of ambulation, as well as impaired intellectual development with poor or absent speech. Additional more variable features may include poor overall growth with microcephaly, seizures, visual loss, microcytic anaemia, and hepatic enlargement or abnormal liver enzymes.

Brain imaging shows deep white matter abnormalities consistent with a progressive leukoencephalopathy.

Calcifications of the brain and spinal cord are a feature.
Intellectual disability syndromic and non-syndromic v1.452 EN2 Chirag Patel gene: EN2 was added
gene: EN2 was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
disputed tags were added to gene: EN2.
Mode of inheritance for gene: EN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EN2 were set to Complex neurodevelopmental disorder, MONDO:0100038
Review for gene: EN2 was set to RED
Added comment: ClinGen DISPUTED - Feb 2021

https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_91eb2fc6-864c-4a4a-9b2d-0b2bdd695999-2021-02-16T170000.000Z?page=1&size=25&search=
Sources: ClinGen
Intellectual disability syndromic and non-syndromic v1.446 COX4I1 Lucy Spencer gene: COX4I1 was added
gene: COX4I1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list
Mode of inheritance for gene: COX4I1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COX4I1 were set to 28766551; 22592081; 31290619; 40095452; 41203052
Phenotypes for gene: COX4I1 were set to Mitochondrial complex IV deficiency, nuclear type 16, MIM#619060
Intellectual disability syndromic and non-syndromic v1.444 COQ5 Zornitza Stark Publications for gene: COQ5 were set to 29044765
Intellectual disability syndromic and non-syndromic v1.441 CUL1 Zornitza Stark gene: CUL1 was added
gene: CUL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: CUL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CUL1 were set to PMID: 41189326
Phenotypes for gene: CUL1 were set to Neurodevelopmental disorder, MONDO:0700092, CUL1-related
Intellectual disability syndromic and non-syndromic v1.439 SEC31A Zornitza Stark Publications for gene: SEC31A were set to 30464055
Intellectual disability syndromic and non-syndromic v1.433 CACNA1A Zornitza Stark Publications for gene: CACNA1A were set to 27476654; 33985586
Intellectual disability syndromic and non-syndromic v1.430 EXOSC10 Zornitza Stark gene: EXOSC10 was added
gene: EXOSC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: EXOSC10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EXOSC10 were set to 41132091
Phenotypes for gene: EXOSC10 were set to Microcephaly, MONDO:0001149, EXOSC10-related
Intellectual disability syndromic and non-syndromic v1.429 RPS6KC1 Rylee Peters gene: RPS6KC1 was added
gene: RPS6KC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: RPS6KC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RPS6KC1 were set to 41130203
Phenotypes for gene: RPS6KC1 were set to Complex neurodevelopmental disorder, MONDO:0100038, RPS6KC1-related
Intellectual disability syndromic and non-syndromic v1.425 KLHL13 Krithika Murali gene: KLHL13 was added
gene: KLHL13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KLHL13 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: KLHL13 were set to PMID: 41159445
Phenotypes for gene: KLHL13 were set to Neurodevelopmental disorder, MONDO:0700092, KLHL13-related
Review for gene: KLHL13 was set to GREEN
Added comment: PMID: 41159445 Akhther et al 2025 (pre-print) report 8 affected individuals from 4 unrelated famlies with hemizygous/heterozygous KLHL13 variants and an X-linked neurodevelopmental disorder with the following phenotypic features including mild-severe ID, developmental delay, macrocephaly, hypotonia, unsteady gait, facial dysmrophism and behavioural issues. Functional studies support LoF disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.420 BAIAP2 Bryony Thompson gene: BAIAP2 was added
gene: BAIAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: BAIAP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BAIAP2 were set to 41133935; 38149472
Phenotypes for gene: BAIAP2 were set to BAIAP2-related complex neurodevelopmental disorder MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.418 QSER1 Zornitza Stark gene: QSER1 was added
gene: QSER1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature,Literature
Mode of inheritance for gene: QSER1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: QSER1 were set to PMID: 41139957
Phenotypes for gene: QSER1 were set to Neurodevelopmental disorder, MONDO:0700092, QSER1-related
Intellectual disability syndromic and non-syndromic v1.416 CCNK Sangavi Sivagnanasundram gene: CCNK was added
gene: CCNK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCNK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CCNK were set to 41101726; 37597256; 30122539
Phenotypes for gene: CCNK were set to CCNK-related neurodevelopmental disorder-severe intellectual disability-facial dysmorphism syndrome MONDO:0035775
Intellectual disability syndromic and non-syndromic v1.414 SRRM1 Zornitza Stark gene: SRRM1 was added
gene: SRRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SRRM1 were set to 41145827
Phenotypes for gene: SRRM1 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM1-related
Review for gene: SRRM1 was set to GREEN
Added comment: PMID 41145827 reports three individuals from three unrelated families with heterozygous truncating SRRM1 variants presenting with a neurodevelopmental disorder characterised by developmental delay, intellectual disability, short stature, behavioural and skeletal anomalies, and facial dysmorphism. Two variants are confirmed de novo and functional assays in neuronal‑like cells and Drosophila support haploinsufficiency as a disease mechanism.

Serine/arginine repetitive matrix protein 1 (SRRM1) is a key component of spliceosomes and plays various roles in messenger RNA processing.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.408 OTUD7A Zornitza Stark Publications for gene: OTUD7A were set to 31997314; 29395075; 29395074; 33381903
Intellectual disability syndromic and non-syndromic v1.406 AUTS2 Zornitza Stark Publications for gene: AUTS2 were set to 23332918; 25205402; 31474318; 39953909
Intellectual disability syndromic and non-syndromic v1.405 AUTS2 Zornitza Stark Publications for gene: AUTS2 were set to 23332918; 25205402; 31474318
Intellectual disability syndromic and non-syndromic v1.404 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.403 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.403 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.402 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171
Intellectual disability syndromic and non-syndromic v1.399 SLC27A3 Sarah Milton gene: SLC27A3 was added
gene: SLC27A3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC27A3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC27A3 were set to PMID: 41054338
Phenotypes for gene: SLC27A3 were set to Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related
Intellectual disability syndromic and non-syndromic v1.398 DIP2B_FRA12A_CGG Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128
Intellectual disability syndromic and non-syndromic v1.396 SSPO Sarah Milton gene: SSPO was added
gene: SSPO was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: SSPO.
Mode of inheritance for gene: SSPO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SSPO were set to PMID: 41077560
Phenotypes for gene: SSPO were set to Neurodevelopmental disorder, MONDO:0700092, SSPOP-related
Intellectual disability syndromic and non-syndromic v1.395 PPFIA2 Zornitza Stark gene: PPFIA2 was added
gene: PPFIA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PPFIA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPFIA2 were set to 41044885
Phenotypes for gene: PPFIA2 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA2 related
Intellectual disability syndromic and non-syndromic v1.394 EIPR1 Zornitza Stark gene: EIPR1 was added
gene: EIPR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: EIPR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIPR1 were set to 41058046
Phenotypes for gene: EIPR1 were set to Mendelian neurodevelopmental disorder MONDO:0100500, EIPR1-related
Penetrance for gene: EIPR1 were set to unknown
Intellectual disability syndromic and non-syndromic v1.393 BRSK1 Zornitza Stark gene: BRSK1 was added
gene: BRSK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: BRSK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BRSK1 were set to 41035394
Phenotypes for gene: BRSK1 were set to Neurodevelopmental disorder, MONDO:0700092, BRSK1-related
Intellectual disability syndromic and non-syndromic v1.392 KLHL20 Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390
Intellectual disability syndromic and non-syndromic v1.391 KLHL20 Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder (MONDO:0700092), KLHL20-related to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390
Intellectual disability syndromic and non-syndromic v1.390 KLHL20 Zornitza Stark reviewed gene: KLHL20: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.384 CDKL1 Zornitza Stark commented on gene: CDKL1: PMID 40088891 reports two unrelated individuals with de novo heterozygous CDKL1 missense variants (p.Val115Ala, p.Arg169Cys) presenting with childhood‑onset neurodevelopmental disorder, developmental delay and seizures; Drosophila rescue assays show dominant‑negative activity of the variants. However, note that the variants are present at low frequency in gnomAD v4, p.Val115Ala: 2 individuals, p.Arg169Cys: 13 individuals. Some supportive functional data presented. Upgrade to Amber but not Green due to pop counts.
Intellectual disability syndromic and non-syndromic v1.382 TBCB Zornitza Stark Phenotypes for gene: TBCB were changed from Neurodevelopmental disorder, MONDO:0700092, TBCB-related to Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382
Intellectual disability syndromic and non-syndromic v1.381 TBCB Zornitza Stark reviewed gene: TBCB: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.380 TBX2 Krithika Murali gene: TBX2 was added
gene: TBX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TBX2 were set to PMID: 36733940
Phenotypes for gene: TBX2 were set to Vertebral anomalies and variable endocrine and T-cell dysfunction - MIM#618223
Review for gene: TBX2 was set to AMBER
Added comment: PMID: 36733940 Rafeeq et al 2022 report a novel de novo nonsense variant (c.529A>T; p.Lys177*; NM_005994.4) in a child with chondrodysplasia. Skeletal features included spinal deformities, short limbs, metaphyseal and epiphyseal dysplasia, and bilateral developmental dislocation of the hip (DDH).

Global developmental delay was also noted in this child.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.378 EIF3B Zornitza Stark gene: EIF3B was added
gene: EIF3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF3B were set to 41033306
Phenotypes for gene: EIF3B were set to Syndromic disease (MONDO:0002254), EIF3B-related
Review for gene: EIF3B was set to GREEN
Added comment: Fourteen individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.376 EIF3A Zornitza Stark gene: EIF3A was added
gene: EIF3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF3A were set to 41033306
Phenotypes for gene: EIF3A were set to Syndromic disease (MONDO:0002254), EIF3A-related
Added comment: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.373 MDGA2 Zornitza Stark gene: MDGA2 was added
gene: MDGA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MDGA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MDGA2 were set to https://doi.org/10.1101/2025.08.28.25330873; 40168357; 27608760
Phenotypes for gene: MDGA2 were set to MDGA2-related neurodevelopmental disorder MONDO:0700092
Review for gene: MDGA2 was set to GREEN
Added comment: Affected individuals present with a broad neurodevelopmental impairment-like phenotype.

Pre-print - https://doi.org/10.1101/2025.08.28.25330873
Individuals with developmental and epileptic encephalopathy (DEE)
8 individuals from 6 consanguineous families exhibiting infantile hypotonia, severe neurodevelopmental delay, intractable seizures, progressive brain atrophy, and consistent dysmorphic features.
7 different biallelic LoF variants were identified
p.Tyr913Ter, p.Arg404Ter, p.Leu920Ter, c.421-1G>A, p.Lys391SerfsTer7 and c.421-96_595+99del - all variants are rare or absent in gnomAD v4.1
In vitro functional studies of three nonsense variants in mammalian expression systems and hippocampal cultured neurons that resulted in impaired MDGA2 membrane trafficking are supportive of a loss-of-function mechanism.

PMID: 40168357, 27608760
A knockout mouse model showed that MGAD2-deficient mice presented with autism-like behaviours (social deficits, repetitive behaviour, and cognitive impairment).
The mice also showed abnormalities in excitatory synapses.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.371 DBX1 Zornitza Stark gene: DBX1 was added
gene: DBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DBX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DBX1 were set to 40995053
Phenotypes for gene: DBX1 were set to central hypoventilation syndrome, congenital MONDO:0800031
Review for gene: DBX1 was set to RED
Added comment: Single individual reported with congenital central hypoventilation syndrome (atypical CCHS) with central hypotonia, global developmental delay, seizures, autoaggressive behaviour. Consanguineous parents, hmz frameshift variant c.340_341delGC, absent from gnomAD.
Mouse Dbx1 knockout is lethal indicating essential role in respiration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.369 NFXL1 Zornitza Stark gene: NFXL1 was added
gene: NFXL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NFXL1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NFXL1 were set to 40430072; 41024252
Phenotypes for gene: NFXL1 were set to Syndromic disease (MONDO:0002254), NFXL1-related
Review for gene: NFXL1 was set to AMBER
Added comment: PMID: 40430072 2 siblings with psychosis and schizophrenia, homozygous for Cys441Tyr. Some modelling suggested a deleterious affect but no functional studies performed.

PMID: 41024252 8 patients from 7 families with joint hyperlaxity, with or without short stature and renal disease. 6 families were homozygous for p.(Cys539Trpfs*64) while the other two were homozygous for p.(Lys681*). Paper described both as founder variants but they are rare/absent in gnomad.

Joint hyperlaxity (7), chronic kidney disease/FSGS (2) small echogenic kidneys (3), acute kidney injury (1), dysmorphic features (6), short stature (6), speech delay (3).

One patient also had epilepsy, developmental delay and spasticity however c.728+1G>A in WDR45 explained this part of her phenotype. Other patients also had more severe outlying symptoms with no other explanation mentioned: 1 with developmental delay, hearing loss, brain malformations, skeletal abnormalities, and another a 3 year old who passed away following a complex medical course including blue sclera, proximal tibial fracture, severe respiratory distress due to a chest infection, and acute kidney injury.

Amber given the variable phenotype findings of the reported patients and only 2 homozygous variants identified so far.

Extent of associated DD/ID currently unclear but adding on this panel as it is often ordered in children with multi-system features suggestive of an underlying syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.366 CDK9 Zornitza Stark gene: CDK9 was added
gene: CDK9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDK9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDK9 were set to 33640901; 30237576; 26633546
Phenotypes for gene: CDK9 were set to multiple congenital anomalies/dysmorphic syndrome-variable intellectual disability syndrome MONDO:0015160; CHARGE-like syndrome with retinal dystrophy
Review for gene: CDK9 was set to AMBER
Added comment: Two independent reports:
1) A boy with a phenotype resembling CHARGE syndrome (multiple anomalies involving the eyes, ears, cleft lip, and palate, and intellectual disability) with retinal dystrophy (p.A288T/p.R303C),
2) 4 consanguineous families homozygous for p.R225C, including a set of cousins.
CDK9 variants demonstrated decreased kinase activity. One of the studies suggested the extent the kinase activity is reduced may account for the absence/presence of the CHARGE-like phenotype with retinal dystrophy

One additional family with retinal dystrophy only.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.365 AGTPBP1 Chirag Patel Phenotypes for gene: AGTPBP1 were changed from Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy; Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 to Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650
Publications for gene AGTPBP1 were changed from 30420557, 28600779, 30976113, 38153683, 28325758 to 30420557, 28600779, 30976113, 38153683, 28325758
Intellectual disability syndromic and non-syndromic v1.363 ALS2 Chirag Patel Source Genetic Health Queensland was removed from ALS2.
Source ClinGen was added to ALS2.
Phenotypes for gene: ALS2 were changed from Spastic paralysis, infantile onset ascending, MIM#607225 to ALS2-related motor neuron disease, MONDO:0100227
Intellectual disability syndromic and non-syndromic v1.357 DDOST Bryony Thompson Publications for gene: DDOST were set to 22305527
Intellectual disability syndromic and non-syndromic v1.352 HYPK Zornitza Stark Publications for gene: HYPK were set to Clinical Genetics Early View
Intellectual disability syndromic and non-syndromic v1.350 BCAT1 Lucy Spencer gene: BCAT1 was added
gene: BCAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BCAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BCAT1 were set to 41029903
Phenotypes for gene: BCAT1 were set to Neurodevelopmental disorder (MONDO:0700092), BCAT1-related
Review for gene: BCAT1 was set to RED
Added comment: PMID: 41029903 One patient with a suspected neurometabolic disorder; congenital blindness and suspected Leber Congenital Amaurosis, microcephaly, failure to thrive, profound global developmental delay and extensive delayed myelination on MRI. AT 10 he was non-verbal and non-ambulatory with regression of motor skills and -3SD for height and weight. Compound heterozygous for Phe264Leu (539 hets but no homs in gnomad v4) and Glu348Lys (over 8000 hets and 24 homs in gnomad v4).

in compound heterozygous iPSCs a severe 75% reduction in BCAT1 protein levels was seen, but mRNA levels were normal suggesting the variants affect protein stability or increased degradation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 RNU6ATAC Lucy Spencer gene: RNU6ATAC was added
gene: RNU6ATAC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU6ATAC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNU6ATAC were set to 40975062
Phenotypes for gene: RNU6ATAC were set to Neurodevelopmental disorder (MONDO:0700092), RNU6ATAC-related
Review for gene: RNU6ATAC was set to RED
Added comment: PMID: 40975062 1 patient compound heterozygous for n.36T>G and n.28C>T. Has short stature, microcephaly, hypotonia, neurodevelopmental delay, ID, seizures, ataxia, ventriculomegaly, syndactyly, nystagmus and oculomotor apraxia. Identified in a cohort of individuals with an excess of significant intron retention outliers in minor intron containing genes which are usually removed by the minor spliceosome of which RNU6ATAC is a part (as is RNU4ATAC). Proband had no candidate variants in RNU4ATAC or RNU12. Both RNU6ATAC variants are in a highly conserved 39bp region, and affect nucleotides predicted to be important for binding to U4ATAC.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 PTBP1 Lucy Spencer gene: PTBP1 was added
gene: PTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTBP1 were set to 40965981
Phenotypes for gene: PTBP1 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP1-related
Review for gene: PTBP1 was set to GREEN
Added comment: PMID: 40965981 27 individuals with abnormal prenatal ultrasound in thirteen (48%) including short femora, IUGR, hydramnios, increased nuchal translucency, asymmetry of heart cavities, and bilateral hydronephrosis. Skeletal anomalies were seen in 24 (89%), short stature/limbs in 63%, facial dysmorphism 25 (93%), developmental delay in 78%, behavioral problems in 30% and ID in 26% generally mild/moderate, 43% had variable brain MRI abnormalities. additional features included skin, nail, and hair anomalies (52%), dental anomalies (37%), ophthalmological findings (44%), and cardiovascular defects (22%).

Variants a mix of missense and startloss, and were confirmed de novo in 23/17 cases.

Various functional studies showed reduced nuclear localization and enhanced cytoplasmic retention, with start-loss variants also leading to increased protein stability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 PTBP2 Lucy Spencer gene: PTBP2 was added
gene: PTBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTBP2 were set to 40965981
Phenotypes for gene: PTBP2 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP2-related
Review for gene: PTBP2 was set to AMBER
Added comment: PMID: 40965981 2 males with developmental delay, ID, autistic features. 1 had some dysmorphic features and tonic-clonic seizures. both probands had a de novo variant in PTBP2 NM_021190.4:c.2T>C (p.Met1?) and NM_021190.4:c.41G>C (p.Arg14Thr), absent from gnomad. Transfection of the variants in transfection in NIH-3T3 cells showed the missense had cytoplasmic retention and colocalization with processing bodies, and that there were 2 alternative downstream start sites Met32 and Met35 that may be used instead.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.346 SF1 Sarah Milton gene: SF1 was added
gene: SF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SF1 were set to PMID: 40987292
Phenotypes for gene: SF1 were set to Neurodevelopmental disorder, MONDO:0700092, SF1-related
Review for gene: SF1 was set to GREEN
Added comment: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing

PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15).
Variant types included missense and high impact LOF (nonsense and frameshift).

Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets.
pLI for SF1 is 1 with overall few LOF variants in gene.

Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.342 SYNE2 Chirag Patel gene: SYNE2 was added
gene: SYNE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SYNE2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SYNE2 were set to 34573277
Phenotypes for gene: SYNE2 were set to Neurodevelopmental disorder, MONDO:0700092, SYNE2 related
Review for gene: SYNE2 was set to RED
Added comment: 1 individual with autism spectrum disorder, developmental delay and intellectual disability (from a cohort of 410 trios with neurodevelopmental disorders). Trio WES found compound heterozygous variants in SYNE2 [c.2483T>G; p.(Val828Gly) and c.2362G>A; p.(Glu788Lys)]. Both variants are rare, predicted to be highly damaging using in silico tools, and located in the nesprin-2 giant spectrin repeat domain. Both parents and the healthy brother were heterozygous. Expression and functional testing in patient lymphoblastoid cell lines showed a significant reduction of nesprin-2 giant protein levels, however SYNE2 transcription and the nuclear envelope localisation of the mutant proteins was unaffected as compared to parental control cells.

SYNE 1-4 genes encode for nesprins (nuclear envelope spectrin repeat proteins) which play fundamental roles in nuclear architecture and positioning, directed cell migration, cellular signalling, ciliogenesis, and mechanobiology.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 INTS6 Sarah Milton changed review comment from: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature; to: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 INTS6 Sarah Milton gene: INTS6 was added
gene: INTS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INTS6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: INTS6 were set to PMID: 40966122
Phenotypes for gene: INTS6 were set to Neurodevelopmental disorder, MONDO:0700092, INTS6-related
Review for gene: INTS6 was set to GREEN
Added comment: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to 40210679; 40442284
Intellectual disability syndromic and non-syndromic v1.338 CRNKL1 Zornitza Stark Publications for gene: CRNKL1 were set to
Intellectual disability syndromic and non-syndromic v1.335 MRPS36 Krithika Murali gene: MRPS36 was added
gene: MRPS36 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRPS36 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MRPS36 were set to PMID: 41018056; 38685873
Phenotypes for gene: MRPS36 were set to Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related
Review for gene: MRPS36 was set to AMBER
Added comment: 3 individuals from 2 unrelated families reported with biallelic MRPS36 variants (current HGNC is KGD4). Gene encodes E4 subunit of OGDHC complex. Individuals present with a phenotype consistent with Leigh syndrome including seizures, hypotonia, dystonia, brain imaging anomalies, persistent lactic acidosis. GDD, ID and cardiomyopathy also reported.

Patient-derived fibroblast studies demonstrates reduced OGDHC enzymatic activity, however, this functional evidence is not gene or variant-specific.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.333 GTF2I Zornitza Stark Publications for gene: GTF2I were set to
Intellectual disability syndromic and non-syndromic v1.329 BBOX1 Zornitza Stark gene: BBOX1 was added
gene: BBOX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BBOX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BBOX1 were set to 41022783
Phenotypes for gene: BBOX1 were set to Carnitine deficiency, MONDO:0017716, BBOX1-related
Review for gene: BBOX1 was set to AMBER
Added comment: Three individuals from two unrelated families reported, presenting with myopathy, neurodevelopmental delay, and later-onset psychiatric manifestations. C. elegans knockout and patient-variant models show embryonic lethality rescued by L‑carnitine supplementation
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.327 INPP4A Zornitza Stark Publications for gene: INPP4A were set to 31978615; 31938306; 25338135; 20011524
Intellectual disability syndromic and non-syndromic v1.325 B9D1 Zornitza Stark Publications for gene: B9D1 were set to 24886560; 21493627
Intellectual disability syndromic and non-syndromic v1.313 AP2S1 Zornitza Stark Publications for gene: AP2S1 were set to 33057194
Intellectual disability syndromic and non-syndromic v1.307 GNAI2 Zornitza Stark Publications for gene: GNAI2 were set to 31036916
Intellectual disability syndromic and non-syndromic v1.305 TRPC5 Zornitza Stark Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890
Intellectual disability syndromic and non-syndromic v1.302 TMEM167A Chirag Patel gene: TMEM167A was added
gene: TMEM167A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM167A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM167A were set to PMID: 40924476
Phenotypes for gene: TMEM167A were set to Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related
Review for gene: TMEM167A was set to GREEN
Added comment: 6 individuals from 6 unrelated families (4/6 consanguineous) presenting with neonatal diabetes onset <4mths (6/6), severe microcephaly (6/6), epilepsy (5/6), and developmental delay (4/6).

Whole genome sequencing identified biallelic variants in TMEM167A gene. Variants were homozygous in 5/6 families, and variant types were missense (4), frameshift (1), and splice (1), and all variants were rare/unreported in gnomAD. Segregation studies not reported in paper.

Microcephaly, epilepsy and diabetes syndrome has 2 known associated genes (IER3IP1 and YIPF5) which encode proteins involved in endoplasmic reticulum to Golgi trafficking. TMEM167A is highly expressed in developing and adult human pancreas and brain. Both TMEM167A depletion in EndoC-βH1 cells and knock‑in of p.Val59Glu variant in iPSC-derived β cells sensitized β cells to ER stress. The p.Val59Glu variant impaired proinsulin trafficking to the Golgi and induced iPSC-β cell dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.301 RAB11A Zornitza Stark Publications for gene: RAB11A were set to 29100083
Intellectual disability syndromic and non-syndromic v1.296 ZNF865 Sangavi Sivagnanasundram gene: ZNF865 was added
gene: ZNF865 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF865 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF865 were set to 40936200
Phenotypes for gene: ZNF865 were set to ZNF865‑associated neurodevelopmental disorder MONDO:0700092
Review for gene: ZNF865 was set to AMBER
Added comment: PMID: 40936200
18 patients reported with DD, hypotonia and six individuals were reported with some dysmorphic features (frontal bossing, a broad nasal bridge, hypertelorism, and low-set ears)
All 18 individuals were reported with de novo truncating variants in ZNF865. All variants were rare/absent in gnomAD v4.1.

The mechanism of disease for this gene is unknown. No pathogenic SNVs have been reported in ClinVar at this stage however there are reports of VUS’s and pathogenic CNVs.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.296 SNAPIN Lucy Spencer gene: SNAPIN was added
gene: SNAPIN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNAPIN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNAPIN were set to 40930097; 26539891
Phenotypes for gene: SNAPIN were set to Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related
Review for gene: SNAPIN was set to GREEN
Added comment: PMID: 40930097 6 patients from 5 families with neuroanatomical, craniofacial, and skeletal anomalies on prenatal ultrasound/MRI, all homozygous for variants in SNAPIN. 2 stopgain, 1 canonical splice, 5 missense. common phenotypes: ventriculomegaly 5/6, cerebellar hypoplasia/atrophy 5/6, clubfeet 4/6, corpus callosum agenesis 4/6, flexion contractures 4/6, microcephaly 3/6, micrognathia/retrognathia 4/6. The patients with the nonsense or splice variants did not survive the perinatal period, while those with missense survived into early childhood.

This paper also mentions a 7th patient reported in PMID: 26539891, who has ID, microcephaly, cortical atrophy, bulbar and cerebellar hypoplasia, sensorineural polyneuropathy, and hypotonia. They are homozygous for a missense variant Asn55Tyr. Of note, the other paper report this as Arg55Trp and one of their patients also has this variant, based off the transcript information provided in both papers Arg55Trp is correct.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.295 SKOR2 Zornitza Stark gene: SKOR2 was added
gene: SKOR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SKOR2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SKOR2 were set to 40890458; 29997391; 21937600
Phenotypes for gene: SKOR2 were set to complex neurodevelopmental disorder with motor features MONDO:0100516
Review for gene: SKOR2 was set to GREEN
Added comment: 3 unrelated families with consistent phenotypes and a supportive mouse model:
PMID: 40890458 - 2 unrelated consanguineous Iranian families with a combination of learning disability, facial dysmorphisms, and motor and speech impairments with homozygous variants (c.374 G>C: p.Arg125Pro & c.1271_1274del: p.K424Rfs*71). The homozygous missense variant segregated with disease in 8 individuals (no unaffected individuals tested were homozygous).

PMID: 29997391 - proband with neurodevelopmental delay, hypotonia, ataxia, cerebellar dysplasia from a consanguineous Turkish family with a homozygous null variant (NM_001278063.1:c.2750C>G; p.Ser917*). None of the 4 healthy siblings were homozygous for the variant.

PMID: 21937600 - Skor2 -/- mouse model had defective Purkinje cell development, a severe reduction of granule cell proliferation and a malformed cerebellum. Mouse had unstable gait.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.293 GBX1 Zornitza Stark gene: GBX1 was added
gene: GBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GBX1 were set to 40519143
Phenotypes for gene: GBX1 were set to Neurodevelopmental disorder, MONDO:0700092, GBX1-related
Review for gene: GBX1 was set to RED
Added comment: Single individual with de novo LoF variant with DD and focal epilepsy. Zebrafish model had abnormal morphology of the interocular area. Furthermore, the zebrafish larvae exhibited an increased susceptibility to neurophysiological abnormalities associated with epileptiform activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.291 MTERF3 Zornitza Stark gene: MTERF3 was added
gene: MTERF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTERF3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MTERF3 were set to 40543543
Phenotypes for gene: MTERF3 were set to Mitochondrial disease (MONDO:0044970), MTERF3-related
Review for gene: MTERF3 was set to AMBER
Added comment: Two individuals reported from unrelated families, presenting with DD/ID, intermittent hypoglycaemia and metabolic acidosis. Genetic testing identified compound heterozygous variants c.635dup p.(Asn212Lysfs*7) and c.1055C > T p.(Pro352Leu) in Patient 1, and a homozygous variant c.943A > Gp.(Met315Val) in Patient 2. Patient's fibroblasts and MTERF3 knockdown cells showed impaired mitochondrial respiration and reduced levels of OXPHOS complexes I, III, and IV. Transcription of MT-ND5, ND6, COII, and COIII was reduced, while other mitochondrial genes were upregulated. Wild-type MTERF3 expression restored these defects, but the variant Pro352Leu from patient failed to rescue mitochondrial dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.289 ATP5A1 Zornitza Stark gene: ATP5A1 was added
gene: ATP5A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP5A1 were set to 34483339; 34954817; 40859057
Phenotypes for gene: ATP5A1 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD
Review for gene: ATP5A1 was set to GREEN
Added comment: At least 12 individuals reported with de novo missense variants in this gene, several recurrent.

PMIDs: 34483339, 34954817: 6xde novo patients 4 with Arg207His, 1 Arg182Gln 1 Ser346Phe. All Arg207His patients were neonates with failure to thrive, hyperammonemia, lactic acidosis, and respiratory defects in fibroblasts, major symptoms remitted with treatment by late infancy, and at age 14mo to 3yrs growth and development were normal. Other 2 patients are 17yo with ID, ataxia, spastic paraparesis and dystonia, and a 12yo with psychomotor retardation, spastic tetraparesis, generalised dystonia, absent speech, swallowing problems, and increased blood lactate concentrations.

And an internal VCGS patient Arg182Gln (variant also seen in a different patient above) with ID, muscular hypotonia, clinodactyly of the 5th finger, and dysmorphic facial features, proteomics showed decreased ATP5F1A and a complex V deficiency. There is also an alternative change at this residue in the DECIPHER cohort Arg182Pro de novo in an individual with a neurodevelopmental disorder.

PMID: 40672495: 6x de novo individuals - 4 variants p.Arg182Gln, p.Ser346Phe, p.Pro331Leu, and p.Leu109Ser - with complex but overlapping neurological phenotypes including developmental delays, intellectual disability, pyramidal tract dysfunction, and dystonia.

In vivo functional studies in C. elegans were performed for three of the variants, showing growth defects and disruption of mitochondrial function (measured by mitochondrial stress). Authors suggest a dominant negative mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.285 COMMD9 Krithika Murali gene: COMMD9 was added
gene: COMMD9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COMMD9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COMMD9 were set to PMID: 40601774
Phenotypes for gene: COMMD9 were set to Neurodevelopmental disorder, MONDO:0700092, COMMD9-related
Review for gene: COMMD9 was set to RED
Added comment: PMID: 40601774 report a cohort ascertained through GeneMatcher with phenotypic features overlapping with Ritscher-Schinzel syndrome.

Homozygous fs variant in COMMD9 [NM_014186.3:c.208_209del, p.Leu70Glyfs*5] identified in a 4 yo M with dev delay, dysmorphism, skeletal changes including brachydactyly and radioulnar dysostosis, hypotonia, MRI-B anomalies - dysgyria, dilated
lateral ventricles, deep white matter periventricular demyelination, thin corpus callosum, cerebellar vermis hypoplasia and malrotation.

Consanguineous parents confirmed to be heterozygous carriers. No information provided regarding segregation of these variants in unaffected siblings.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.283 TBCB Krithika Murali gene: TBCB was added
gene: TBCB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBCB were set to PMID: 40856104
Phenotypes for gene: TBCB were set to Neurodevelopmental disorder, MONDO:0700092, TBCB-related
Review for gene: TBCB was set to AMBER
Added comment: PMID: 40856104 Bratman, S. et al 2025 (Genetics in Medicine) report 10 individuals from 8 unrelated families of Ashkenazi Jewish descent with a homozygous missense founder variant in TBCB (c.589T>A, p.Tyr197Asn) identified through exome sequencing. This variant is present at 1.3% carrier frequency in the AJ population in gnomAD v4 with 0 homozygotes. Variant is reasonably well-conserved, REVEL 0.9 and in the Cap-Gly domain. No other homozygous missense variants in this region in gnomAD v4 and homozygous variants rare, overall.

Phenotypic features included:
- Motor/speech delays in infancy (almost all)
- ASD (8/10)
- ADHD (5/10)
- Mild ID - formal cognitive evaluation (5/8).
- Spastic paraparesis in late childhood (9-12y) with slowly progressive gait difficulties and lower limb spasticity. Urinary abnormalities were not reported.
- Brain MRI was performed on five individuals - three displayed a thin corpus callosum,
and two had decreased white matter.

No prenatal features reported.

Supportive Drosophilia models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.281 COMMD4 Lucy Spencer gene: COMMD4 was added
gene: COMMD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COMMD4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COMMD4 were set to 40601774
Phenotypes for gene: COMMD4 were set to Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related
Review for gene: COMMD4 was set to RED
Added comment: PMID: 40601774 3 siblings with Ritscher-Schinzel syndrome and a homozygous missense in COMMD4 NM_017828.5:c.122T>G; p.Leu41Arg. All three individuals died in infancy and the authors suggest there could be a dual diagnosis to explain the severity.

This variant was expressed in a H4 neuroglioma cell line with COMMD4 knocked out, and showed an enhanced degradative turnover compared to WT when treated with cyclohexamide. Western blot in HEK293T cells showed a decrease in the steady-state abundance of COMMD4.

Knock out of COMMD4 protein leads to destabilization of the Commander complex.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.280 TMEM184B Lucy Spencer gene: TMEM184B was added
gene: TMEM184B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM184B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TMEM184B were set to 39006436
Phenotypes for gene: TMEM184B were set to Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related
Review for gene: TMEM184B was set to GREEN
Added comment: A cohort of 6 patients with developmental delay (5/6), corpus callosum hypoplasia (4/6), microcephaly (1/6), seizures (3/6), and ID (2/6). 2 patients also had gastrointestinal motility disruption. All 6 have de novo variants in TMEM184B, 5 missense 1 canonical splice. 1 of the missense variants has 35 hets in gnomad but the rest are absent. The authors also say they are aware of a 7th patient with overlapping features by personal communication.

A knockout zebrafish model showed a dose dependent reduction in head size and body length in larvae. Knock-in of 2 of the missense variants also showed head size and body length reduction, but the other missense did not. However the other three missense failed to rescue the phenotype of a knockout zebrafish while WT and a negative control did. The authors suggest the first 2 variants are dominant negative while the latter three and loss of function.

The splice variant was shown to cause exon 7 skipping which is out of frame.

Transfection of the missense and splice variants in HEK293T cells showed that all but 1 had reduced TMEM184B protein levels.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.280 POLR3D Zornitza Stark gene: POLR3D was added
gene: POLR3D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR3D was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3D were set to 37915380
Phenotypes for gene: POLR3D were set to Leukodystrophy, MONDO:0019046, POLR3D-related
Review for gene: POLR3D was set to RED
Added comment: PMID 37915380: single individual with compound het variants in POLR3D and childhood onset leukodystrophy manifesting as DD/ID.

Additional neurological features included cerebellar signs (e.g., dysarthria, ataxia, and intention tremor) and dysphagia, while non-neurological features included hypodontia, hypogonadotropic hypogonadism, and dysmorphic facial features. Her MRI was notable for diffuse hypomyelination with myelin preservation of early myelinating structures, characteristic of POLR3-related leukodystrophy. Exome sequencing revealed the biallelic variants in POLR3D, a missense variant (c.541C > T, p.P181S) and an intronic splice site variant (c.656-6G > A, p.?). Functional studies of the patient's fibroblasts demonstrated significantly decreased RNA-level expression of POLR3D, along with reduced expression of other Pol III subunit genes. Notably, Pol III transcription was also shown to be aberrant, with a significant decrease in 7SK RNA and several distinct tRNA genes analyzed. Affinity purification coupled to mass spectrometry of the POLR3D p.P181S variant showed normal assembly of Pol III subunits yet altered interaction of Pol III with the PAQosome chaperone complex, indicating the missense variant is likely to alter complex maturation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.278 HS6ST2 Bryony Thompson gene: HS6ST2 was added
gene: HS6ST2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HS6ST2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: HS6ST2 were set to 40686562; 30471091; 36993824; 38015989
Phenotypes for gene: HS6ST2 were set to X-linked syndromic intellectual disability MONDO:0020119
Review for gene: HS6ST2 was set to GREEN
Added comment: 4 males with a neurodevelopmental phenotype from 3 families (1 set monozygotic twins) hemizygous for rare missense variants and a supporting mouse model.
PMID: 40686562 - a Chinese male child with a syndromic neurodevelopmental phenotype hemizygous c.764C>A (p.Pro255Glu) and in vitro assays showing the variant alters function. Parents were unaffected and variant was maternally inherited.

PMID: 38015989 - knockout mouse model impairs dendritic spines of hippocampal neurons, and affects memory.

PMID: 36993824 - an Iranian male child with a syndromic neurodevelopmental phenotype hemizygouc.979C>T p.Pro327Ser.

PMID: 30471091 - Italian monozygotic male twins with a syndromic neurodevelopmental phenotype hemizygous c.916G>C (p.G306R - inherited from unaffected mother) and functional assay showing altered enzyme activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.277 FSCN1 Zornitza Stark gene: FSCN1 was added
gene: FSCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FSCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FSCN1 were set to 40874942
Phenotypes for gene: FSCN1 were set to Neurodevelopmental disorder, MONDO:0700092, FSCN1-related
Review for gene: FSCN1 was set to RED
Added comment: Two individuals reported from an Iranian cohort with same missense variant, c.665C>A; p.Ala222Asp plus other circumstantial data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.276 TTC1 Zornitza Stark gene: TTC1 was added
gene: TTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TTC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTC1 were set to 40879651
Phenotypes for gene: TTC1 were set to Pontocerebellar hypoplasia, MONDO:0020135, TTC1-related
Review for gene: TTC1 was set to RED
Added comment: Four individuals from two families reported with the same homozygous missense variant, NM_003314.3: c.784 T > G, p.Phe262Val. No other supporting data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.274 MAEA Zornitza Stark gene: MAEA was added
gene: MAEA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAEA were set to 40880485
Phenotypes for gene: MAEA were set to Neurodevelopmental disorder, MONDO:0700092, MAEA-related
Review for gene: MAEA was set to AMBER
Added comment: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.273 CSMD2 Krithika Murali changed review comment from: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature; to: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. In addition, no information about unaffected/affected siblings and segregation testing has been provided

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.273 CDK6 Zornitza Stark Publications for gene: CDK6 were set to 23918663
Intellectual disability syndromic and non-syndromic v1.272 CSMD2 Krithika Murali gene: CSMD2 was added
gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688
Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related
Review for gene: CSMD2 was set to RED
Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.272 CSMD2 Krithika Murali gene: CSMD2 was added
gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688
Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related
Review for gene: CSMD2 was set to RED
Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.267 WDR18 Krithika Murali gene: WDR18 was added
gene: WDR18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDR18 were set to PMID: 40677927
Phenotypes for gene: WDR18 were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: WDR18 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.266 MIS18BP1 Krithika Murali gene: MIS18BP1 was added
gene: MIS18BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MIS18BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MIS18BP1 were set to PMID: 40677927
Phenotypes for gene: MIS18BP1 were set to Cornelia de Lange syndrome (MONDO:0016033)
Review for gene: MIS18BP1 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.265 HYPK Zornitza Stark gene: HYPK was added
gene: HYPK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HYPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HYPK were set to Clinical Genetics Early View
Phenotypes for gene: HYPK were set to Neurodevelopmental disorder, MONDO:0700092, HYPK-related
Review for gene: HYPK was set to RED
Added comment: Single case report - Patel, R. et al 2025 Clinical Genetics Early View

Male proband with developmental delay, autism and facial dysmorphism with a de novo missense HYPK variant (p. R70I). Variant-specific biochemical analyses demonstrates enhanced inhibitory activity of HYPK on NatA-mediated N-terminal protein acetylation.

GestaltMatcher analysis indicates that the proband's facial phenotype closely resembles Ogden syndrome (NAA10) and some resemblance to NAA15-NDS - both associated genes are also involved in the N-terminal acetylation pathway.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.264 DDX39A Zornitza Stark gene: DDX39A was added
gene: DDX39A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX39A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX39A were set to 40726340
Phenotypes for gene: DDX39A were set to Neurodevelopmental disorder, MONDO:0700092, DDX39A-related
Review for gene: DDX39A was set to RED
Added comment: PMID: 40726340 Ahmed et al 2025 (Clinical Genetics) report a 7 month old F with GDD, seizures, microcephaly, hypotonia, corpus callosum thinning and homozygous missense variant (p.Lys137Gln) in DDX39A on trio WES with both non-consanguineous parents confirmed to be heterozygous carriers. DDX39A is involved in mRNA splicing and export. Patient-derived fibroblast studies showed that mutant protein resulted in aberrant nuclear clumping and failure to interact with the TREX complex.

Of note, closely-related paralogue DDX39B is also a component of the TREX complex and has a definitive monoallelic association with neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.263 ARID3A Zornitza Stark gene: ARID3A was added
gene: ARID3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARID3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARID3A were set to 40677927
Phenotypes for gene: ARID3A were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: ARID3A was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.262 PIK3C3 Zornitza Stark gene: PIK3C3 was added
gene: PIK3C3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIK3C3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PIK3C3 were set to 40677927
Phenotypes for gene: PIK3C3 were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: PIK3C3 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.260 GLYAT Zornitza Stark gene: GLYAT was added
gene: GLYAT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GLYAT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLYAT were set to 40747359
Phenotypes for gene: GLYAT were set to Neurodevelopmental disorder, MONDO:0700092, GLYAT-related
Review for gene: GLYAT was set to RED
Added comment: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.258 C1orf109 Zornitza Stark gene: C1orf109 was added
gene: C1orf109 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: C1orf109 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C1orf109 were set to 40760247
Phenotypes for gene: C1orf109 were set to Neurodevelopmental disorder, MONDO:0700092, C1orf109-related
Review for gene: C1orf109 was set to GREEN
Added comment: Cohort of 11 unrelated families, encompassing 18 individuals with bi-allelic variants in C1orf109, 17 liveborn. Affected individuals presented with moderate-to-severe or severe global developmental delay/intellectual disability (17 of 17) and never achieved developmental milestones. Microcephaly and seizures were other common features.

Reduced ribosome activity demonstrated during early brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.256 ASAP2 Zornitza Stark gene: ASAP2 was added
gene: ASAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ASAP2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ASAP2 were set to 40770811; 28191890; 33057194; 35982160
Phenotypes for gene: ASAP2 were set to Neurodevelopmental disorder, MONDO:0700092, ASAP2-related
Review for gene: ASAP2 was set to AMBER
Added comment: One individual reported with compound het missense variants. Identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811. Another individual with biallelic variants identified in the DDD cohort. Several others found with de novo variants through retrospective literature review of large cohort studies reporting multiple gene candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of ASAP2 in brain development. Rated AMBER as only two families with bi-allelic variants and minimal information on the cases with mono-allelic variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.254 RTF1 Zornitza Stark gene: RTF1 was added
gene: RTF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RTF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RTF1 were set to 40770811; 33057194; 35982160; 31038196
Phenotypes for gene: RTF1 were set to Neurodevelopmental disorder, MONDO:0700092, RTF1-related
Review for gene: RTF1 was set to GREEN
Added comment: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 MED29 Sarah Milton gene: MED29 was added
gene: MED29 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED29 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED29 were set to PMID: 40745490
Phenotypes for gene: MED29 were set to Pontocerebellar hypoplasia, MONDO:0020135, MED29-related
Review for gene: MED29 was set to AMBER
Added comment: MED29 encodes part of the mediator (MED) complex which has role in RNA polymerase II (Poll II) gene transcription.

PMID: 40745490 describes 2 siblings from one consanguineous family affected with pontocerebellar hypoplasia, profound GDD, severe microcephaly, cataracts and variable seizures.
Both shared the same homozygous missense variant with presumed LOF mechanism.

No homozygous LOF variants in gnomAD v4.

Extensive functional studies performed with morpholino knockdown of MED29 having marked reduction of GABAergic neurons and abnormal touch response.
Studies of hippocampal neurons from mice with knockdown MED29 showed impaired development.
Mouse embryos that had knockdown of MED29 during development demonstrated abnormal neuronal migration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 CCDC93 Sarah Milton gene: CCDC93 was added
gene: CCDC93 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC93 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC93 were set to PMID: 40601774
Phenotypes for gene: CCDC93 were set to Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related
Review for gene: CCDC93 was set to AMBER
Added comment: CCDC93 encodes the coiled coil domain containing subunit of commander complex involved in recycling of integral membrane proteins.

PMID: 40601774 describes 1 affected individual with compound heterozygous variants in CCDC93 who presented with Ritscher Schinzel like phenotype. Features included hypoplasia of cerebellar hemispheres, hypoplasia of the brainstem and of the corpus callosum, distinctive facial features and multiple small renal cysts.
Variants were missense and nonsense.

No homozygous LOF variants in gnomAD v4.

Some supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 SCN3B Sarah Milton gene: SCN3B was added
gene: SCN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SCN3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCN3B were set to PMID: 40879121
Phenotypes for gene: SCN3B were set to Neurodevelopmental disorder, MONDO:0700092, SCN3B-related
Review for gene: SCN3B was set to AMBER
Added comment: SCN3B Encodes b3 auxiliary subunit of the sodium channel.

4 affected individuals from 2 consanguineous families reported in PMID: 40879121 with biallelic variants in this gene with neurodevelopmental phenotypes. Presentation included GDD, ID of variable severity, autism, seizures.
One variant was nonsense, one canonical splice site in the penultimate exon.

No homozygous LOF variants in gnomAD v4.

Some functional studies performed with loss of function of channel demonstrated for one variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 XPO1 Sangavi Sivagnanasundram gene: XPO1 was added
gene: XPO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: XPO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: XPO1 were set to 40819229
Phenotypes for gene: XPO1 were set to Neurodevelopmental disorder, XPO1-related, MONDO:0700092
Review for gene: XPO1 was set to GREEN
Added comment: Established gene-disease association
22 probands with de novo XPO1 variants presenting with phenotypes associated with NDD (DD, ID, motor delay, behavioral problems, facial dysmorphisms, microcephaly and organ anomalies) along with supportive Drosophila knockdown model reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 ZNF496 Zornitza Stark gene: ZNF496 was added
gene: ZNF496 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF496 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF496 were set to 40806714
Phenotypes for gene: ZNF496 were set to Neurodevelopmental disorder, MONDO:0700092, ZNF496-related
Review for gene: ZNF496 was set to RED
Added comment: Single individual with NDD and de novo LoF variant, no other supportive data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.251 TRIM74 Sangavi Sivagnanasundram gene: TRIM74 was added
gene: TRIM74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRIM74 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRIM74 were set to 40735933
Phenotypes for gene: TRIM74 were set to Neurodevelopmental disorder, TRIM74-related, MONDO:0700092
Review for gene: TRIM74 was set to RED
Added comment: Only one reported case with DD.

PMID: 40735933
5yr M presenting from non consanguineous parents with global developmental delay, hypotonia, seizures, and diffuse cerebral atrophy with mega cisterna magna. Parents of the proband were found to be carriers of the variant.
Homozygous variant c.562C > T (p.Pro121Leu) - NFE AF 0.0188% - rare enough for AR

Supportive functional analysis on human fibroblast showed protein function disruption leading to protein aggregation, proteostasis collapse, and cell death.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.248 TMPRSS7 Zornitza Stark gene: TMPRSS7 was added
gene: TMPRSS7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMPRSS7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMPRSS7 were set to 40796295
Phenotypes for gene: TMPRSS7 were set to Neurodevelopmental disorder, TMPRSS7-related
Review for gene: TMPRSS7 was set to RED
Added comment: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.247 PPP1R2 Zornitza Stark gene: PPP1R2 was added
gene: PPP1R2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP1R2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPP1R2 were set to 40597352; 26558779
Phenotypes for gene: PPP1R2 were set to Neurodevelopmental disorder, PPP1R2-related
Review for gene: PPP1R2 was set to RED
Added comment: Single individual reported with homozygous splicing variant c.403 + 3 A >T. Abnormal splicing demonstrated but leaky. Clinical features included pre and postnatal growth restriction, ventricular septal defect, dysmorphic features (proptosis, long eye lashes, thick eyebrows, low-set ears), microcephaly, sensorineural hearing loss, cortical cataracts, retinal defects, intellectual disability with limited speech, and autism spectrum disorder. Note mouse model is embryonically lethal, leading the authors to speculate survival may be due to fraction of normally spliced transcripts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.245 BORCS5 Zornitza Stark gene: BORCS5 was added
gene: BORCS5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BORCS5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BORCS5 were set to 40385417
Phenotypes for gene: BORCS5 were set to Lysosomal storage disease, MONDO:0002561, BORCS5-related
Review for gene: BORCS5 was set to GREEN
Added comment: preprint PMID 40385417, describing 12 individuals from 7 families with a spectrum of abnormalities (osteopetrosis not mentioned), suggestive of lysosomal disorder.

Homozygous loss-of-function variants presented with prenatally lethal arthrogryposis multiplex congenita, brain malformations, and neuropathological evidence of diffuse neuroaxonal dystrophy. Individuals with missense variants presented differently, with microcephaly, developmental epileptic encephalopathy, intellectual disability, optic atrophy, spasticity, and progressive movement disorders. In this group, brain MRI showed diffuse hypomyelination and progressive global cerebral atrophy, consistent with neurodegeneration. Borcs5 knockout in zebrafish exhibited microcephaly, motor deficits, and seizures, mirroring the patients' clinical presentation. At the cellular level, BORCS5 loss-of-function but not missense variants, resulted in lower protein expression and impaired BORC assembly, paralleled by perinuclear lysosomal clustering. However, both loss-of-function and missense BORCS5 variants were associated with reduced total lysosomal proteolysis, reduced activity of the lysosomal hydrolases glucocerebrosidase and cathepsin B, and presence of multilamellar bodies, indicating lysosomal dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.244 ARNTL Sarah Milton gene: ARNTL was added
gene: ARNTL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARNTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARNTL were set to PMID: 40720646
Phenotypes for gene: ARNTL were set to Neurodevelopmental disorder, MONDO:0700092, BMAL1-related
Review for gene: ARNTL was set to GREEN
Added comment: Note has new HGNC approved name - BMAL1

BMAL1 encodes a transcription factor that plays a role in the mammalian molecular clock, binds to promoter of PER and CRY family genes to promote transcription. Other circardian genes have sleep phase disorder assoc but not neurodevelopmental phenotype.

10 affected individuals described in PMID: 40455867 with variable developmental delay/ID from average IQ to severe ID, seizures in 50%, autism, some had sleep disturbance and marfanoid habitus.
Variants were LOF & missense and very rare or absent in gnomAD v4.
5 confirmed de novo, 2 confirmed inherited (one from apparently unaffected mother).

Functional studies using luciferase reporter assay of downstream target PER showed reduced luminescence for most variants with presumed LOF mechanism. One variant p.(Ile201Thr) led to increased luminescence with author's postulating GOF mechanism for this variant. Drosophilia studies for 2 of the variants demonstrated altered circadian rhythm. ?needs more studies to further define mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.244 MAN2A2 Zornitza Stark Publications for gene: MAN2A2 were set to 36357165
Intellectual disability syndromic and non-syndromic v1.241 CCDC186 Zornitza Stark gene: CCDC186 was added
gene: CCDC186 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC186 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC186 were set to 33259146; 37569695; 40633195
Phenotypes for gene: CCDC186 were set to Neurodevelopmental disorder, MONDO:0700092, CCDC186-related
Review for gene: CCDC186 was set to GREEN
Added comment: At least 3 unrelated families reported with bi-allelic LoF variants and a neurodevelopmental phenotype comprising ID and seizures, plus other more variable features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.240 PCLO Zornitza Stark Publications for gene: PCLO were set to 25832664
Intellectual disability syndromic and non-syndromic v1.237 TAF13 Zornitza Stark Publications for gene: TAF13 were set to 28257693
Intellectual disability syndromic and non-syndromic v1.235 FAAH2 Zornitza Stark Publications for gene: FAAH2 were set to 25885783
Intellectual disability syndromic and non-syndromic v1.220 TBC1D32 Zornitza Stark gene: TBC1D32 was added
gene: TBC1D32 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: TBC1D32 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBC1D32 were set to 24285566; 32573025; 32060556; 31130284; 36826837; 40319332
Phenotypes for gene: TBC1D32 were set to Orofacial digital syndrome type IX, MIM#258865
Review for gene: TBC1D32 was set to GREEN
Added comment: Multiple affected individuals reported from unrelated families. Midline brain abnormalities are a feature and DD/ID is variable.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.218 RNU5B-1 Zornitza Stark Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1
Intellectual disability syndromic and non-syndromic v1.216 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to 40210679
Intellectual disability syndromic and non-syndromic v1.213 ST5 Rylee Peters gene: ST5 was added
gene: ST5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ST5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ST5 were set to 40717498
Phenotypes for gene: ST5 were set to Neurodevelopmental disorder (MONDO:0700092), DENND2B-related
Review for gene: ST5 was set to GREEN
Added comment: HGNC: DENND2B
Cohort of 11 individuals all with a history of motor and/or language developmental delay, intellectual disability in 6/11 (mild to severe), brain structure/function abnormalities were reported in 9/11 patients (7/11 seizures; 5/9 abnormal findings on brain MRI), muscle weakness/hypotonia in 8/9, psychosis in 4/10 patients, symptoms of catatonia in 4/10, other psychiatric/behavioural concerns (anxiety, attention deficit, autism or autistic features) in 10/10.

Total of 10 variants including 2x frameshift/nonsense, 6x missense, 1x splice, 1x single amino acid deletion – all absent from v4 and de novo except 1 inherited from a father with cognitive and psychiatric symptoms and the inframe del which has 2 hets in gnomAD and is inherited an unaffected father (no formal assessment).

In vivo zebrafish modelling measuring cilia length suggests that patient variants tested (9/10 excluding the splice variant) did not induce cilia length shortening, which is consistent with KO models and therefore a loss of function effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.213 BLOC1S1 Rylee Peters changed review comment from: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211
11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1.

The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy (in some cases), and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy.

Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.; to: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211
11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1.

The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy, and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy.

Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.
Intellectual disability syndromic and non-syndromic v1.211 KDM2B Zornitza Stark Publications for gene: KDM2B were set to 36322151
Intellectual disability syndromic and non-syndromic v1.209 SNW1 Lucy Spencer gene: SNW1 was added
gene: SNW1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNW1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SNW1 were set to 40608414
Phenotypes for gene: SNW1 were set to Neurodevelopmental disorder (MONDO:0700092), SNW1-related
Review for gene: SNW1 was set to GREEN
Added comment: cohort of 9 patients with moderate to profound ID, microcephaly, seizures (7/9), facial dysmorphism, and brain malformations (6/9 - corpus callosum hypoplasia, Dandy-Walker malformation).

3 splice, 1 frameshift, 2 missense, 3 in frame deletions, 1 start loss. all but 1 de novo (the last parents not available).

SNW1 is a core component of the spliceosome and facilitates the conformational changes of the spliceosome. Expression of variants in HEK293 cells showed some decreased SNW1 expression while others increased it (including the frameshift), and only the frameshift variant was mislocalised/in the cytoplasm instead of the nucleus. Several of the variants caused loss of binding to PPIL1 or other proteins which SNW1 usually recruits to the spliceosome. All variants in this study were found to either affect protein expression or localization or influence interactions with other proteins in the spliceosome complex suggesting loss of function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.208 CHTF18 Sangavi Sivagnanasundram gene: CHTF18 was added
gene: CHTF18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHTF18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHTF18 were set to 40717333
Phenotypes for gene: CHTF18 were set to complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465
Review for gene: CHTF18 was set to AMBER
Added comment: Only two individuals reported with ID/DD:
1 - 9M with DD, autism and seizures. De novo variant identified - p.Leu355Val
2 - 23month F with congenital bilateral ventriculomegaly status post ventriculoperitoneal shunt placement, epilepsy, right eye optic nerve hypoplasia, hypotonic cerebral palsy complicated by left hip subluxation, and G-tube dependence. De novo variant identified - p.His645Pro
3 - 3F presenting with global DD, hypotonia, seizure and abnormal brain MRI. De novo variant identified - p.Leu676Arg
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.208 SV2A Zornitza Stark Publications for gene: SV2A were set to PMID: 37985816
Intellectual disability syndromic and non-syndromic v1.206 RNU5A-1 Zornitza Stark gene: RNU5A-1 was added
gene: RNU5A-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU5A-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU5A-1 were set to 40379786
Phenotypes for gene: RNU5A-1 were set to Neurodevelopmental disorder (MONDO:0700092), RNU5A-1 related
Review for gene: RNU5A-1 was set to AMBER
Added comment: PMID: 40379786 (2025) - three unrelated individuals with de novo variants in the RNU5A-1 gene (classified as VUS) and a neurodevelopmental disorder. Six individuals with rare de novo variants were identified in total but clinical details were only available for 3/6. Of these three individuals, two harboured the same variant (n.40_41insA) on the maternal allele, while the third individual harboured a different variant (n.39del) but also on the 5′ loop I domain of RNU5A-1. Clinical data showed neurodevelopmental abnormalities (mild ID (2), severe ID (1), epilepsy (2), brain MRI abnormalities (1)) with variable congenital malformations.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.204 BSN Zornitza Stark gene: BSN was added
gene: BSN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: BSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BSN were set to 40393460
Phenotypes for gene: BSN were set to Neurodevelopmental disorder (MONDO:0700092), BSN-related
Review for gene: BSN was set to GREEN
Added comment: Guzman et al 2025: Described 12 additional patients with missense (3/12) and premature termination variants (9/12) which included de novo and inherited variants, suggesting incomplete penetrance.

They assessed all reported patients (n=29) which revealed common clinical characteristics including epilepsy(13/29), febrile seizures (7/29), generalised tonic-clonic seizures (5/29), and focal-onset seizures (3/29). Behavioural phenotypes were present in almost half of all individuals (14/29), which included ADHD (7/29) and autistic behaviour (5/29). Additional common features included developmental delay (11/29), obesity (10/29), and delayed speech (8/29). In adults with BSN PTVs, milder features were common, suggesting phenotypic variability, including a range of individuals without obvious neurodevelopmental features (7/29).
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.198 PDE1B Zornitza Stark gene: PDE1B was added
gene: PDE1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PDE1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDE1B were set to 40492975
Phenotypes for gene: PDE1B were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related
Review for gene: PDE1B was set to GREEN
Added comment: PMID:40492975 reported seven individuals from five unrelated families identified with biallelic PDE1B variants. Three truncating (p.Gln45Ter, p.Gln86Ter, p.Ser298Alafs*6) and three splicing variants (c.594 + 2 T>G, c.735 + 5G>A, c.837-1G>C) were identified from these patients in total. They presented with an early-onset movement disorder characterised by hypotonia in infancy, progressing to ataxia and dystonia in early childhood, with motor and speech delay, and intellectual disability. Functional evidence is also available for these variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.195 FASTKD5 Chirag Patel gene: FASTKD5 was added
gene: FASTKD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FASTKD5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FASTKD5 were set to PMID: 40499538
Phenotypes for gene: FASTKD5 were set to Leigh syndrome MONDO:0009723
Review for gene: FASTKD5 was set to GREEN
Added comment: 3 unrelated individuals with Leigh syndrome (1 x severe/early-onset/fatal, 1 x milder/childhood-onset, 1 x adult-onset). WES identified compound heterozygous variants in FASTKD5 gene (3 x missense variants, 2 x frameshift variants leading to a premature stop codon). The FASTKD5 gene codes for a mitochondrial protein essential for processing mRNAs at non-canonical cleavage sites in the primary mitochondrial transcript.

Analysis of fibroblasts from two subjects showed reduced steady-state levels of FASTKD5 protein by immunoblot, reduced translation of the cytochrome c oxidase subunit 1, impaired assembly of complex IV, and a consequent decrease in cytochrome c oxidase enzymatic activity. The extent of these deficiencies appeared to correlate with the severity of the clinical phenotype. Expression of a wild-type FASTKD5 cDNA, but not cDNAs expressing the missense variants, rescued all the molecular defects in the subjects' fibroblasts, demonstrating that the alleles are pathogenic. 2/3 missense variants resulted in near complete loss of function, while one was hypomorphic, resulting from impaired protein stability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.193 NDUFA4 Sarah Milton gene: NDUFA4 was added
gene: NDUFA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NDUFA4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA4 were set to PMID: 39967265
Phenotypes for gene: NDUFA4 were set to Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065
Review for gene: NDUFA4 was set to GREEN
Added comment: HGNC symbol now COXFA4

Around 10 patients reported in literature thus far with most having developmental delay. Association with hypertrophic cardiomyopathy reported in 3 siblings from a family in PMID: 39967265
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.190 LONP1 Zornitza Stark Publications for gene: LONP1 were set to 31636596
Intellectual disability syndromic and non-syndromic v1.185 LGI1 Krithika Murali gene: LGI1 was added
gene: LGI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LGI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LGI1 were set to PMID:40455867
Phenotypes for gene: LGI1 were set to Developmental and epileptic encephalopathy MONDO:0100062, LGI1-related
Review for gene: LGI1 was set to GREEN
Added comment: PMID: 40455867 report patients with biallelic variants in 6 individuals from 4 consanguineous families with a more severe DEE phenotype. All indivduals had seizures, global dev delay/ID and generalised hypotonia. Four out of five exhibited spasticity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.183 WDR91 Bryony Thompson gene: WDR91 was added
gene: WDR91 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR91 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR91 were set to 32732226; 38041506; 34791078; 40550703; 28860274; 34028500; ClinVar: SCV000965687.1
Phenotypes for gene: WDR91 were set to Complex neurodevelopmental disorder MONDO:0100038
Review for gene: WDR91 was set to GREEN
Added comment: Homozygous LoF variants were identified in at least 5 families with a mainly neurodevelopmental disorder phenotype. Also, supporting mouse models
1. Brain malformation
2. Severe developmental delay, microcephaly, severe microlissencephaly, agenesis of corpus callosum, epilepsy, spastic tetraparesis, laryngomalacia, bicuspid aortic valve, congenital hip dislocation, growth retardation, dysmorphisms
3. Severe microcephaly, dysmorphic features, and organomegaly, along with early onset psychomotor delay, hypotonia, sensorineural hearing impairment, and visual impairment
4. Hygroma, macrocephaly, abnormal ears, unilateral simian crease, hydrocephaly, cerebellar hypoplasia, interventricular
communication
5. Neurodevelopmental disorder with brain malformations and multiple congenital anomalies
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.178 NSUN3 Zornitza Stark gene: NSUN3 was added
gene: NSUN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSUN3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NSUN3 were set to 27356879; 32488845; 40465263
Phenotypes for gene: NSUN3 were set to Combined oxidative phosphorylation deficiency 48, MIM# 619012
Review for gene: NSUN3 was set to GREEN
Added comment: Six families reported. DD/ID can be part of the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.177 SREK1 Sangavi Sivagnanasundram gene: SREK1 was added
gene: SREK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SREK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SREK1 were set to 40549565
Phenotypes for gene: SREK1 were set to Prader-Willi-like syndrome, SREK1-related MONDO:0008300
Review for gene: SREK1 was set to AMBER
Added comment: Three Pakistani probands from three consanguineous families identified with biallelic variants in SREK1. Affected individuals presented with hyperphagic obesity and neurodevelopmental delay. They also presented with psychological and behavioural issues and were phenotypically similar to Prader-Willi affected individuals. ID/DD is a feature in the affected individuals.

Further testing was conducted using human induced pluripotent stem cell (iPSC) -derived neurons followed by RNA sequencing conducted on the neurons.
The results of the assay was suggestive that variants located in the RNA recognition domain (residues 19–96 and 173–256) of SREK1 downregulation of SNORD115 and SNORD116 leading to Prader-Willi-like phenotype however proper validation and controls weren't used.

No relevant mouse models were identified on IMPC (international mouse phenotype consortium) to further support gene-disease association there gene reviewed as Amber.

Variants identified in SREK1 - AF's from gnomADv4.1
P95L - absent in gnomAD v4.1
T194M - EAS PopMax AF - 0.03787% (47 hets)
E601K - SAS PopMax AF - 0.01319% (12 hets)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.176 ADAM23 Sarah Milton gene: ADAM23 was added
gene: ADAM23 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADAM23 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAM23 were set to PMID: 40455867
Phenotypes for gene: ADAM23 were set to Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related
Review for gene: ADAM23 was set to AMBER
Added comment: ADAM23 encodes a transmembrane protein receptor which is a receptor for LGI1. LGI1/ADAM22/ADAM23 form a complex that regulates excitatory synaptic transmission and neuronal excitability in the brain.

1 affected individual described in PMID: 40455867 with severe neonatal seizures, joint contractures, absent reflexes. Noted to have a homozygous NMD predicted variant in ADAM23.
Also had a de novo missense variant in PRKD1.

Knockout ADAM23 mice show early lethal epilepsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.176 SMARCC1 Gemma Edwards gene: SMARCC1 was added
gene: SMARCC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCC1 were set to 29983323; 37285932
Phenotypes for gene: SMARCC1 were set to SMARCC1-associated developmental dysgenesis syndrome (MONDO:0700123)
Review for gene: SMARCC1 was set to GREEN
Added comment: Phenotype expansion since original literature. ClinGen - "SMARCC1-associated developmental dysgenesis syndrome is characterized by developmental delay, cerebral ventriculomegaly, aqueductal stenosis, and other associated structural brain and cardiac defects". See cases in PMIDs 29983323, 37285932.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.175 IKZF2 Zornitza Stark gene: IKZF2 was added
gene: IKZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IKZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: IKZF2 were set to 37316189
Phenotypes for gene: IKZF2 were set to Immunodysregulation, craniofacial anomalies, hearing impairment, athelia, and developmental delay, MIM# 621234
Review for gene: IKZF2 was set to AMBER
Added comment: PMID 37316189: two individuals with de novo variants and syndromic immunodysregulation, including craniofacial anomalies, hearing impairment, athelia, and developmental delay.

Note that variants in this gene are also associated with non-syndromic immune dysregulation and non-syndromic HL. Genotype-phenotype correlation unclear.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.173 ANKS1B Lilian Downie gene: ANKS1B was added
gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: ANKS1B.
Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANKS1B were set to PMID: 31388001; 38129387
Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related
Review for gene: ANKS1B was set to GREEN
Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model.

Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.171 KCNA6 Zornitza Stark gene: KCNA6 was added
gene: KCNA6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNA6 were set to 36318112; 40472070
Phenotypes for gene: KCNA6 were set to Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related
Review for gene: KCNA6 was set to GREEN
Added comment: PMID 36318112: four individuals with de novo variants in this gene and NDD/epilepsy phenotype. Supportive functional data. Additional individual in PMID 40472070 with de novo variant and epilepsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.168 ZBTB7B Zornitza Stark gene: ZBTB7B was added
gene: ZBTB7B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZBTB7B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZBTB7B were set to 40392549
Phenotypes for gene: ZBTB7B were set to Inborn error of immunity, MONDO:0003778, ZBTB7B-related
Review for gene: ZBTB7B was set to AMBER
Added comment: Single patient presented with a complex syndromic phenotype including CID, severe atopy, severe fibroinflammatory interstitial lung disease, corneal vascularization and scarring, sensorineural hearing loss, global developmental delay, and growth failure.

K360N variant is not found in unaffected individuals; functional investigations indicate that K360N exhibits damaging multimorphic effects; and the causal relationship between K360N and the clinical phenotype was confirmed through gene transfer experiments in both T cells and pulmonary fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.164 PTPN1 Zornitza Stark gene: PTPN1 was added
gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTPN1 were set to 39986310
Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related
Review for gene: PTPN1 was set to GREEN
Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.162 WSB2 Krithika Murali gene: WSB2 was added
gene: WSB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WSB2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WSB2 were set to PMID:40374945
Phenotypes for gene: WSB2 were set to Complex neurodevelopmental disorder, MONDO:0100038, WSB2-related
Review for gene: WSB2 was set to GREEN
Added comment: PMID: 40374945 describe 5 individuals from 4 unrelated families with biallelic WSB2 variants and a complex neurodevelopmental disorder. Phenotypic features include:
- Dev delay (all)
- Brain anomalies (4/5 including callosal anomalies and cerebellar hypoplasia)
- Dysmorphic feature
- IUGR/oligohydramnios (3/5)
- Hypotonia (all)
- Microcephaly (3/5)
- Seizures (3/5)

Includes two siblings with biallelic missense variants and shared phenotype. 3 unaffected siblings were heterozygous for the variant or hmz wt. Phenotypic features associated with hmz nonsense/fs variants were more severe than missense.

Supportive mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.161 NKAP Zornitza Stark Mode of inheritance for gene: NKAP was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.160 PRR12 Zornitza Stark Publications for gene: PRR12 were set to 29556724
Intellectual disability syndromic and non-syndromic v1.159 RREB1 Zornitza Stark Publications for gene: RREB1 were set to 32938917; 38332451
Intellectual disability syndromic and non-syndromic v1.158 TAF1C Zornitza Stark Publications for gene: TAF1C were set to 32779182
Intellectual disability syndromic and non-syndromic v1.155 TM2D3 Zornitza Stark gene: TM2D3 was added
gene: TM2D3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TM2D3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TM2D3 were set to 40449487
Phenotypes for gene: TM2D3 were set to Neurodevelopmental disorder, MONDO:0700092, TM2D3-related
Review for gene: TM2D3 was set to GREEN
Added comment: Four individuals from 4 unrelated families identified with biallelic variants in this gene. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.153 SLK Zornitza Stark gene: SLK was added
gene: SLK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLK were set to 40347834
Phenotypes for gene: SLK were set to Neurodevelopmental disorder, MONDO:0700092, SLK-related
Review for gene: SLK was set to GREEN
Added comment: Three affected individuals from three unrelated families reported. Two of the families were consanguineous and homozygous LoF variants were present in the probands. Third individual had compound het missense variants. Functional data from a Drosophila model and transdifferentiated neurons.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.148 MYCBP2 Zornitza Stark edited their review of gene: MYCBP2: Added comment: Concerns about LoF variants in population datasets as well as in individuals undergoing diagnostic testing for a wide variety of unrelated phenotypes: downgrade to RED.; Changed rating: RED
Intellectual disability syndromic and non-syndromic v1.148 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to 24026985
Intellectual disability syndromic and non-syndromic v1.141 SMAD6 Boris Keren gene: SMAD6 was added
gene: SMAD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMAD6 were set to PMID: 32499606
Penetrance for gene: SMAD6 were set to Incomplete
Review for gene: SMAD6 was set to GREEN
Added comment: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.132 FBXO22 Sarah Milton gene: FBXO22 was added
gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXO22 were set to PMID: 40215970
Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related
Review for gene: FBXO22 was set to GREEN
Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases.

14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4).

Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies.

Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.132 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark gene: GAP43 was added
gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GAP43 were set to 39738362
Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related
Review for gene: GAP43 was set to RED
Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities.

The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.130 LSM1 Zornitza Stark Publications for gene: LSM1 were set to PMID: 31010896
Intellectual disability syndromic and non-syndromic v1.127 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Previously referred to as RNU2-2P
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.125 BRF2 Zornitza Stark gene: BRF2 was added
gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRF2 were set to 40229899
Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related
Review for gene: BRF2 was set to GREEN
Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant.

Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID.

Supportive functional data, including animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.121 RAB3A Bryony Thompson gene: RAB3A was added
gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB3A were set to 40166812
Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092
Review for gene: RAB3A was set to GREEN
Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.120 PCNA Sangavi Sivagnanasundram gene: PCNA was added
gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCNA were set to 24911150, 33426167, 36990216
Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309
Review for gene: PCNA was set to AMBER
Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778

Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown.
Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability.
Sources: ClinGen
Intellectual disability syndromic and non-syndromic v1.120 EIF3K Sangavi Sivagnanasundram gene: EIF3K was added
gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF3K were set to 40219605
Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092
Review for gene: EIF3K was set to RED
Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported.

Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%).
The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype.
The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant.
Sources: Other
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID: 40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants.

Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.115 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.113 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.111 FMR1_FXS_CGG Bryony Thompson STR: FMR1_FXS_CGG was added
STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184
Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624
Review for STR: FMR1_FXS_CGG was set to GREEN
STR: FMR1_FXS_CGG was marked as clinically relevant
STR: FMR1_FXS_CGG was marked as current diagnostic
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.109 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.106 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.104 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.101 EEF1D Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321
Intellectual disability syndromic and non-syndromic v1.96 CDKL1 Sarah Milton gene: CDKL1 was added
gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL1 were set to PMID: 40088891
Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related
Mode of pathogenicity for gene: CDKL1 was set to Other
Review for gene: CDKL1 was set to AMBER
Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4).

Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.96 CDKL2 Sarah Milton gene: CDKL2 was added
gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL2 were set to PMID: 40088891
Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related
Penetrance for gene: CDKL2 were set to Complete
Mode of pathogenicity for gene: CDKL2 was set to Other
Review for gene: CDKL2 was set to AMBER
Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion.
2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging.

Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5)

Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.95 MED16 Zornitza Stark Publications for gene: MED16 were set to
Intellectual disability syndromic and non-syndromic v1.93 CELF4 Zornitza Stark gene: CELF4 was added
gene: CELF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF4 were set to 40108438
Phenotypes for gene: CELF4 were set to Neurodevelopmental disorder, MONDO:0700092, CELF4-related
Review for gene: CELF4 was set to GREEN
Added comment: 15 individuals with de novo missense variants clustering in the N-terminal reported, LoF is the likely mechanism. Most individuals presented with neurodevelopmental disorders including global developmental delay/intellectual disability (11/14), seizures (9/15) and overweight/obesity (10/14). Clinical features are similar to the reported celf4-mouse mutant phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.91 SVBP Zornitza Stark Publications for gene: SVBP were set to PMID: 31363758; 30607023
Intellectual disability syndromic and non-syndromic v1.89 CRMP1 Zornitza Stark gene: CRMP1 was added
gene: CRMP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CRMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CRMP1 were set to 36511780; 39758889
Phenotypes for gene: CRMP1 were set to neurodevelopmental disorder, MONDO:0700092, CRMP2-related
Review for gene: CRMP1 was set to GREEN
Added comment: PMID:36511780 reported the identification of three different heterozygous de novo variants in the CRMP1 gene (p.(Pro589Leu), p.(Thr427Met) & p.(Phe351Ser)) in three unrelated individuals with a neurodevelopmental disorder presenting with muscular hypotonia, intellectual disability, and/or autism spectrum disorder. ID was moderate in two of them, while IQ was normal in one. There is also functional evidence available for these variants.

PMID:39758889 reported the identification of a novel heterozygous de novo frameshift variant in CRMP1 (p.(Lys586fs)) in a 9-year-old male patient presenting with phenotypes such as autism, language delay, hyperactivity, and learning disabilities. This patient was reported with moderate ID.

Four individuals with neurodevelopmental disorders and de novo variants in this gene.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.86 EXOSC2 Zornitza Stark Publications for gene: EXOSC2 were set to 26843489; 31628467
Intellectual disability syndromic and non-syndromic v1.84 KMT2C Zornitza Stark Publications for gene: KMT2C were set to
Intellectual disability syndromic and non-syndromic v1.82 MEG3 Zornitza Stark gene: MEG3 was added
gene: MEG3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MEG3 was set to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Publications for gene: MEG3 were set to 33010492; 33746039; 33067531; 38212313
Phenotypes for gene: MEG3 were set to Kagami-Ogata syndrome, MIM# 608149
Review for gene: MEG3 was set to GREEN
Added comment: Small deletions of MAG3 reported in multiple patients as one of the mechanisms of disease.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.79 PPP2R5E Chirag Patel gene: PPP2R5E was added
gene: PPP2R5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP2R5E was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R5E were set to PMID: 39284558
Phenotypes for gene: PPP2R5E were set to Mendelian neurodevelopmental disorder MONDO:0100500
Review for gene: PPP2R5E was set to RED
Added comment: One 20yrs old individual with learning issues, motor coordination disorders, hypotonia (myopathy on EMG), and behavioural issues (mood and emotional dysregulation). WES testing identified a de novo heterozygous missense variant (Glu191Lys) in PPP2R5E gene. The variant was not found in the 4 healthy brothers of the individual. The variant is located within a conserved LFDSEDPRER motif common to all PPP2R5 B-subunits. Biochemical assays demonstrated a decreased interaction with the PP2A A and C subunits, leading to disturbances in holoenzyme formation.

Protein phosphatase 2A (PP2A) is a family of multifunctional enzymatic complexes crucial for cellular signalling, playing a pivotal role in brain function and development. Mutations in specific genes encoding PP2A complexes have been associated with neurodevelopmental disorders with hypotonia and high risk of seizures (e.g. PP2AR-1A, 2B, 3C, 5C, 5D).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.76 CDO1 Zornitza Stark gene: CDO1 was added
gene: CDO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDO1 were set to 39949058
Phenotypes for gene: CDO1 were set to Syndromic disease, MONDO:0002254, CDO1-related
Review for gene: CDO1 was set to AMBER
Added comment: Three children with overlapping features including severe microcephaly and DD/ID. Three missense de novo variants were identified and were clustered around exon 3 and exon 4. The three missense variants identified p.(His147Arg, Ala131Val, Glu143Lys) are all absent from gnomAD v4.1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.74 PHACTR4 Zornitza Stark gene: PHACTR4 was added
gene: PHACTR4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PHACTR4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PHACTR4 were set to 40012205
Phenotypes for gene: PHACTR4 were set to Syndromic disease, MONDO:0002254, PHACTR4-related
Review for gene: PHACTR4 was set to AMBER
Added comment: Two individuals with syndromic disease and de novo missense variants reported together with aggregate information on additional individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.72 C14orf80 Zornitza Stark gene: C14orf80 was added
gene: C14orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: C14orf80.
Mode of inheritance for gene: C14orf80 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C14orf80 were set to 39979680; 38252227
Phenotypes for gene: C14orf80 were set to Primary microcephaly, MONDO:0016660
Review for gene: C14orf80 was set to AMBER
Added comment: New HGNC approved Gene Name: TEDC1
Only two families reported with biallelic variants in this gene - Reports of a supportive functional assay however rated as Amber given that one of the reported families are consanguineous with hmz missense.

PMID: 39979680 - Male sibs from non-consanguineous parents presenting with a range of phenotypes including growth development abnormalities, microcephaly, DD, ID and endocrine insufficiency. The brothers were found to carry chet variants identified in trans [NM_001134877.1 c.[104-5C>G];[787delG] p.[?];[(Ala263LeufsTer29)].
Homozygous zebrafish model recapitulated the human phenotype and is supportive of the loss of function mechanism of disease.

PMID: 38252227 - Iranian consanguineous families identified with a rare biallelic missense variant (Gln269Arg). The affected brothers presented with a range of developmental phenotypes including cognitive impairment and microcephaly.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.70 SPOUT1 Bryony Thompson gene: SPOUT1 was added
gene: SPOUT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPOUT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPOUT1 were set to 39962046
Phenotypes for gene: SPOUT1 were set to complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related
Review for gene: SPOUT1 was set to GREEN
Added comment: Biallelic SPOUT1 variants were identified in 28 individuals with a complex neurodevelopmental disorder from 21 unrelated families. Common phenotypes include microcephaly (18/21), seizures (20/28), intellectual disability (14/14), and varying degrees of developmental delays (28/28). Also, supporting zebrafish model. The suggested name of the disorder is SpADMiSS (SPOUT1 Associated Development delay Microcephaly Seizures Short stature).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.68 DDX39B Sangavi Sivagnanasundram gene: DDX39B was added
gene: DDX39B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX39B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DDX39B were set to 39918047
Phenotypes for gene: DDX39B were set to neurodevelopmental disorder MONDO:0700092, DDX39B-related
Review for gene: DDX39B was set to GREEN
Added comment: Established gene-disease association - ID/DD is a prominent feature in affected individuals.

6 individuals from 5 families with variable neurological and developmental phenotypes including hypotonia, DD, ID and epilepsy.
4 de novo missense variants and 1 inherited splice variant were identified. All variants are absent from gnomAD v4.1.
In vivo functional assay using Drosophila transgenic flies was supportive of a loss of function phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.67 SMARCA1 Zornitza Stark gene: SMARCA1 was added
gene: SMARCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: SMARCA1 were set to 37841849
Phenotypes for gene: SMARCA1 were set to Neurodevelopmental disorder, MONDO:0700092, SMARCA1-related
Review for gene: SMARCA1 was set to GREEN
Added comment: 40 individuals from 30 families with NDD and variants in this gene reported in this preprint, publication imminent
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.65 C12orf66 Zornitza Stark Publications for gene: C12orf66 were set to
Intellectual disability syndromic and non-syndromic v1.62 ARHGEF40 Chirag Patel gene: ARHGEF40 was added
gene: ARHGEF40 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARHGEF40 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARHGEF40 were set to PMID: 39838643
Phenotypes for gene: ARHGEF40 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: ARHGEF40 was set to RED
Added comment: 2 individuals with global developmental delay, hypotonia, short stature, hearing impairment, nystagmus, feeding issues, and dysmorphism (bifid uvula, narrow mouth, high palate, micrognathia). Trio clinical whole exome sequencing identified de novo variants in the ARHGEF40 gene at position p.Arg225, which is fully conserved in mammals and located within the n-terminal keratin binding region (p.Arg225Trp and p.Arg225Gln). Of note, multiple additional probands with rare missense variants at the p.Arg225 residue have been identified by the same laboratory (but there was no consent for publication, providing further evidence of
the importance of this residue.

The ARHGEF40 gene (aka SOLO) is a member of the Rho guanine nucleotide exchange factor (Rho-GEF) family of proteins, which stimulate Rho signal transduction molecules by converting them from inactive GDP-bound form to the active GTP-bound state. No functional studies to characterise disease-gene relationship or disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.59 HECTD1 Chirag Patel gene: HECTD1 was added
gene: HECTD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HECTD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HECTD1 were set to PMID: 39879987
Phenotypes for gene: HECTD1 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: HECTD1 was set to GREEN
Added comment: 14 unrelated individuals (identified through GeneMatcher) with 15 variants of uncertain significance (VUS) in HECTD1 (10 missense, 3 frameshift, 1 nonsense, and 1 splicing variant). Of the 15 different variants in HECTD1, 10 occurred de novo, 3 had unknown inheritance, and 2 were compound heterozygous. All variants were absent in gnomAD, and HECTD1 is highly intolerant to loss-of-function variation (loss-of-function-intolerant score of 1). Clinical presentation was variable developmental delay, intellectual disability, autism spectrum disorder, ADHD, and epilepsy.

The one individual with compound heterozygous variants had growth impairment along with NDD. The variants were inherited from apparently healthy parents, suggesting that genetic or environmental modifiers may be required to develop the phenotype.

Significant enrichment of de novo variants in HECTD1 was also shown in an independent cohort of 53,305 published trios with NDDs or congenital heart disease.

HECT-domain-containing protein 1 (HECTD1) mediates developmental pathways, including cell signalling, gene expression, and embryogenesis. Conditional knockout of Hectd1 in the neural lineage in mice resulted in microcephaly, severe hippocampal malformations, and complete agenesis of the corpus callosum, supporting a role for Hectd1 in embryonic brain development. Functional studies of 2 missense variants and 1 nonsense variant in C. elegans revealed dominant effects, including either change-of-function or loss-of-function/haploinsufficient mechanisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.57 PTPMT1 Bryony Thompson gene: PTPMT1 was added
gene: PTPMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPMT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTPMT1 were set to 39279645; 37672386
Phenotypes for gene: PTPMT1 were set to inborn mitochondrial metabolism disorder MONDO:0004069
Review for gene: PTPMT1 was set to GREEN
Added comment: 6 cases from 3 independent families with biallelic variants in PTPMT1 (a mitochondrial tyrosine phosphatase required for de novo cardiolipin biosynthesis). All cases presented with a complex, neonatal/infantile onset neurological and neurodevelopmental syndrome including developmental delay, microcephaly, facial dysmorphism, epilepsy, spasticity, cerebellar ataxia and nystagmus, sensorineural hearing loss, optic atrophy and bulbar dysfunction. Supporting knockout zebrafish and mouse models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.55 ITGAV Zornitza Stark gene: ITGAV was added
gene: ITGAV was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ITGAV was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ITGAV were set to 39526957
Phenotypes for gene: ITGAV were set to Syndromic disease, MONDO:0002254, ITGAV-related
Review for gene: ITGAV was set to AMBER
Added comment: Three unrelated families reported: two with affected children (one hmz missense; other compound het LoF with missense) and one family with four affected fetuses. Clinical features included brain and eye anomalies and IBD/immune dysregulation. TGF-beta signalling pathway affected. The deletion of itgav in zebrafish recapitulated patient phenotypes including retinal and brain defects and the loss of microglia in early development as well as colitis in juvenile zebrafish with reduced SMAD3 expression and transcriptional regulation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.52 RYBP Zornitza Stark gene: RYBP was added
gene: RYBP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RYBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RYBP were set to 39891528
Phenotypes for gene: RYBP were set to Neurodevelopmental disorder, MONDO:0700092, RYBP-related
Review for gene: RYBP was set to GREEN
Added comment: Seven individuals with heterozygous de novo variants in RYBP reported. Clinical findings include severe developmental delay, dysmorphisms and multiple congenital anomalies. All the single nucleotide variants in RYBP localized to the N-terminal domain of the gene, which encodes the zinc finger domain and ubiquitin binding moiety. Further supportive in vitro and Drosophila functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.47 TRPM7 Zornitza Stark gene: TRPM7 was added
gene: TRPM7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRPM7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRPM7 were set to 35561741; 35712613; 39099563
Phenotypes for gene: TRPM7 were set to Familial primary hypomagnesemia, MONDO:0018100, TRPM7-related
Review for gene: TRPM7 was set to GREEN
Added comment: Protein expressed in the distal tubule, related to TRPM6. Postulated link with hypoMg with secondary hypoCa.
PMID 35561741: two families reported with dominant inheritance. F1: three affected individuals with splicing variant; some supportive functional data. F2: single affected individual, de novo missense variant.
PMID 35712613: de novo missense variant in an individual with hypoMg.
PMID 39099563: three affected individuals with missense variants, all de novo. Probands had DD, two had seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.45 TAOK2 Zornitza Stark gene: TAOK2 was added
gene: TAOK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TAOK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAOK2 were set to 39737487
Phenotypes for gene: TAOK2 were set to neurodevelopmental disorder, MONDO:0700092, TAOK2-related
Review for gene: TAOK2 was set to GREEN
Added comment: PMID:39737487 reported 10 individuals with monoallelic TAOK2 variants and with a neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.42 LRRC45 Zornitza Stark gene: LRRC45 was added
gene: LRRC45 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC45 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LRRC45 were set to 39638757
Phenotypes for gene: LRRC45 were set to Neurodevelopmental disorder MONDO:0700092, LRRC45-related
Review for gene: LRRC45 was set to AMBER
Added comment: Three individuals from two families reported with two homozygous variants, one splice site and the other missense. Features of a neurological ciliopathy with some supportive experimental evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.41 WASHC3 Zornitza Stark gene: WASHC3 was added
gene: WASHC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WASHC3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: WASHC3 were set to DOI: https://doi.org/10.1016/j.gimo.2024.101915
Phenotypes for gene: WASHC3 were set to neurodevelopmental disorder MONDO:0700092, WASHC3 related
Review for gene: WASHC3 was set to RED
Added comment: One family with de novo missense. Two families with homozygous start loss variant. The functional evidence provided does not directly link to the human phenotype. Given two variants and two different MOIs, RED rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.39 NAV3 Zornitza Stark gene: NAV3 was added
gene: NAV3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAV3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAV3 were set to 39708122; 38977784
Phenotypes for gene: NAV3 were set to Neurodevelopmental disorder, MONDO:0700092, NAV3-related
Review for gene: NAV3 was set to GREEN
Added comment: 17 individuals from 11 families reported with bi-allelic variants and neurodevelopmental phenotypes, including DD/ID and behavioural abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.37 EEFSEC Zornitza Stark gene: EEFSEC was added
gene: EEFSEC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EEFSEC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EEFSEC were set to 39753114
Phenotypes for gene: EEFSEC were set to Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related
Review for gene: EEFSEC was set to GREEN
Added comment: Nine individuals from 8 unrelated families reported with bi-allelic variants in this gene and progressive neurodevelopmental disorder manifesting with global developmental delay, progressive spasticity, ataxia, and seizures. Cerebral MRI primarily demonstrated a cerebellar pathology, including hypoplasia and progressive atrophy. In line with the clinical phenotype, an eEFSec-RNAi Drosophila model displays progressive impairment of motor function, which is reflected in the synaptic defects in this model organisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.33 EP400 Sangavi Sivagnanasundram gene: EP400 was added
gene: EP400 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EP400 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EP400 were set to 39708813
Phenotypes for gene: EP400 were set to neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930
Review for gene: EP400 was set to GREEN
Added comment: 6 unrelated probands presenting with epilepsy with NDD (including ID and DD) had compound heterozygous variants in EP400. They were confirmed in trans and inherited from their asymptomatic parents.

Knockdown of EP400 ortholog in Drosophila showed an increase in seizure-like susceptibility and abnormal neurological behaviour.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.33 LRRC8C Sangavi Sivagnanasundram gene: LRRC8C was added
gene: LRRC8C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC8C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: LRRC8C were set to 39623139
Phenotypes for gene: LRRC8C were set to TIMES syndrome MIM#621056
Mode of pathogenicity for gene: LRRC8C was set to Other
Review for gene: LRRC8C was set to AMBER
Added comment: TIMES syndrome is a multisystem disorder characterised by considerable phenotypic variability, but overlapping features include telangiectasia, impaired intellectual development, microcephaly, metaphyseal dysplasia, eye abnormalities, and short stature. Patients exhibit striking cutis marmorata in infancy.

Two individuals from unrelated families presenting with similar features consistent with TIMES syndrome.
Leu400IlefsTer8 and Val390Leu variants were identified however the proposed mechanism of disease is GoF.
Supporting in vitro functional assay was conducted however further evidence is required to upgrade the gene classification.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.32 RICTOR Bryony Thompson gene: RICTOR was added
gene: RICTOR was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RICTOR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RICTOR were set to 39738822
Phenotypes for gene: RICTOR were set to Neurodevelopmental disorder MONDO:0700092, RICTOR-related
Review for gene: RICTOR was set to GREEN
Added comment: 8 unrelated cases presenting with ID and/or developmental delay with de novo or heterozygous variants inherited from one affected parent, including three missense variants, four loss-of-function variants and one 3 kb deletion encompassing RICTOR. Possible gain of function and loss of function mechanism of disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.30 UBR5 Bryony Thompson gene: UBR5 was added
gene: UBR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBR5 were set to 39721588
Phenotypes for gene: UBR5 were set to Neurodevelopmental disorder MONDO:0700092, UBR5-related
Review for gene: UBR5 was set to GREEN
Added comment: 29 individuals with a neurodevelopment syndrome (24 de novo variants) with a core phenotype characterised by developmental delay (26/28), autism (16/26), and intellectual disability (56%). Additionally, some individuals presented with epilepsy/seizures (11/27), movement disorders, and/or genital anomalies (35%). Loss of function is the expected mechanism of disease with functional experiments in C. elegans and in vitro ubiquitination assays.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.26 RUNX1T1 Zornitza Stark Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340
Intellectual disability syndromic and non-syndromic v1.23 RUNX1T1 Chirag Patel gene: RUNX1T1 was added
gene: RUNX1T1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RUNX1T1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RUNX1T1 were set to PMID: 39568205, 19172993, 22644616, 31223340
Phenotypes for gene: RUNX1T1 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: RUNX1T1 was set to GREEN
Added comment: RUNX1T1 encodes a transcription regulator for hematopoietic genes and is well-known for its involvement in hematologic malignancies. Germline RUNX1T1 variants may also play a role in human congenital neurodevelopmental disorders.

PMID: 39568205
3 unrelated individuals with developmental delay, learning disability, ASD, ADHD, and dysmorphism (1 x heart defects). Trio WES identified de novo variants in RUNX1T1 gene (1 x nonsense variant in 5' region [p.Gln36Ter], 2 x missense variants in C-terminus [p.Gly412Arg and p.His521Tyr]).

PMID: 19172993
1 individual with mild-moderate ID and congenital heart disease, and chromosome t(5;8)(q32;q21.3) translocation. Molecular characterization revealed that one of the break points was within the RUNX1T1 gene. Analysis of RUNX1T1 expression in human embryonic and fetal tissues suggests a role of RUNX1T1 in brain and heart development.

PMID: 22644616
1 individual with mild ID and dysmorphism, and de novo deletion exons 3-7 in RUNX1T1.

PMID: 31223340
1 individual with ID, anaemia, atrial septal defect, dysmorphism, and seizures. Found to have a 2.1 Mb deletion at 8q21.3q22.1 involving entire RUNX1T1 gene (and 2 adjacent genes - SLC26A7 and TRIQK), and a benign familial 4.3 Mb duplication at 1p22.1p21.3 (present in unaffected healthy brother).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.21 CAPZA2 Zornitza Stark Publications for gene: CAPZA2 were set to 32338762
Intellectual disability syndromic and non-syndromic v1.18 CCT6A Ain Roesley gene: CCT6A was added
gene: CCT6A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCT6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CCT6A were set to 39480921
Phenotypes for gene: CCT6A were set to neurodevelopmental disorder MONDO:0700092, CCT6A-related
Penetrance for gene: CCT6A were set to Complete
Review for gene: CCT6A was set to GREEN
gene: CCT6A was marked as current diagnostic
Added comment: previously known as CCT6

5x individuals including 4x de novo
3x PTCS + 1x +5C>G + 1x missense

4/5 DD/ID
2/5 visual impairment
2/5 seizures
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.16 TCP1 Ain Roesley gene: TCP1 was added
gene: TCP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TCP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TCP1 were set to 39480921
Phenotypes for gene: TCP1 were set to neurodevelopmental disorder MONDO:0700092, TCP1-related
Penetrance for gene: TCP1 were set to Complete
Review for gene: TCP1 was set to GREEN
gene: TCP1 was marked as current diagnostic
Added comment: previously known as CCT1

8x individuals including 5x de novo
6x PTCs + 2x missense

6/8 DD/ID
2/8 visual impairment
6/8 seizures
6/8 polymicrogyria + 1x Ventriculomegaly, white matter hyperintensities
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.14 CCT3 Ain Roesley gene: CCT3 was added
gene: CCT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CCT3 were set to 39480921
Phenotypes for gene: CCT3 were set to neurodevelopmental disorder MONDO:0700092, CCT3-related
Penetrance for gene: CCT3 were set to Complete
Review for gene: CCT3 was set to GREEN
gene: CCT3 was marked as current diagnostic
Added comment: 4x de novo - 3x PTCs and 1x missense

overlapping phenotypes:
4/4 ID/DD
3/4 visual impairment
2/4 seizures
4/4 Hypomyelination of white matter
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.13 CLASP1 Ain Roesley gene: CLASP1 was added
gene: CLASP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLASP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CLASP1 were set to 39040917
Phenotypes for gene: CLASP1 were set to neurodevelopmental disorder MONDO:0700092, CLASP1-related
Review for gene: CLASP1 was set to RED
gene: CLASP1 was marked as current diagnostic
Added comment: 3 siblings from a consanguineous family, homozygous for p.(Arg1481His)
at birth, all had low weight and microcephaly (< 3-4SD), profound dev delay, spasticity, seizures and lissencephaly

Arg1481His - 3 hets 0 Homs in v4
codon is highly conserved with a high REVEL score 0.83
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.12 GPATCH11 Zornitza Stark Publications for gene: GPATCH11 were set to
Intellectual disability syndromic and non-syndromic v1.10 MGA Zornitza Stark gene: MGA was added
gene: MGA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MGA were set to 39600096; 20044811
Phenotypes for gene: MGA were set to Syndromic disease, MONDO:0002254, MGA-related
Review for gene: MGA was set to GREEN
Added comment: Three individuals with de novo LoF variants reported in individuals with ID and congenital anomalies. Zebrafish model supports role of this transcription factor in organogenesis. Note there are previous, less clear reports of association with NDD/CHD. Gene is constrained for LoF variants in gnomad v4; however, note there are ~30 individuals with LoF variants present. Borderline Green/Amber.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.7 PPP2R2B Bryony Thompson gene: PPP2R2B was added
gene: PPP2R2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP2R2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R2B were set to 25356899; 39565297
Phenotypes for gene: PPP2R2B were set to Neurodevelopmental disorder MONDO:0700092, PPP2R2B-related
Review for gene: PPP2R2B was set to AMBER
Added comment: 5 cases with NDD and heterozygous missense (4/5 confirmed de novo): p.Thr246Lys (unknown inheritance), p.Asn310Lys (confirmed de novo), p.Glu37Lys (confirmed de novo, also had RNU4-2 path de novo Path variant), p.Ile427Thr (confirmed de novo, also had TAOK1 inherited Path variant), p.Arg149Pro (confirmed de novo). 5/5 with intellectual disability and developmental delay, 4/5 with seizures, 2/5 with hearing loss/auditory neuropathy. Study includes in vitro functional assays supporting a possible loss of function mechanism of disease. The 2 missense with additional diagnoses (E37K & I427T) demonstrated a partial reduction in PP2A holoenzyme assembly. Only 3 cases with a possible diagnosis that could be attributed to the PPP2R2B only, and only 2 were confirmed de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.5 WDR47 Bryony Thompson gene: WDR47 was added
gene: WDR47 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR47 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR47 were set to 39609633
Phenotypes for gene: WDR47 were set to Complex neurodevelopmental disorder MONDO:0100038, WDR47-related
Review for gene: WDR47 was set to GREEN
Added comment: 7 cases from 5 unrelated families with biallelic variants and a complex neurodevelopmental syndrome. The most frequent phenotypes were corpus callosum dysgenesis (7/7), microcephaly (7/7), mild to severe intellectual disability (7/7), epilepsy (7/7). Additionally, mouse models recapitulate the human phenotype. Loss of function is the mechanism of disease. Heterozygous parents had no phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.3 PPP5C Lucy Spencer gene: PPP5C was added
gene: PPP5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP5C were set to 35361529; 25363768; 33057194
Phenotypes for gene: PPP5C were set to Neurodevelopmental disorder, MONDO:0700092, PPP5C-related
Review for gene: PPP5C was set to AMBER
Added comment: PMID: 35361529 - reported a de novo missense in a proband with microcephaly, developmental delay and epilepsy. However, after personal communication with the undiagnosed disease network this proband has since been found to have a different diagnosis with a nonsense and a missense in VARS1 identified, so unclear if the PPP5C variant is contributing to their phenotype.

3 more probands with de novo missense variants have been published in large autism or developmental disorder cohort with limited information (PMIDs: 25363768, 33057194)

An internal VCGS proband with intellectual disability and failure to thrive was also found to have a de novo missense variant in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6910 FMR1 Zornitza Stark Publications for gene: FMR1 were set to
Intellectual disability syndromic and non-syndromic v0.6907 HADHA Zornitza Stark Publications for gene: HADHA were set to
Intellectual disability syndromic and non-syndromic v0.6903 PCNT Zornitza Stark Publications for gene: PCNT were set to
Intellectual disability syndromic and non-syndromic v0.6898 PC Zornitza Stark Publications for gene: PC were set to
Intellectual disability syndromic and non-syndromic v0.6895 PAX8 Zornitza Stark Publications for gene: PAX8 were set to
Intellectual disability syndromic and non-syndromic v0.6891 PAX6 Zornitza Stark Publications for gene: PAX6 were set to
Intellectual disability syndromic and non-syndromic v0.6888 PARN Zornitza Stark Publications for gene: PARN were set to
Intellectual disability syndromic and non-syndromic v0.6886 OTX2 Zornitza Stark Phenotypes for gene: OTX2 were changed from to Microphthalmia, syndromic 5, MIM# 610125; Pituitary hormone deficiency, combined, 6, MIM# 613986; Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125; Otocephaly-dysgnathia complex
Intellectual disability syndromic and non-syndromic v0.6885 OTX2 Zornitza Stark Publications for gene: OTX2 were set to
Intellectual disability syndromic and non-syndromic v0.6882 OPA3 Zornitza Stark Publications for gene: OPA3 were set to 25159689; 31119193; 31928268
Intellectual disability syndromic and non-syndromic v0.6881 OPA3 Zornitza Stark Publications for gene: OPA3 were set to
Intellectual disability syndromic and non-syndromic v0.6877 OCLN Zornitza Stark Publications for gene: OCLN were set to
Intellectual disability syndromic and non-syndromic v0.6874 NRAS Zornitza Stark Publications for gene: NRAS were set to
Intellectual disability syndromic and non-syndromic v0.6869 NPHP1 Zornitza Stark Publications for gene: NPHP1 were set to 15138899; 32139166; 28347285; 8852662; 9856524
Intellectual disability syndromic and non-syndromic v0.6868 NPHP1 Zornitza Stark Publications for gene: NPHP1 were set to
Intellectual disability syndromic and non-syndromic v0.6865 NF1 Zornitza Stark Publications for gene: NF1 were set to 23931823; 10762507
Intellectual disability syndromic and non-syndromic v0.6864 NF1 Zornitza Stark Publications for gene: NF1 were set to
Intellectual disability syndromic and non-syndromic v0.6861 NDUFS8 Zornitza Stark Publications for gene: NDUFS8 were set to 23430795; 9837812; 15159508; 22499348; 20818383; 20819849
Intellectual disability syndromic and non-syndromic v0.6860 NDUFS8 Zornitza Stark Publications for gene: NDUFS8 were set to 23430795; 9837812; 15159508; 22499348; 20818383; 20819849
Intellectual disability syndromic and non-syndromic v0.6859 NDUFS8 Zornitza Stark Publications for gene: NDUFS8 were set to
Intellectual disability syndromic and non-syndromic v0.6855 NDUFS4 Zornitza Stark Publications for gene: NDUFS4 were set to
Intellectual disability syndromic and non-syndromic v0.6851 MYCN Zornitza Stark Publications for gene: MYCN were set to
Intellectual disability syndromic and non-syndromic v0.6847 LARS2 Zornitza Stark Publications for gene: LARS2 were set to
Intellectual disability syndromic and non-syndromic v0.6844 LARGE1 Zornitza Stark Publications for gene: LARGE1 were set to
Intellectual disability syndromic and non-syndromic v0.6840 LAMP2 Zornitza Stark Publications for gene: LAMP2 were set to
Intellectual disability syndromic and non-syndromic v0.6839 LAMP2 Zornitza Stark Mode of inheritance for gene: LAMP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6837 KRAS Zornitza Stark Publications for gene: KRAS were set to
Intellectual disability syndromic and non-syndromic v0.6833 KMT2E Zornitza Stark Publications for gene: KMT2E were set to
Intellectual disability syndromic and non-syndromic v0.6829 KAT6B Zornitza Stark Publications for gene: KAT6B were set to
Intellectual disability syndromic and non-syndromic v0.6826 KAT6A Zornitza Stark Publications for gene: KAT6A were set to
Intellectual disability syndromic and non-syndromic v0.6823 INPP5K Zornitza Stark Publications for gene: INPP5K were set to
Intellectual disability syndromic and non-syndromic v0.6820 IKBKG Zornitza Stark Publications for gene: IKBKG were set to
Intellectual disability syndromic and non-syndromic v0.6816 IFT172 Zornitza Stark Publications for gene: IFT172 were set to
Intellectual disability syndromic and non-syndromic v0.6813 IFIH1 Zornitza Stark Publications for gene: IFIH1 were set to
Intellectual disability syndromic and non-syndromic v0.6810 IDUA Zornitza Stark Publications for gene: IDUA were set to 20301341
Intellectual disability syndromic and non-syndromic v0.6809 IDUA Zornitza Stark Publications for gene: IDUA were set to
Intellectual disability syndromic and non-syndromic v0.6806 IDS Zornitza Stark Publications for gene: IDS were set to
Intellectual disability syndromic and non-syndromic v0.6805 IDS Zornitza Stark Mode of inheritance for gene: IDS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6803 IDH2 Zornitza Stark Publications for gene: IDH2 were set to
Intellectual disability syndromic and non-syndromic v0.6800 HTRA2 Zornitza Stark Publications for gene: HTRA2 were set to
Intellectual disability syndromic and non-syndromic v0.6795 HSPD1 Zornitza Stark Publications for gene: HSPD1 were set to
Intellectual disability syndromic and non-syndromic v0.6791 HSD17B10 Zornitza Stark Publications for gene: HSD17B10 were set to
Intellectual disability syndromic and non-syndromic v0.6790 HSD17B10 Zornitza Stark Mode of inheritance for gene: HSD17B10 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6788 HPRT1 Zornitza Stark Publications for gene: HPRT1 were set to
Intellectual disability syndromic and non-syndromic v0.6785 HPD Zornitza Stark Publications for gene: HPD were set to
Intellectual disability syndromic and non-syndromic v0.6782 HOXA1 Zornitza Stark Publications for gene: HOXA1 were set to
Intellectual disability syndromic and non-syndromic v0.6779 HNRNPK Zornitza Stark Publications for gene: HNRNPK were set to
Intellectual disability syndromic and non-syndromic v0.6776 HMGCL Zornitza Stark Publications for gene: HMGCL were set to
Intellectual disability syndromic and non-syndromic v0.6773 HLCS Zornitza Stark Publications for gene: HLCS were set to
Intellectual disability syndromic and non-syndromic v0.6768 HIBCH Zornitza Stark Publications for gene: HIBCH were set to
Intellectual disability syndromic and non-syndromic v0.6764 HEXB Zornitza Stark Publications for gene: HEXB were set to 35420740
Intellectual disability syndromic and non-syndromic v0.6764 HEXB Zornitza Stark Publications for gene: HEXB were set to
Intellectual disability syndromic and non-syndromic v0.6760 HEXA Zornitza Stark Publications for gene: HEXA were set to
Intellectual disability syndromic and non-syndromic v0.6757 HESX1 Zornitza Stark Publications for gene: HESX1 were set to
Intellectual disability syndromic and non-syndromic v0.6754 HEPACAM Zornitza Stark Publications for gene: HEPACAM were set to
Intellectual disability syndromic and non-syndromic v0.6751 HCCS Zornitza Stark Publications for gene: HCCS were set to
Intellectual disability syndromic and non-syndromic v0.6750 HCCS Zornitza Stark Mode of inheritance for gene: HCCS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6749 HCCS Zornitza Stark reviewed gene: HCCS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: linear skin defects with multiple congenital anomalies 1 (MONDO:0024552); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6748 GTF2H5 Zornitza Stark Publications for gene: GTF2H5 were set to
Intellectual disability syndromic and non-syndromic v0.6745 GRM1 Zornitza Stark Publications for gene: GRM1 were set to
Intellectual disability syndromic and non-syndromic v0.6742 GPC3 Zornitza Stark Publications for gene: GPC3 were set to
Intellectual disability syndromic and non-syndromic v0.6741 GPC3 Zornitza Stark Mode of inheritance for gene: GPC3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6739 GNS Zornitza Stark Publications for gene: GNS were set to
Intellectual disability syndromic and non-syndromic v0.6736 GNPTAB Zornitza Stark Publications for gene: GNPTAB were set to
Intellectual disability syndromic and non-syndromic v0.6733 GNPAT Zornitza Stark Publications for gene: GNPAT were set to
Intellectual disability syndromic and non-syndromic v0.6730 GMPPB Zornitza Stark Publications for gene: GMPPB were set to
Intellectual disability syndromic and non-syndromic v0.6727 GMPPA Zornitza Stark Publications for gene: GMPPA were set to
Intellectual disability syndromic and non-syndromic v0.6724 GM2A Zornitza Stark Publications for gene: GM2A were set to
Intellectual disability syndromic and non-syndromic v0.6721 PSPH Ain Roesley Publications for gene: PSPH were set to
Intellectual disability syndromic and non-syndromic v0.6720 PRPS1 Ain Roesley Publications for gene: PRPS1 were set to 24961627
Intellectual disability syndromic and non-syndromic v0.6719 PRPS1 Ain Roesley Publications for gene: PRPS1 were set to
Intellectual disability syndromic and non-syndromic v0.6719 PRPS1 Ain Roesley Mode of inheritance for gene: PRPS1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6718 PRPS1 Ain Roesley reviewed gene: PRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24961627; Phenotypes: PRPS1 deficiency disorder MONDO:0100061; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6718 PRODH Ain Roesley Publications for gene: PRODH were set to 17412540; 12217952
Intellectual disability syndromic and non-syndromic v0.6717 PRODH Ain Roesley Publications for gene: PRODH were set to
Intellectual disability syndromic and non-syndromic v0.6715 PPT1 Ain Roesley Publications for gene: PPT1 were set to
Intellectual disability syndromic and non-syndromic v0.6712 FTSJ1 Zornitza Stark Publications for gene: FTSJ1 were set to
Intellectual disability syndromic and non-syndromic v0.6710 PPP3CA Ain Roesley Publications for gene: PPP3CA were set to
Intellectual disability syndromic and non-syndromic v0.6702 POLR3B Ain Roesley Publications for gene: POLR3B were set to
Intellectual disability syndromic and non-syndromic v0.6699 POLG Ain Roesley Publications for gene: POLG were set to 20301791
Intellectual disability syndromic and non-syndromic v0.6698 POLG Ain Roesley Publications for gene: POLG were set to 20301791
Intellectual disability syndromic and non-syndromic v0.6698 POLG Ain Roesley Publications for gene: POLG were set to
Intellectual disability syndromic and non-syndromic v0.6697 PNPLA6 Ain Roesley Publications for gene: PNPLA6 were set to 25299038
Intellectual disability syndromic and non-syndromic v0.6696 PNPLA6 Ain Roesley Publications for gene: PNPLA6 were set to
Intellectual disability syndromic and non-syndromic v0.6695 PMM2 Ain Roesley Publications for gene: PMM2 were set to 20301289
Intellectual disability syndromic and non-syndromic v0.6694 PMM2 Ain Roesley Publications for gene: PMM2 were set to
Intellectual disability syndromic and non-syndromic v0.6693 PLA2G6 Ain Roesley Publications for gene: PLA2G6 were set to 20301718
Intellectual disability syndromic and non-syndromic v0.6692 PLA2G6 Ain Roesley Publications for gene: PLA2G6 were set to
Intellectual disability syndromic and non-syndromic v0.6691 PIK3CA Ain Roesley Publications for gene: PIK3CA were set to 23946963
Intellectual disability syndromic and non-syndromic v0.6690 PIK3CA Ain Roesley Publications for gene: PIK3CA were set to
Intellectual disability syndromic and non-syndromic v0.6689 PHGDH Ain Roesley Publications for gene: PHGDH were set to 37347880
Intellectual disability syndromic and non-syndromic v0.6688 PHGDH Ain Roesley Publications for gene: PHGDH were set to
Intellectual disability syndromic and non-syndromic v0.6687 PEX7 Ain Roesley Publications for gene: PEX7 were set to 20301447
Intellectual disability syndromic and non-syndromic v0.6686 PEX7 Ain Roesley Publications for gene: PEX7 were set to
Intellectual disability syndromic and non-syndromic v0.6685 PEX6 Ain Roesley Publications for gene: PEX6 were set to
Intellectual disability syndromic and non-syndromic v0.6683 PEX5 Ain Roesley Publications for gene: PEX5 were set to 20301621
Intellectual disability syndromic and non-syndromic v0.6682 PEX5 Ain Roesley Publications for gene: PEX5 were set to
Intellectual disability syndromic and non-syndromic v0.6681 PEX3 Ain Roesley Publications for gene: PEX3 were set to
Intellectual disability syndromic and non-syndromic v0.6679 PEX26 Ain Roesley Publications for gene: PEX26 were set to
Intellectual disability syndromic and non-syndromic v0.6678 PEX2 Ain Roesley Publications for gene: PEX2 were set to 20301621
Intellectual disability syndromic and non-syndromic v0.6677 PEX2 Ain Roesley Publications for gene: PEX2 were set to
Intellectual disability syndromic and non-syndromic v0.6675 PEX19 Ain Roesley Publications for gene: PEX19 were set to
Intellectual disability syndromic and non-syndromic v0.6673 PEX16 Ain Roesley Publications for gene: PEX16 were set to
Intellectual disability syndromic and non-syndromic v0.6672 PEX14 Ain Roesley Publications for gene: PEX14 were set to 37493040; 20301621
Intellectual disability syndromic and non-syndromic v0.6671 PEX14 Ain Roesley Publications for gene: PEX14 were set to
Intellectual disability syndromic and non-syndromic v0.6669 PEX13 Ain Roesley Publications for gene: PEX13 were set to
Intellectual disability syndromic and non-syndromic v0.6667 PEX12 Ain Roesley Publications for gene: PEX12 were set to
Intellectual disability syndromic and non-syndromic v0.6665 TSHZ3 Bryony Thompson gene: TSHZ3 was added
gene: TSHZ3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TSHZ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TSHZ3 were set to 27668656; 34919690; 36553458; 39420202
Phenotypes for gene: TSHZ3 were set to congenital anomaly of kidney and urinary tract MONDO:0019719
Review for gene: TSHZ3 was set to AMBER
Added comment: More evidence for the gene-disease association is required
PMID: 27668656 - TSHZ3 is included in the region deleted in chromosome 19q13.11 Deletion Syndrome, which includes intellectual disability and behavioural issues, congenital anomalies of the kidney and urinary tract (CAKUT)
PMID: 34919690 - haploinsufficient mouse model leads to kidney defects
PMID: 36553458 - heterozygous frameshift variant c.119_120dup p.Pro41SerfsTer79 in a case with intellectual disability, behavioural issues, pyelocaliceal dilatation, and mild urethral stenosis.
PMID: 39420202 - 12 CAKUT patients from 9/301 (3%) families carried 5 different rare heterozygous TSHZ3 missense variants. However, 1 of the variants (p.Ser58Gly) present in 5 of the families is more common in gnomAD v4.1 than you would expect for a dominant disease including 5 homozygotes (1,408/1,612,114 alleles, 5 hom, AF=0.0008734). The authors state this is not unexpected in a condition, such as CAKUT. However, the different missense variants are inherited from unaffected parents in at least 2/9 families (there was no phenotype information available for an additional 3 parents).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6663 WDR83OS Bryony Thompson gene: WDR83OS was added
gene: WDR83OS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR83OS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR83OS were set to 39471804; 30250217
Phenotypes for gene: WDR83OS were set to complex neurodevelopmental disorder MONDO:0100038; neurodevelopmental disorder with hypercholanemia
Review for gene: WDR83OS was set to GREEN
Added comment: Now 14 cases from 9 unrelated families with homozygous LoF variants, including the family reported in 2019. Consistent clinical features include NDD (14/14), facial dysmorphism (13/14), intractable itching (9/14), and elevated bile acids (5/6). Also, supporting null zebrafish model that recapitulates the human phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6661 GON4L Bryony Thompson gene: GON4L was added
gene: GON4L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GON4L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON4L were set to 39500882; 21937992
Phenotypes for gene: GON4L were set to complex neurodevelopmental disorder MONDO:0100038
Review for gene: GON4L was set to GREEN
Added comment: 2 LoF variants in 4 cases from 3 unrelated consanguineous families, and supporting null zebrafish model
PMID: 39500882 - 2 homozygous truncating GON4L variants [NM_001282860.2: c.62_63del, p.(Gln21Argfs*12) and c.5517+1G>A] in 3 patients from 2 consanguineous families with prenatal-onset growth impairment, developmental delay, mild intellectual disability, speech impairment, progressive and disproportionate microcephaly, facial asymmetry, congenital heart anomaly, and brain structure abnormalities.
Null zebrafish model had distinct morphological and size abnormalities in the craniofacial cartilage of zebrafish larvae
Heterozygous carriers in biallelic families were unaffected
PMID: 21937992 - a case from Iran from a consanguineous family homozygous for c.5517+1G>A with syndromic ID. No other clinical details provided
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6660 SGSM3 Zornitza Stark Publications for gene: SGSM3 were set to PMID: 37833060
Intellectual disability syndromic and non-syndromic v0.6658 UBTF Zornitza Stark Phenotypes for gene: UBTF were changed from Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701 to Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701; Neurodevelopmental disorder, MONDO:0700092, UBTF-related
Intellectual disability syndromic and non-syndromic v0.6657 UBTF Zornitza Stark Publications for gene: UBTF were set to 28777933; 29300972
Intellectual disability syndromic and non-syndromic v0.6654 BHLHE22 Zornitza Stark gene: BHLHE22 was added
gene: BHLHE22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BHLHE22 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: BHLHE22 were set to 39502664
Phenotypes for gene: BHLHE22 were set to Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related
Review for gene: BHLHE22 was set to GREEN
Added comment: Four individuals with de novo missense variants within the highly conserved helix-loop-helix domain and seven individuals from five unrelated families with a recurrent homozygous frameshift variant, p.(Gly74Alafs*18).

Individuals presented with absent or limited speech, severely impaired motor abilities, intellectual disability (ID), involuntary movements, autistic traits with stereotypies, abnormal muscle tone. The majority of individuals had partial or complete agenesis of the corpus callosum (ACC). Additional symptoms comprised epilepsy, variable dysmorphic features, and eye anomalies. One additional individual had spastic paraplegia without delayed development and ACC, expanding the phenotype to milder and later onset forms.

Mice lacking bhlhe22 show nearly complete loss of three brain comminsure, including the corpus callosum.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6652 MRPL49 Zornitza Stark gene: MRPL49 was added
gene: MRPL49 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRPL49 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MRPL49 were set to 39417135
Phenotypes for gene: MRPL49 were set to Mitochondrial disease, MONDO:0044970, MRPL49-related
Review for gene: MRPL49 was set to GREEN
Added comment: Five unrelated families with presentations ranging from Perrault syndrome (primary ovarian insufficiency and sensorineural hearing loss) to severe childhood onset of leukodystrophy, learning disability, microcephaly and retinal dystrophy and bi-allelic variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6651 PEX11B Ain Roesley Publications for gene: PEX11B were set to 28129423; 22581968
Intellectual disability syndromic and non-syndromic v0.6649 PEX11B Ain Roesley Publications for gene: PEX11B were set to
Intellectual disability syndromic and non-syndromic v0.6647 PEX10 Ain Roesley Publications for gene: PEX10 were set to 20301621
Intellectual disability syndromic and non-syndromic v0.6646 PEX10 Ain Roesley Publications for gene: PEX10 were set to
Intellectual disability syndromic and non-syndromic v0.6645 PEX1 Ain Roesley Publications for gene: PEX1 were set to
Intellectual disability syndromic and non-syndromic v0.6644 PEPD Ain Roesley Publications for gene: PEPD were set to 26110198; 32455636
Intellectual disability syndromic and non-syndromic v0.6643 PEPD Ain Roesley Publications for gene: PEPD were set to
Intellectual disability syndromic and non-syndromic v0.6640 PDSS2 Ain Roesley Publications for gene: PDSS2 were set to
Intellectual disability syndromic and non-syndromic v0.6637 PDHX Ain Roesley Publications for gene: PDHX were set to
Intellectual disability syndromic and non-syndromic v0.6636 PDHA1 Ain Roesley Publications for gene: PDHA1 were set to 23021068
Intellectual disability syndromic and non-syndromic v0.6635 PDHA1 Ain Roesley Publications for gene: PDHA1 were set to
Intellectual disability syndromic and non-syndromic v0.6635 PDHA1 Ain Roesley Mode of inheritance for gene: PDHA1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6634 PDHA1 Ain Roesley reviewed gene: PDHA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23021068; Phenotypes: Pyruvate dehydrogenase E1-alpha deficiency MIM#312170; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6634 PDGFRB Ain Roesley Publications for gene: PDGFRB were set to 31710779; 35221873
Intellectual disability syndromic and non-syndromic v0.6633 PDGFRB Ain Roesley Publications for gene: PDGFRB were set to
Intellectual disability syndromic and non-syndromic v0.6632 PCCB Ain Roesley Publications for gene: PCCB were set to 22593918
Intellectual disability syndromic and non-syndromic v0.6631 PCCB Ain Roesley Publications for gene: PCCB were set to
Intellectual disability syndromic and non-syndromic v0.6631 PCCA Ain Roesley Publications for gene: PCCA were set to 22593918
Intellectual disability syndromic and non-syndromic v0.6631 PCDH19 Ain Roesley Publications for gene: PCDH19 were set to 28669061
Intellectual disability syndromic and non-syndromic v0.6630 PCCA Ain Roesley Publications for gene: PCCA were set to
Intellectual disability syndromic and non-syndromic v0.6630 PCDH19 Ain Roesley Publications for gene: PCDH19 were set to
Intellectual disability syndromic and non-syndromic v0.6628 MARK2 Chirag Patel gene: MARK2 was added
gene: MARK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MARK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MARK2 were set to PMID: 39419027, 39436150
Phenotypes for gene: MARK2 were set to Neurodevelopmental disorder MONDO:0700092
Review for gene: MARK2 was set to GREEN
Added comment: 31 individuals with autism spectrum disorder (30/31), intellectual disability/developmental delay (100%), motor delay (62%), speech-language problems (100%), seizure/epilepsy (46%), behaviour disorders (ADHD, aggression, anxiety)(74%), and distinctive facial features (narrow face, abnormal or broad forehead, downslanting palpebral fissures, and large or dysplastic ears).

WES/WGS identified 25 LOF and 6 missense variants in MARK2 gene (Microtubule affinity-regulating kinase 2) which contributes to establishing neuronal polarity and developing dendritic spines. LOF variants were de novo (16/25), inherited (4/25), or unk (5/25). All 6 missense variants were de novo and clustered in the kinase or KA1 domains.

The mRNA and protein expression of MARK2 in PBMCs were significantly lower in affected individuals with LOF variants than in the control group. In vitro expression assay of missense variants supported the effect of MARK2 loss. Proband-derived and CRISPR-engineered isogenic induced pluripotent stem cells (iPSCs) showed MARK2 loss leads to early neuronal developmental and functional deficits, including anomalous polarity and disorganization in neural rosettes, as well as imbalanced proliferation and differentiation in neural progenitor cells (NPCs). Mark2+/- mice showed abnormal cortical formation and partition and ASD-like behaviour. Through the use of RNA sequencing (RNA-seq) and lithium treatment, they linked MARK2 loss to downregulation of the WNT/β-catenin signaling pathway and identified lithium as a potential drug for treating MARK2-associated ASD.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6626 LINC01578 Zornitza Stark gene: LINC01578 was added
gene: LINC01578 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: LINC01578.
Mode of inheritance for gene: LINC01578 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LINC01578 were set to 39442041
Phenotypes for gene: LINC01578 were set to Neurodevelopmental disorder, MONDO:0700092, CHASERR-related
Review for gene: LINC01578 was set to GREEN
Added comment: CHASERR encodes a human long noncoding RNA (lncRNA) adjacent to CHD2, a coding gene in which de novo loss-of-function variants cause developmental and epileptic encephalopathy. Three unrelated children reported with a syndromic, early-onset neurodevelopmental disorder, each of whom had a de novo deletion in the CHASERR locus. The children had severe encephalopathy, shared facial dysmorphisms, cortical atrophy, and cerebral hypomyelination - a phenotype that is distinct from the phenotypes of patients with CHD2 haploinsufficiency. CHASERR deletion results in increased CHD2 protein abundance in patient-derived cell lines and increased expression of the CHD2 transcript in cis, indicating bidirectional dosage sensitivity in human disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6623 RNU5B-1 Zornitza Stark gene: RNU5B-1 was added
gene: RNU5B-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU5B-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1
Review for gene: RNU5B-1 was set to GREEN
Added comment: 20 individuals reported in two preprints with de novo variants in this gene and a neurodevelopmental phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6620 KCNJ11 Zornitza Stark Phenotypes for gene: KCNJ11 were changed from to {Diabetes mellitus, type 2, susceptibility to} 125853; Diabetes mellitus, transient neonatal, 3 610582; Diabetes, permanent neonatal, with or without neurologic features 606176; Hyperinsulinemic hypoglycemia, familial, 2 601820; Maturity-onset diabetes of the young, type 13 616329 AD
Intellectual disability syndromic and non-syndromic v0.6617 YAP1 Zornitza Stark Publications for gene: YAP1 were set to
Intellectual disability syndromic and non-syndromic v0.6614 SUOX Zornitza Stark Publications for gene: SUOX were set to
Intellectual disability syndromic and non-syndromic v0.6611 SPTBN2 Zornitza Stark Publications for gene: SPTBN2 were set to
Intellectual disability syndromic and non-syndromic v0.6604 ANKRD31 Megan Ball gene: ANKRD31 was added
gene: ANKRD31 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ANKRD31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANKRD31 were set to 27541642
Review for gene: ANKRD31 was set to RED
Added comment: 1 individual with Rett-like phenotype. De novo missense. C.196A>T, p.Ile66Phe. Onset of features at 3 years, delayed ambulation, epilepsy, developmental regression, stereotypies, non-verbal. 17 years old at time of publication. A C.elegans model of ANKRD31 with a deletion showed significantly defective locomotion and asymmetric dynamics of axonal and dendritic microtubule defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6603 SLC35A2 Zornitza Stark Publications for gene: SLC35A2 were set to
Intellectual disability syndromic and non-syndromic v0.6602 SLC35A2 Zornitza Stark Mode of inheritance for gene: SLC35A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6601 SLC35A2 Zornitza Stark reviewed gene: SLC35A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23561849, 24115232, 27743886, 25778940, 33407896; Phenotypes: Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854, Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6601 SLC33A1 Zornitza Stark Publications for gene: SLC33A1 were set to 31194315
Intellectual disability syndromic and non-syndromic v0.6600 SLC33A1 Zornitza Stark Publications for gene: SLC33A1 were set to
Intellectual disability syndromic and non-syndromic v0.6598 SLC2A1 Zornitza Stark Phenotypes for gene: SLC2A1 were changed from to GLUT1-deficiency syndrome, MONDO:0000188; Dystonia 9 601042; GLUT1 deficiency syndrome 1, infantile onset, severe 606777; GLUT1 deficiency syndrome 2, childhood onset 612126; Stomatin-deficient cryohydrocytosis with neurologic defects 608885
Intellectual disability syndromic and non-syndromic v0.6597 SLC2A1 Zornitza Stark Publications for gene: SLC2A1 were set to
Intellectual disability syndromic and non-syndromic v0.6595 SLC2A1 Zornitza Stark reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32913944; Phenotypes: GLUT1-deficiency syndrome, MONDO:0000188, Dystonia 9 601042, GLUT1 deficiency syndrome 1, infantile onset, severe 606777, GLUT1 deficiency syndrome 2, childhood onset 612126, Stomatin-deficient cryohydrocytosis with neurologic defects 608885; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6594 SLC25A22 Zornitza Stark Publications for gene: SLC25A22 were set to
Intellectual disability syndromic and non-syndromic v0.6590 SLC25A12 Zornitza Stark Publications for gene: SLC25A12 were set to
Intellectual disability syndromic and non-syndromic v0.6587 SLC17A5 Zornitza Stark Publications for gene: SLC17A5 were set to
Intellectual disability syndromic and non-syndromic v0.6584 SLC12A6 Zornitza Stark Publications for gene: SLC12A6 were set to
Intellectual disability syndromic and non-syndromic v0.6580 AJAP1 Zornitza Stark gene: AJAP1 was added
gene: AJAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AJAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AJAP1 were set to 38985877
Phenotypes for gene: AJAP1 were set to neurodevelopmental disorder, MONDO:0700092, AJAP1-related
Review for gene: AJAP1 was set to GREEN
Added comment: PMID:38985877 reported five unrelated individuals with monoallelic variants or a deletion in AJAP1 gene and they presented with epilepsy, neurodevelopmental problems, or intellectual disability. There is also supporting functional evidence available.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6577 KIF5A Zornitza Stark Publications for gene: KIF5A were set to 18853458
Intellectual disability syndromic and non-syndromic v0.6576 KIF5A Zornitza Stark Publications for gene: KIF5A were set to
Intellectual disability syndromic and non-syndromic v0.6570 KIF7 Zornitza Stark Publications for gene: KIF7 were set to
Intellectual disability syndromic and non-syndromic v0.6567 KLHL7 Zornitza Stark Publications for gene: KLHL7 were set to 27392078; 30142437; 29074562
Intellectual disability syndromic and non-syndromic v0.6566 KLHL7 Zornitza Stark Publications for gene: KLHL7 were set to
Intellectual disability syndromic and non-syndromic v0.6563 L2HGDH Zornitza Stark Publications for gene: L2HGDH were set to
Intellectual disability syndromic and non-syndromic v0.6559 LAMA1 Zornitza Stark Publications for gene: LAMA1 were set to
Intellectual disability syndromic and non-syndromic v0.6553 ISPD Zornitza Stark Publications for gene: ISPD were set to 23288328
Intellectual disability syndromic and non-syndromic v0.6552 ISPD Zornitza Stark Publications for gene: ISPD were set to
Intellectual disability syndromic and non-syndromic v0.6548 DHRSX Zornitza Stark gene: DHRSX was added
gene: DHRSX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DHRSX was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DHRSX were set to 38821050
Phenotypes for gene: DHRSX were set to congenital disorder of glycosylation, MONDO:0015286, DHRSX-related
Added comment: PMID:38821050 reported the identification of biallelic missense variants in DHRSX gene in four patients from three unrelated families with a congenital disorder of glycosylation. They displayed distinct facial features, severe neurological involvement including hypotonia, scoliosis, contractures, profound intellectual disability, epilepsy, and sensorineural hearing loss. These patients also experienced severe failure to thrive (requiring tube feeding); variable respiratory insufficiency; and involvement of the eyes, the gastrointestinal system, and other organs.

Gene located in PAR.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6546 ITPR1 Zornitza Stark Publications for gene: ITPR1 were set to 27108797; 27108798; 15623688; 22986007; 28488678
Intellectual disability syndromic and non-syndromic v0.6545 ITPR1 Zornitza Stark Publications for gene: ITPR1 were set to
Intellectual disability syndromic and non-syndromic v0.6542 IVD Zornitza Stark Publications for gene: IVD were set to
Intellectual disability syndromic and non-syndromic v0.6540 KCNT1 Zornitza Stark Phenotypes for gene: KCNT1 were changed from to Developmental and epileptic encephalopathy MIM#614959; childhood-onset epilepsy syndrome MONDO:0020072
Intellectual disability syndromic and non-syndromic v0.6539 KCNT1 Zornitza Stark Publications for gene: KCNT1 were set to
Intellectual disability syndromic and non-syndromic v0.6535 KCTD7 Zornitza Stark Publications for gene: KCTD7 were set to
Intellectual disability syndromic and non-syndromic v0.6532 KDM6A Zornitza Stark Publications for gene: KDM6A were set to
Intellectual disability syndromic and non-syndromic v0.6531 KDM6A Zornitza Stark Mode of inheritance for gene: KDM6A was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6530 KIAA0586 Zornitza Stark Publications for gene: KIAA0586 were set to
Intellectual disability syndromic and non-syndromic v0.6528 KCNT1 Sangavi Sivagnanasundram reviewed gene: KCNT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23086397, 24029078; Phenotypes: childhood-onset epilepsy syndrome MONDO:0020072; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6527 BORCS8 Zornitza Stark Phenotypes for gene: BORCS8 were changed from Neurodevelopmental disorder (MONDO#0700092), BORCS8-related to Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987
Intellectual disability syndromic and non-syndromic v0.6526 BORCS8 Zornitza Stark reviewed gene: BORCS8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6525 GLYCTK Bryony Thompson Publications for gene: GLYCTK were set to
Intellectual disability syndromic and non-syndromic v0.6521 GLI3 Bryony Thompson Publications for gene: GLI3 were set to
Intellectual disability syndromic and non-syndromic v0.6518 GLI2 Bryony Thompson Publications for gene: GLI2 were set to
Intellectual disability syndromic and non-syndromic v0.6515 GLDC Bryony Thompson Publications for gene: GLDC were set to
Intellectual disability syndromic and non-syndromic v0.6512 GLB1 Bryony Thompson Publications for gene: GLB1 were set to
Intellectual disability syndromic and non-syndromic v0.6509 GK Bryony Thompson Publications for gene: GK were set to
Intellectual disability syndromic and non-syndromic v0.6505 GJC2 Bryony Thompson Publications for gene: GJC2 were set to
Intellectual disability syndromic and non-syndromic v0.6502 GFM1 Bryony Thompson Publications for gene: GFM1 were set to
Intellectual disability syndromic and non-syndromic v0.6499 SLC12A5 Zornitza Stark Publications for gene: SLC12A5 were set to
Intellectual disability syndromic and non-syndromic v0.6496 SC5D Zornitza Stark Publications for gene: SC5D were set to
Intellectual disability syndromic and non-syndromic v0.6485 RNASET2 Zornitza Stark Marked gene: RNASET2 as ready
Intellectual disability syndromic and non-syndromic v0.6485 RNASET2 Zornitza Stark Gene: rnaset2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.6485 RNASET2 Zornitza Stark Phenotypes for gene: RNASET2 were changed from to Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951
Intellectual disability syndromic and non-syndromic v0.6484 RNASET2 Zornitza Stark Publications for gene: RNASET2 were set to
Intellectual disability syndromic and non-syndromic v0.6483 RNASET2 Zornitza Stark Mode of inheritance for gene: RNASET2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6482 RNASET2 Zornitza Stark edited their review of gene: RNASET2: Added comment: More than 10 families reported, DD/ID is part of the phenotype.; Changed publications: 31349848, 19525954, 27091087, 29336640, 18545798, 15851732
Intellectual disability syndromic and non-syndromic v0.6482 RNASET2 Zornitza Stark reviewed gene: RNASET2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.6475 RMND1 Zornitza Stark Publications for gene: RMND1 were set to
Intellectual disability syndromic and non-syndromic v0.6472 RIT1 Zornitza Stark Publications for gene: RIT1 were set to
Intellectual disability syndromic and non-syndromic v0.6467 RARS2 Zornitza Stark Publications for gene: RARS2 were set to
Intellectual disability syndromic and non-syndromic v0.6464 IPO8 Zornitza Stark gene: IPO8 was added
gene: IPO8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IPO8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IPO8 were set to 34010604; 33875846; 34010605
Phenotypes for gene: IPO8 were set to Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472; Loeys-Dietz syndrome-like; cardiovascular, neurologic, skeletal and immunologic abnormalities
Review for gene: IPO8 was set to GREEN
Added comment: There are 35 unrelated cases with a IPO8 variant, 4/35 with mild ID, 1/35 with severe ID and 7 global developmental delay. There is a further case with severe ID, but the patient also has a 1.779Mb deletion in 19q13.4, which could be responsible for the ID (PMID: 34010605).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6463 PRKACB Zornitza Stark Publications for gene: PRKACB were set to 33058759
Intellectual disability syndromic and non-syndromic v0.6459 RAF1 Zornitza Stark Publications for gene: RAF1 were set to
Intellectual disability syndromic and non-syndromic v0.6455 RAB18 Zornitza Stark Publications for gene: RAB18 were set to
Intellectual disability syndromic and non-syndromic v0.6452 PYCR1 Zornitza Stark Publications for gene: PYCR1 were set to
Intellectual disability syndromic and non-syndromic v0.6449 PUS1 Zornitza Stark Publications for gene: PUS1 were set to
Intellectual disability syndromic and non-syndromic v0.6443 PTPN11 Zornitza Stark Publications for gene: PTPN11 were set to
Intellectual disability syndromic and non-syndromic v0.6439 PTF1A Zornitza Stark Publications for gene: PTF1A were set to
Intellectual disability syndromic and non-syndromic v0.6435 PTDSS1 Zornitza Stark Publications for gene: PTDSS1 were set to
Intellectual disability syndromic and non-syndromic v0.6429 KBTBD2 Zornitza Stark gene: KBTBD2 was added
gene: KBTBD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KBTBD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KBTBD2 were set to 39313616
Phenotypes for gene: KBTBD2 were set to neurodevelopmental disorder MONDO:0700092, KBTBD2-related
Review for gene: KBTBD2 was set to GREEN
Added comment: 3 families - 2 compound hets and 1 hom

phenotypes include:
Microcephaly, hypotonia, failure to thrive, IUGR, delayed gross motor development, dysmorphism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6427 MAP2K1 Zornitza Stark Publications for gene: MAP2K1 were set to 16439621; 17551924; 18042262; 20301365
Intellectual disability syndromic and non-syndromic v0.6426 MAP2K1 Zornitza Stark Publications for gene: MAP2K1 were set to
Intellectual disability syndromic and non-syndromic v0.6420 MAP2K2 Zornitza Stark Publications for gene: MAP2K2 were set to
Intellectual disability syndromic and non-syndromic v0.6417 MAT1A Zornitza Stark Publications for gene: MAT1A were set to
Intellectual disability syndromic and non-syndromic v0.6414 MBOAT7 Zornitza Stark Publications for gene: MBOAT7 were set to
Intellectual disability syndromic and non-syndromic v0.6411 MKKS Zornitza Stark Publications for gene: MKKS were set to
Intellectual disability syndromic and non-syndromic v0.6408 MKS1 Zornitza Stark Publications for gene: MKS1 were set to
Intellectual disability syndromic and non-syndromic v0.6405 MLC1 Zornitza Stark Publications for gene: MLC1 were set to
Intellectual disability syndromic and non-syndromic v0.6402 MMAA Zornitza Stark Publications for gene: MMAA were set to
Intellectual disability syndromic and non-syndromic v0.6399 MMAB Zornitza Stark Publications for gene: MMAB were set to
Intellectual disability syndromic and non-syndromic v0.6396 MMADHC Zornitza Stark Publications for gene: MMADHC were set to
Intellectual disability syndromic and non-syndromic v0.6393 MUT Zornitza Stark Publications for gene: MUT were set to
Intellectual disability syndromic and non-syndromic v0.6390 MOCS2 Zornitza Stark Publications for gene: MOCS2 were set to
Intellectual disability syndromic and non-syndromic v0.6386 POLR3K Bryony Thompson gene: POLR3K was added
gene: POLR3K was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3K were set to https://doi.org/10.1155/2024/8807171; 30584594
Phenotypes for gene: POLR3K were set to POLR3-related leukodystrophy MONDO:0700282
Review for gene: POLR3K was set to GREEN
Added comment: 3 apparently unrelated cases (1 compound het & 2 homozygous for the same missense & supporting functional assays) with phenotypes consistent with POLR3-related leukodystrophy which includes ID and DD as part of the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6384 GFAP Bryony Thompson Publications for gene: GFAP were set to
Intellectual disability syndromic and non-syndromic v0.6382 ATAD2B Zornitza Stark gene: ATAD2B was added
gene: ATAD2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATAD2B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATAD2B were set to 39313616
Phenotypes for gene: ATAD2B were set to neurodevelopmental disorder MONDO:0700092, ATAD2B-related
Review for gene: ATAD2B was set to AMBER
Added comment: 3 families including 2 siblings
1 fam is hom for a highly conserved missense

Amber because of the lack of specific phenotypes:
Abnormality of the nervous system and Abnormality of the eye
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6380 MRPS22 Zornitza Stark Publications for gene: MRPS22 were set to
Intellectual disability syndromic and non-syndromic v0.6377 MTFMT Zornitza Stark Publications for gene: MTFMT were set to 21907147; 23499752; 24461907; 22499348
Intellectual disability syndromic and non-syndromic v0.6376 MTFMT Zornitza Stark Publications for gene: MTFMT were set to
Intellectual disability syndromic and non-syndromic v0.6374 MVK Zornitza Stark Publications for gene: MVK were set to 29047407; 26409462
Intellectual disability syndromic and non-syndromic v0.6373 MVK Zornitza Stark Publications for gene: MVK were set to 29047407; 26409462
Intellectual disability syndromic and non-syndromic v0.6373 MVK Zornitza Stark Publications for gene: MVK were set to
Intellectual disability syndromic and non-syndromic v0.6370 MYO5A Zornitza Stark Publications for gene: MYO5A were set to
Intellectual disability syndromic and non-syndromic v0.6367 MTHFR Zornitza Stark Publications for gene: MTHFR were set to
Intellectual disability syndromic and non-syndromic v0.6364 NPC2 Zornitza Stark Publications for gene: NPC2 were set to 11125141; 17470133
Intellectual disability syndromic and non-syndromic v0.6363 NPC2 Zornitza Stark Publications for gene: NPC2 were set to
Intellectual disability syndromic and non-syndromic v0.6360 NPC1 Zornitza Stark Publications for gene: NPC1 were set to
Intellectual disability syndromic and non-syndromic v0.6356 NKX2-1 Zornitza Stark Publications for gene: NKX2-1 were set to 10931427; 27066577; 26839702; 26103969; 23911641; 11854319; 24714694
Intellectual disability syndromic and non-syndromic v0.6355 NKX2-1 Zornitza Stark Publications for gene: NKX2-1 were set to
Intellectual disability syndromic and non-syndromic v0.6352 NGLY1 Zornitza Stark Publications for gene: NGLY1 were set to
Intellectual disability syndromic and non-syndromic v0.6349 NFIX Zornitza Stark Publications for gene: NFIX were set to 33034087; 29897170; 30548146; 25118028
Intellectual disability syndromic and non-syndromic v0.6348 NFIX Zornitza Stark Publications for gene: NFIX were set to
Intellectual disability syndromic and non-syndromic v0.6345 NEU1 Zornitza Stark Publications for gene: NEU1 were set to
Intellectual disability syndromic and non-syndromic v0.6342 NDUFV1 Zornitza Stark Publications for gene: NDUFV1 were set to
Intellectual disability syndromic and non-syndromic v0.6339 NDUFS7 Zornitza Stark Publications for gene: NDUFS7 were set to
Intellectual disability syndromic and non-syndromic v0.6335 NDUFA1 Zornitza Stark Publications for gene: NDUFA1 were set to
Intellectual disability syndromic and non-syndromic v0.6332 NALCN Zornitza Stark Publications for gene: NALCN were set to
Intellectual disability syndromic and non-syndromic v0.6329 NAGLU Zornitza Stark Publications for gene: NAGLU were set to
Intellectual disability syndromic and non-syndromic v0.6326 NAGA Zornitza Stark Publications for gene: NAGA were set to
Intellectual disability syndromic and non-syndromic v0.6323 SCO2 Zornitza Stark Publications for gene: SCO2 were set to
Intellectual disability syndromic and non-syndromic v0.6320 SKI Zornitza Stark Publications for gene: SKI were set to
Intellectual disability syndromic and non-syndromic v0.6317 SHH Zornitza Stark Publications for gene: SHH were set to
Intellectual disability syndromic and non-syndromic v0.6312 SECISBP2 Zornitza Stark Publications for gene: SECISBP2 were set to 16228000; 19602558; 21084748; 22247018
Intellectual disability syndromic and non-syndromic v0.6309 FLVCR1 Bryony Thompson Publications for gene: FLVCR1 were set to
Intellectual disability syndromic and non-syndromic v0.6307 LRRC7 Sangavi Sivagnanasundram gene: LRRC7 was added
gene: LRRC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LRRC7 were set to 39256359
Phenotypes for gene: LRRC7 were set to neurodevelopmental disorder (MONDO:0700092)
Review for gene: LRRC7 was set to GREEN
Added comment: Well established gene-disease association.
Neurodevelopmental disorder with a clinical spectrum - symptoms include ID, ADHD, aggression and in many cases, hyperphagia associate obesity.
Heterozygous missense and LoF variants have been reported and functional assays were conducted on missense and truncating variants that support LoF mechanism of disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6302 ZDHHC16 Ain Roesley gene: ZDHHC16 was added
gene: ZDHHC16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZDHHC16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZDHHC16 were set to 39313616
Phenotypes for gene: ZDHHC16 were set to neurodevelopmental disorder MONDO:0700092, ZDHHC16-related
Review for gene: ZDHHC16 was set to AMBER
gene: ZDHHC16 was marked as current diagnostic
Added comment: 6 families including a pair of siblings

Amber because 5 of the families had non specific phenotypes listed
Abnormality of:
the nervous system, metabolism/homeostasis, head/neck, immune system, the integument, the digestive system, the respiratory system, the endocrine system, Growth abnormality the skeletal system, the musculature, the eye

Specific HPOs were provided for one individual (homoyzygous for a canonical splice)

Abnormality of the face; Cerebellar hypoplasia; Developmental regression; Encephalopathy; Hyperreflexia; Hypertonia; Hypotonia; Inguinal hernia; Laryngomalacia; Microcephaly; Motor delay; Optic atrophy; Seizure; Spastic paraparesis; Spasticity; Talipes equinovarus; Umbilical hernia
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6300 EPB41L3 Bryony Thompson gene: EPB41L3 was added
gene: EPB41L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EPB41L3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EPB41L3 were set to 39292993
Phenotypes for gene: EPB41L3 were set to neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063
Review for gene: EPB41L3 was set to GREEN
Added comment: 6 cases from 5 unrelated consanguineous families (2nd & 3rd degree) with homozygous LoF variants and a neurodevelopmental condition, including ID and seizures. Epb41l3 shRNA-mediated downregulation in mouse oligodendroglia demonstrated impaired oligodendrocyte function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6298 GCH1 Bryony Thompson Publications for gene: GCH1 were set to 22473768; 7869202
Intellectual disability syndromic and non-syndromic v0.6297 GCH1 Bryony Thompson Publications for gene: GCH1 were set to
Intellectual disability syndromic and non-syndromic v0.6294 GAMT Bryony Thompson Publications for gene: GAMT were set to
Intellectual disability syndromic and non-syndromic v0.6291 GALE Bryony Thompson Publications for gene: GALE were set to
Intellectual disability syndromic and non-syndromic v0.6288 GALC Bryony Thompson Publications for gene: GALC were set to
Intellectual disability syndromic and non-syndromic v0.6285 GABRB2 Bryony Thompson Publications for gene: GABRB2 were set to
Intellectual disability syndromic and non-syndromic v0.6282 FUCA1 Bryony Thompson Publications for gene: FUCA1 were set to
Intellectual disability syndromic and non-syndromic v0.6279 FOXRED1 Bryony Thompson Publications for gene: FOXRED1 were set to
Intellectual disability syndromic and non-syndromic v0.6276 FOXG1 Bryony Thompson Publications for gene: FOXG1 were set to
Intellectual disability syndromic and non-syndromic v0.6273 FKTN Bryony Thompson Publications for gene: FKTN were set to
Intellectual disability syndromic and non-syndromic v0.6269 FKRP Bryony Thompson Publications for gene: FKRP were set to
Intellectual disability syndromic and non-syndromic v0.6266 FIG4 Bryony Thompson Publications for gene: FIG4 were set to
Intellectual disability syndromic and non-syndromic v0.6263 FBXL4 Bryony Thompson Publications for gene: FBXL4 were set to
Intellectual disability syndromic and non-syndromic v0.6260 FAT4 Bryony Thompson Publications for gene: FAT4 were set to
Intellectual disability syndromic and non-syndromic v0.6257 FAM20C Bryony Thompson Publications for gene: FAM20C were set to
Intellectual disability syndromic and non-syndromic v0.6254 FAM126A Bryony Thompson Publications for gene: FAM126A were set to
Intellectual disability syndromic and non-syndromic v0.6251 ESCO2 Bryony Thompson Publications for gene: ESCO2 were set to
Intellectual disability syndromic and non-syndromic v0.6248 OTX2 Chirag Patel reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24167467, 25589041, 31969185,; Phenotypes: Microphthalmia, syndromic 5, MIM# 610125, Pituitary hormone deficiency, combined, 6, MIM# 613986, Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125, Otocephaly-dysgnathia complex; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6247 ERCC8 Bryony Thompson Publications for gene: ERCC8 were set to
Intellectual disability syndromic and non-syndromic v0.6244 ERCC6L2 Bryony Thompson Publications for gene: ERCC6L2 were set to
Intellectual disability syndromic and non-syndromic v0.6241 ERCC6 Bryony Thompson Publications for gene: ERCC6 were set to
Intellectual disability syndromic and non-syndromic v0.6238 ERCC3 Bryony Thompson Publications for gene: ERCC3 were set to
Intellectual disability syndromic and non-syndromic v0.6234 ERCC2 Bryony Thompson Publications for gene: ERCC2 were set to
Intellectual disability syndromic and non-syndromic v0.6231 EP300 Bryony Thompson Publications for gene: EP300 were set to https://search.clinicalgenome.org/CCID:004751
Intellectual disability syndromic and non-syndromic v0.6230 EP300 Bryony Thompson Publications for gene: EP300 were set to
Intellectual disability syndromic and non-syndromic v0.6227 ELOVL4 Bryony Thompson Publications for gene: ELOVL4 were set to
Intellectual disability syndromic and non-syndromic v0.6224 EIF2AK3 Bryony Thompson Publications for gene: EIF2AK3 were set to
Intellectual disability syndromic and non-syndromic v0.6223 DIAPH1 Bryony Thompson Publications for gene: DIAPH1 were set to 24781755; 26463574
Intellectual disability syndromic and non-syndromic v0.6222 HSD17B10 Sangavi Sivagnanasundram reviewed gene: HSD17B10: Rating: GREEN; Mode of pathogenicity: None; Publications: 22132097, 17618155; Phenotypes: HSD10 mitochondrial disease MONDO:0010327; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6221 DIAPH1 Zornitza Stark Publications for gene: DIAPH1 were set to 24781755; 26463574
Intellectual disability syndromic and non-syndromic v0.6220 DIAPH1 Zornitza Stark Publications for gene: DIAPH1 were set to
Intellectual disability syndromic and non-syndromic v0.6216 DIS3L2 Zornitza Stark Publications for gene: DIS3L2 were set to
Intellectual disability syndromic and non-syndromic v0.6215 DIAPH1 Ken Lee Wan changed review comment from: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development, and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632).

Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).; to: Seizures, cortical blindness, and microcephaly syndrome (SCBMS) is an autosomal recessive neurodevelopmental disorder characterized by microcephaly, early-onset seizures, severely delayed psychomotor development and cortical blindness. Affected individuals also tend to show poor overall growth with short stature (MIM: 616632).

Biallelic loss-of-function DIAPH1 variants have been reported in 3 Middle Eastern consanguineous families with a unique syndrome of early onset seizures, progressive microcephaly, intellectual disability and severe visual impairment (PMIDs: 24781755; 26463574). Western blot analysis showed lack of the mDia1 protein for affected individuals (PMID: 24781755).
Intellectual disability syndromic and non-syndromic v0.6205 RNU2-2P Zornitza Stark gene: RNU2-2P was added
gene: RNU2-2P was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU2-2P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Phenotypes for gene: RNU2-2P were set to Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related
Review for gene: RNU2-2P was set to GREEN
Added comment: 15 individuals reported with de novo, recurrent variants in this gene at nucleotide positions 4 and 35. The disorder is characterized by intellectual disability, neurodevelopmental delay, autistic behavior, microcephaly, hypotonia, epilepsy and hyperventilation. All cases display a severe and complex seizure phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6196 MRAS Krithika Murali gene: MRAS was added
gene: MRAS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MRAS were set to Noonan syndrome 11 - MIM#618499
Review for gene: MRAS was set to GREEN
Added comment: Developmental delay is a phenotypic feature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6195 CEP76 Mark Cleghorn gene: CEP76 was added
gene: CEP76 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038; Joubert syndrome; Bardet-Biedl syndrome; retinitis pigmentosa
Penetrance for gene: CEP76 were set to unknown
Review for gene: CEP76 was set to GREEN
Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago
ESHG presentation 4/6/24, unpublished

CEP76 associated with syndromic ciliopathy

CEP76 localizes to centrioles and basal body primary cilia
Role in normal centriolar duplication

Index case
Bardet Biedl syndrome
Compound heterozygous pLoF variants in CEP76

Via Gene matcher
7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum:
Obesity
Ocular phenotype
Structural brain anomalies
Renal?

3/7 families clinical Dx Joubert syndrome
1/7 BBS
1/7 GDD/ID NOS
2/7 retinitis pigmentosa (1 of these with learning difficulties)

Mixture of biallelic pLOF and missense variant

CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant

Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6195 EIF3I Mark Cleghorn gene: EIF3I was added
gene: EIF3I was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: EIF3I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EIF3I were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: EIF3I were set to unknown
Review for gene: EIF3I was set to AMBER
Added comment: Marcello Scala, Genoa
ESHG presentation 4/6/24, unpublished

De novo EIF3I missense variants as a cause for novel NDD syndrome

EIF3 complex involved in regulating initiation of mRNA translation
Negative regulator of the TGF beta pathway

8 individuals from 8 families
Mod/severe GDD or ID
Short stature
Midline brain anomalies (hypoplasia/agenesis of corpus callosum and pituitary hypoplasia)
Frontal bossing, hypertelorism, long philtrum
All w rare de novo missense variants om EIF3I, clustering within highly conserved WD repeats

Functional studies
Transfected HEK293 cell studies suggested EIF3I protein from variant alleles (from patients above) had disrupted interaction with other EIF subunits, and cells had reduced protein synthesis overall
No animal models
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6193 DDHD2 Bryony Thompson Publications for gene: DDHD2 were set to
Intellectual disability syndromic and non-syndromic v0.6191 DDC Bryony Thompson Publications for gene: DDC were set to
Intellectual disability syndromic and non-syndromic v0.6189 FKBP4 Mark Cleghorn gene: FKBP4 was added
gene: FKBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: FKBP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FKBP4 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: FKBP4 were set to unknown
Review for gene: FKBP4 was set to AMBER
Added comment: Rebecca Yarwood, University of Manchester
ESHG presentation 4/6/24, unpublished

Bilalleic FKBP4 w NDD + DSD
Protein has functions in hormone receptor trafficking
FKPB4 highly expressed in stem cell and progenitor cells in gonad and neuronal degeneration

Index case
Severe GDD
abN external genitalia
CV AbN
FBBP4 p.E196*

Via GeneMatcher
7 families (12 individuals)

12/12 severe GDD/ID
9/10 microcephaly
11/12 external genital abnormalities (details not provided)

All w homozygous pLoF variants (mixture of canonical splice, frameshift, nonsense)
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6188 MED16 Mark Cleghorn gene: MED16 was added
gene: MED16 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: MED16 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MED16 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: MED16 were set to unknown
Review for gene: MED16 was set to GREEN
Added comment: MED16
Charlotte Guillouet, Imagine institute Paris
ESHG presentation 4/6/24, unpublished

MED16 is part of tail of ‘mediator complex’
Plays a role in enhancer/promotor regions

Disruptive variants in other genes encoding proteins within this mediator complex (MED11/12/12/17/20, CDK8) are assoc w neurodevelopmental/neurodegenerative disorders

Cases
index family
Sibs (M/F) to consanguineous parents w NDD/mod ID, tetralogy of Fallot or VSD, bilat deafness, micrognathia, malar hypoplasia, dental AbN, pre auricular tags, hypoplastic nails, brachydactly
WES: biallelic MED16 p.Asp217Asn

Via genematcher
16 families total, 22 individuals, homozygous or compound het rare MED16 variants
Mixture of pLoF and missense variants

Motor delay in 16/17
DD or ID in 17/17
Speech delay in 15/15
6/19 ToF
7/19 other septal/aortic defects
6/18 deafness
11/18 microretognathia
6/17 cleft palate
8/19 preauricular tags
9/20 puffy eyelids
12/20 nasal dysplasia (most commonly short columella w bulbous nasal tip)
7/20 corpus callosum anomalies

Not clear that functional work recapitulated phenotype as yet?
Immunofluroescence on HeLa cells transfected with variants observed ?conclusion
MED16 knockout mouse > growth delay, pre weaning lethality
MED16 knockout zebrafish > reduced body length, early death, no obvious craniofacial phenotype
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6188 LAMP2 Chirag Patel reviewed gene: LAMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 10972294; Phenotypes: Danon disease, MIM# 300257, MONDO:0010281; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.6187 SLC6A3 Zornitza Stark Publications for gene: SLC6A3 were set to
Intellectual disability syndromic and non-syndromic v0.6184 SRD5A3 Zornitza Stark Publications for gene: SRD5A3 were set to
Intellectual disability syndromic and non-syndromic v0.6181 SLC6A8 Zornitza Stark Publications for gene: SLC6A8 were set to
Intellectual disability syndromic and non-syndromic v0.6177 ST3GAL3 Zornitza Stark Publications for gene: ST3GAL3 were set to
Intellectual disability syndromic and non-syndromic v0.6173 SUCLG1 Zornitza Stark Publications for gene: SUCLG1 were set to
Intellectual disability syndromic and non-syndromic v0.6169 SURF1 Zornitza Stark Publications for gene: SURF1 were set to
Intellectual disability syndromic and non-syndromic v0.6166 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to 23217329; 23519211
Intellectual disability syndromic and non-syndromic v0.6165 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Intellectual disability syndromic and non-syndromic v0.6162 TSEN2 Zornitza Stark Publications for gene: TSEN2 were set to 23562994; 20952379
Intellectual disability syndromic and non-syndromic v0.6161 TSEN2 Zornitza Stark Publications for gene: TSEN2 were set to
Intellectual disability syndromic and non-syndromic v0.6157 TTC19 Zornitza Stark Publications for gene: TTC19 were set to
Intellectual disability syndromic and non-syndromic v0.6155 TTC19 Zornitza Stark changed review comment from: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances.

At least 4 unrelated families reported.; to: Mitochondrial complex III deficiency nuclear type 2 is an autosomal recessive severe neurodegenerative disorder that usually presents in childhood, but may show later onset, even in adulthood. Affected individuals have motor disability, with ataxia, apraxia, dystonia, and dysarthria, associated with necrotic lesions throughout the brain. Most patients also have cognitive impairment and axonal neuropathy and become severely disabled later in life. The disorder may present clinically as spinocerebellar ataxia or Leigh syndrome, or with psychiatric disturbances.

Included due to phenotypic overlap.

At least 4 unrelated families reported.
Intellectual disability syndromic and non-syndromic v0.6152 ZNRF3 Bryony Thompson gene: ZNRF3 was added
gene: ZNRF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNRF3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNRF3 were set to 39168120
Phenotypes for gene: ZNRF3 were set to Complex neurodevelopmental disorder MONDO:0100038
Review for gene: ZNRF3 was set to GREEN
Added comment: 12 individuals with ZNRF3 variants and various phenotypes. 8 individuals with de novo missense and neurodevelopment disorders (NDD), including cluster of variants in the RING ligase domain with macrocephalic NDD. Plus 4 individuals from 3 families with de novo truncating or de novo/inherited large in-frame deletion variants with non-NDD phenotypes, including heart, adrenal, or nephrotic problems. Overall, 4 individuals had congenital heart defects and 2 had microcephaly. Also, supporting in vitro functional assays.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6150 DHTKD1 Zornitza Stark Publications for gene: DHTKD1 were set to
Intellectual disability syndromic and non-syndromic v0.6146 DCX Zornitza Stark Publications for gene: DCX were set to 26743950; 11468322; 20726879; 20301364; 12552055; 9489699
Intellectual disability syndromic and non-syndromic v0.6145 DCX Zornitza Stark Publications for gene: DCX were set to
Intellectual disability syndromic and non-syndromic v0.6144 DCX Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6142 DARS2 Zornitza Stark Publications for gene: DARS2 were set to
Intellectual disability syndromic and non-syndromic v0.6139 D2HGDH Zornitza Stark Publications for gene: D2HGDH were set to
Intellectual disability syndromic and non-syndromic v0.6134 GPN2 Mark Cleghorn gene: GPN2 was added
gene: GPN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: GPN2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPN2 were set to complex neurodevelopmental disorder MONDO:0100038; Perrault syndrome
Review for gene: GPN2 was set to AMBER
Added comment: GPN2
ESHG talk 2/6/24, unpublished
Thomas Smith, University of Manchester

Biallelic GPN2 proposed to cause Perrault syndrome (SNHL, ovarian dysfunction, NDD)
RNA polymerase assembly factor

4 families (14 affected individuals) w biallalic GPN2 rare missense variants
Segregated w phenotype
Fam 2 and 3 may be distantly related (leaving 3 distinct kindreds)

Clinical features
13/14 SNHL
3/4 families all females of adolescent age or older had primary ovarian insufficiency
4/4 GDD, ataxia (no data on family w 10 affected indiv.)

Some functional work, not conclusive
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6134 ATP6V1C1 Zornitza Stark gene: ATP6V1C1 was added
gene: ATP6V1C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP6V1C1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V1C1 were set to 39210597
Phenotypes for gene: ATP6V1C1 were set to neurodevelopmental disorder MONDO:0700092, ATP6V1C1-related
Review for gene: ATP6V1C1 was set to RED
Added comment: 1x de novo missense p.Glu289Lys (absent in v4 gnomad). Manual inspection of IGV found the dad was mosaic 7% VAF and he shared some of the clinical features (minor digit anomalies). Some functional studies using patient fibroblasts were performed, demonstrating similar effects as known pathogenic variants in ATP6V1B2. - lysosomal morphology - autophagic flux dysregulation - increased acidification of lysosome borderline red/amber
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6127 RFC4 Chirag Patel gene: RFC4 was added
gene: RFC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RFC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RFC4 were set to PMID: 39106866
Phenotypes for gene: RFC4 were set to RFC4-related multisystem disorder
Review for gene: RFC4 was set to GREEN
gene: RFC4 was marked as current diagnostic
Added comment: 9 affected individuals (aged birth to 47yrs) from 8 unrelated families with a multisystem disorder. Clinical features included: muscle weakness/myopathy (9/9), motor incoordination/gait disturbance (8/8), delayed gross motor development (6/9), dysarthria (5/5), peripheral neuropathy (3/3 adults), bilateral sensorineural hearing impairment (6/9), decreased body weight (8/9), short stature (5/9), microcephaly (4/9), respiratory issues/insufficiency (6/9), cerebellar atrophy (4/9), pituitary hypoplasia (3/9).

WES or WGS identified biallelic loss-of-function variants in RFC4 (3 frameshift, 2 splice site, 1 single AA duplication, 2 single AA deletions, 2 missense), and almost all are likely to disrupt the C-terminal domain indispensable for Replication factor C (RFC) complex formation. All variants segregated with the disease.

The RFC complex (with 5 subunits) is central to process of regulation of DNA replication, and it loads proliferating cell nuclear antigen onto DNA to facilitate the recruitment of replication and repair proteins and enhance DNA polymerase processivity. RFC1 is associated with CANVAS but the contributions of RFC2-5 subunits on human Mendelian disorders is unknown.

Analysis of a previously determined cryo-EM structure of RFC bound to proliferating cell nuclear antigen suggested that the variants disrupt interactions within RFC4 and/or destabilize the RFC complex. Cellular studies using RFC4-deficient HeLa cells and primary fibroblasts demonstrated decreased RFC4 protein, compromised stability of the other RFC complex subunits, and perturbed RFC complex formation. Additionally, functional studies of the RFC4 variants affirmed diminished RFC complex formation, and cell cycle studies suggested perturbation of DNA replication and cell cycle progression.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6126 LARP1 Sangavi Sivagnanasundram gene: LARP1 was added
gene: LARP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: LARP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LARP1 were set to 39182167
Phenotypes for gene: LARP1 were set to Neurodevelopmental disorder; MONDO:0700092
Review for gene: LARP1 was set to GREEN
Added comment: Seven unrelated probands (6 males and 1 female) with ASD or another variable NDD phenotype (ID, hypotonia, motor delay and/or ASD). Variants were showed to be de novo null variants or missense variants that resulted in haploinsufficiency.

Ex vivo (knockout CRISPR-Cas9) functional assay using lymphoblasts that was collected and immortilised from one proband was conducted to assess the functional impact of the LARP1 variant. The results showed a reduction in protein compared to WT causing reduced rates of aerobic respiration and glycolysis
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6124 PNPLA8 Chirag Patel gene: PNPLA8 was added
gene: PNPLA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PNPLA8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PNPLA8 were set to PMID: 39082157
Phenotypes for gene: PNPLA8 were set to PNPLA8-related neurological diseases
Review for gene: PNPLA8 was set to GREEN
gene: PNPLA8 was marked as current diagnostic
Added comment: Cohort analysis of clinical features of new and previously reported individuals with biallelic PNPLA8 variants (25 affected individuals across 20 families). They showed that PNPLA8-related neurological diseases manifest as a continuum ranging from variable developmental and/or degenerative epileptic-dyskinetic encephalopathy to childhood-onset neurodegeneration. Complete loss of PNPLA8 was associated with the more profound end of the spectrum. 13/19 individuals (info available) had developmental delay and/or severe intellectual disability.

Using cerebral organoids generated from human induced pluripotent stem cells, they found that loss of PNPLA8 led to developmental defects by reducing the number of basal radial glial cells and upper-layer neurons. Neural progenitor cells lacking PNPLA8 showed a reduced amount of lysophosphatidic acid, lysophosphatidylethanolamine and phosphatidic acid. They show that PNPLA8 is crucial to meet phospholipid synthetic needs and to produce abundant basal radial glial cells in human brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6123 MED22 Mark Cleghorn gene: MED22 was added
gene: MED22 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: MED22 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MED22 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: MED22 were set to unknown
Review for gene: MED22 was set to AMBER
Added comment: ESHG talk 2/6/24, unpublished
Elisa Cali, UCL

Recurrent homozygous MED22:c.397_399del (p.Glu133del) inframe variant in 8 individuals from 6 families w progressive NDD, microcepahly, cerebellar atrophy, dystonia, seizures

Rare in gnomad v4.1 (9 het alleles, no homozygotes)

Functional work on patient fibroblasts: quantity of protein comparable to controls, did not mentioned assays of protein function (?mechanism proposed)
Drosophilia heterozygous model with equivalent of p.Glu133del variant: structural anomalies, less movements, all died prior to pupae stage
Zebrafish: MED22 mutants less mobile, died prior to adulthood, reduced brain size
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 SF3B1 Mark Cleghorn gene: SF3B1 was added
gene: SF3B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: SF3B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SF3B1 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: SF3B1 were set to unknown
Review for gene: SF3B1 was set to AMBER
Added comment: SF3B1
Delphine Bernard, University of Brest
ESHG talk 2/6/24, unpublished

De novo germline SF3B1 variants, proposed spliceosomopathy/NDD gene

SF3B1 is an RNA binding protein that stabilizes the U2 snRNP complex at branchpoint sequences
Somatic SF3B1 missense commonly occur in haematological malignancy (K700E recurrent)

25 patients with syndromic NDD + de novo heterozygous rare SF3B1 variants identified on WES, genematcher
13 missense (incl recurrent xxx and xxx) within HEAT domain
5 nonsense
4 splicing
1 frameshift

Patients w missense variants may have more severe phenotype incl mircocepahly, palate anomalies, cerebral anomalies, GI/cardiac anomalies

Cellular models of missense variants: erythroluekaemia K562, HEK293T
Suggest missense variants do not cause loss of function, but increase exon skipping and alternative 3’ splice sites
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 C12orf66 Mark Cleghorn gene: C12orf66 was added
gene: C12orf66 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: C12orf66 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: C12orf66 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: C12orf66 were set to unknown
Review for gene: C12orf66 was set to AMBER
Added comment: KICS2 (previously known as C12ORF66)
Rebecca Buchert, Universitatklinikum Tubingen
ESHG talk 2/6/24, unpublished

Proposed ID + epilepsy gene

8 families w 11 affected individuals
Phenotypes: 11/11 ID, 9/11 epilepsy, 3/11 hearing impairment
3/8 homozygous missense variants (p.Asp296Glu, p.Tyr393Cys, p.Tyr393Cys), all highly conserved
1/8 compound het PTC (p.Lys262*) with 1.1Mb deletion
4/8 homozygous PTC (p.Glu3*, p.Gly79Valfs*18, p.Gly79Valfs*18, p.Lys260Asnfs*18)

Gene appears to be involved in mTOR pathway, and cilia function
mTORC1 activity in CRISPR-HEK293T cells – reduced activity in cells w variants above

Zebrafish model: otolith defects, ciliary dysfunction
?not clear if truly mimics phenotype observed in patient cohort described
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 REPS2 Mark Cleghorn gene: REPS2 was added
gene: REPS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: REPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: REPS2 were set to complex neurodevelopmental disorder MONDO:0100038; Cerebral palsy HP:0100021
Penetrance for gene: REPS2 were set to unknown
Review for gene: REPS2 was set to AMBER
Added comment: REPS2
Hao Hu, Guangzhou Women and Children’s MC
ESHG talk 1/6/24, unpublished

Proposed X-linked cerebral palsy + NDD gene

4 unrelated males with predicted deleterious hemizygous REPS2 variants, 2 PTC, 2 missense. 2 de novo, 2 maternally inherited
Phenotypes: 2 w CP + moderate ID/ASD, 2 w NDD NOS
Variants described:
c.1050_1052delGAA;p.K351del
c.1040T>C; p.I347T
c.962C>G; p.S321C
c.1736delA; p.N579Tfs*17

In vitro assay of above 4 variants suggest reduced REPS2 protein stability
Zebrafish model: REPS2 expressed in neuronal cells, REPS2 knock down have reduced motor activity and abN neuronal morphology
Mouse model hemizygous w one of above variants (not specified): reduced performance in cognitive tasks, abnormal neuronal migration pattern on post mortem examination
Mechanism may relate to dopamine signalling?
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 TTL Mark Cleghorn gene: TTL was added
gene: TTL was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: TTL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTL were set to complex neurodevelopmental disorder MONDO:0100038
Review for gene: TTL was set to AMBER
Added comment: TTL
Valentina Serpieri, University of Pavia
ESHG talk 1/6/24

FAM1 (Italy)
2 affected sisters born to consanguineous Pakistani parents
GDD, spastic tetraparesis, optic atrophy, brain anomalies resembling tubulinopathies (dysplasia of corpus callosum, basal ganglia, brainstem)
WES: homozygous TTL:c.1013G>A; p.Cys338Tyr in both affected sisters

Via genematcher
5 more families (9 individuals) w similar phenotypes and biallelic variants in TTL

FAM2 (Egypt): homozygous p.Arg46Pro
FAM3 (Egypt): homozygous p.Arg46Pro
FAM4 (Australia): homozygous p.Gln183Arg
FAM5 (France): homozygous p.Trp147*
FAM6 (Saudi Arabia): homozygous p.His243Tyr

TTL KO mice: death soon after birth, no overt malformations, but defects in organisation of cerebral layers

Functional work on patient fibroblasts
FAM1 – reduced quantity of TTL protein compared to control on Western blot, decreased function of TTL protein (increase in detyrosinated tubulin) compared to controls – infer LoF as mechanism
FAM3 – mentioned but no details
FAM4– mentioned but no details
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6123 DCX Sumudu Perera reviewed gene: DCX: Rating: ; Mode of pathogenicity: None; Publications: 26743950, 11468322, 20726879, 20301364, 12552055, 9489699; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6121 CSMD1 Krithika Murali gene: CSMD1 was added
gene: CSMD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD1 were set to PMID 38816421
Phenotypes for gene: CSMD1 were set to complex neurodevelopmental disorder MONDO:0100038
Review for gene: CSMD1 was set to GREEN
Added comment: PMID 38816421 Werren et al 2024 report 8 individuals from 6 families with biallelic missense CSMD1 variants identified through exome sequencing and subsequent gene-sharing efforts. Shared phenotypic features included: GDD, ID, microcephaly and polymicrogyria. Other features included dysmorphism, IUGR, hypotonia, arthrogryposis, seizures, opthalmological anomalies and other brain white matter anomalies Heterozygous parents were unaffected.

Loss of function is the postulated mechanism based on experimental data involving early-stage forebrain organoids differentiated from CSMD1 knockout human embryonic stem cells. ClinGen haploinsufficiency score of 1, however, this curation was last reviewed in 2018. This gene is within the scope of review for the ClinGen Autisim and ID GCEP.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6119 COQ8A Zornitza Stark Publications for gene: COQ8A were set to
Intellectual disability syndromic and non-syndromic v0.6116 CTDP1 Zornitza Stark Publications for gene: CTDP1 were set to
Intellectual disability syndromic and non-syndromic v0.6113 CTSA Zornitza Stark Publications for gene: CTSA were set to
Intellectual disability syndromic and non-syndromic v0.6108 CYB5R3 Zornitza Stark Publications for gene: CYB5R3 were set to
Intellectual disability syndromic and non-syndromic v0.6105 SOX9 Zornitza Stark Publications for gene: SOX9 were set to
Intellectual disability syndromic and non-syndromic v0.6099 TBC1D7 Zornitza Stark Publications for gene: TBC1D7 were set to 24515783; 23687350
Intellectual disability syndromic and non-syndromic v0.6093 HDAC3 Zornitza Stark gene: HDAC3 was added
gene: HDAC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HDAC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HDAC3 were set to 39047730
Review for gene: HDAC3 was set to GREEN
Added comment: Six individuals with de novo missense variants in this gene and variable NDD phenotypes, including ID, seizures. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6091 SLC39A14 Zornitza Stark Publications for gene: SLC39A14 were set to
Intellectual disability syndromic and non-syndromic v0.6087 COL4A2 Zornitza Stark Publications for gene: COL4A2 were set to
Intellectual disability syndromic and non-syndromic v0.6083 COQ4 Zornitza Stark Publications for gene: COQ4 were set to 34656997
Intellectual disability syndromic and non-syndromic v0.6083 COQ4 Zornitza Stark Publications for gene: COQ4 were set to
Intellectual disability syndromic and non-syndromic v0.6078 LEO1 Zornitza Stark gene: LEO1 was added
gene: LEO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LEO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LEO1 were set to 38965372
Phenotypes for gene: LEO1 were set to neurodevelopmental disorder MONDO:0700092, LEO-1 related
Review for gene: LEO1 was set to AMBER
Added comment: cohort of individuals with delayed motor and speech development, ASD

8x de novo – 6x missense + 2x PTC
1x pat splice (father unaffected)
2x unknown_inh PTCs

Of the missense variants, G370E has 8 hets in gnomad v4

This gene is not constraint for LoF with 4 hets with an NMD variant in gnomad v4
3 of the missense are said to lie within a region of missense constraint, however this isn't the case in v4
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6077 CHD2 Zornitza Stark Phenotypes for gene: CHD2 were changed from Epileptic encephalopathy, childhood-onset (MIM # 615369) to Developmental and epileptic encephalopathy 94, MIM# 615369
Intellectual disability syndromic and non-syndromic v0.6076 CHD2 Zornitza Stark Publications for gene: CHD2 were set to
Intellectual disability syndromic and non-syndromic v0.6073 PCBP2 Ain Roesley gene: PCBP2 was added
gene: PCBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PCBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PCBP2 were set to 38965372
Phenotypes for gene: PCBP2 were set to neurodevelopmental disorder MONDO:0700092, PCBP2-related
Review for gene: PCBP2 was set to GREEN
gene: PCBP2 was marked as current diagnostic
Added comment: 3x individuals with de novo variants
Motor and speech delay and ASD
2x missense + 1x fs

There are 2 NMD variants with 9 and 8 hets respectively in gnomad v4, however the IGV looks to be low quality
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6072 SLC45A1 Zornitza Stark Publications for gene: SLC45A1 were set to 28434495
Intellectual disability syndromic and non-syndromic v0.6070 SRPK3 Zornitza Stark Publications for gene: SRPK3 were set to 38429495; 39073169
Intellectual disability syndromic and non-syndromic v0.6068 SRPK3 Zornitza Stark gene: SRPK3 was added
gene: SRPK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRPK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: SRPK3 were set to 38429495; 39073169
Phenotypes for gene: SRPK3 were set to Neurodevelopmental disorder, MONDO:0700092, SRPK3-related
Review for gene: SRPK3 was set to GREEN
Added comment: PMID 39073169: 9 individuals from 5 unrelated families reported with 4 missense and 1 putative truncating variant and a neurodevelopmental phenotype. The 8 patients ascertained postnatally shared common clinical features including intellectual disability, agenesis of the corpus callosum, abnormal eye movement, and ataxia. A ninth case, ascertained prenatally, had a complex structural brain phenotype. Supportive animal model data (mouse and zebrafish).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6066 RBBP5 Ain Roesley gene: RBBP5 was added
gene: RBBP5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RBBP5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RBBP5 were set to 39036895
Review for gene: RBBP5 was set to GREEN
gene: RBBP5 was marked as current diagnostic
Added comment: 5x Indivs (4x de novo) = 3x PTCs + 2x missense

4/5 dev delay/ID
2/5 short stature (<=-3 SD) + 2/5 <= -2 SD
1/5 microcephaly (<= -3 SD) + 3/5 <= -2 SD
2/5 SNHL
2/5 seizures
3/5 hypotonia
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6064 NDC1 Bryony Thompson gene: NDC1 was added
gene: NDC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NDC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDC1 were set to 39003500; 19782045
Phenotypes for gene: NDC1 were set to triple-A syndrome MONDO:0009279
Review for gene: NDC1 was set to GREEN
Added comment: 7 cases from 4 consanguineous families (3 different variants: 1 intronic variants that causes in-frame RNA splice impact, 2 missense) with a Triple-A-like syndrome (including ID and neuropathy). Supporting cellular localisation studies were conducted in patient cell lines with the splice variant. NDC1 is required to anchor ALADIN (encoded by AAAS, the gene that causes Triple-A syndrome) in the nuclear pore complex.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6062 CRNKL1 Mark Cleghorn gene: CRNKL1 was added
gene: CRNKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: CRNKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CRNKL1 were set to complex neurodevelopmental disorder MONDO:0100038
Penetrance for gene: CRNKL1 were set to Complete
Review for gene: CRNKL1 was set to GREEN
Added comment: Unpublished, presented at ESHG June 2024 - Louise Bicknell, University of Otago NZ
8 unrelated families via gene matcher with rare, de novo, missense variants in CRNKL1
severe microcephaly (all, -8 to -11 SD)
ID/epilepsy
pontocerebellar hypoplasia (6/8)
simplified gyration (8/8)
7 variants are missense at p.Arg267 residue
1 variant missense at p.Arg301
RNA-seq on patient fibroblasts - no alteration in gene expression
Zebrafish homolog of Arg267 and Arg301 - mimics observed phenotype (reduced brain development), increased in embryo apoptosis
RNQ seq on affected zebrafish embryos - transcriptome strongly disrupted
Splicing analysis in progress

CRKNL1 supports U6 structure in spliceosome
Sources: Other
Intellectual disability syndromic and non-syndromic v0.6062 RNU4-2 Zornitza Stark Publications for gene: RNU4-2 were set to 38645094
Intellectual disability syndromic and non-syndromic v0.6061 FDXR Zornitza Stark Publications for gene: FDXR were set to 30250212
Intellectual disability syndromic and non-syndromic v0.6055 SREBF2 Zornitza Stark gene: SREBF2 was added
gene: SREBF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SREBF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SREBF2 were set to 38847193
Phenotypes for gene: SREBF2 were set to Neurocutaneous syndrome, MONDO:0042983, SREBF2-related
Review for gene: SREBF2 was set to AMBER
Added comment: Two individuals with de novo missense variants, presenting with neurological, cutaneous and skeletal features; supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6051 PSMF1 Zornitza Stark gene: PSMF1 was added
gene: PSMF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMF1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSMF1 were set to https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1
Phenotypes for gene: PSMF1 were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related
Review for gene: PSMF1 was set to GREEN
Added comment: 22 individuals from 15 families reported with a range of neurological phenotypes ranging from early-onset Parkinson's disease; childhood conditions typified by ID and a range of movement disorders; through to perinatal lethal presentations with arthrogryposis multiplex. Genotype-phenotype correlation: biallelic missense variants resulted in the milder phenotypes, while bi-allelic LoF variants in the more severe phenotypes. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6050 VPS50 Ain Roesley Publications for gene: VPS50 were set to 34037727
Intellectual disability syndromic and non-syndromic v0.6048 PSMD11 Bryony Thompson gene: PSMD11 was added
gene: PSMD11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMD11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PSMD11 were set to 38866022; 30733659
Phenotypes for gene: PSMD11 were set to Neurodevelopmental disorder, MONDO:0700092, PSMD11-related
Review for gene: PSMD11 was set to GREEN
Added comment: PMID: 38866022 - 10 unrelated children with early-onset syndromic intellectual disability and neurodevelopmental delay with recurrent obesity. Cognitive impairment is recapitulated in a drosophila model. Loss of function is the mechanism of disease

PMID: 30733659 - 4 probands with ID and different 17q11.2 deletions spanning PSMD11
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6046 PAK2 Ain Roesley gene: PAK2 was added
gene: PAK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PAK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PAK2 were set to 33693784; 38894571; 38712026
Phenotypes for gene: PAK2 were set to Knobloch 2 syndrome MIM#618458
Review for gene: PAK2 was set to GREEN
gene: PAK2 was marked as current diagnostic
Added comment: total of 3 families including 2 siblings with intra-familial variability

Siblings' phenotypes:
Both had retinal detachment and interstitial parenchymal pulmonary changes on chest X-rays, but only one child had additional significant features such as cataract, posterior encephalocele, severe DD/ID with ASD, and epilepsy.

Other 2 pro bands:
GDD, delayed motor (but normal verbal) skills, hypotonia

Missense variants with in vitro functional demonstrating reduction in PAK2 auto phosphorylation
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6038 RDH14 Zornitza Stark gene: RDH14 was added
gene: RDH14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RDH14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RDH14 were set to 34848785
Phenotypes for gene: RDH14 were set to Neurodevelopmental disorder, MONDO:0700092, RDH14-related
Review for gene: RDH14 was set to RED
Added comment: Two related individuals with ID and cerebellar atrophy and homozygous LoF variant reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6034 SLC6A1 Zornitza Stark Publications for gene: SLC6A1 were set to 29315614
Intellectual disability syndromic and non-syndromic v0.6030 ANO4 Ain Roesley gene: ANO4 was added
gene: ANO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ANO4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANO4 were set to 38744284
Phenotypes for gene: ANO4 were set to neurodevelopmental disorder MONDO:0700092, ANO4-related
Review for gene: ANO4 was set to GREEN
gene: ANO4 was marked as current diagnostic
Added comment: aka TMEM16D

5x de novo + 2x inherited missense (73% penetrance + asymptomatic)

the ones with de novo variants:
all had ID, hypotonia
4x skeletal features (scoliosis, funnel chest, pet plants, hyper extensible joints)

all had epilepsy
all had abnormal MRI
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6027 KCND1 Ain Roesley gene: KCND1 was added
gene: KCND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCND1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: KCND1 were set to 38772379
Phenotypes for gene: KCND1 were set to neurodevelopmental disorder MONDO:0700092, KCND1-related
Review for gene: KCND1 was set to GREEN
gene: KCND1 was marked as current diagnostic
Added comment: 18 males from 17 families
2x de novo missense + 3x maternal NMDs + 12x maternal missense
Some functional studies were done

14x ID
4x delayed motor dev
7x muscular hypotonia
6x epilepsy
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6025 ATXN7L3 Chirag Patel gene: ATXN7L3 was added
gene: ATXN7L3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATXN7L3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATXN7L3 were set to PMID: 38753057
Phenotypes for gene: ATXN7L3 were set to Neurodevelopmental disorder, MONDO_0100500
Review for gene: ATXN7L3 was set to GREEN
gene: ATXN7L3 was marked as current diagnostic
Added comment: This study reports 9 unrelated individuals with de novo heterozygous variants in ATXN7L3 identified through WES testing and GeneMatcher. Core clinical features included: global motor and language developmental delay, hypotonia, and dysmorphic features (hypertelorism, epicanthal folds, blepharoptosis, small nose, small mouth, and low-set posteriorly rotated ears). Variable features included: feeding difficulties, seizures, mild periventricular leukomalacia, and structural cardiac abnormalities.

A recurrent nonsense variant [p.(Arg114Ter)] was found in 5/9 individuals. The other variants were 1 frameshift [p.(Ser112LysfsTer12)] and 3 missense variants [p.(Ile71Thr), p.(Ser92Arg), and p.(Leu106Pro)]. They investigated the effects of the recurrent nonsense variant [p.(Arg114Ter)] in fibroblasts of an affected individual. ATXN7L3 protein levels were reduced, and deubiquitylation was impaired (as indicated by an increase in histone H2Bub1 levels). This is consistent with the previous observation of increased H2Bub1 levels in Atxn7l3-null mouse embryos, which have developmental delay and embryonic lethality.

Pathogenic variants in deubiquitinating enzymes (DUBs) have been implicated in neurodevelopmental disorders (ND) and congenital abnormalities. ATXN7L3 is a component of the DUB module of the SAGA complex, and two other related DUB modules, and serves as an obligate adaptor protein of 3 ubiquitin-specific proteases (USP22, USP27X or USP51).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6022 FAM177A1 Chirag Patel gene: FAM177A1 was added
gene: FAM177A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FAM177A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM177A1 were set to PMID: 38767059, 25558065
Phenotypes for gene: FAM177A1 were set to Neurodevelopmental disorder, MONDO_0100500
Review for gene: FAM177A1 was set to GREEN
gene: FAM177A1 was marked as current diagnostic
Added comment: PMID: 38767059
5 individuals from 3 unrelated families reported with with biallelic loss of function variants in FAM177A1. Clinical features included: global developmental delay, intellectual disability, seizures, behavioural abnormalities, hypotonia, gait disturbance, and macrocephaly.

They showed that FAM177A1 localizes to the Golgi complex in mammalian and zebrafish cells. Intersection of the RNA-seq and metabolomic datasets from FAM177A1-deficient human fibroblasts and whole zebrafish larvae demonstrated dysregulation of pathways associated with apoptosis, inflammation, and negative regulation of cell proliferation.

PMID: 25558065
A study of 143 multiplex consanguineous families identified a homozygous frameshift variant in FAM177A1 in 1 family with 4 affected siblings with intellectual disability, dolicocephaly, obesity, and macrocephaly. The variant segregated with all 4 affected siblings and parents were confirmed heterozygous carriers.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.6020 PPFIA3 Zornitza Stark Publications for gene: PPFIA3 were set to 37034625
Intellectual disability syndromic and non-syndromic v0.6018 SSR4 Zornitza Stark Publications for gene: SSR4 were set to
Intellectual disability syndromic and non-syndromic v0.6016 RELN Zornitza Stark Publications for gene: RELN were set to
Intellectual disability syndromic and non-syndromic v0.6012 DPYD Zornitza Stark Publications for gene: DPYD were set to
Intellectual disability syndromic and non-syndromic v0.6006 COG7 Zornitza Stark Publications for gene: COG7 were set to
Intellectual disability syndromic and non-syndromic v0.6003 COG1 Zornitza Stark Publications for gene: COG1 were set to
Intellectual disability syndromic and non-syndromic v0.6001 SSR4 Katie Thompson reviewed gene: SSR4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24218363, 26264460; Phenotypes: intellectual disabilities, hypotonia, microcephaly, seizures, Feeding problems, Facial dysmorphism, Gastrointestinal abnormalities, Failure to thrive, strabismus; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.6000 COL4A1 Zornitza Stark Publications for gene: COL4A1 were set to
Intellectual disability syndromic and non-syndromic v0.5997 SNAP29 Zornitza Stark Publications for gene: SNAP29 were set to
Intellectual disability syndromic and non-syndromic v0.5984 CBL Zornitza Stark Publications for gene: CBL were set to
Intellectual disability syndromic and non-syndromic v0.5981 CACNA1A Zornitza Stark Publications for gene: CACNA1A were set to
Intellectual disability syndromic and non-syndromic v0.5978 C12orf65 Zornitza Stark Publications for gene: C12orf65 were set to
Intellectual disability syndromic and non-syndromic v0.5975 BTD Zornitza Stark Publications for gene: BTD were set to
Intellectual disability syndromic and non-syndromic v0.5972 BSCL2 Zornitza Stark Publications for gene: BSCL2 were set to
Intellectual disability syndromic and non-syndromic v0.5969 BCS1L Zornitza Stark Publications for gene: BCS1L were set to
Intellectual disability syndromic and non-syndromic v0.5966 BCKDHB Zornitza Stark Publications for gene: BCKDHB were set to
Intellectual disability syndromic and non-syndromic v0.5963 BCKDHA Zornitza Stark Publications for gene: BCKDHA were set to
Intellectual disability syndromic and non-syndromic v0.5960 BBS2 Zornitza Stark Publications for gene: BBS2 were set to
Intellectual disability syndromic and non-syndromic v0.5957 BBS12 Zornitza Stark Publications for gene: BBS12 were set to
Intellectual disability syndromic and non-syndromic v0.5954 BBS10 Zornitza Stark Publications for gene: BBS10 were set to
Intellectual disability syndromic and non-syndromic v0.5951 BBS1 Zornitza Stark Publications for gene: BBS1 were set to
Intellectual disability syndromic and non-syndromic v0.5948 TBCE Zornitza Stark Publications for gene: TBCE were set to
Intellectual disability syndromic and non-syndromic v0.5945 SLC25A1 Zornitza Stark Publications for gene: SLC25A1 were set to
Intellectual disability syndromic and non-syndromic v0.5942 ROR2 Zornitza Stark Publications for gene: ROR2 were set to 33937263, 32954672, 32172608
Intellectual disability syndromic and non-syndromic v0.5941 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Intellectual disability syndromic and non-syndromic v0.5938 SOX10 Zornitza Stark Publications for gene: SOX10 were set to
Intellectual disability syndromic and non-syndromic v0.5934 SLC4A4 Zornitza Stark Publications for gene: SLC4A4 were set to
Intellectual disability syndromic and non-syndromic v0.5931 SLX4 Zornitza Stark Publications for gene: SLX4 were set to
Intellectual disability syndromic and non-syndromic v0.5927 SCN8A Zornitza Stark Publications for gene: SCN8A were set to
Intellectual disability syndromic and non-syndromic v0.5924 THRA Zornitza Stark Publications for gene: THRA were set to
Intellectual disability syndromic and non-syndromic v0.5921 SIX3 Zornitza Stark Publications for gene: SIX3 were set to
Intellectual disability syndromic and non-syndromic v0.5918 SAMHD1 Zornitza Stark Publications for gene: SAMHD1 were set to
Intellectual disability syndromic and non-syndromic v0.5916 SCN2A Zornitza Stark Publications for gene: SCN2A were set to
Intellectual disability syndromic and non-syndromic v0.5910 BMP4 Zornitza Stark Publications for gene: BMP4 were set to
Intellectual disability syndromic and non-syndromic v0.5907 CDON Zornitza Stark Publications for gene: CDON were set to
Intellectual disability syndromic and non-syndromic v0.5904 RBBP8 Zornitza Stark Publications for gene: RBBP8 were set to
Intellectual disability syndromic and non-syndromic v0.5900 SAMD9 Zornitza Stark Publications for gene: SAMD9 were set to
Intellectual disability syndromic and non-syndromic v0.5898 LIG4 Zornitza Stark Publications for gene: LIG4 were set to
Intellectual disability syndromic and non-syndromic v0.5893 SLC35A1 Zornitza Stark Publications for gene: SLC35A1 were set to
Intellectual disability syndromic and non-syndromic v0.5889 LRPPRC Zornitza Stark Publications for gene: LRPPRC were set to
Intellectual disability syndromic and non-syndromic v0.5886 TREX1 Zornitza Stark Publications for gene: TREX1 were set to
Intellectual disability syndromic and non-syndromic v0.5883 SERAC1 Zornitza Stark Publications for gene: SERAC1 were set to
Intellectual disability syndromic and non-syndromic v0.5881 SLC19A3 Zornitza Stark Publications for gene: SLC19A3 were set to
Intellectual disability syndromic and non-syndromic v0.5877 SASS6 Zornitza Stark gene: SASS6 was added
gene: SASS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: SASS6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SASS6 were set to 24951542; 30639237
Phenotypes for gene: SASS6 were set to Microcephaly 14, primary, autosomal recessive, MIM# 616402
Review for gene: SASS6 was set to GREEN
Added comment: At least 3 unrelated families reported, severe ID is part of the phenotype.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5875 SPECC1L Zornitza Stark Publications for gene: SPECC1L were set to
Intellectual disability syndromic and non-syndromic v0.5873 GABRA4 Adam Ivey gene: GABRA4 was added
gene: GABRA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GABRA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABRA4 were set to PMID: 38565639
Phenotypes for gene: GABRA4 were set to Developmental delay; Intellectual disability; Epileptic seizures
Penetrance for gene: GABRA4 were set to Complete
Review for gene: GABRA4 was set to GREEN
Added comment: Four unrelated individuals with unique de novo missense variants in the transmembrane domain of GABRA4 have developmental delay and varying degrees of intellectual disability (PMID: 38565639). These variants are not present in gnomAD and three of the four variants have pathogenic REVEL scores. Two of the GABRA4 variants were heterozygous, while the remaining two were mosaic.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5870 LAMC3 Zornitza Stark Publications for gene: LAMC3 were set to
Intellectual disability syndromic and non-syndromic v0.5862 MED12 Zornitza Stark Mode of inheritance for gene: MED12 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5860 MED13L Zornitza Stark Publications for gene: MED13L were set to
Intellectual disability syndromic and non-syndromic v0.5857 MED23 Zornitza Stark Publications for gene: MED23 were set to
Intellectual disability syndromic and non-syndromic v0.5854 MID1 Zornitza Stark Mode of inheritance for gene: MID1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5846 OFD1 Zornitza Stark Publications for gene: OFD1 were set to
Intellectual disability syndromic and non-syndromic v0.5841 PORCN Zornitza Stark Publications for gene: PORCN were set to
Intellectual disability syndromic and non-syndromic v0.5840 PORCN Zornitza Stark Mode of inheritance for gene: PORCN was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5837 SETBP1 Zornitza Stark Marked gene: SETBP1 as ready
Intellectual disability syndromic and non-syndromic v0.5837 SETBP1 Zornitza Stark Gene: setbp1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.5837 SETBP1 Zornitza Stark Phenotypes for gene: SETBP1 were changed from to Schinzel-Giedion syndrome MONDO:0010010; complex neurodevelopmental disorder MONDO:0100038
Intellectual disability syndromic and non-syndromic v0.5836 SETBP1 Zornitza Stark Publications for gene: SETBP1 were set to
Intellectual disability syndromic and non-syndromic v0.5835 SETBP1 Zornitza Stark Mode of inheritance for gene: SETBP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5832 SLC25A15 Zornitza Stark Publications for gene: SLC25A15 were set to
Intellectual disability syndromic and non-syndromic v0.5829 WAC Zornitza Stark Publications for gene: WAC were set to 26264232
Intellectual disability syndromic and non-syndromic v0.5823 SHANK2 Zornitza Stark Publications for gene: SHANK2 were set to
Intellectual disability syndromic and non-syndromic v0.5821 SLC25A15 Rajkumar Krishnaswamy changed review comment from: Rare genetic disorder representing a heterogeneous disease with high clinical variability. Pyramidal dysfunction, developmental, cognitive and behavioural abnormalities have been reported. ID/mental retardation ranging from mild, moderate to severe have been reported in several cases usually manifesting in the childhood or as adult onset.; to: Rare genetic disorder representing a heterogeneous disease with high clinical variability. Lethargy, feeding difficulties, seizures, pyramidal dysfunction, developmental, cognitive and behavioural abnormalities have been reported with various features exhibited at various stages of life e.g. neonates, infantile/childhood and adults.
ID/mental retardation ranging from mild, moderate to severe have been reported in several cases usually manifesting in childhood or adults.
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram reviewed gene: SETBP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28346496, 21037274; Phenotypes: Schinzel-Giedion syndrome MONDO:0010010, complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram commented on gene: SETBP1: Classified DEFINITIVE for both conditions by ClinGen ID and Autism GCEP.

SGS classified on 16/02/2021 - https://search.clinicalgenome.org/CCID:006117
Complex neurodevelopmental disorders on 20/10/2020 - https://search.clinicalgenome.org/CCID:006116

LoF is associated with complex neurodevelopmental disorder. There have been 20 LoF variants reported in individuals so far (nonsense, frameshift, large deletions)

GoF is proposed to be the mechanism of disease for Schinzel-Giedion syndrome (SGS) due to an increase in SETBP1 protein production. Missense variants (especially affecting p.868-871) are known to be disease causing.
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram commented on gene: SETBP1: Classified DEFINITIVE for both conditions by ClinGen ID and Autism GCEP.

SGS classified on 16/02/2021 - https://search.clinicalgenome.org/CCID:006117
Complex neurodevelopmental disorders on 20/10/2020 - https://search.clinicalgenome.org/CCID:006116

LoF is associated with complex neurodevelopmental disorder. There have been 20 LoF variants reported in individuals so far (nonsense, frameshift, large deletions)

GoF is proposed to be the mechanism of disease for Schinzel-Giedion syndrome (SGS) due to an increase in SETBP1 protein production. Missense variants (especially affecting p.868-871) are known to be disease causing.
Intellectual disability syndromic and non-syndromic v0.5821 SETBP1 Sangavi Sivagnanasundram reviewed gene: SETBP1: Rating: GREEN; Mode of pathogenicity: Other; Publications: 28346496, 21037274; Phenotypes: Schinzel-Giedion syndrome MONDO:0010010, complex neurodevelopmental disorder MONDO:0100038; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5821 PORCN Sangavi Sivagnanasundram reviewed gene: PORCN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301712; Phenotypes: focal dermal hypoplasia MONDO:0010592; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 MID1 Sangavi Sivagnanasundram reviewed gene: MID1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005386; Phenotypes: X-linked Opitz G/BBB syndrome MONDO:0010222; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 MED12 Sangavi Sivagnanasundram reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005361; Phenotypes: MED12-related intellectual disability syndrome MONDO:0100000; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 IDS Sangavi Sivagnanasundram reviewed gene: IDS: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:005112; Phenotypes: mucopolysaccharidosis type 2 MONDO:0010674; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 GPC3 Sangavi Sivagnanasundram reviewed gene: GPC3: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004990; Phenotypes: Simpson-Golabi-Behmel syndrome MONDO:0010731; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5821 GDI1 Sangavi Sivagnanasundram reviewed gene: GDI1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004941; Phenotypes: non-syndromic X-linked intellectual disability MONDO:0019181; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5820 SPR Zornitza Stark Publications for gene: SPR were set to
Intellectual disability syndromic and non-syndromic v0.5818 MAST3 Zornitza Stark Publications for gene: MAST3 were set to 34185323
Intellectual disability syndromic and non-syndromic v0.5813 CASK Zornitza Stark Publications for gene: CASK were set to
Intellectual disability syndromic and non-syndromic v0.5809 DHCR7 Zornitza Stark Publications for gene: DHCR7 were set to
Intellectual disability syndromic and non-syndromic v0.5806 DKC1 Zornitza Stark Publications for gene: DKC1 were set to
Intellectual disability syndromic and non-syndromic v0.5800 FLNA Zornitza Stark Publications for gene: FLNA were set to
Intellectual disability syndromic and non-syndromic v0.5799 FLNA Zornitza Stark Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5798 FLNA Sangavi Sivagnanasundram reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004863; Phenotypes: periventricular nodular heterotopia MONDO:0020341; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5798 BCORL1 Sangavi Sivagnanasundram reviewed gene: BCORL1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:004254; Phenotypes: Shukla-Vernon syndrome MONDO:0026727; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5794 DAGLA Zornitza Stark gene: DAGLA was added
gene: DAGLA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DAGLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DAGLA were set to 35737950
Phenotypes for gene: DAGLA were set to Neuroocular syndrome 2, paroxysmal type, MIM# 168885
Review for gene: DAGLA was set to GREEN
Added comment: 9 individuals from 8 families reported with daily paroxysmal spells characterized by eye deviation or nystagmus with abnormal head posturing apparent from birth or early infancy. The episodes tend to be triggered after sleeping, and most patients show improvement of the ocular symptoms over time. Affected individuals also have hypotonia, mild developmental delay, dysarthria, and gait ataxia; most have mildly impaired intellectual development. Seizures are not observed.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5790 NOTCH3 Ain Roesley changed review comment from: Pre-print (https://sciprofiles.com/publication/view/62eb776390415f0166f73fae7cd172ed)

Review of research and diagnostic databases and literature review found 50 individuals from 31 families with biallelic variants.

13 PTCS (including splice) and 15 missense resulting in gain or loss of Cys residue.

AR PTCs are associated with early onset leukoencephalopathy including cognitive decline, dev delay/ID and dysmorphism

AR missense are associated with CADASIL-like phenotype; to: Pre-print (https://sciprofiles.com/publication/view/62eb776390415f0166f73fae7cd172ed)

Review of research and diagnostic databases and literature review found 50 individuals from 31 families with biallelic variants.

13 PTCS (including splice) and 15 missense resulting in gain or loss of Cys residue.

AR PTCs are associated with early onset leukoencephalopathy including cognitive decline, dev delay/ID and dysmorphism; seizures, spasticity, hypotonia, ataxia

AR missense are associated with CADASIL-like phenotype
Intellectual disability syndromic and non-syndromic v0.5789 SLC35C1 Zornitza Stark Publications for gene: SLC35C1 were set to
Intellectual disability syndromic and non-syndromic v0.5786 PRMT9 Chirag Patel gene: PRMT9 was added
gene: PRMT9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRMT9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PRMT9 were set to PMID: 38561334
Phenotypes for gene: PRMT9 were set to Neurodevelopmental disorder, MONDO:0100500
Review for gene: PRMT9 was set to RED
Added comment: A homozygous variant (G189R) in PRMT9 is reported based on large WGS study in 136 consanguineous families - unclear if only found in 1 family and no clinical information on case(s).

PMRTs (protein arginine methyltransferases) catalyse post translational modification via arginine methylation. Functional studies showed that the G189R variant abolishes PRMT9's methyltransferase activity - specifically at the R508 residue of SF3B2 RNA (exclusively methylated by PRMT9) - and leads to heavy PRMT9 ubiquitination, and abnormal splicing activity of SF3B2. Knock out mouse model showed PRMT9 loss in excitatory neurons leads to aberrant synapse development and impaired learning and memory.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5784 PTRH2 Bryony Thompson Publications for gene: PTRH2 were set to 25574476; 28175314; 28328138; 25558065; 27129381
Intellectual disability syndromic and non-syndromic v0.5782 PTRH2 Bryony Thompson reviewed gene: PTRH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33092935, 37239392; Phenotypes: neurologic, endocrine, and pancreatic disease, multisystem, infantile-onset 1 MONDO:8000012; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5781 RNU4-2 Zornitza Stark Publications for gene: RNU4-2 were set to
Intellectual disability syndromic and non-syndromic v0.5776 STRA6 Zornitza Stark Publications for gene: STRA6 were set to
Intellectual disability syndromic and non-syndromic v0.5771 CAPRIN1 Zornitza Stark Phenotypes for gene: CAPRIN1 were changed from Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636 to Neurodevelopmental disorder with language impairment, autism, and attention deficit-hyperactivity disorder, MIM# 620782; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636
Intellectual disability syndromic and non-syndromic v0.5767 BANF1 Zornitza Stark gene: BANF1 was added
gene: BANF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BANF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BANF1 were set to 35982159
Phenotypes for gene: BANF1 were set to Neurodevelopmental disorder, MONDO:0700092, BANF1-related
Review for gene: BANF1 was set to RED
Added comment: Single individual reported with a de novo variant, p.Ala87Thr, and a neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5765 RNU4-2 Zornitza Stark gene: RNU4-2 was added
gene: RNU4-2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU4-2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RNU4-2 were set to Neurodevelopmental disorder, MONDO:0700092, RNU4-2 related
Review for gene: RNU4-2 was set to GREEN
Added comment: Emerging evidence that de novo variants in this gene cause ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5763 YKT6 Zornitza Stark gene: YKT6 was added
gene: YKT6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: YKT6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YKT6 were set to 38522068
Phenotypes for gene: YKT6 were set to Syndromic disease, MONDO:0002254, YKT6-related
Review for gene: YKT6 was set to AMBER
Added comment: Two individuals homozygous for YKT6 [NM_006555.3:c.554A>G p.(Tyr185Cys)] exhibited normal prenatal course followed by failure to thrive, developmental delay and progressive liver disease. Haplotype analysis identified a shared homozygous region flanking the variant, suggesting a common ancestry. The third individual homozygous for YKT6 [NM_006555.3:c.191A>G p.(Tyr64Cys)] exhibited neurodevelopmental disorders and optic atrophy. Supportive functional data in Drosophila. Amber rating due to homozygous missense variants and founder effect in two of the families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5761 SEPHS1 Zornitza Stark gene: SEPHS1 was added
gene: SEPHS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SEPHS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SEPHS1 were set to 38531365
Phenotypes for gene: SEPHS1 were set to Neurodevelopmental disorder, MONDO:0700092, SEPHS1-related
Review for gene: SEPHS1 was set to GREEN
Added comment: Nine individuals from eight families with developmental delay, growth and feeding problems, hypotonia, and dysmorphic features, all with heterozygous missense variants in SEPHS1. Eight of these individuals had a recurrent variant at amino acid position 371 of SEPHS1 (p.Arg371Trp, p.Arg371Gln, and p.Arg371Gly); seven of these variants were known to be de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5759 GLUL Zornitza Stark Publications for gene: GLUL were set to
Intellectual disability syndromic and non-syndromic v0.5756 GTF3C5 Bryony Thompson gene: GTF3C5 was added
gene: GTF3C5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GTF3C5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF3C5 were set to 38520561; 35503477
Phenotypes for gene: GTF3C5 were set to neurodevelopmental disorder MONDO:0700092, GTF3C5-related
Review for gene: GTF3C5 was set to GREEN
gene: GTF3C5 was marked as current diagnostic
Added comment: 4 families/probands with syndromic ID. Loss of function is the expected
PMID: 38520561 - Biallelic variants identified (3 missense & 1 stopgain) in 4 individuals from 3 families presenting with multisystem developmental syndrome including the features: growth retardation, developmental delay, intellectual disability, dental anomalies, cerebellar malformations, delayed bone age, skeletal anomalies, and facial dysmorphism. Gene-disease relationship supported by: reduced protein expression in patient cells, yeast assays, and a zebrafish model
PMID: 35503477 - 1 proband with biallelic missense variants and hypomelanosis of Ito, seizures, growth retardation, abnormal brain MRI, developmental delay, and facial dysmorphism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5753 DISP1 Zornitza Stark Publications for gene: DISP1 were set to 19184110; 26748417; 23542665
Intellectual disability syndromic and non-syndromic v0.5749 DOCK4 Bryony Thompson Publications for gene: DOCK4 were set to
Intellectual disability syndromic and non-syndromic v0.5745 FRYL Ain Roesley gene: FRYL was added
gene: FRYL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FRYL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FRYL were set to 38479391
Phenotypes for gene: FRYL were set to neurodevelopmental disorder MONDO:0700092, FRYL-related
Review for gene: FRYL was set to GREEN
gene: FRYL was marked as current diagnostic
Added comment: 14 individuals, all de novo except 1x duo testing (not present in tested father)
5x missense + 8x fs/stopgain + 1x canonical splice

13/13 with ID/DD (1x deceased)
4/14 seizures
7/14 with cardiac anomalies such as PDA, TOF, VSD, dextrocardia

1x also has a de novo fs variant in SF3B4
1x also has a de novo stop gain variant in SDHA

functional studies using flies were performed
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5743 KCNB2 Ain Roesley gene: KCNB2 was added
gene: KCNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNB2 were set to 38503299
Phenotypes for gene: KCNB2 were set to neurodevelopmental disorder MONDO:0700092, KCNB2-related
Review for gene: KCNB2 was set to GREEN
gene: KCNB2 was marked as current diagnostic
Added comment: 7 individuals, all missense
5 de novo + 1x inherited from father who has hypotonia + 1x from asymptomatic father

2/5 MRI anomalies
2/5 cardiac anomalies
2/7 urogenital anomalies
7/7 with ID
2/7 epilepsy
2/7 hypotonia
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5741 PLXNB2 Chirag Patel gene: PLXNB2 was added
gene: PLXNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLXNB2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLXNB2 were set to PMID: 38458752
Phenotypes for gene: PLXNB2 were set to Amelogenesis imperfecta MONDO:0019507, PLXNB2 -related; Sensorineural hearing loss disorder MONDO:0020678, PLXNB2 -related
Review for gene: PLXNB2 was set to GREEN
gene: PLXNB2 was marked as current diagnostic
Added comment: 8 individuals from 6 families with core features of amelogenesis imperfecta and sensorineural hearing loss. Intellectual disability, ocular disease, ear developmental abnormalities and lymphoedema were also present in multiple cases. WES and WGS identified biallelic pathogenic variants in PLXNB2 (missense, nonsense, splice and a multiexon deletion variants). Variants segregated with disease.

PLXNB2 is a large transmembrane semaphorin receptor protein, and semaphorin-plexin signalling controls cellular interactions that are critical during development as well as in adult life stages. Plxnb2 expression was detected in differentiating ameloblasts in mice. Human phenotype overlaps with that seen in Plxnb2 knockout mice.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5738 CEP295 Chirag Patel gene: CEP295 was added
gene: CEP295 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CEP295 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP295 were set to PMID: 38154379
Phenotypes for gene: CEP295 were set to Seckel syndrome 11, OMIM # 620767
Review for gene: CEP295 was set to GREEN
gene: CEP295 was marked as current diagnostic
Added comment: 4 children from 2 unrelated families with Seckel-like syndrome - severe primary microcephaly, short stature, developmental delay, intellectual disability, facial deformities, and abnormalities of fingers and toes. WES identified biallelic pathogenic variants in CEP295 gene (p(Q544∗) and p(R1520∗); p(R55Efs∗49) and p(P562L)).

Patient-derived fibroblasts and CEP295-depleted U2OS and RPE1 cells were used to clarify the underlying mechanisms. Depletion of CEP295 resulted in a decrease in the numbers of centrioles and centrosomes and triggered p53-dependent G1 cell cycle arrest. Loss of CEP295 caused extensive primary ciliary defects in both patient-derived fibroblasts and RPE1 cells. The results from complementary experiments revealed that the wild-type CEP295, but not the mutant protein, can correct the developmental defects of the centrosome/centriole and cilia in the patient-derived skin fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5736 USP27X Zornitza Stark Publications for gene: USP27X were set to 25644381
Intellectual disability syndromic and non-syndromic v0.5733 FEM1B Zornitza Stark Publications for gene: FEM1B were set to 31036916
Intellectual disability syndromic and non-syndromic v0.5731 FEM1B Zornitza Stark edited their review of gene: FEM1B: Added comment: Five individuals reported now with same recurrent missense variant, NM_015322.5:c.377G>A NP_056137.1:p.(Arg126Gln). Affected individuals shared a severe neurodevelopmental disorder with behavioral phenotypes and a variable set of malformations, including brain anomalies, clubfeet, skeletal abnormalities, and facial dysmorphism. Overexpression of the the FEM1BR126Q variant but not FEM1B wild-type protein, during mouse brain development, resulted in delayed neuronal migration of the target cells.; Changed rating: GREEN; Changed publications: 31036916, 38465576; Changed phenotypes: Syndromic disease MONDO:0002254, FEM1B-related
Intellectual disability syndromic and non-syndromic v0.5729 USP14 Zornitza Stark gene: USP14 was added
gene: USP14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: USP14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: USP14 were set to 38469793; 35066879
Phenotypes for gene: USP14 were set to Syndromic disease MONDO:0002254, USP14-related
Review for gene: USP14 was set to AMBER
Added comment: AMBER rating as two of the families had affected fetuses, one had a severely affected newborn, and fourth had a progressive course: none fit well with ID, though there's likely to be a continuum.

PMID 35066879: 3 fetuses from 2 different branches of a consanguineous family, presenting with distal arthrogryposis, underdevelopment of the corpus callosum, and dysmorphic facial features. Exome sequencing identified a biallelic 4-bp deletion (c.233_236delTTCC; p.Leu78Glnfs*11) in USP14, and sequencing of family members showed segregation with the phenotype. Ubiquitin-specific protease 14 (USP14) encodes a major proteasome-associated deubiquitinating enzyme with an established dual role as an inhibitor and an activator of proteolysis, maintaining protein homeostasis. Usp14-deficient mice show a phenotype similar to lethal human multiple congenital contractures phenotypes, with callosal anomalies, muscle wasting, and early lethality, attributed to neuromuscular junction defects due to decreased monomeric ubiquitin pool. RT-qPCR experiment in an unaffected heterozygote revealed that mutant USP14 was expressed, indicating that abnormal transcript escapes nonsense-mediated mRNA decay.

PMID 38469793: biallelic USP14 variants in four individuals from three unrelated families: one fetus, a newborn with a syndromic NDD, and two siblings affected by a progressive neurological disease. Specifically, the two siblings from the latter family carried two compound heterozygous variants c.8T>C p.(Leu3Pro) and c.988C>T p.(Arg330*), while the fetus had a homozygous frameshift c.899_902del p.(Lys300Serfs*24) variant and the newborn patient harbored a homozygous frameshift c.233_236del p.(Leu78Glnfs*11) variant. The fetus and the newborn had extensive brain malformations.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5724 ZFHX3 Zornitza Stark Publications for gene: ZFHX3 were set to 37292950
Intellectual disability syndromic and non-syndromic v0.5722 PTRHD1 Zornitza Stark Phenotypes for gene: PTRHD1 were changed from Parkinsonism; Intellectual disability to Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747
Intellectual disability syndromic and non-syndromic v0.5721 PTRHD1 Zornitza Stark edited their review of gene: PTRHD1: Changed phenotypes: Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747
Intellectual disability syndromic and non-syndromic v0.5717 CELSR3 Crystle Lee gene: CELSR3 was added
gene: CELSR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELSR3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CELSR3 were set to PMID: 38429302
Phenotypes for gene: CELSR3 were set to Neurodevelopmental disorder (MONDO#0700092), CELSR3-related
Review for gene: CELSR3 was set to GREEN
Added comment: PMID: 38429302:12 affected individuals from 11 families reported with bi-allelic variants. Phenotype ranged from CNS anomalies (7/12), CNS and CAKUT (3/12) and CAKUT only (2/12). 8/12 has ID/DD. Only missense variants reported and 1 inframe variant. Functional studies done in zebrafish demonstrate similar structural anomalies of the developing pronephros and neuronal abnormalities to affected individuals
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5715 ZSCAN10 Rylee Peters gene: ZSCAN10 was added
gene: ZSCAN10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZSCAN10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZSCAN10 were set to PMID: 38386308
Phenotypes for gene: ZSCAN10 were set to Syndromic disease MONDO:0002254
Review for gene: ZSCAN10 was set to GREEN
Added comment: Bi-allelic ZSCAN10 loss-of-function variants were identified in seven affected individuals from five unrelated families with syndromic neurodevelopmental disorder.

Highly consistent phenotypic features include global developmental delay, behavioural abnormalities, and variable facial asymmetry with outer and inner ear malformations leading to profound SNHL.

Facial asymmetry was recapitulated in the Zscan10 mouse model along with inner and outer ear malformations.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5715 SNF8 Elena Savva Phenotypes for gene: SNF8 were changed from Severe developmental delay, epileptic encephalopathy, brain MRI abnormality; intellectual disability, childhood-onset optic atrophy, ataxia to Neurodevelopmental disorder (MONDO:0700092), SNF8-related
Intellectual disability syndromic and non-syndromic v0.5715 POP1 Ain Roesley Publications for gene: POP1 were set to
Intellectual disability syndromic and non-syndromic v0.5714 SLC12A9 Zornitza Stark gene: SLC12A9 was added
gene: SLC12A9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC12A9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC12A9 were set to 38334070
Phenotypes for gene: SLC12A9 were set to Neurodevelopmental disorder, MONDO:0700092, SLC12A9-related
Review for gene: SLC12A9 was set to GREEN
Added comment: Three individuals from unrelated families with bi-allelic LoF variants and a neurodevelopmental phenotype, skeletal abnormalities, brain abnormalities, hypopigmentation, dysmorphic features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5713 DIP2C Melanie Marty gene: DIP2C was added
gene: DIP2C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DIP2C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DIP2C were set to PMID: 38421105
Phenotypes for gene: DIP2C were set to Neurodevelopmental disorder (MONDO#0700092), DIP2C-related
Review for gene: DIP2C was set to GREEN
Added comment: PMID: 38421105 - Twenty three patients with het DIP2C variants (10 de novo).
All patients had developmental delays affecting expressive language and speech, most had mild dev delay and ID. Four patients had seizures. Additional phenotypic findings were non-specific but recurrent anomalies did include a high anterior hair-line, prominent forehead, and a broad nasal tip. Four patients had cardiac defects (hypertrophic cardiomyopathy, atrial septal defects,and bicuspid aortic valve)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5713 DENND5B Elena Savva Publications for gene: DENND5B were set to
Intellectual disability syndromic and non-syndromic v0.5712 SNF8 Chern Lim gene: SNF8 was added
gene: SNF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNF8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNF8 were set to 38423010
Phenotypes for gene: SNF8 were set to Severe developmental delay, epileptic encephalopathy, brain MRI abnormality; intellectual disability, childhood-onset optic atrophy, ataxia
Review for gene: SNF8 was set to GREEN
gene: SNF8 was marked as current diagnostic
Added comment: PMID: 38423010
- Nine individuals from six families presenting with a spectrum of neurodevelopmental/neurodegenerative features caused by bi-allelic variants in SNF8. In total, three putative LoF variants and four missense variants were identified.
- The phenotypic spectrum included four individuals with severe developmental and epileptic encephalopathy, massive reduction of white matter, hypo-/aplasia of the corpus callosum, neurodevelopmental arrest, and early death. A second cohort shows a milder phenotype with intellectual disability, childhood-onset optic atrophy, or ataxia. All mildly affected individuals shared the same hypomorphic variant, c.304G>A (p.Val102Ile) as compound heterozygous.
- Functional studies using fibroblasts derived from patients and zebrafish model showed LoF is the disease mech.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5711 RREB1 Zornitza Stark gene: RREB1 was added
gene: RREB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RREB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RREB1 were set to 32938917; 38332451
Phenotypes for gene: RREB1 were set to Rasopathy, MONDO:0021060, RREB1-related
Review for gene: RREB1 was set to AMBER
Added comment: PMID 32938917: Single individual reported with Noonan syndrome-like features and a deletion encompassing RREB1. Overlapping deletions in publicly reported databases examined, and RREB1 postulated to be the key gene. Rreb1 hemizygous mice display orbital hypertelorism and age dependent cardiac hypertrophy. RREB1 recruits SIN3A and KDM1A to an RRE in target promoters in human and murine cells to control histone H3K4 methylation of MAPK pathway genes. In summary, single well phenotyped individual with a CNV and experimental data to support gene-disease association.

PMID 38332451: de novo LoF variant in an individual with phenotype consistent with the previous reports.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5709 FEZF2 Ain Roesley gene: FEZF2 was added
gene: FEZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FEZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FEZF2 were set to 38425142
Phenotypes for gene: FEZF2 were set to neurodevelopmental disorder MONDO:0700092, FEZF2-related
Review for gene: FEZF2 was set to GREEN
gene: FEZF2 was marked as current diagnostic
Added comment: - 7 indiv but 1 has whole gene deletion and 6x SNV (4x PTCs and 2x same missense Arg344Cys)
- of the 6x SNV, 4x de novo + 1x from affected father
- all have ID/ASD
- 1x seizures
- 1x hypotonia
- 1x motor coordination disorder
- 2x enuresis after 7yo
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5706 ZFX Sarah Leigh gene: ZFX was added
gene: ZFX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZFX was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: ZFX were set to 26350204; 26740508; 38325380
Phenotypes for gene: ZFX were set to X-linked neurodevelopmental disorder with recurrent facial gestalt
Review for gene: ZFX was set to GREEN
Added comment: To date, germline variants in ZFX have not been associated with a phenotype in OMIM or Gen2Phen.
A single ZFX variant has been associated with a neurodevelopmental disorder, that has a Rett syndrome-like phenotype disorder, in a 14 year old male. The ZFX variant was allelic with another X-linked variant in SHROOM4. These variants were inherited from the mother, who had random X inactivation pattern (PMID: 26740508).
PMID: 38325380 reports 11 ZFX variants in 18 subjects from 16 unrelated families (14 males and 4 females) with an X-linked neurodevelopmental disorder with recurrent facial gestalt. Seven variants were truncating and the remaining were missense variants within the Zinc finger array. In the pedigree of family 6 (figure 3, PMID: 38325380), it was apparent that there were female carriers of the ZFX variant (GRCh38 chrX: 24229396A>G, c.2438A>G, p.Tyr774Cys) with hyperparathyroidism and two affected males and one affected female, with the neurodevelopmental disorder. It appeared that skewed X-inactivation in the female carriers was responsible for the different phenotypic features. The association between ZFX variants and a novel neurodevelopmental disorder, was further supported by functional studies showing altered transcriptional activity in missense variants and altered behavior in a zebrafish loss-of-function model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5702 HMBS Zornitza Stark Publications for gene: HMBS were set to 15534187
Intellectual disability syndromic and non-syndromic v0.5700 HMBS Zornitza Stark gene: HMBS was added
gene: HMBS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: HMBS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HMBS were set to 15534187
Phenotypes for gene: HMBS were set to Encephalopathy, porphyria-related MIM#620704; Leukoencephalopathy, porphyria-related, MIM#620711
Review for gene: HMBS was set to GREEN
Added comment: Several families reported with encephalopathy/leukoencephalopathy and ballelic variants in this gene.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5699 DDX3X Abhijit Kulkarni changed review comment from: Genotype-Phenotype Correlations

Females. Affected females with a subset of missense variants generally are more severely affected than those with truncating variants [Lennox et al 2020].

Polymicrogyria has been associated with missense or in-frame deletions [Lennox et al 2020].

Males. While all affected males have had missense DDX3X variants (see Table 6), their female relatives who are heterozygous for the same DDX3X variant do not manifest an atypical neurodevelopmental phenotype.; to: Genotype-Phenotype Correlations

Females. Affected females with a subset of missense variants generally are more severely affected than those with truncating variants PMID: 32135084

Polymicrogyria has been associated with missense or in-frame deletions PMID: 32135084

Males. While all affected males have had missense DDX3X variants , their female relatives who are heterozygous for the same DDX3X variant do not manifest an atypical neurodevelopmental phenotype.
Intellectual disability syndromic and non-syndromic v0.5696 NDUFB9 Zornitza Stark Publications for gene: NDUFB9 were set to 22200994
Intellectual disability syndromic and non-syndromic v0.5692 ASCC3 Zornitza Stark gene: ASCC3 was added
gene: ASCC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: ASCC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ASCC3 were set to 21937992; 35047834
Phenotypes for gene: ASCC3 were set to Intellectual developmental disorder, autosomal recessive 81, MIM# 620700
Review for gene: ASCC3 was set to GREEN
Added comment: Combined neuromuscular and neurobehavioral phenotype.

11 individuals from 7 unrelated families with homozygous (missense) or compound heterozygous variants (missense with a presumed LoF variant or 2 missense, no biallelic LoF) with a neurologic phenotype that ranges from severe developmental delay to muscle fatigue
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5687 WDR44 Zornitza Stark gene: WDR44 was added
gene: WDR44 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR44 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: WDR44 were set to 38191484
Phenotypes for gene: WDR44 were set to Ciliopathy, MONDO:0005308, WDR44-related
Review for gene: WDR44 was set to GREEN
Added comment: 11 male patients with 6 missense and 1 nonsense variant in WDR44 displaying a wide range of cognitive impairment and variable congenital anomalies associated with primary cilium dysfunction. All patients had learning difficulties with 8 labelled as intellectually disabled (mild-moderate). Other clinical features included anomalies of craniofacial, musculoskeletal, brain, renal and cardiac development.
WDR44 is a negative regulator of ciliogenesis. Increased binding is hypothesised to underlie the pathogenicity of WDR44 variants identified in this cohort. Functional data supported impaired ciliogenesis initiation in patient fibroblasts and a zebrafish model. A zebrafish model recapitulated the human phenotype when morphants expressed WDR44 L668S, D669N, S764F, G782C, H839R, and R733* variants. Of note, D648G or N840S did not recapitulate the phenotype in the zebrafish model.
The studies supported a GoF mechanism, but the authors could not rule out that LoF of WDR44 contributes to the ciliopathy-like phenotype observed, because protein expression data was only available for a limited number of patients.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5685 ACACA Zornitza Stark gene: ACACA was added
gene: ACACA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ACACA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ACACA were set to 34552920; 10677481; 16717184; 36709796
Phenotypes for gene: ACACA were set to Acetyl-CoA carboxylase deficiency, MIM# 613933
Review for gene: ACACA was set to AMBER
Added comment: Two families with molecular testing, missense variants, supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5683 SP9 Suliman Khan gene: SP9 was added
gene: SP9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SP9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SP9 were set to PMID: 38288683
Phenotypes for gene: SP9 were set to neurodevelopmental disorder MONDO:0700092
Review for gene: SP9 was set to GREEN
Added comment: PMID: 38288683: reported 5 unrelated patients with de novo heterozygous variants (missense and PTV) in SP9 gene. In silico and in vitro studies suggested a novel form of interneuronopathy with variable severity depending on the presence of loss or gain of function variants. Patients with loss-of-function variants had ID, ASD, and epilepsy, whereas missense variants in the second C2H2 binding domain result in hypomorphic and neomorphic DNA binding functions that cause severe epileptic encephalopathy. The author suggested a novel form of interneuronopathy with variable severity depending on the presence of loss or gain of function variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5682 CAMK2D Elena Savva gene: CAMK2D was added
gene: CAMK2D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAMK2D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CAMK2D were set to PMID: 38272033
Phenotypes for gene: CAMK2D were set to Neurodevelopmental disorder (MONDO#0700092), CAMK2D-related
Review for gene: CAMK2D was set to GREEN
Added comment: PMID: 38272033
- 8 patients (5/8 de novo) with mostly missense and a single splice site variant, ages range from 5 weeks to 20 years old
- Most variants functionally shown to have a GOF mechanism causing addition DCM phenotype, LOF is only neurological
- Phenotypes include dev delay (mild-severe) (7/7 patients), skeletal anomalies (7/8, scoliosis, kyphosis, involving spine/hands/feet/palate), DCM (6/8), seizures (3/8), visual anomalies (astigmatism, cortical vision impairment, myopia, strabismus 5/5), enlarged brain ventricles (3/5)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5680 RBMX Zornitza Stark Publications for gene: RBMX were set to 25256757; 34260915
Intellectual disability syndromic and non-syndromic v0.5666 PPFIA3 Zornitza Stark gene: PPFIA3 was added
gene: PPFIA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPFIA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPFIA3 were set to 37034625
Phenotypes for gene: PPFIA3 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA3-related
Review for gene: PPFIA3 was set to GREEN
Added comment: 19 individuals with mono-allelic variants presenting with features including developmental delay, intellectual disability, hypotonia, micro/macrocephaly, autism, and epilepsy.

One individual with compound het variants: insufficient evidence for bi-allelic variants causing disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5661 MAX Rylee Peters gene: MAX was added
gene: MAX was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAX were set to 38141607
Phenotypes for gene: MAX were set to Syndromic disease (MONDO:0002254), MAX-related
Review for gene: MAX was set to GREEN
Added comment: Three individuals who each share a recurrent de novo germline variant in the MAX gene, resulting in a p.Arg60Gln substitution in the loop of the b-HLH-LZ domain.

Affected individuals have a complex disorder consisting primarily of macrocephaly, polydactyly, and delayed ophthalmic development. Other phenotypes reported include intellectual disability, perianal abscesses, pectus carinatum, hypospadias, renal agenesis, single umbilical artery, flattened thoracic vertebrae.

Functional analysis of the p.Arg60Gln variant shows a significant increase in CCND2 protein and a more efficient heterodimerization with c-Myc resulting in an increase in transcriptional activity of c-Myc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 ZRSR2 Chris Ciotta gene: ZRSR2 was added
gene: ZRSR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZRSR2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ZRSR2 were set to PMID: 38158857
Phenotypes for gene: ZRSR2 were set to Orofacialdigital syndrome MONDO:0015375, ZRSR2-related
Review for gene: ZRSR2 was set to GREEN
Added comment: Oral-facial-digital (OFD) syndrome with brain anomalies ranging from alobar holoprosencephaly to pituitary anomalies.
Six unrelated families with two truncating variants and functional studies:
- p.(Gly404GlufsTer23): detected in one family with 2x affected males
- p.(Arg403GlyfsTer24): 5 unrelated families, both de novo and inherited
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 CACHD1 Suliman Khan gene: CACHD1 was added
gene: CACHD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CACHD1 were set to PMID: 38158856
Phenotypes for gene: CACHD1 were set to syndromic complex neurodevelopmental disorder MONDO:0800439
Penetrance for gene: CACHD1 were set to unknown
Review for gene: CACHD1 was set to GREEN
Added comment: PMID: 38158856 - Six affected individuals from four unrelated families with homozygous CACHD1 variants (3 splice, 2 frameshift and 1 nonsense variant). Excluding the two fatal cases, all other were affected by syndromic neurodevelopmental abnormalities, multiple organ systems featuring global impairment of psychomotor development, dysmorphic facial features, genitourinary abnormalities, oculo-auricular and congenital malformation. Seizure was reported in one case. Whole exome sequencing identified bi-allelic loss of function variants in the CACHD1 gene. In vitro human neural models of CACHD1 depletion displayed dysregulated of Wnt signaling in the developing brain.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 SOX8 Paul De Fazio gene: SOX8 was added
gene: SOX8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SOX8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SOX8 were set to https://www.neurology.org/doi/full/10.1212/NXG.0000000000200088
Phenotypes for gene: SOX8 were set to Neurodevelopmental disorder (MONDO:0700092), SOX8-related
Review for gene: SOX8 was set to RED
gene: SOX8 was marked as current diagnostic
Added comment: Proband presented to genetics clinic at 27 years of age with BMI -3.4SD, height -2.7SD, head circumference -1.8SD. She had mild intellectual delay and clinical features of a congenital, nonprogressive myopathy with moderate proximal and distal weakness. X-rays showed skeletal dysplasia, including cervical thoracic scoliosis and lumbar scoliosis. She was reported as having had weakness at birth with poor suck, micrognathia, hypotonia, and talipes. She was documented to have significant motor delay as a child. MRI of the brain demonstrated large posterior fossa CSF spaces.

Biallelic SOX8 variants biallelic (NM_014587.3:c.422+5G>C; c.583dup p.(His195ProfsTer11)) were identified by WGS. The +5 variant was shown to affect splicing, while the frameshift variant resulted in production of low-level truncated protein (not NMD predicted).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5660 BORCS8 Lauren Rogers gene: BORCS8 was added
gene: BORCS8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BORCS8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BORCS8 were set to 38128568
Phenotypes for gene: BORCS8 were set to Neurodevelopmental disorder (MONDO#0700092), BORCS8-related
Review for gene: BORCS8 was set to GREEN
Added comment: 3 unrelated families with five affected children with homozygous or compound heterozygous loss of function missense and PTC variants.

HEK293T cells show the missense variants are expressed at normal levels but exhibit reduced assembly with other BORC subunits and reduced ability to drive lysosome distribution. The BORCS8 PTC frameshift variant is expressed at lower levels and is completely incapable of assembling with other BORC subunits and promoting lysosome distribution. Zebrafish KO of the orthologous brocs8 causes decreased brain and eye size, neuromuscular anomalies and impaired locomotion, recapitulating some of the key traits of the human disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5659 GTPBP1 Lucy Spencer gene: GTPBP1 was added
gene: GTPBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GTPBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTPBP1 were set to 38118446
Phenotypes for gene: GTPBP1 were set to Neurodevelopmental disorder (MONDO#0700092), GTPBP1-related
Review for gene: GTPBP1 was set to GREEN
Added comment: PMID: 38118446- Cohort of individuals with variants in GTPBP2 (which has been previously described) and GTPBP1 (new) who have an identical neurodevelopmental syndrome. 4 homozygous individuals from 3 consanguineous families. 2 families have different NMD-predicted nonsense variants and the third has a missense, all are absent from gnomad v4.

The shared cardinal features of GTPBP1 and 2 related disease are microcephaly, profound neurodevelopmental impairment, and distinctive craniofacial features. Epilepsy was present in 10 of 20 individuals but its not clear if those individuals had GTPBP1 or 2 variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5658 ALG8 Zornitza Stark Publications for gene: ALG8 were set to 26066342
Intellectual disability syndromic and non-syndromic v0.5656 PRICKLE2 Zornitza Stark Publications for gene: PRICKLE2 were set to PMID: 34092786
Intellectual disability syndromic and non-syndromic v0.5649 CAPRIN1 Zornitza Stark Phenotypes for gene: CAPRIN1 were changed from Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636 to Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636
Intellectual disability syndromic and non-syndromic v0.5648 CAPRIN1 Zornitza Stark Phenotypes for gene: CAPRIN1 were changed from Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092 to Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092; Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636
Intellectual disability syndromic and non-syndromic v0.5648 CAPRIN1 Zornitza Stark Publications for gene: CAPRIN1 were set to 35979925; 35977029; 28135719; 31398340
Intellectual disability syndromic and non-syndromic v0.5647 CAPRIN1 Zornitza Stark reviewed gene: CAPRIN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 36136249; Phenotypes: Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.5646 MANF Zornitza Stark gene: MANF was added
gene: MANF was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: MANF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MANF were set to 26077850; 33500254; 34815294
Phenotypes for gene: MANF were set to Diabetes, deafness, developmental delay, and short stature syndrome, MIM# 620651
Review for gene: MANF was set to AMBER
Added comment: Two individuals reported with homozygous variants. Mouse model recapitulates deafness phenotype.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5641 PRPF19 Zornitza Stark gene: PRPF19 was added
gene: PRPF19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRPF19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRPF19 were set to 37962958
Phenotypes for gene: PRPF19 were set to Neurodevelopmental disorder (MONDO:0700092), PRPF19-related
Review for gene: PRPF19 was set to GREEN
Added comment: PMID: 37962958 Six unrelated individuals with de novo variants. Five had speech language motor delay, four had formal diagnosis of autism, three hypotonia and one fetus with multiple congenital abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5641 PRPF19 Zornitza Stark gene: PRPF19 was added
gene: PRPF19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRPF19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRPF19 were set to 37962958
Phenotypes for gene: PRPF19 were set to Neurodevelopmental disorder (MONDO:0700092), PRPF19-related
Review for gene: PRPF19 was set to GREEN
Added comment: PMID: 37962958 Six unrelated individuals with de novo variants. Five had speech language motor delay, four had formal diagnosis of autism, three hypotonia and one fetus with multiple congenital abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5635 FUK Zornitza Stark Publications for gene: FUK were set to 30503518
Intellectual disability syndromic and non-syndromic v0.5631 SV2A Karina Sandoval gene: SV2A was added
gene: SV2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SV2A was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: SV2A were set to PMID: 37985816
Phenotypes for gene: SV2A were set to Epilepsy, MONDO:0005027; microcephaly MONDO:0001149; intellectual disability MONDO:0001071
Review for gene: SV2A was set to AMBER
Added comment: Monoallelic variants cause epilepsy. Biallelic variant in this 5yo with p.Arg289Ter and another 5yo from another paper with homozygous p.Arg383Gln, reported to cause severe phenotype of drug-resistant epileptic encephalopathy with microcephaly, DD, movement disorder and growth retardation.
This paper references 5 other families with both AR & AD
Family #1 – p.Arg383Gln, AR, 2 affected in family, parents healthy carriers
Family #2 – p.Arg570Cys, AD, 2 affected, inherited from affected mother (in gnomAD v2 1 het, absent from gnomAD v3)
Family #3 – p.Gly660Arg, AD, de novo
Family #4 – p.Gly660Arg, AD, segregated in 11 family members
Family #5 (this study) – p.Arg289Ter, AR, parents and 2 sibs asymptomatic carriers
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5631 CRELD1 Naomi Baker gene: CRELD1 was added
gene: CRELD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CRELD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRELD1 were set to PMID: 37947183
Phenotypes for gene: CRELD1 were set to Neurodevelopmental disorder (MONDO:0700092), CRELD1-related
Review for gene: CRELD1 was set to GREEN
Added comment: Publication reports 18 individuals from 14 unrelated families affected by biallelic recessive variants in CRELD1, presenting with early-onset neurodevelopmental features, most notably hypotonia and epilepsy, with developmental plateauing and slowly progressive nonneurologic medical complexities in survivors, including cardiac rhythm disturbances and frequent infections. Most individuals have a missense variant in trans with a putative null allele. Four variants were re-current: p.(Cys192Tyr) in 10 families, p.(Gln320Argfs) in 5 families, p.(Ala377Thrfs) in 2 families, and p.(Met369Val) also in 2 families. Some functional studies also reported (Xenopus tropicalis).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5631 RAB1A Chris Ciotta gene: RAB1A was added
gene: RAB1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB1A were set to PMID: 37924809
Phenotypes for gene: RAB1A were set to neurodevelopmental disorder MONDO:0700092, CASP2-related
Review for gene: RAB1A was set to AMBER
Added comment: 4 families and 5 individuals, 2/5 have speech delay and 4/5 have motor delay.
Anxiety in 3/5 and autism in 2/5. Microcephaly in only one individual, spastic paraplegia observed in 2 individuals from one family.
In 2 families variants were inherited from an affected parent.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5628 PLA2G16 Lauren Rogers gene: PLA2G16 was added
gene: PLA2G16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLA2G16 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PLA2G16 were set to PMID: 37919452
Phenotypes for gene: PLA2G16 were set to Lipodystrophy (MONDO:0006573)
Added comment: 7 patients from 4 unrelated consanguineous families with homozygous loss of function PTC variants. Features: 4/7 metabolic features, 6/7 neurological/skeletal features, 3/7 Psychomotor retardation/intellectual disability, 5/7 demyelinating peripheral neuropathy.

Null mouse and patient derived white adipose tissue showed enrichment of arachidonic acid-containing membrane phospholipids and a strong decrease in PPARγ. CRISPR–Cas9-mediated PLAAT3 inactivation in human adipose stem cells induced insulin resistance, altered adipocyte differentiation with decreased lipid droplet formation and reduced the expression of adipogenic and mature adipocyte markers, including PPARγ.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5628 MARK4 Rylee Peters changed review comment from: Missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother.

Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway.
Sources: Literature; to: Heterozygous missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother.

Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5627 DDX17 Melanie Marty gene: DDX17 was added
gene: DDX17 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DDX17 were set to https://www.medrxiv.org/search/DDX17
Phenotypes for gene: DDX17 were set to Neurodevelopmental disorder (MONDO#0700092), DDX17-related
Review for gene: DDX17 was set to GREEN
Added comment: https://www.medrxiv.org/search/DDX17 (pre-print)
11 patients with het de novo variants in DDX17 (5 NMD, 6 missense). Patient's phenotype included mild-moderate intellectual disability, delayed speech and language development and global developmental delay. 64% had dysmorphic facial features. Some patients also have gross and fine motor delay, generalized hypotonia, stereotypy, and evidence of autism spectrum disorder.

Knockdown of Ddx17 in newborn mice showed impaired axon outgrowth and reduced axon outgrowth and branching was observed in primary cortical neurons in vitro. This result was replicated in Crispant Xenopus tadpoles, which had clear functional neural defects and showed an impaired neurobehavioral phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5627 MARK4 Rylee Peters gene: MARK4 was added
gene: MARK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MARK4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MARK4 were set to PMID: 38041405
Phenotypes for gene: MARK4 were set to neurodevelopmental disorder (MONDO:0700092), MARK4-related
Mode of pathogenicity for gene: MARK4 was set to Other
Review for gene: MARK4 was set to AMBER
gene: MARK4 was marked as current diagnostic
Added comment: Missense variant, c.604T>C; p.Phe202Leu, identified in two siblings with childhood-onset neurodevelopmental disorder characterised by global developmental delay, intellectual disability, behavioural abnormalities, and dysmorphic features. The variant is located in the catalytic domain of the kinase, and is inherited from unaffected mosaic mother.

Functional investigation revealed that the variant results in a gain-of-function in the ability of MARK4 to phosphorylate tau and leads to up-regulation of the mTORC1 pathway.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5627 SEL1L Sarah Pantaleo gene: SEL1L was added
gene: SEL1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SEL1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SEL1L were set to PMID: 37943610; PMID: 37943617
Phenotypes for gene: SEL1L were set to Neurodevelopmental disorder, MONDO:0700092, SEL1L-related
Penetrance for gene: SEL1L were set to Complete
Review for gene: SEL1L was set to GREEN
Added comment: Wang paper PMID: 37943610

SEL1L protein is involved in the SEL1L-HRD1 endoplasmic reticulum (ER)-associated degradation.

Report two biallelic missense variants in SEL1L in six children from three independent families presenting with developmental delay, intellectual disability, microcephaly, facial dysmorphisms, hypotonia and/or ataxia (termed ERAD-associated neurodevelopment disorder with onset in infancy (ENDI). The variants were hypomorphic and impaired ERAD function.

Identified by WES. Parents heterozygous and asymptomatic. P.(Gly585Asp) in Patient 1, p.(Met528Arg) in Patients 2 and 3 (siblings).

All variants cause substrate accumulation. The extent of substrate accumulation in knockin cells was modest compared to those in knockout cells, pointing to a hypomorphic nature.

They also had a variant in HRD1.



Weis paper PMID: 37943617

Third variant p.(Cys141Tyr), biallelic, causing premature death in five patients from a consanguineous family with early-onset neurodevelopmental disorders and agammaglobulinaemia due to severe SEL1L-HRD1 ERAD dysfunction.

This variant appears to have a more severe outcome, exhibiting B cell depletion and agammaglobulinaemia, causing the most severe dysfunction among all of the variants described by this group so far. They postulate that functionality of SEL1L-HRD1 ERAD is inversely correlated with disease severity in humans.

Their symptoms were dev delay, neurological disorder and agammaglobulinaemia in childhood. Along with severe axial hypotonia, short stature and microcephaly.

“Not a complete loss-of-function variant”.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5626 RBFOX1 Zornitza Stark Publications for gene: RBFOX1 were set to 24664471
Intellectual disability syndromic and non-syndromic v0.5624 PPID Elena Savva gene: PPID was added
gene: PPID was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPID was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PPID were set to 37977818
Phenotypes for gene: PPID were set to Stutter disorder, (MONDO:0000723), PPID-related
Review for gene: PPID was set to RED
Added comment: PMID: 37977818 - a large family (10 affected confirmed to have the variant) with stuttering/language disorder and a het missense (p.(Pro270Ser)). Mouse K/I model showed microstructural changes in the corticospinal tract
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5623 GRIA3 Zornitza Stark Publications for gene: GRIA3 were set to 32977175; 17989220
Intellectual disability syndromic and non-syndromic v0.5622 GRIA3 Zornitza Stark Mode of inheritance for gene: GRIA3 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5621 GRIA3 Zornitza Stark reviewed gene: GRIA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 38038360; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, Wu type (MIM#300699); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5620 WBP4 Zornitza Stark Publications for gene: WBP4 were set to
Intellectual disability syndromic and non-syndromic v0.5616 DOT1L Zornitza Stark gene: DOT1L was added
gene: DOT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DOT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DOT1L were set to 37827158
Phenotypes for gene: DOT1L were set to Neurodevelopmental disorder, MONDO:0700092, DOT1L-related
Mode of pathogenicity for gene: DOT1L was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: DOT1L was set to GREEN
Added comment: Nine individuals reported with seven de novo missense variants.

All had DD/ID and variable patterns of associated congenital anomalies.

Variants demonstrated to be GoF and lead to increased H3K79 methylation levels in flies and human cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5612 KCNA3 Zornitza Stark Publications for gene: KCNA3 were set to
Intellectual disability syndromic and non-syndromic v0.5609 FOXP4 Elena Savva Publications for gene: FOXP4 were set to 33110267
Intellectual disability syndromic and non-syndromic v0.5607 HIST1H4J Zornitza Stark Publications for gene: HIST1H4J were set to 31804630
Intellectual disability syndromic and non-syndromic v0.5606 VCP Manny Jacobs gene: VCP was added
gene: VCP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: VCP were set to PMID: 37883978
Phenotypes for gene: VCP were set to Neurodevelopmental disorder (MONDO: 0700092)
Review for gene: VCP was set to GREEN
Added comment: 13 unrelated individuals with childhood onset ID/DD disorder including macrocephaly, hypotonia and dysmorphic features. Non-specific / mild MRI findings.
12 de novo - 1 inherited
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5602 SGSM3 Dean Phelan gene: SGSM3 was added
gene: SGSM3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SGSM3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SGSM3 were set to PMID: 37833060
Phenotypes for gene: SGSM3 were set to Neurodevelopmental disorder (MONDO:0700092), SGSM3-related
Review for gene: SGSM3 was set to GREEN
Added comment: PMID: 37833060
- 13 patients from 8 families of Ashkenazi Jewish origin all had the same homozygous frameshift variant (c.981dup). Predicted to cause NMD. The variant co-segregated with disease in all available family members. The affected individuals displayed mild global developmental delay and mild to moderate intellectual disability. Additional prevalent phenotypes observed included hypotonia, behavioural challenges and short stature. Considered a founder variant (1 in 52 Ashkenazi Jews carry the variant). Also present in other populations but no homozygotes in gnomAD.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5602 AGPAT3 Ee Ming Wong gene: AGPAT3 was added
gene: AGPAT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AGPAT3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AGPAT3 were set to PMID: 37821758
Phenotypes for gene: AGPAT3 were set to Neurodevelopmental disorder (MONDO#0700092), AGPAT3-related
Review for gene: AGPAT3 was set to GREEN
gene: AGPAT3 was marked as current diagnostic
Added comment: - Single consanguineous family with four individuals with severe intellectual disability and retinitis pigmentosa
- All affected individuals were homozygous for a nonsense variant in AGPAT3, healthy unaffected individuals who were tested were heterozygous for the variant
- Overexpression of mutant transcript revealed absence of AGPAT3 protein compared to WT transcript via Western blot analysis
- KO AGPAT3 mouse demonstrated impaired neuronal migration
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5601 DLG2 Elena Savva gene: DLG2 was added
gene: DLG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DLG2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DLG2 were set to PMID: 37860969
Phenotypes for gene: DLG2 were set to Intellectual disability (MONDO#0001071), DLG2-related
Review for gene: DLG2 was set to AMBER
Added comment: PMID: 37860969 - 13 patients from 10 families with neurodevelopmental disorders, dysmorphic features and intragenic deletions including both exonic (minimal affect all transcripts) and UTR regions.
Majority of variants were inherited, some de novo. But many NMD PTCs in gnomAD (some looking messy, in noncanonical transcript etc.)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5599 CASP2 Ain Roesley gene: CASP2 was added
gene: CASP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CASP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CASP2 were set to 37880421
Phenotypes for gene: CASP2 were set to neurodevelopmental disorder MONDO:0700092, CASP2-related
Penetrance for gene: CASP2 were set to Complete
Review for gene: CASP2 was set to GREEN
gene: CASP2 was marked as current diagnostic
Added comment: 7 patients from 5 families
4 families hom for PTCs, 1 family Chet for splice+PTC
RNA studies done for the splice to indicate usage of 2 cryptic splice donor sites

5/5 have ID/dev delay
1/5 has seizures
2/5 hypotonia
3/5 lissencephaly (pachygyria and cortical thickening)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5598 ELP1 Sarah Pantaleo gene: ELP1 was added
gene: ELP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ELP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ELP1 were set to PMID: 36864284
Phenotypes for gene: ELP1 were set to Neurodevelopmental disorder, MONDO:0700092, ELP1-related
Review for gene: ELP1 was set to RED
Added comment: “A novel ELP1 mutation impairs the function of the Elongator complex and causes a severe neurodevelopment disorder”.

The Elongator complex is suggested to play a role in NDDs, given that patient-derived mutations in its ELP2, ELP3, ELP4 and ELP6 subunits have been associated with these disorders.

Pathogenic variants in ELP1 have been previously found in familial dysautonomia and medulloblastoma, with no link to NDDs affecting primarily the central nervous system.

Clinical investigation included patient history and physical, neurological and MRI. A novel homozygous likely pathogenic ELP1 variant was identified by WGS (absent from gnomAD). Functional studies included in silico analysis of the mutated ELP1 in the context of the holo-complex, production and purification of the ELP1 harbouring the identified mutation and in vitro analyses.

Report a novel missense mutation in the ELP1 identified in two siblings with ID and GDD (both less than 10 years old). The mutation is shown to perturb the ability of ELP123 to bind tRNAs and compromises the function of the Elongator in vitro and in human cells.

Both sibling are non-verbal and had severe ID/GDD. MRI revealed white matter lesions with enlarged perivascular spaces, suggestive of an inflammatory reaction associate with demyelination. WGS identified c.2444A>C; p.(Lys815Thr), homozygous in both siblings. Consanguineous family. Parents heterozygous and asymptomatic. Carry out significant functional studies.

Conclude that screening for ELP1 mutations “may be beneficial”.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5596 PTPN4 Bryony Thompson Publications for gene: PTPN4 were set to 17953619; 25424712; 30238967; DOI: https://doi.org/10.1016/j.xhgg.2021.100033
Intellectual disability syndromic and non-syndromic v0.5594 ZFHX3 Zornitza Stark Publications for gene: ZFHX3 were set to
Intellectual disability syndromic and non-syndromic v0.5591 ZFHX3 Chirag Patel edited their review of gene: ZFHX3: Added comment: 41 patients with protein truncating variants (PTVs) or (partial) deletions of ZFHX3. Presentations included (mild) ID and/or behavioural problems, postnatal growth retardation, feeding difficulties, dysmorphism (rarely cleft palate). Nuclear abundance of ZFHX3 increases during human brain development and neuronal differentiation in neural stem cells and SH-SY5Y cells, ZFHX3 interacts with the chromatin remodelling BRG1/Brm-associated factor complex and the cleavage and polyadenylation complex. ZFHX3 haploinsufficiency associates with a specific DNA methylation profile in leukocyte-derived DNA, and participates in chromatin remodelling and mRNA processing.; Changed rating: GREEN; Changed publications: PMID: 37292950; Changed phenotypes: Neurodevelopmental disorder; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Set current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.5577 KCNH5 Zornitza Stark Publications for gene: KCNH5 were set to https://www.medrxiv.org/content/10.1101/2022.04.26.22274147v1
Intellectual disability syndromic and non-syndromic v0.5566 BRAF Zornitza Stark Publications for gene: BRAF were set to
Intellectual disability syndromic and non-syndromic v0.5562 SMARCA4 Zornitza Stark Publications for gene: SMARCA4 were set to
Intellectual disability syndromic and non-syndromic v0.5558 SMC3 Zornitza Stark Publications for gene: SMC3 were set to
Intellectual disability syndromic and non-syndromic v0.5555 SMC1A Zornitza Stark Publications for gene: SMC1A were set to
Intellectual disability syndromic and non-syndromic v0.5554 SMC1A Zornitza Stark Mode of inheritance for gene: SMC1A was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5552 SMARCB1 Zornitza Stark Publications for gene: SMARCB1 were set to
Intellectual disability syndromic and non-syndromic v0.5549 SMC1A Kaitlyn Dianna Weldon reviewed gene: SMC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301283; Phenotypes: Cornelia de Lange syndrome 2 MONDO:0010370; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5548 STXBP1 Zornitza Stark Publications for gene: STXBP1 were set to
Intellectual disability syndromic and non-syndromic v0.5545 FH Zornitza Stark Publications for gene: FH were set to
Intellectual disability syndromic and non-syndromic v0.5542 TMEM70 Zornitza Stark Publications for gene: TMEM70 were set to
Intellectual disability syndromic and non-syndromic v0.5540 TMEM240 Zornitza Stark Publications for gene: TMEM240 were set to
Intellectual disability syndromic and non-syndromic v0.5536 TMEM216 Zornitza Stark Publications for gene: TMEM216 were set to
Intellectual disability syndromic and non-syndromic v0.5533 TMCO1 Zornitza Stark Publications for gene: TMCO1 were set to
Intellectual disability syndromic and non-syndromic v0.5530 TCF4 Zornitza Stark Publications for gene: TCF4 were set to
Intellectual disability syndromic and non-syndromic v0.5527 TBC1D24 Zornitza Stark Publications for gene: TBC1D24 were set to
Intellectual disability syndromic and non-syndromic v0.5524 TAZ Zornitza Stark Publications for gene: TAZ were set to
Intellectual disability syndromic and non-syndromic v0.5521 TAT Zornitza Stark Publications for gene: TAT were set to
Intellectual disability syndromic and non-syndromic v0.5518 TANGO2 Zornitza Stark Publications for gene: TANGO2 were set to
Intellectual disability syndromic and non-syndromic v0.5512 MAST4 Ain Roesley gene: MAST4 was added
gene: MAST4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAST4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAST4 were set to 36910266; 33057194
Phenotypes for gene: MAST4 were set to neurodevelopmental disorder MONDO:0700092, MAST4-related
Penetrance for gene: MAST4 were set to Complete
Review for gene: MAST4 was set to GREEN
gene: MAST4 was marked as current diagnostic
Added comment: PMID: 36910266 - 4 families with 4 affecteds, all de novo missense

2x borderline microcephaly (-2SD)
2x gross motor delay
2x dysmorphism
4x ID + seizures
3x abnormal brain MRI findings

PMID: 33057194 - 5x de novos, 4x missense + 1x PTC
Cohort of individuals with severe developmental disorder
individual phenotypic information not provided


Recurrent variants are Thr1471Ile (3x) and Ser1181Phe)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5509 ATP2B2 Andrew Fennell gene: ATP2B2 was added
gene: ATP2B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP2B2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP2B2 were set to PMID: 37675773
Phenotypes for gene: ATP2B2 were set to Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related
Mode of pathogenicity for gene: ATP2B2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: ATP2B2 was set to GREEN
Added comment: 7 unrelated individuals reported with a variable phenotype including dystonia, ataxia, intellectual disability, behavioural symptoms, and seizures.

All patients have either missense variants or frameshift variants in the penultimate exon not expected to lead to NMD. This is in contrast to patients with isolated deafness previously reported to have nonsense, frameshift, or splice-site variants outside of this region.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5509 COG3 Daniel Flanagan gene: COG3 was added
gene: COG3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: COG3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COG3 were set to PMID: 37711075
Phenotypes for gene: COG3 were set to Neurodevelopmental disorder (MONDO#0700092), COG3-related
Review for gene: COG3 was set to AMBER
Added comment: Two COG3 homozygous missense variants in four individuals from two unrelated consanguineous families. Clinical phenotypes of affected individuals include global developmental delay, severe intellectual disability, microcephaly, epilepsy, facial dysmorphism, and variable neurological findings.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5509 ZBTB47 Elena Savva gene: ZBTB47 was added
gene: ZBTB47 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZBTB47 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ZBTB47 were set to 37743782
Phenotypes for gene: ZBTB47 were set to Neurodevelopmental disorder (MONDO#0700092), ZBTB47-related
Review for gene: ZBTB47 was set to GREEN
Added comment: PMID 37743782:
- 5 patients with de novo missense, 4/5 have a recurring p.Gly477Lys. Probands have intellectual disability (5/5), seizures (5/5), hypotonia (5/5), gait abnormalities, and variable movement abnormalities (5/5).
- Missense variants are positioned close to His and Cys residues involved in forming C2H2 zinc fingers.
- No functional studies performed
- Minimal PTCs in gnomAD
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5507 ATRX Zornitza Stark Mode of inheritance for gene: ATRX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5506 ATRX Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ATR-X-related syndrome MONDO:0016980; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5500 TSEN54 Zornitza Stark Publications for gene: TSEN54 were set to
Intellectual disability syndromic and non-syndromic v0.5497 TSFM Zornitza Stark Publications for gene: TSFM were set to
Intellectual disability syndromic and non-syndromic v0.5494 TSHB Zornitza Stark Publications for gene: TSHB were set to
Intellectual disability syndromic and non-syndromic v0.5486 TTC37 Zornitza Stark Publications for gene: TTC37 were set to
Intellectual disability syndromic and non-syndromic v0.5480 ASTN2 Zornitza Stark gene: ASTN2 was added
gene: ASTN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ASTN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ASTN2 were set to 28940097; 34412080; 27138430
Phenotypes for gene: ASTN2 were set to Neurodevelopmental disorder, MONDO:0700092, ASTN2-related
Review for gene: ASTN2 was set to AMBER
Added comment: Candidate gene reported by Anazi et al; rare CNVs also reported; other circumstantial evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5478 MCCC1 Bryony Thompson Publications for gene: MCCC1 were set to
Intellectual disability syndromic and non-syndromic v0.5471 TUBB3 Zornitza Stark Publications for gene: TUBB3 were set to
Intellectual disability syndromic and non-syndromic v0.5468 TUBB4A Zornitza Stark Publications for gene: TUBB4A were set to
Intellectual disability syndromic and non-syndromic v0.5465 TH Zornitza Stark Publications for gene: TH were set to
Intellectual disability syndromic and non-syndromic v0.5460 TUBG1 Zornitza Stark Publications for gene: TUBG1 were set to
Intellectual disability syndromic and non-syndromic v0.5457 TWIST1 Zornitza Stark Publications for gene: TWIST1 were set to
Intellectual disability syndromic and non-syndromic v0.5454 UBA5 Zornitza Stark Publications for gene: UBA5 were set to 33811063
Intellectual disability syndromic and non-syndromic v0.5453 UBA5 Zornitza Stark Publications for gene: UBA5 were set to
Intellectual disability syndromic and non-syndromic v0.5450 UBE3A Zornitza Stark Publications for gene: UBE3A were set to
Intellectual disability syndromic and non-syndromic v0.5447 SDHA Zornitza Stark Publications for gene: SDHA were set to
Intellectual disability syndromic and non-syndromic v0.5444 VLDLR Zornitza Stark Publications for gene: VLDLR were set to
Intellectual disability syndromic and non-syndromic v0.5441 VPS13B Zornitza Stark Publications for gene: VPS13B were set to
Intellectual disability syndromic and non-syndromic v0.5437 VRK1 Zornitza Stark Publications for gene: VRK1 were set to
Intellectual disability syndromic and non-syndromic v0.5434 WDR45 Zornitza Stark Publications for gene: WDR45 were set to
Intellectual disability syndromic and non-syndromic v0.5433 WDR45 Zornitza Stark Mode of inheritance for gene: WDR45 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5431 WDR73 Zornitza Stark Publications for gene: WDR73 were set to
Intellectual disability syndromic and non-syndromic v0.5428 SMAD4 Zornitza Stark Publications for gene: SMAD4 were set to
Intellectual disability syndromic and non-syndromic v0.5425 WWOX Zornitza Stark Publications for gene: WWOX were set to
Intellectual disability syndromic and non-syndromic v0.5422 XRCC4 Zornitza Stark Publications for gene: XRCC4 were set to
Intellectual disability syndromic and non-syndromic v0.5419 TUBB2B Zornitza Stark Publications for gene: TUBB2B were set to
Intellectual disability syndromic and non-syndromic v0.5416 ZDHHC9 Zornitza Stark Publications for gene: ZDHHC9 were set to
Intellectual disability syndromic and non-syndromic v0.5413 ZFYVE26 Zornitza Stark Publications for gene: ZFYVE26 were set to
Intellectual disability syndromic and non-syndromic v0.5410 ZIC2 Zornitza Stark Publications for gene: ZIC2 were set to
Intellectual disability syndromic and non-syndromic v0.5407 TSC1 Zornitza Stark Publications for gene: TSC1 were set to
Intellectual disability syndromic and non-syndromic v0.5404 TSC2 Zornitza Stark Publications for gene: TSC2 were set to
Intellectual disability syndromic and non-syndromic v0.5401 NR2F2 Zornitza Stark Publications for gene: NR2F2 were set to 29478779; 29663647
Intellectual disability syndromic and non-syndromic v0.5399 SDHA Claire Fryer-Smith reviewed gene: SDHA: Rating: GREEN; Mode of pathogenicity: None; Publications: 1492653, 23322652; Phenotypes: Cardiomyopathy, dilated, 1GG MIM#613642, Mitochondrial complex II deficiency, nuclear type 1 MIM#252011, Neurodegeneration with ataxia and late-onset optic atrophy MIM#619259, Paragangliomas MIM#614165; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5399 WDR45 Kaitlyn Dianna Weldon reviewed gene: WDR45: Rating: GREEN; Mode of pathogenicity: None; Publications: 28211668; Phenotypes: X-linked complex neurodevelopmental disorder MONDO:0100148, neurodegeneration with brain iron accumulation 5 MONDO:0010476; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5396 FTCD Bryony Thompson Publications for gene: FTCD were set to
Intellectual disability syndromic and non-syndromic v0.5392 COL4A3BP Zornitza Stark Publications for gene: COL4A3BP were set to 25533962
Intellectual disability syndromic and non-syndromic v0.5387 RAB5C Rylee Peters gene: RAB5C was added
gene: RAB5C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB5C were set to PMID: 37552066
Phenotypes for gene: RAB5C were set to Neurodevelopmental disorder MONDO:0700092, RAB5C-related
Penetrance for gene: RAB5C were set to Complete
Review for gene: RAB5C was set to GREEN
gene: RAB5C was marked as current diagnostic
Added comment: 12 individuals with nine different heterozygous de novo variants in RAB5C.
9 with missense, 1 inframe duplication and 2 stop-gains (clinically more severe).
All has mild-severe ID, 4/12 have epilepsy, 6/12 have macrocephaly (more than 3 SD).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5387 AXIN1 Elena Savva gene: AXIN1 was added
gene: AXIN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AXIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AXIN1 were set to PMID: 37582359
Phenotypes for gene: AXIN1 were set to Syndromic disease, (MONDO:0002254), AXIN1-related
Review for gene: AXIN1 was set to GREEN
Added comment: PMID: 37582359
- four families (7 individuals) with three homozygous truncating variants.
- all variant shown to result in reduced protein, though 1/3 would be NMD predicted
- Probands had macrocephaly (4/6), GDD (3/7), hip dysplasia (5/6), cardiac anomalies eg. VSD/ASD (3/7), cranial hyperostosis and vertebral endplate sclerosis
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5385 PPP1R3F Andrew Fennell gene: PPP1R3F was added
gene: PPP1R3F was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP1R3F was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: PPP1R3F were set to 37531237
Phenotypes for gene: PPP1R3F were set to Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related
Review for gene: PPP1R3F was set to GREEN
Added comment: 13 unrelated hemizygous individuals reported with functional evidence
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5382 SOX11 Zornitza Stark Publications for gene: SOX11 were set to 24886874; 33785884; 33430815; 33086258; 31530938
Intellectual disability syndromic and non-syndromic v0.5379 ATP5O Zornitza Stark gene: ATP5O was added
gene: ATP5O was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ATP5O was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATP5O were set to 35621276; 34954817
Phenotypes for gene: ATP5O were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359
Review for gene: ATP5O was set to GREEN
Added comment: Three unrelated families reported. Presenting features included DD, hypotonia, seizures.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5377 HIKESHI Zornitza Stark gene: HIKESHI was added
gene: HIKESHI was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: HIKESHI was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HIKESHI were set to 34111619; 26545878
Phenotypes for gene: HIKESHI were set to Leukodystrophy, hypomyelinating, 13, MIM# 616881
Review for gene: HIKESHI was set to GREEN
Added comment: Over 10 individuals reported with recurrent homozygous c.160G>C;p.(Val54Leu) variant, high carrier frequency in the Ashkenazi Jewish population. Optic atrophy reported in several.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5370 PTCD3 Zornitza Stark gene: PTCD3 was added
gene: PTCD3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: PTCD3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTCD3 were set to 30607703; 19427859; 36450274
Phenotypes for gene: PTCD3 were set to Combined oxidative phosphorylation deficiency-51, MIM#619057; Intellectual disability; optic atrophy; Leigh-like syndrome
Review for gene: PTCD3 was set to GREEN
Added comment: Four families and functional data. ID is a feature.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5362 ARV1 Zornitza Stark Publications for gene: ARV1 were set to
Intellectual disability syndromic and non-syndromic v0.5359 ARID1A Zornitza Stark Publications for gene: ARID1A were set to
Intellectual disability syndromic and non-syndromic v0.5355 AP3B1 Zornitza Stark Publications for gene: AP3B1 were set to
Intellectual disability syndromic and non-syndromic v0.5344 ADGRG1 Zornitza Stark Publications for gene: ADGRG1 were set to
Intellectual disability syndromic and non-syndromic v0.5341 NEUROG1 Zornitza Stark gene: NEUROG1 was added
gene: NEUROG1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NEUROG1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NEUROG1 were set to 23419067; 26077850; 33439489; 36647078
Phenotypes for gene: NEUROG1 were set to Cranial dysinnervation disorder, congenital, with absent corneal reflex and developmental delay, OMIM:620469
Review for gene: NEUROG1 was set to GREEN
Added comment: There are four unrelated cases reported with global developmental delay/ intellectual disability.

PMID:23419067 - A homozygous micro deletion of NEUROG1 was identified in a six year-old boy presenting with profound sensorineural deafness, balance disorder, severe disorder of oral motor function, and mild global developmental delay. His IQ was normal.

PMID:26077850 - A homozygous NEUROG1 variant (p.Arg116Leu) was identified in a 12 year-old boy presented with syndromic corneal opacity, mild intellectual disability and absent corneal reflex.

PMID:33439489 - A homozygous loss-of-function variant (p.Glu68Ter) was identified in a 12 year-old boy presenting with hypotonia, global developmental delay, sensorineural hearing loss, and keratoconjunctivitis due to lack of corneal reflex. This patient had a global IQ of 62 at the age of ten.

PMID:36647078 - A female proband was identified with a novel homozygous truncating frameshift variant (p.Thr78ProfsTer122 and was reported with profound global developmental delay, autism spectrum disorder, hearing loss, corneal opacity and no eye blinking. Her sister also had a similar, but less severe phenotype and also harboured the same variant at homozygous state.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5338 CCDC115 Elena Savva gene: CCDC115 was added
gene: CCDC115 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC115 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC115 were set to Congenital disorder of glycosylation, type IIo MIM# 616828
Review for gene: CCDC115 was set to GREEN
Added comment: Added following CAM discussion
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5336 ATP6V0C Zornitza Stark Phenotypes for gene: ATP6V0C were changed from Epilepsy; Intellectual Disability; microcephaly to Epilepsy, early-onset, with or without developmental delay, MIM#620465; Epilepsy; Intellectual Disability; microcephaly
Intellectual disability syndromic and non-syndromic v0.5333 HNRNPC Zornitza Stark gene: HNRNPC was added
gene: HNRNPC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HNRNPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HNRNPC were set to 37541189
Phenotypes for gene: HNRNPC were set to Neurodevelopmental disorder (MONDO:0700092), HNRNPC-related
Review for gene: HNRNPC was set to GREEN
Added comment: 13 individuals with global developmental delay, intellectual disability, behavioral abnormalities, and subtle facial dysmorphology with heterozygous HNRNPC germline variants. Five had an identical in-frame deletion of nine amino acids in the extreme C terminus.

Supportive functional data; haploinsufficiency is the mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5329 PSMC3 Zornitza Stark Publications for gene: PSMC3 were set to 32500975
Intellectual disability syndromic and non-syndromic v0.5326 EMC1 Zornitza Stark Publications for gene: EMC1 were set to 26942288; 29271071
Intellectual disability syndromic and non-syndromic v0.5320 EZH1 Zornitza Stark Publications for gene: EZH1 were set to
Intellectual disability syndromic and non-syndromic v0.5317 AQP4 Lucy Spencer gene: AQP4 was added
gene: AQP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AQP4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AQP4 were set to 37143309
Phenotypes for gene: AQP4 were set to ?Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448
Review for gene: AQP4 was set to AMBER
Added comment: PMID: 37143309
Cohort patients with an MRI based diagnosis of megalencephalic leukoencephalopathy with subcortical cysts (MLC). Missense variant in AQP4 seen homozygous in 2 siblings and het in the parents. Patients had macrocephaly, developmental delay, hypotonia, epilepsy, and cognitive deficit.

Western blots on generated MDCK cell lines showed no detectable expression of AQP4 protein from the cells with the patients variant. Immunofluorescence also showed no membrane expression. Overexpression studies in HEK293T cells showed WT was seen as mainly monomers or dimers where as variant protein formed large aggregates- likely due to the saturation of protein degradation pathways because of the overexpression.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5317 PHF5A Daniel Flanagan gene: PHF5A was added
gene: PHF5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PHF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PHF5A were set to PMID: 37422718
Phenotypes for gene: PHF5A were set to Neurodevelopmental disorder (MONDO#0700092), PHF5A-related
Review for gene: PHF5A was set to GREEN
Added comment: Nine subjects with congenital malformations, including hypospadias, growth abnormalities, and developmental delay who had de novo PHF5A variants. Prenatally, six subjects had intrauterine growth retardation. All subjects had motor and speech delay and developmental delay. Congenital abnormalities comprised hypospadias in three of four male subjects, and heart defects (3/9), inguinal hernia (3/9), and sacral dimple (3/9). Six of the nine subjects had short stature. Craniofacial dysmorphism is variable in the nine subjects, high forehead and preauricular skin tag(s) in five subjects.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5313 GPRC5B Lucy Spencer gene: GPRC5B was added
gene: GPRC5B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GPRC5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GPRC5B were set to PMID: 37143309
Phenotypes for gene: GPRC5B were set to Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447
Review for gene: GPRC5B was set to GREEN
Added comment: PMID: 37143309
Cohort of 5 patients with an MRI based diagnosis of megalencephalic leukoencephalopathy with subcortical cysts (MLC). 3 unrelated patients had variants in GPRC5B, 2 have the same inframe dup Ile175dup and the third has an in frame dup of Ala177. All 3 were de novo and unaffected siblings did not have the variants. All patients have macrocephaly, delayed motor development, spasticity, ataxia and dystonia, seizures, all had varying degrees of cognitive deficits. MRI showed MLC, abnormal and swollen cerebral white matter.

Patient cell lines showed reduced regulatory volume decrease, and western blot showed a strong increase in GRPC5B levels in patient lymphoblasts. Together, these findings indicate disturbed volume regulation in lymphoblasts from patients with GPRC5B variants, potentially due to increased GPRC5B levels. Transfected cells caused increased volume-regulated anion channel activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5313 SLC4A10 Krithika Murali gene: SLC4A10 was added
gene: SLC4A10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC4A10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC4A10 were set to PMID: 37459438
Phenotypes for gene: SLC4A10 were set to Neurodevelopmental disorderMONDO:0700092, SLC4A10-related
Review for gene: SLC4A10 was set to GREEN
Added comment: PMID: 37459438 Fasham et al 2023 (Brain) report 10 affected individuals from 5 unrelated families with biallelic LoF variants in this gene with a novel neurodevelopmental disorder.

Phenotypic features include hypotonia in infancy, delayed psychomotor development, typically severe ID, progressive postnatal microcephaly, ASD traits, corpus callosal abnormalities and 'slit-like' lateral ventricles. These phenotypic features were recapitulated in knockout mice with additional supportive functional studies.

Isolated seizures was reported in 2/10 cases.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5312 SLC4A10 Krithika Murali gene: SLC4A10 was added
gene: SLC4A10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC4A10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC4A10 were set to PMID: 37459438
Phenotypes for gene: SLC4A10 were set to Neurodevelopmental disorderMONDO:0700092, SLC4A10-related
Review for gene: SLC4A10 was set to GREEN
Added comment: PMID: 37459438 Fasham et al 2023 (Brain) report 10 affected individuals from 5 unrelated families with biallelic LoF variants in this gene with a novel neurodevelopmental disorder.

Phenotypic features include hypotonia in infancy, delayed psychomotor development, typically severe ID, progressive postnatal microcephaly, ASD traits, corpus callosal abnormalities and 'slit-like' lateral ventricles. These phenotypic features were recapitulated in knockout mice with additional supportive functional studies.

Isolated seizures was reported in 2/10 cases.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5312 PIP5K1C Elena Savva Publications for gene: PIP5K1C were set to 37451268
Intellectual disability syndromic and non-syndromic v0.5311 NAA30 Sarah Pantaleo gene: NAA30 was added
gene: NAA30 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAA30 was set to Unknown
Publications for gene: NAA30 were set to PMID: 37387332
Penetrance for gene: NAA30 were set to unknown
Review for gene: NAA30 was set to RED
Added comment: Report a de novo heterozygous NAA30 nonsense variant c.244C>T, p.(Gln82*) in a 5yo boy with GDD, ASD, hypotonia, seizures, tracheal cleft and recurrent respiratory infections. Seizures resolved after two weeks of life. Family history of ASD in older sister. Epilepsy in mother, childhood onset.

Biochemical studies performed to assess the functional impact of the premature stop codon on catalytic activity. The variant was found to completely disrupt N-terminal acetyltransferase activity using an in vitro acetylation assay.

Variant de novo, “in a gene sensitive to loss of heterozygosity”. Limitation of study - have not established whether this gene variant acts in a dominant or recessive manner.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5311 PIP5K1C Elena Savva Publications for gene: PIP5K1C were set to
Intellectual disability syndromic and non-syndromic v0.5310 EZH1 Dean Phelan gene: EZH1 was added
gene: EZH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EZH1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5308 TMEM63B Zornitza Stark gene: TMEM63B was added
gene: TMEM63B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM63B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TMEM63B were set to 37421948
Phenotypes for gene: TMEM63B were set to developmental and epileptic encephalopathy, MONDO:0100062, TMEM63B-related
Review for gene: TMEM63B was set to GREEN
Added comment: 17 unrelated individuals with severe early-onset developmental and epileptic encephalopathy (DEE), intellectual disability, and severe motor and cortical visual impairment were identified with ten distinct heterozygous variants inTMEM63B. The variants occurred de novo in 16/17 individuals for whom parental DNA was available and either missense or in-frame. All individuals had global developmental delay, with moderate-to-profound intellectual disability and severe motor impairment. All individuals had early-onset drug-resistant epilepsy, whose onset ranged from birth to 3 years but occurred within the first year in 14/17 (82%) and in the first month of life in 6/17 (35%).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5306 DHX9 Zornitza Stark gene: DHX9 was added
gene: DHX9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DHX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DHX9 were set to 37467750
Phenotypes for gene: DHX9 were set to Neurodevelopmental disorder, MONDO:0700092, DHX9-related
Review for gene: DHX9 was set to GREEN
Added comment: PMID:37467750 - 17 unrelated individuals were identified with de novo, ultra-rare, heterozygous missense or loss-of-function DHX9 variants, of which 14 individuals were reported with a neurodevelopmental disorder (NDD) and three were reported with Charcot-Marie-Tooth disease (CMT). All 14 cases with NDD had developmental delay, of which eight were reported with intellectual disability (4 severe, 1 moderate, 3 mild). Two cases did not have ID, one had borderline ID and three cases were too young (0-5 years old). The three cases with CMT presented with adult-onset axonal neuropathy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5305 NLGN4X Zornitza Stark Publications for gene: NLGN4X were set to 12669065; 18231125; 10071191; 29428674
Intellectual disability syndromic and non-syndromic v0.5298 TEFM Zornitza Stark gene: TEFM was added
gene: TEFM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TEFM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TEFM were set to 36823193
Phenotypes for gene: TEFM were set to Combined oxidative phosphorylation deficiency 58, MIM# 620451
Review for gene: TEFM was set to GREEN
Added comment: Seven individuals from 5 families reported. Presentation predominantly with encephalopathy, seizures and ID, in addition to lactic acidosis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5285 TTI1 Zornitza Stark Publications for gene: TTI1 were set to 26539891; 30315573
Intellectual disability syndromic and non-syndromic v0.5282 WBP4 Chirag Patel gene: WBP4 was added
gene: WBP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: WBP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WBP4 were set to Neurodevelopmental disorder
Review for gene: WBP4 was set to GREEN
gene: WBP4 was marked as current diagnostic
Added comment: ESHG 2023:
11 individuals from 8 families with homozygous LOF variants in WBP4 gene (4 different variants). Presentation of severe DD and ID, hypotonia, abnormal outer ears, and varying congenital anomalies. WBP4 is spliceosome protein which binds/interacts with SNRNP200. In vivo and in vitro studies previously showed WBP4 enhances splicing and regulates alternative splicing. Patient fibroblasts showed loss of expression of WBP4. RNA sequencing analysis showed abnormal splicing patterns. Proposed spliceosomopathy.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5280 KDM2A Chirag Patel gene: KDM2A was added
gene: KDM2A was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: KDM2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KDM2A were set to Neurodevelopmental disorder
Review for gene: KDM2A was set to GREEN
gene: KDM2A was marked as current diagnostic
Added comment: ESHG 2023:
14 patients with de novo HTZ variants in KDM2A (5 x truncating, 9 x missense)
Presentation with DD, ID (mild), seizures, growth retardation, and dysmorphism.

Functional studies:
-patient blood showed aberrant genome wide methylation profile - potential episignature
-HEK293T cells showed altered subcellular localisation of KDM2A
-Drosophila models showed variants caused neurotoxicity
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5278 PIP5K1C Chirag Patel gene: PIP5K1C was added
gene: PIP5K1C was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: PIP5K1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PIP5K1C were set to Neurodevelopmental disorder and microcephaly
Review for gene: PIP5K1C was set to GREEN
gene: PIP5K1C was marked as current diagnostic
Added comment: ESHG 2023:
9 unrelated patients with de novo missense variants in PIP5K1C (3 x recurrent variants).
Presentation with DD/ID (mod-profound), microcephaly, seizures, visual impairment, and dysmorphism.

PIP5K1C is one of the phosphoinositolides, which control membrane composition of organelles and varying cellular processes. Patient fibroblasts showed increased PI(4,5)P2 levels, altered PI(4,5)P2 composition of early endosomes, and impaired endocytosis trafficking. Drosophila models showed microcephaly and ocular phenotype.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5275 INTS13 Chirag Patel gene: INTS13 was added
gene: INTS13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INTS13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: INTS13 were set to PMID: 36229431
Phenotypes for gene: INTS13 were set to Oral-facial-digital syndrome
Review for gene: INTS13 was set to GREEN
Added comment: 2 families with 4 affected individuals with Oral-facial-digital (OFD) phenotype. Homozygosity mapping and WES found 2 homozygous variants in INTS13 gene. This is a subunit of the Integrator complex, which associates with RNA Polymerase II and cleaves nascent RNA to modulate gene expression. Variants segregated with disease. Depletion of INTS13 disrupts ciliogenesis in human cultured cells and causes dysregulation of a broad collection of ciliary genes. Knockdown in Xenopus embryos leads to motile cilia anomalies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5273 DCAF15 Chirag Patel gene: DCAF15 was added
gene: DCAF15 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: DCAF15 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DCAF15 were set to Cornelia de Lange syndrome
Review for gene: DCAF15 was set to AMBER
Added comment: ESHG 2023:
3 unrelated cases with CdLS (1 x TOP with MCA, 1 x death @20mths, 1 x living child)
Features suggestive of CdLS - DD, microcephaly, CHD, dysmorphism, visual/hearing impairment.

WES identified recurrent de novo variant (p.Ser470Phe) in DCAF15 gene. This mediates ubiquitination and degradation of target proteins, and interacts with cohesin complex members (SMC1/SMC3).

Protein analysis from individuals showed increased accumulation of ubiquitination-modified proteins and SM3 (GOF mechanism). EpiSign analysis showed same DNA methylation pattern as other CdLS cases/genes. Zebrafish model showed reduced body length, reduced head size, reduced oligodendrocytes, heart defect, aberrant motor neurons, and abnormal response to visual/auditory stimuli.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5271 CYHR1 Chirag Patel gene: CYHR1 was added
gene: CYHR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: CYHR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYHR1 were set to Neurodevelopmental disorder and microcephaly
Review for gene: CYHR1 was set to AMBER
gene: CYHR1 was marked as current diagnostic
Added comment: ESHG 2023:
5 individuals from 3 families with biallelic LOF variants in CYHR1 (aka ZTRAF1). Presentation with microcephaly, hypotonia, DD, and ID. Expression studies showed mislocalisation of CYHR1. Mutant fibroblasts showed increased lysosomal markers and upregulated lysosomal proteins, leading to impaired autophagy. Zebrafish KO however did not show a phenotype.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5270 GPATCH11 Chirag Patel gene: GPATCH11 was added
gene: GPATCH11 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: GPATCH11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPATCH11 were set to Leber congenital amaurosis and developmental delay
Review for gene: GPATCH11 was set to GREEN
gene: GPATCH11 was marked as current diagnostic
Added comment: ESHG 2023:
3 families with 8 individuals with leber congenital amaurosis, developmental delay, language disorder, and behavioural issues.
GPATCH11 localises to nucleus and basal body of primary cilium (similar to other LCA genes).
Biallelic variants found in GPATCH11 - 1 splice variant common to all 3 families (1 other variant in 3rd family). Splice variant leads to loss of exon 4 (mRNA studies).
Mouse models showed i) abnormal rod/cone responses on ERG; ii) decreased outer nuclear layer in retina, and iii) abnormal associate/episodic memory
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5267 KCNA3 Chirag Patel gene: KCNA3 was added
gene: KCNA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: KCNA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNA3 were set to Neurodevelopmental disorder
Review for gene: KCNA3 was set to GREEN
gene: KCNA3 was marked as current diagnostic
Added comment: ESHG 2023:
10 individuals with de novo missense variants in KCNA3 (K+ channel)
Variable electrophysiology studies of effect of variants (5 x LOF, 4 x GOF, 1 no change)
Presentation: abnormal speech development (8/8), ID (6/8), epilepsy (5/8), and ASD (7/8)
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5265 FSD1L Chirag Patel gene: FSD1L was added
gene: FSD1L was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: FSD1L was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FSD1L were set to Neurodevelopmental disorder
Review for gene: FSD1L was set to GREEN
gene: FSD1L was marked as current diagnostic
Added comment: ESHG 2023:
8 families with biallelic missense/nonsense variants
Presentation only described 1 family/2 affecteds with DD, ID, spastic paraparesis, epilepsy, corpus callosum hypoplasia, and optic nerve hypoplasia

Functional assays:
-reduced expression of FSD1L in mature neurons (RNA studies)
-very low % mature neurons (neuronal differentiation)
-reduced neuronal migration
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5263 DENND5B Chirag Patel gene: DENND5B was added
gene: DENND5B was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: DENND5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DENND5B were set to Neurodevelopmental disorder with white matter anomalies
Review for gene: DENND5B was set to GREEN
gene: DENND5B was marked as current diagnostic
Added comment: ESHG 2023:
7 patients/7 families with de novo DENND5B variants (6 missense, 1 splice)
DD/ID (mod/profound)(7/7), white matter anomalies (6/7) hypotonia, epilepsy (3/7)

DENND5B acts as:
-GEF for activation of RAB proteins which are involved in membrane trafficking and neurotransmitter release
-regulator of lipid absorption and homeostasis

Functional studies showed loss of expression of DENND5B in fibroblasts, abnormal vesicle trafficking, and impaired lipid uptake and intracellular distribution
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5260 DMAP1 Chirag Patel gene: DMAP1 was added
gene: DMAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: DMAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DMAP1 were set to Neurodevelopmental disorder
Review for gene: DMAP1 was set to GREEN
gene: DMAP1 was marked as current diagnostic
Added comment: ESHG 2023:
9 patients/8 families with bilallelic variants in DMAP1 (3 missense, 7 LOF)
All with DD, speech delay, hypotonia, and ID
Some with epilepsy (4/6), FTT (4/5), and brain malformations (3/5)
Drosophila showed abnormal behaviour pattern and bang sensitivity
Specific methylation episignature also seen
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5258 HCN2 Elena Savva gene: HCN2 was added
gene: HCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: HCN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: HCN2 were set to Febrile seizures, familial, 2 MIM#602477; Generalized epilepsy with febrile seizures plus, type 11 MIM#602477; {Epilepsy, idiopathic generalized, susceptibility to, 17} MIM#602477; Neurodevelopmental disorder (MONDO#0700092), HCN2-related
Review for gene: HCN2 was set to AMBER
Added comment: ICG 2023 conference
- cohort of 20 individuals where >80% had a form of intellectual disability (half were severe) and/or seizures. Some had isolated intellectual disability, especially those with a recurring de novo p.E478del.
- Patients were both mono- and biallelic.
- Monoallelic individuals had de novo missense and an inframe deletion. Biallelic individuals had a mix of missense and PTC
Sources: Other
Intellectual disability syndromic and non-syndromic v0.5256 ZMYM3 Zornitza Stark reviewed gene: ZMYM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Intellectual developmental disorder, X-linked 112, MIM# 301111; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5252 SART3 Daniel Flanagan gene: SART3 was added
gene: SART3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SART3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SART3 were set to PMID: 37296101
Phenotypes for gene: SART3 were set to Neurodevelopmental disorder (MONDO#0700092), SART3-related, with 46,XY gonadal dysgenesis
Review for gene: SART3 was set to GREEN
Added comment: Nine individuals from six families presenting with intellectual disability, global developmental delay, a subset of brain anomalies, together with gonadal dysgenesis in 46,XY individuals. Additionally, two individuals had seizures and two had epileptiform activity reported on EEG.

Human induced pluripotent stem cells carrying patient variants in SART3 show disruption to multiple signalling pathways, upregulation of spliceosome components and demonstrate aberrant gonadal and neuronal differentiation in vitro.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5251 ERI1 Elena Savva gene: ERI1 was added
gene: ERI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ERI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERI1 were set to 37352860
Phenotypes for gene: ERI1 were set to Intellectual disability (MONDO#0001071), ERI1-related
Review for gene: ERI1 was set to GREEN
Added comment: PMID: 37352860 - 8 individuals from 7 unrelated families
- Patients with biallelic missense show a MORE severe spondyloepimetaphyseal dysplasia, syndactyly, brachydactyly/clinodactyly/camptodactyly
- Patients with biallelic null/whole gene deletion had mild ID and digit anomalies including brachydactyly/clinodactyly/camptodactyly
- Patient chet for a missense and PTC variant has a blended phenotype with short stature, syndactyly, brachydactyly/clinodactyly/camptodactyly, mild ID and failure to thrive

- Missense variants were functionally shown to not be able to rescue 5.8S rRNA processing in KO HeLa cells
- K/O mice had neonatal lethality with growth defects, brachydactyly. Skeletal-specific K/O had mild platyspondyly, had more in keeping with patients with null variants than missense

More severe phenotype hypothesised due to "exonuclease-dead proteins may compete for the target RNA molecules with other exonucleases that have functional redundancy
with ERI1, staying bound to those RNA molecules"
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5250 RPH3A Lucy Spencer gene: RPH3A was added
gene: RPH3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RPH3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RPH3A were set to 37403762; 29441694
Phenotypes for gene: RPH3A were set to Neurodevelopmental disorder (MONDO#0700092), RPH3A-related
Review for gene: RPH3A was set to GREEN
Added comment: PMID: 37403762- 6 patients with RPH3A variant. All 6 have ID, 4 have epilepsy, 2 with obesity, 1 with dysmorphic features. All 6 have missense variants, 3 shown to be de novo, the other 3 parents were not available for testing. I patient also had language and motor impairment, breathing issues and mixed hypo/hypertonia- he also had variants in CUL4B, PRKAG2, SCN4A, none of these genes cause seizures (which he had).

Patch clamp studies on 2 of the missense showed they increased either the number of NMDA receptors on neuron membrane surface or increased their conductance. Study suggests that the variants interrupt the normal role of RPH3A activity at the synaptic NMDAR complex which is needed for the induction of synaptic plasticity and NMDAR-dependant behaviours

Also previously 1 biallelic patient was reported, PMID: 29441694- 1 girl with learning disabilities, tremors, ataxia, hyperglycemia and muscle fatigability. Chet for 2 RPH3A missense. Functional analysis showed strong and marginal impairment of protein binding for each variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5250 DRG1 Dean Phelan gene: DRG1 was added
gene: DRG1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DRG1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DRG1 were set to PMID: 37179472
Phenotypes for gene: DRG1 were set to Neurodevelopmental disorder (MONDO:0700092), DRG1-related
Review for gene: DRG1 was set to GREEN
Added comment: PMID: 37179472
- Biallelic variants were identified in four affected individuals from three distinct families with neurodevelopmental disorder with global developmental delay, primary microcephaly, short stature and craniofacial anomalies. Functional studies show the variants result in a loss of function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5249 SRRM2 Zornitza Stark Publications for gene: SRRM2 were set to 33057194
Intellectual disability syndromic and non-syndromic v0.5246 RHOBTB2 Zornitza Stark Publications for gene: RHOBTB2 were set to 29768694; 29276004
Intellectual disability syndromic and non-syndromic v0.5239 NSUN6 Michelle Torres gene: NSUN6 was added
gene: NSUN6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSUN6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NSUN6 were set to 37226891
Phenotypes for gene: NSUN6 were set to neurodevelopmental disorder MONDO:0700092, NSUN6-related
Review for gene: NSUN6 was set to AMBER
Added comment: Three unrelated consanguineous families with developmental delay, intellectual disability, motor delay, and behavioral anomalies. WES detected homozygous variants:
- p.(Leu9Glufs*3): even though authors say is is predicted to cause NMD, it actually is NMD escape. No further studies were performed. A deceased affected sibling and parents were NOT tested.
- p.(Asp323Asn): Shown to result in a misfolded protein. Methylation assay showed mutant could not catalyze m5C deposition in transcribed tRNACys and tRNAThr substrates in vitro. One of the parents and both unaffected siblings were shown to be carriers.
- p.(Glu441Profs*15): truncation (full protein is 470aa) which would result in loss of residues involved in recognition and methylation. Shown to result in a misfolded protein. Parents were shown carriers.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5239 UNC79 Krithika Murali gene: UNC79 was added
gene: UNC79 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UNC79 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UNC79 were set to PMID:37183800
Phenotypes for gene: UNC79 were set to Complex neurodevelopmental disorder - MONDO:0100038
Review for gene: UNC79 was set to AMBER
Added comment: PMID:37183800 Bayat et al 2023 report 6 unrelated patients with heterozygous NMD-predicted LoF variants in UNC79 - x1 canonical splice site variant, x5 nonsense/frameshift. 5 were confirmed de novo, 1 not identified in mother - father unavailable for testing. All variants absent in gnomAD and v2 pLI score for UNC79 is 1.

Patients with UNC79 variants were identified through GeneMatcher or an international network of Epilepsy and Genetics departments. x1 patient underwent duo exome sequencing, remaining had trio exome sequencing - no other causative variants identified.

Phenotypic features included:
- 4/6 autistic features
- 5/6 patients mild-moderate ID
- 4/6 behavioural issues (aggression, stereotypies)
- 4/6 epilepsy (focal to bilateral tonic-clonic seizures)
- 5/6 hypotonia

unc79 knockdown drosophila flies exhibited significantly higher rate of seizure-like behaviour than controls. unc79 haploinsufficiency shown to lead to significant reduction in protein levels of both unc79 and unc80 in mouse brains. Unc79 haploinsufficiency associated with deficiency in hippocampal-dependent learning and memory in mice.

Authors have reviewed their own evidence in relation to the gene-disease criteria detailed by Strande et al 2017 and note that their clinical and experimental data provides moderate-level evidence supporting the association between UNC79 and a neurodevelopment disorder including ASD.

Amber association favoured due to clinical phenotypic range reported between affected individuals and their lack of specificity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5238 POU3F2 Ain Roesley Phenotypes for gene: POU3F2 were changed from Autism spectrum disorder, NDD, and adolescent-onset obesity; neurodevelopmental disorder MONDO:0700092, POU3F2-related to Autism spectrum disorder, NDD, and adolescent-onset obesity; neurodevelopmental disorder MONDO:0700092, POU3F2-related
Intellectual disability syndromic and non-syndromic v0.5237 POU3F2 Ain Roesley Phenotypes for gene: POU3F2 were changed from Autism spectrum disorder, NDD, and adolescent-onset obesity; neurodevelopmental disorder MONDO:0700092, POU3F2-related to Autism spectrum disorder, NDD, and adolescent-onset obesity; neurodevelopmental disorder MONDO:0700092, POU3F2-related
Intellectual disability syndromic and non-syndromic v0.5237 POU3F2 Ain Roesley Phenotypes for gene: POU3F2 were changed from Autism spectrum disorder, NDD, and adolescent-onset obesity; neurodevelopmental disorder MONDO:0700092, POU3F2-related to Autism spectrum disorder, NDD, and adolescent-onset obesity; neurodevelopmental disorder MONDO:0700092, POU3F2-related
Intellectual disability syndromic and non-syndromic v0.5237 POU3F2 Ain Roesley Phenotypes for gene: POU3F2 were changed from Autism spectrum disorder, NDD, and adolescent-onset obesity to Autism spectrum disorder, NDD, and adolescent-onset obesity; neurodevelopmental disorder MONDO:0700092, POU3F2-related
Intellectual disability syndromic and non-syndromic v0.5235 U2AF2 Elena Savva Publications for gene: U2AF2 were set to 33057194
Intellectual disability syndromic and non-syndromic v0.5234 ACBD6 Lucy Spencer gene: ACBD6 was added
gene: ACBD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ACBD6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ACBD6 were set to 36457943; 21937992; 35446914
Phenotypes for gene: ACBD6 were set to Neurodevelopmental disorder (MONDO#0700092), ACBD6-related
Review for gene: ACBD6 was set to GREEN
Added comment: PMID: 36457943
2 siblings with a neurodevelopmental disorder: severely delayed development, obesity, pancytopenia, diabetes, liver cirrhosis, intravertebral disc herniation, mild brain atrophy. Consanguineous family both siblings found to have a homozygous frameshift.

This paper also mentioned 3 other reported variants in 6 individuals (only 3 unrelated) all homozygous, 2 frameshift, 1 canonical splice. All reported to have a neurodevelopmental disorder, some with limited information but one family also has obesity, spasticity, and dysmorphism. PMIDs: 21937992, 35446914
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5234 POU3F2 Sarah Pantaleo gene: POU3F2 was added
gene: POU3F2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POU3F2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: POU3F2 were set to PMID: 37207645
Phenotypes for gene: POU3F2 were set to Autism spectrum disorder, NDD, and adolescent-onset obesity
Penetrance for gene: POU3F2 were set to unknown
Mode of pathogenicity for gene: POU3F2 was set to Other
Review for gene: POU3F2 was set to GREEN
Added comment: We associate ultra-rare variants in POU3F2, encoding a central nervous system transcription factor, with syndromic obesity and neurodevelopment delay in 12 individuals. Demonstrate variant pathogenicity through in vitro analysis. Used exome sequencing, GeneMatcher and Genomics England 100,000 Genomes Project rare disease database.

Both truncating and missense variants in over 10 individuals sharing autism spectrum disorder, NDD, and adolescent-onset obesity (may have had other features eg. CAKUT in 2 individuals, diabetes in two) . Affected individuals presented with low-to-normal birth weight and infantile feeding difficulties but developed insulin resistance and hyperplasia during childhood. With the exception of an early truncating variant, the variants showed adequate nuclear translocation but overall disturbed DNA-binding ability and promoter activation.

Variants absent from population and clinical databases. Almost all constituted putatively non-inherited de novo variants (8/10).

Functional studies provide evidence for loss of function in eight and gain of function in one obesity-associated POU3F2 variant. One variant did not impact POU3F2-promoter activation, leaving the possibility for further path-mechanisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5232 MAP4K4 Zornitza Stark Publications for gene: MAP4K4 were set to 37126546
Intellectual disability syndromic and non-syndromic v0.5232 MAP4K4 Zornitza Stark Publications for gene: MAP4K4 were set to
Intellectual disability syndromic and non-syndromic v0.5230 MCM6 Suliman Khan gene: MCM6 was added
gene: MCM6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MCM6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MCM6 were set to PMID: 37198333
Phenotypes for gene: MCM6 were set to Neurodevelopmental disorder, MONDO:0700092, MCM6-related
Review for gene: MCM6 was set to GREEN
Added comment: PMID: 37198333 reported 5 unrelated families with de novo variants in MCM6 gene. Two patients with the same missense variant p.(Cys158Tyr) in zinc finger domain presented with intra-uterine growth retardation, short stature, congenital microcephaly, endocrine features, developmental delay and urogenital anomalies.

In other three unrelated individuals different de novo missense variants were identified in the oligo nucleotide binding (OB)-fold domain. These patients had variable neurodevelopmental features including autism spectrum disorder, developmental delay, and epilepsy.

The clinical features and functional defects related to the zinc binding residue resembled those observed in syndromes related to other MCM components and DNA replication factors (Meier–Gorlin syndrome and Seckel syndrome), while de novo OB-fold domain missense variants were associated with more variable neurodevelopmental phenotypes (PMID: 37198333).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5225 LHX2 Zornitza Stark Publications for gene: LHX2 were set to PMID:
Intellectual disability syndromic and non-syndromic v0.5219 LHX2 Manny Jacobs gene: LHX2 was added
gene: LHX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LHX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LHX2 were set to PMID:
Intellectual disability syndromic and non-syndromic v0.5219 CNOT9 Karina Sandoval gene: CNOT9 was added
gene: CNOT9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CNOT9 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: CNOT9 were set to PMID: 37092538
Phenotypes for gene: CNOT9 were set to neurodevelopmental disorder, MONDO:0700092
Review for gene: CNOT9 was set to GREEN
Added comment: 7 individuals with de novo variants. In silico predictions of functional relevance. All affected persons have DD/ID, with five of them showing seizures. Other symptoms include.

Symptoms: Neuro dev disorder. ID, Epilepsy. All affected persons have DD/ID, with five of them showing seizures. Other symptoms include muscular hypotonia, facial dysmorphism, and behavioral abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5219 CBX1 Daniel Flanagan gene: CBX1 was added
gene: CBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CBX1 were set to PMID: 37087635
Phenotypes for gene: CBX1 were set to Neurodevelopmental disorder (MONDO#0700092), CBX1-related
Review for gene: CBX1 was set to GREEN
Added comment: Three different de novo missense variants identified in three unrelated individuals with developmental delay, hypotonia, autistic features, and variable dysmorphic features such as broad forehead and head circumference above average. Mutant mice displayed increased latency-to-peak response, suggesting the possibility of synaptic delay or myelination deficits. Functional studies confirmed the reduction of mutant HP1β binding to heterochromatin.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5216 INTS11 Melanie Marty gene: INTS11 was added
gene: INTS11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INTS11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: INTS11 were set to PMID: 37054711
Phenotypes for gene: INTS11 were set to Global developmental delay; launguage delay; intellectual disability; impaired motor development; brain atrophy
Review for gene: INTS11 was set to GREEN
Added comment: PMID: 37054711 - 15 individuals from 10 unrelated families with bi-allelic variants in INTS11 with global developmental and language delay, intellectual disability, impaired motor development, and brain atrophy.

Functional studies in Drosophila showed that dIntS11 (fly ortholog of INTS11) is essential and expressed in the central nervous systems in a subset of neurons and most glia in larval and adult stages.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5216 SRSF1 Paul De Fazio gene: SRSF1 was added
gene: SRSF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRSF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SRSF1 were set to 37071997
Phenotypes for gene: SRSF1 were set to Neurodevelopmental disorder, SRSF1-related MONDO:0700092
Review for gene: SRSF1 was set to GREEN
gene: SRSF1 was marked as current diagnostic
Added comment: 17 individuals from 16 families reported with mostly de novo variants. Variants were a mixture of missense, nonsense/frameshift (both NMD-predicted and not NMD-predicted) and microdeletions. In one family, only one parent was available for testing. In another family, 2 affected siblings had the variant but the variant was not identified in either parent suggesting germline mosaicism.

Functional testing of a subset of variants in Drosophila supported pathogenicity in most, but 2 missense variants showed no functional effect and were classified VUS. Episignature analysis (EpiSign) on patient DNA from blood showed a specific DNA methylation signature in patients with the variants classified pathogenic but not those classified VUS.

Phenotypes included mainly neurological abnormalities (mild to moderate ID/dev delay, motor delay, speech delay, and behavioural disorders) and facial dysmorphisms.

Other features included hypotonia (11/16), variable brain abnormalities on MRI (6/12), variable cardiac malformations (6/14). urogenital malformations e.g. hypospadias, cryptorchidism (6/13), scoliosis (5/17) and/or variable other skeletal abnormalities (10/17).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5216 POLR1A Elena Savva gene: POLR1A was added
gene: POLR1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR1A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: POLR1A were set to PMID: 37075751
Phenotypes for gene: POLR1A were set to Acrofacial dysostosis, Cincinnati type MIM#616462
Review for gene: POLR1A was set to GREEN
Added comment: PMID: 37075751 - >10 patients with developmental delay
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5215 SLC30A9 Lucy Spencer gene: SLC30A9 was added
gene: SLC30A9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC30A9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC30A9 were set to 37041080
Phenotypes for gene: SLC30A9 were set to Birk-Landau-Perez syndrome (MIM#617595)
Review for gene: SLC30A9 was set to GREEN
Added comment: PMID:37041080 - 2 families previously reported and this paper describes 4 more with biallelic SLC30A9 variants. Original 2 families: 6 affected members all hom for Ala350del, and 1 affected member chet for 2 frameshifts. 4 families from this paper: 2 families have the same homozygous missense (Gly418Val), family 3 has 4 affected sibs hom for Ala350del, family 4 1 affected chet for a frameshift and a synonymous. So 2 fams homs for Ala350del and 2 fams hom for Gly418Val.
All have Brik-Landau-Perez syndrome: all with ID, movement disorder and dystonia, and many with oculomotor apraxia, renal abnormalitie, ptosis, some had hearing impairment.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5214 GATAD2A Bryony Thompson gene: GATAD2A was added
gene: GATAD2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GATAD2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GATAD2A were set to https://doi.org/10.1016/j.xhgg.2023.100198; 17565372
Phenotypes for gene: GATAD2A were set to Neurodevelopmental disorder, MONDO:0700092, GATAD2A-related
Review for gene: GATAD2A was set to GREEN
Added comment: https://doi.org/10.1016/j.xhgg.2023.100198 - Five unrelated individuals with a neurodevelopmental disorder identified with 3 missense & 2 LoF (4 de novo & 1 unknown inheritance). The shared clinical features with variable expressivity include global developmental delay (4/4), craniofacial dysmorphism (3/5), structural brain defects (2/3), musculoskeletal anomalies (3/5), vision/hearing defects (2/3), gastrointestinal/renal defects (2/3). Loss of function is the expected mechanism of disease. In vitro assays of one of the missense variants (p.Cys420Tyr) demonstrates disruption of GATAD2A integration with CHD3, CHD4, and CHD5
PMID: 17565372 - null mouse model is embryonic lethal.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5212 KDM5A Zornitza Stark gene: KDM5A was added
gene: KDM5A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KDM5A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: KDM5A were set to 21937992; 33350388
Phenotypes for gene: KDM5A were set to Neurodevelopmental disorder MONDO:0700092, KDM5A-related
Review for gene: KDM5A was set to GREEN
Added comment: PMID:21937992 reported a family with recessive missense KDM5A variant presenting with an undefined developmental disorder characterised with intellectual disability and facial dysmorphisms.

PMID:33350388 reported nine patients from seven unrelated families identified with variants in KDM5A, of which three unrelated patients harboured heterozygous variants, while six patients from four unrelated families had homozygous variants. These patients presented with autism spectrum disorder (ASD) and a spectrum of neurodevelopmental phenotypes including intellectual disability, lack of speech, developmental delay and motor impairment.

In addition, loss of KDM5A has resulted in repetitive behaviors, sociability deficits, cognitive dysfunction, and abnormal dendritic morphogenesis in mice.

This gene has already been associated with phenotype in Gene2Phenotype (biallelic inheritance with 'limited' rating), but not in OMIM.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5201 YWHAE Yetong Chen gene: YWHAE was added
gene: YWHAE was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: YWHAE was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: YWHAE were set to 36999555
Phenotypes for gene: YWHAE were set to Neurodevelopmental disorder, MONDO:0700092
Review for gene: YWHAE was set to GREEN
Added comment: PMID 36999555 reports 6 patients with YWHAE variants (1 intragenic deletion and 5 large deletions encompassing YWHEA but not PAFAH1B1) who have mild to severe intellectual disability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5198 CRIPT Karina Sandoval gene: CRIPT was added
gene: CRIPT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRIPT were set to PMID: 37013901
Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789) : Rothmund-Thomson syndrome MONDO:0010002
Review for gene: CRIPT was set to GREEN
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5195 SNAPC4 Ee Ming Wong gene: SNAPC4 was added
gene: SNAPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNAPC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNAPC4 were set to 36965478
Phenotypes for gene: SNAPC4 were set to Neurodevelopmental disorder (MONDO#0700092), SNAPC4-related
Review for gene: SNAPC4 was set to GREEN
gene: SNAPC4 was marked as current diagnostic
Added comment: - Ten individuals from eight families with neurodevelopmental disorder found to be compound heterozygous for variants in SNAPC4
- Identified variants included 6x missense, 1x nonsense, 1x frameshift and 6x splice
- Depletion of SNAPC4 levels in HeLa cell lines via genomic editing led to decreased snRNA expression and global dysregulation of alternative splicing, similarly observed in patient fibroblasts
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5195 MKL2 Dean Phelan gene: MKL2 was added
gene: MKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MKL2 were set to PMID: 37013900
Phenotypes for gene: MKL2 were set to Neurodevelopmental disorder (MONDO:0700092), MKL2-related
Mode of pathogenicity for gene: MKL2 was set to Other
Review for gene: MKL2 was set to AMBER
Added comment: PMID: 37013900
- de novo missense variants in MKL2 (now known as MRTFB) were identified in two patients with mild dysmorphic features, intellectual disability, global developmental delay, speech apraxia, and impulse control issues. Functional studies in a Drosophila model suggest a gain of function disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5195 RNH1 Krithika Murali gene: RNH1 was added
gene: RNH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNH1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNH1 were set to PMID: 36935417
Phenotypes for gene: RNH1 were set to RNH1-related disorder
Review for gene: RNH1 was set to AMBER
Added comment: PMID: 36935417 report two siblings from a consanguineous Somali family with homozygous RNH1 splice site variant (c.615-2A>C) with congenital cataracts, global developmental delay, hypotonia, seizures (focal and generalised) and regression in the context of infection. RT-PCR and RNASeq of skeletal muscle supported exon 7 skipping with an in-frame deletion involving 57 amino acids with reduced expression on Western blot analysis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5195 ESAM Chern Lim gene: ESAM was added
gene: ESAM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ESAM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ESAM were set to 36996813
Phenotypes for gene: ESAM were set to Neurodevelopmental disorder (MONDO#0700092), ESAM-related
Review for gene: ESAM was set to GREEN
gene: ESAM was marked as current diagnostic
Added comment: PMID 36996813:
- Thirteen affected individuals, including four fetuses, from eight unrelated families, with homozygous loss-of-function-type variants in ESAM – 2 of the variants are frameshifts, 1x nonsense, 1x canonical splice.
- Affected individuals have profound global developmental delay/unspecified intellectual disability, epilepsy, absent or severely delayed speech, varying degrees of spasticity, ventriculomegaly, and ICH/cerebral calcifications, the latter being also observed in the fetuses.
- One of the frameshift variant c.115del (p.Arg39Glyfs*33), was detected in six individuals from four unrelated families from the same geographic region in Turkey (southeastern Anatolia), suggesting a founder effect.
- The c.451+1G>A variant was detected in three individuals from two independent families with the same ethnic origin (Arab Bedouin)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5192 TAB2 Lucy Spencer gene: TAB2 was added
gene: TAB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TAB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAB2 were set to 35971781
Phenotypes for gene: TAB2 were set to Congenital heart defects, multiple types, 2 MONDO:0014000
Review for gene: TAB2 was set to GREEN
Added comment: PMID: 35971781 - expansion of the phenotype, 14 patients with TAB2 variants 6 have dev delay and 4 are also listed as having ID along with other phenotype features associated with this gene.

Note- there is a previous review of this paper in the mendeilome as amber
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5187 CTR9 Zornitza Stark Publications for gene: CTR9 were set to PMID: 35499524
Intellectual disability syndromic and non-syndromic v0.5184 YWHAZ Achchuthan Shanmugasundram gene: YWHAZ was added
gene: YWHAZ was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: YWHAZ was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: YWHAZ were set to 36001342
Phenotypes for gene: YWHAZ were set to Intellectual disability, MONDO:0001071
Review for gene: YWHAZ was set to RED
Added comment: PMID:36001342 reported one large three-generation family with intellectual disability and global developmental delay, where all affected members were identified with a heterozygous missense variant (c.147A>T/ p.Lys49Asn) in YWHAZ gene. Although there were 10 other rare variants located in 10 genes (ARHGAP4, AGPS, APOL3, CES3, DACT2, ECH1, FAM71E2, KREMEN1, YWHAZ, ZFYVE26) that co-segregated with the ID/GDD phenotype were identified in the family, they were either not present in all affected members or present in unaffected members.

In addition, computational modeling and knockdown/ knockin studies with Drosophila also confirmed the role of this YWHAZ variant in intellectual disability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5183 RRAS2 Elena Savva gene: RRAS2 was added
gene: RRAS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RRAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RRAS2 were set to PMID: 31130282; 31130285
Phenotypes for gene: RRAS2 were set to Noonan syndrome 12 MIM#618624
Mode of pathogenicity for gene: RRAS2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: RRAS2 was set to AMBER
Added comment: Gene has an established GOF mechanism

PMID: 31130282 - 3/9 individuals had mild learning difficulties or mild GDD

PMID: 31130285 - 1/3 individuals had mild ID, 1/3 had severe ID, 1/3 normal
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5182 RBSN Achchuthan Shanmugasundram gene: RBSN was added
gene: RBSN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RBSN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RBSN were set to 25233840; 29784638; 35652444
Phenotypes for gene: RBSN were set to intellectual disability, MONDO:0001071
Review for gene: RBSN was set to GREEN
Added comment: This gene should be rated GREEN as bi-allelic variants in RBSN has been associated with a phenotype encompassing developmental delay and intellectual disability from four unrelated families.

PMID:25233840 reported a 6.5 year old female patient with a homozygous missense variant c.1273G > A (p.Gly425Arg) and her clinical presentation included intractable seizures, developmental delay, microcephaly, dysostosis, osteopenia, craniofacial dysmorphism, macrocytosis and megaloblastoid erythropoiesis.

PMID:29784638 reported three siblings with homozygous variant c.289G>C (p.Gly97Arg) in RBSN. The proband presented global developmental delay, had complete 46,XY male-to-female sex reversal and died at age 20 months after multiple infections. The other 2 affected siblings underwent unrelated-donor bone marrow or stem cell transplantation at 8 and 6.5 months of age, respectively. Both have severe intellectual disability and are nonambulatory and nonverbal.

PMID:35652444 reported two unrelated families (three siblings from a family of Iranian descent identified with homozygous variant c.547G>A (p.Gly183Arg) and four members from a family of indigenous Cree descent identified with homozygous variant c.538C>G (p.Arg180Gly)) with overlapping phenotypes including developmental delay, intellectual disability, distal motor axonal neuropathy and facial dysmorphism.

This gene has not yet been associated with any phenotypes either in OMIM or in Gene2Phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5182 DPYSL2 Achchuthan Shanmugasundram gene: DPYSL2 was added
gene: DPYSL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DPYSL2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DPYSL2 were set to 27249678; 35861646
Phenotypes for gene: DPYSL2 were set to intellectual disability, MONDO:0001071; Aplasia/Hypoplasia of the corpus callosum, HP:0007370
Review for gene: DPYSL2 was set to AMBER
Added comment: This gene should be rated AMBER, as it has been associated with intellectual disability (ID) from two unrelated cases displaying monoallelic variants in DPYSL2/ CRMP2, and supported by functional studies. However, the evidence is not sufficient for green rating as there are variants reported in other (but different) genes in the two patients.

PMID:35861646 reported two cases identified with heterozygous variants (patient1: c.1693C>T (p.Arg565Cys); patient 2: c.42C>A (p.Ser14Arg). These patients had overlapping phenotypes including dysmorphic features, severe global developmental delay and hypoplasia of the corpus callosum. In addition, patient 2 was bed-ridden and could not roll out and had a history of myoclonic seizures and status epilepticus.

It should be noted that patient 1 is compound heterozygous for 2 missense variants in the EFCAB5 gene and was hemizygous for a maternally inherited missense variant in the GPKOW gene and patient 2 had 1 de novo missense variant in the COBLL1 gene and was compound heterozygous for 2 missense variants in the POTEF gene. The severity of the phenotypes between the two cases differs significantly and the additional variants may have possibly contributed to this phenotype.

Brain-specific Crmp2 knockout mice display neuronal development deficits and behavioural impairments associated with hypoplasia of the corpus callosum. In addition, functional studies performed in zebrafish and cell lines that the CRMP2 variants lead to the loss-of-function of CRMP2 protein and can cause intellectual disability.

This gene has not yet been associated with relevant phenotypes either in OMIM or in Gene2Phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5181 AMOTL1 Lucy Spencer gene: AMOTL1 was added
gene: AMOTL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AMOTL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AMOTL1 were set to 36751037
Phenotypes for gene: AMOTL1 were set to Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related
Review for gene: AMOTL1 was set to GREEN
Added comment: PMID: 36751037- 16 individuals from 12 families with orofacial clefting syndrome and het variants in AMOTL1. Many in 1 hotspot: 5 individuals from 3 families have R157C, 6 individuals from another 4 families have R157H, 1 has P160L, and another has Q161R. Out of this hostpaot- 1 with P368A, 1 with E507K, 1 with E579K. 7 are de novo. All but 2 have clefting, 7 are dysmorphic, 5 have hearing loss, 9 have CHD, 7 have tall stature, 6 have dev delay. Other features include liver disease, myopia, scoliosis and immune involvement.

Another 2 families have been previously reported (described in the panelapp review in mendeliome) with variants in this hotspot 1 has 2 individuals with R157C, the other has 1 individual with P160L. All hotspot are absent from gnomad v2.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5180 SLC35B2 Zornitza Stark gene: SLC35B2 was added
gene: SLC35B2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC35B2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC35B2 were set to 35325049
Phenotypes for gene: SLC35B2 were set to Leukodystrophy, hypomyelinating, 26, with chondrodysplasia, MIM# 620269
Review for gene: SLC35B2 was set to AMBER
Added comment: 2 x individuals with homozygous variants (c.1218_1220del and c.1224_1225del) in SLC35B2. Phenotypes included pre- and postnatal growth retardation, scoliosis, severe motor and intellectual disabilities and hypomyelinating leukodystrophy. Functional analysis on patient cells showed that the variants result in a decreased expression of mRNA and affect protein subcellular localization leading to functional impairment of the protein.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5177 ROBO1 Achchuthan Shanmugasundram gene: ROBO1 was added
gene: ROBO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ROBO1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ROBO1 were set to 28286008; 30692597; 35227688; 35348658
Phenotypes for gene: ROBO1 were set to intellectual disability, MONDO:0001071
Review for gene: ROBO1 was set to GREEN
Added comment: Comment on gene classification: This gene should be rated green as this gene has been associated with intellectual disability from six unrelated cases. However, the MOI should be set as "BIALLELIC, autosomal or pseudoautosomal" as five of these cases were reported with biallelic variants and only one case was reported with monoallelic variant.

PMID:28286008 reported a boy with compound heterozygous variants that was presented with developmental delay in 13 months and had severe intellectual disability and hyperactivity at nine years of age. He was nonverbal and wheelchair dependent because of spastic diplegia and ataxia.

PMID:30692597 reported a five year old boy identified with a homozygous ROBO1 variant who had combined pituitary hormone deficiency, psychomotor developmental delay, severe intellectual disability, sensorineural hearing loss, strabismus and characteristic facial features.

PMID:35227688 reported eight patients including the boy reported in PMID:30692597. Of the other seven patients, three were presented with intellectual disability. Of these three patients, two harboured compound heterozygous and one harboured homozygous variants.

PMID:35348658 reported a patient identified with monoallelic de novo variant (p.D422G) who presented with early-onset epileptic encephalopathy and had severe developmental delay.

This gene has not yet been associated with any phenotypes in OMIM or Gene2Phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5177 ATG4D Suliman Khan gene: ATG4D was added
gene: ATG4D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATG4D was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATG4D were set to PMID: 36765070
Phenotypes for gene: ATG4D were set to neurodevelopmental disorder; Abnormal facial shape
Penetrance for gene: ATG4D were set to unknown
Review for gene: ATG4D was set to GREEN
Added comment: PMID: 36765070 reported three individuals from two unrelated families with a neurodevelopmental disorder characterized by speech and motor impairment with a similar facial gestalt comprising almond-shaped eyes, depressed nasal bridge, and a prominent Cupid’s bow with variable disease severity and progression. NGS analysis revealed bi-allelic loss-of-function variants in ATG4D gene. Based on the clinical, bioinformatic, and functional data, the author concluded that bi-allelic loss-of-function variants in ATG4D contribute to the pathogenesis of syndromic neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5177 PPM1K Zornitza Stark Publications for gene: PPM1K were set to 23086801
Intellectual disability syndromic and non-syndromic v0.5174 RAB39B Zornitza Stark Publications for gene: RAB39B were set to
Intellectual disability syndromic and non-syndromic v0.5171 JPH3 Zornitza Stark Publications for gene: JPH3 were set to 33824468
Intellectual disability syndromic and non-syndromic v0.5166 GOLGA2 Zornitza Stark Publications for gene: GOLGA2 were set to PMID: 30237576; 26742501
Intellectual disability syndromic and non-syndromic v0.5164 WDR5 Bryony Thompson Publications for gene: WDR5 were set to DOI:https://doi.org/10.1016/j.xhgg.2022.100157
Intellectual disability syndromic and non-syndromic v0.5160 FICD Elena Savva gene: FICD was added
gene: FICD was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FICD was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FICD were set to 36704923
Phenotypes for gene: FICD were set to Neurodevelopmental disorder, FICD-related (MONDO#0700092)
Review for gene: FICD was set to AMBER
Added comment: PMID: 36704923:
- five individuals (3 families) w/ infancy onset diabetes mellitus (5/5) and severe neurodevelopmental delay (4/5)
- all homozygous for p.R371S
- variant expression in E. coli showed loss of affinity, deregulates BiP-AMP and affects secretion
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5159 OGDH Zornitza Stark gene: OGDH was added
gene: OGDH was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: OGDH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OGDH were set to 36520152; 32383294
Phenotypes for gene: OGDH were set to Oxoglutarate dehydrogenase deficiency, MIM# 203740
Review for gene: OGDH was set to GREEN
Added comment: 6 individuals reported with bi-allelic variants in this gene and DD.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5158 CCDC84 Lucy Spencer gene: CCDC84 was added
gene: CCDC84 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC84 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC84 were set to 34009673
Phenotypes for gene: CCDC84 were set to Mosaic variegated aneuploidy syndrome 4 (MIM#620153)
Review for gene: CCDC84 was set to AMBER
Added comment: PMID: 34009673- patients with constitutional mosaic aneuploidy were found to have biallelic mutations in CENATAC(CCDC84). 2 adult siblings with mosaic aneuploidies, microcephaly, dev delay, and maculopathy. Both chet for a missense and a splice site deletion- but the paper days these both result in the creation of a novel splice site that leads to frameshifts and loss of the c-terminal 64 amino acids.

Gene is shown to be part of a spliceosome. CENATAC depletion or expression of disease mutants resulted in retention of introns in ~100 genes enriched for nucleocytoplasmic transport and cell cycle regulation, and caused chromosome segregation errors.

Functional analysis in CENATAC-depleted HeLa cells demonstrated chromosome congression defects and subsequent mitotic arrest, which could be fully rescued by wildtype but not mutant CENATAC. Expression of the MVA-associated mutants exacerbated the phenotype, suggesting that the mutant proteins dominantly repress the function of any residual wildtype protein.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5156 TCEAL1 Zornitza Stark reviewed gene: TCEAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with gait disturbance, dysmorphic facies and behavioral abnormalities, X-linked, MIM# 301094; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5155 FGF13 Zornitza Stark Publications for gene: FGF13 were set to 33245860
Intellectual disability syndromic and non-syndromic v0.5150 NAE1 Zornitza Stark gene: NAE1 was added
gene: NAE1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAE1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAE1 were set to 36608681
Phenotypes for gene: NAE1 were set to Neurodevelopmental disorder, MONDO:0700092, NAE1-related
Review for gene: NAE1 was set to GREEN
Added comment: Four individuals reported with bi-allelic variants and intellectual disability, ischiopubic hypoplasia, stress-mediated lymphopenia and neurodegeneration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5148 TRPC5 Zornitza Stark gene: TRPC5 was added
gene: TRPC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRPC5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890
Phenotypes for gene: TRPC5 were set to Neurodevelopmental disorder, MONDO:0700092, TRPC5-related
Review for gene: TRPC5 was set to AMBER
Added comment: PMID: 36323681; Leitão E. et al. (2022) Nat Commun.13(1):6570:
Missense variant NM_012471.2:c.523C>T, p.(Arg175Cys in three brothers with intellectual disability (ID) and autistic spectrum disorder (ASD), inherited from an asymptomatic mother and absent in the maternal grandparents.
Whole cell patch clamp studies of HEK293 created by site-directed mutagenesis showed increased current of this calcium channel (constitutively opened).
(This variant is absent in gnomAD v2.1.1).

Also, the nonsense variant, c.965G> A, p.(Trp322*) was found in a high functioning ASD male (maternally inherited), NMD-predicted.

Other papers and TRPC5 variants that were cited to associate this gene with X-linked ID and/or ASD include:
PMID: 24817631; Mignon-Ravix, C. et al. (2014) Am. J.Med. Genet. A 164A: 1991–1997: A hemizygous 47-kb deletion in Xq23 including exon 1 of the TRPC5 gene. He had macrocephaly, delayed psychomotor development, speech delay, behavioural problems, and autistic features. Maternally inherited, and a family history compatible with X-linked inheritance (i.e., maternal great uncle was also affected, although not tested).

In addition, PMID: 36323681; Leitão E. et al. (2022) cites papers with the variants p.(Pro667Thr), p.(Arg71Gln) and p.(Trp225*).
NB. p.(Pro667Thr) is absent in gnomAD (v2.1.1), p.(Arg71Gln) is also absent (the alternative variant p.(Arg71Trp) is present once as heterozygous only). p.(Trp225*) is absent, and it should be noted that PTCs / LoF variants are very rare (pLI = 1).

However, looking further into the three references, the evidence is not as clear or as accurate as was stated.

The missense variant c.1999C>A, p.(Pro667Thr), was stated as de novo, but was actually maternally inherited but was still considered a candidate for severe intellectual disability (shown in the Appendix, Patient 93, with severe speech delay, autism spectrum disorder and Gilles de la Tourette). This patient also has a de novo MTF1 variant. Reference: PMID: 23033978; de Ligt, J. et al. (2012) N. Engl. J. Med. 367: 1921–1929).

Missense variant (de novo): c.212G>A, p.(Arg71Gln), was found as part of the Deciphering Developmental Disorders (DDD) study and is shown in individual 164 in Supplementary Table 2 of PMID: 33504798; Martin, HC. et al. (2021) Nat. Commun.12: 627. Also displayed in DECIPHER (DDD research variant) with several phenotype traits, but ID and ASD are not specifically mentioned.

Nonsense variant: c.674G>A. p.(Trp225*) was stated as de novo but was inherited (reference PMID: 28191890; Kosmicki, JA. et al. (2017) Nat. Genet. 49: 504–510. Supplement Table 7). This was a study of severe intellectual delay, developmental delay / autism. (NB. The de novo p.(Arg71Gln) variant from the DDD study is also listed (subject DDD 342 in Supplement 4 / Table 2).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5146 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762
Intellectual disability syndromic and non-syndromic v0.5145 CDK16 Zornitza Stark Publications for gene: CDK16 were set to 25644381
Intellectual disability syndromic and non-syndromic v0.5137 ZMYM3 Zornitza Stark Publications for gene: ZMYM3 were set to 24721225
Intellectual disability syndromic and non-syndromic v0.5134 EIF4A2 Dean Phelan gene: EIF4A2 was added
gene: EIF4A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF4A2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: EIF4A2 were set to PMID: 36528028
Phenotypes for gene: EIF4A2 were set to Neurodevelopmental disorder (MONDO:0700092), EIF4A2-related
Mode of pathogenicity for gene: EIF4A2 was set to Other
Review for gene: EIF4A2 was set to GREEN
Added comment: PMID: 36528028
- EIF4A2 variants were observed in 15 individuals from 14 families. Affected individuals had a range of symptoms including global developmental delay (9/15), ID (7/15), epilepsy (11/15) and structural brain alterations (10/15). Monoallelic and biallelic variants were reported and functional studies showed both LOF and GOF disease mechanisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5134 TRA2B Elena Savva gene: TRA2B was added
gene: TRA2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRA2B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TRA2B were set to PMID: 36549593
Phenotypes for gene: TRA2B were set to Neurodevelopmental disorder, TRA2B-related (MONDO#0700092)
Review for gene: TRA2B was set to GREEN
Added comment: PMID: 36549593
- 12 individuals with ID and dev delay. Additional features include infantile spams 6/12, hypotonia 12/12, dilated brain ventricles 6/12, microcephaly 5/12
- All variants result in the loss of 1/2 transcripts (start-losses or PTCs upstream of a second translation start position). Shorter transcript expression is increased, longer transcript expression is decreased.
- Apparently het mice K/O are normal, but complete K/O cannot develop embryonically.
- DN mechanism suggested
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5133 ZMYM3 Belinda Chong reviewed gene: ZMYM3: Rating: GREEN; Mode of pathogenicity: None; Publications: 36586412, 24721225; Phenotypes: Neurodevelopmental disorders (NDDs); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5129 SETD2 Zornitza Stark Phenotypes for gene: SETD2 were changed from Luscan-Lumish syndrome, MIM#616831 to Luscan-Lumish syndrome, MIM#616831; Rabin-Pappas syndrome,MIM# 620155; Intellectual developmental disorder, autosomal dominant 70, MIM# 620157
Intellectual disability syndromic and non-syndromic v0.5128 SETD2 Zornitza Stark Publications for gene: SETD2 were set to 29681085
Intellectual disability syndromic and non-syndromic v0.5127 SETD2 Zornitza Stark edited their review of gene: SETD2: Added comment: PMID 32710489: 12 unrelated patients, ranging from 1 month to 12 years of age, with a multisystemic neurodevelopmental disorder associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740W).

Key clinical features: severely impaired global development apparent from infancy, feeding difficulties with failure to thrive, small head circumference, and dysmorphic facial features. Affected individuals have impaired intellectual development and hypotonia; they do not achieve walking or meaningful speech. Other neurologic findings may include seizures, hearing loss, ophthalmologic defects, and brain imaging abnormalities. There is variable involvement of other organ systems, including skeletal, genitourinary, cardiac, and possibly endocrine.

Further 3 unrelated patients identified with mild to moderately impaired intellectual development associated with a specific de novo heterozygous mutation in the SETD2 gene (R1740Q).

These are distinct clinically from Luscan-Lumish syndrome, which is characterised by overgrowth.; Changed publications: 29681085, 32710489; Changed phenotypes: Luscan-Lumish syndrome, MIM#616831, Rabin-Pappas syndrome,MIM# 620155, Intellectual developmental disorder, autosomal dominant 70, MIM# 620157
Intellectual disability syndromic and non-syndromic v0.5127 CLDN5 Suliman Khan gene: CLDN5 was added
gene: CLDN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLDN5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CLDN5 were set to PMID: 36477332
Phenotypes for gene: CLDN5 were set to seizures; developmental delay; microcephaly; brain calcifications
Penetrance for gene: CLDN5 were set to Complete
Mode of pathogenicity for gene: CLDN5 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: CLDN5 was set to GREEN
Added comment: PMID: 36477332 identified de novo heterozygous missense variants in CLDN5 in fifteen unrelated patients who presented with a shared constellation of features including developmental delay, seizures (primarily infantile onset focal epilepsy), microcephaly and a recognizable pattern of pontine atrophy and brain calcifications.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5126 BUB1B Zornitza Stark Publications for gene: BUB1B were set to
Intellectual disability syndromic and non-syndromic v0.5121 FZR1 Zornitza Stark gene: FZR1 was added
gene: FZR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: FZR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FZR1 were set to 34788397
Phenotypes for gene: FZR1 were set to Developmental and epileptic encephalopathy 109, MIM# 620145
Review for gene: FZR1 was set to GREEN
Added comment: Four unrelated individuals reported with de novo missense variants in this gene. Affected individuals had developmental delay before and concurrent with the onset of seizures. Features included impaired intellectual development with poor speech, ataxic gait, coordination problems, and behavioral abnormalities. Drosophila model supports gene-disease association.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.5119 ELP2 Zornitza Stark Publications for gene: ELP2 were set to
Intellectual disability syndromic and non-syndromic v0.5116 AMER1 Zornitza Stark Publications for gene: AMER1 were set to
Intellectual disability syndromic and non-syndromic v0.5115 AMER1 Zornitza Stark Mode of inheritance for gene: AMER1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5113 DLD Zornitza Stark Publications for gene: DLD were set to
Intellectual disability syndromic and non-syndromic v0.5110 DHCR24 Zornitza Stark Publications for gene: DHCR24 were set to
Intellectual disability syndromic and non-syndromic v0.5107 DOCK8 Zornitza Stark Publications for gene: DOCK8 were set to
Intellectual disability syndromic and non-syndromic v0.5105 CDC42 Zornitza Stark Publications for gene: CDC42 were set to
Intellectual disability syndromic and non-syndromic v0.5101 ALMS1 Zornitza Stark Publications for gene: ALMS1 were set to
Intellectual disability syndromic and non-syndromic v0.5095 B3GLCT Zornitza Stark Publications for gene: B3GLCT were set to
Intellectual disability syndromic and non-syndromic v0.5092 AP1S1 Zornitza Stark Publications for gene: AP1S1 were set to 30244301; 24754424; 19057675; 23423674
Intellectual disability syndromic and non-syndromic v0.5091 AP1S1 Zornitza Stark Publications for gene: AP1S1 were set to
Intellectual disability syndromic and non-syndromic v0.5088 ASAH1 Zornitza Stark Publications for gene: ASAH1 were set to
Intellectual disability syndromic and non-syndromic v0.5085 DPM1 Zornitza Stark Publications for gene: DPM1 were set to 10642602; 23856421; 16641202; 15669674; 10642597
Intellectual disability syndromic and non-syndromic v0.5085 DPM1 Zornitza Stark Publications for gene: DPM1 were set to
Intellectual disability syndromic and non-syndromic v0.5082 CENPF Zornitza Stark Publications for gene: CENPF were set to
Intellectual disability syndromic and non-syndromic v0.5079 NLGN4X Krithika Murali reviewed gene: NLGN4X: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:26350204, PMID:14963808, PMID:12669065, PMID:23352163, PMID:28263302, PMID:16648374; Phenotypes: Intellectual developmental disorder, X-linked - MIM#300495; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5079 AMER1 Deepak Subramanian reviewed gene: AMER1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 19079258, 22987541, 23401208, 28497491, 32879452, 35186393, 20950377, 22043478; Phenotypes: Osteopathia striata with cranial sclerosis, OMIM:300373, Osteopathia striata-cranial sclerosis syndrome, ORPHA:2780, Intellectual disability, HP:0001249; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.5078 BCKDK Zornitza Stark Publications for gene: BCKDK were set to
Intellectual disability syndromic and non-syndromic v0.5075 AHI1 Zornitza Stark Publications for gene: AHI1 were set to
Intellectual disability syndromic and non-syndromic v0.5072 CEP41 Zornitza Stark Publications for gene: CEP41 were set to
Intellectual disability syndromic and non-syndromic v0.5069 DAG1 Zornitza Stark Publications for gene: DAG1 were set to
Intellectual disability syndromic and non-syndromic v0.5066 BOLA3 Zornitza Stark Publications for gene: BOLA3 were set to
Intellectual disability syndromic and non-syndromic v0.5056 ARF3 Zornitza Stark Publications for gene: ARF3 were set to 34346499
Intellectual disability syndromic and non-syndromic v0.5053 TCEAL1 Melanie Marty gene: TCEAL1 was added
gene: TCEAL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TCEAL1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: TCEAL1 were set to PMID: 36368327
Phenotypes for gene: TCEAL1 were set to hypotonia; abnormal gait; developmental delay; intellectual disability; autism; dysmorphic facial features.
Review for gene: TCEAL1 was set to GREEN
Added comment: 7 individuals (males and females) with de novo variants involving TCEAL1 with an X-linked
dominant neurodevelopmental syndrome. Individuals had hypotonia, abnormal gait, developmental delay/intellectual disability especially affecting expressive language, autistic-like behavior, and mildly dysmorphic facial features. Additional features included strabismus, refractive errors, variable nystagmus, gastroesophageal reflux, constipation, dysmotility, recurrent infections, seizures, and structural brain anomalies.

1 additional male individual with a maternally inherited missense variant (unaffected mother), which was considered a VUS. This individual had hypertonia and spasticity without syndromic features.

4 PTCs, 2 CNVs, 2 missense reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5053 EPRS Lucy Spencer gene: EPRS was added
gene: EPRS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EPRS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EPRS were set to 29576217, 36411955
Phenotypes for gene: EPRS were set to Leukodystrophy, hypomyelinating, 15 (MIM#617951)
Review for gene: EPRS was set to GREEN
Added comment: 5 patients across 2 papers, with delayed development (3/5) and/or regression, ataxia, dystonia, hypomyelinating leukodystrophy or periventricular white matter, 2 with epilepsy, 3 with optic atrophy, 2 with deafness, 2 with micrcephaly, 1 noted to have some facial dysmorphism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5053 GABRA3 Sarah Pantaleo gene: GABRA3 was added
gene: GABRA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GABRA3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: GABRA3 were set to PMID: 29053855
Phenotypes for gene: GABRA3 were set to Epilepsy, intellectual disability, dysmorphic features,
Penetrance for gene: GABRA3 were set to Incomplete
Review for gene: GABRA3 was set to GREEN
Added comment: Six variants in GABRA3 encoding the alpha3-subunit of the GABA(A) receptor.
Five missense variants and one micro duplication were detected in four families and two sporadic cases presenting with a range of epileptic seizure types, a varying degree of intellectual disability and developmental delay, sometimes with dysmorphic features or nystagmus.
The variants co-segregated mostly but not completely with the phenotype in the families, indicating in some cases incomplete penetrance, involvement of other genes, or presence of phenocopies.
Overall, males were more severely affected and there were three asymptomatic female mutation carriers compared to only one male without a clinical phenotype.
Mechanism suggested - three detected missense variants are localised in the extracellular GABA-binding NH2-terminus, one in the M2-M3 linker and one in the M4 transmembrane segment of the alpha3-subunit. Functional studies in Xenopus leaves oocytes revealed a variable but significant reduction of GABA-evoked anion currents for all mutants compared to wild-type receptors. The degree of current reduction correlated partially with the phenotype.
Results reveal that rare loss-of-function variants in GABRA3 increase the risk for a varying combination of epilepsy, intellectual disability/developmental delay and dysmorphic features, presenting in some pedigrees with an X-linked inheritance pattern.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5052 FEM1C Paul De Fazio gene: FEM1C was added
gene: FEM1C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FEM1C was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FEM1C were set to 36336956; 28135719; 33398170; 33398168
Phenotypes for gene: FEM1C were set to Neurodevelopmental disorder, FEM1C-related MONDO:0700092
Review for gene: FEM1C was set to GREEN
gene: FEM1C was marked as current diagnostic
Added comment: PMID:36336956 describes a 9-year-old boy with severe DD, lack of speech, pyramidal signs, and limb ataxia who had a de novo missense variant Asp126His in FEM1C ascertained by WES. The equivalent variant introduced into the nematode C.elegans resulted in disabled locomotion caused by synaptic abnormalities and not muscle dysfunction.

An alternate change Asp126Val was reported in the DDD study de novo in a patient with uncharacterised developmental delay (PMID:28135719).

The Asp126 residue (but not either of the variants above specifically) was shown to be functionally important by in vitro studies (PMID:33398170;33398168). The residue is highly conserved and located in a region of missense constraint.

Borderline green, 2 patients and an animal model. Note all evidence points to the Asp126 residue being of specific importance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5050 KDM2B Ain Roesley gene: KDM2B was added
gene: KDM2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KDM2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KDM2B were set to 36322151
Phenotypes for gene: KDM2B were set to neurodevelopmental disorder MONDO#070009, KDM2B-related
Review for gene: KDM2B was set to GREEN
gene: KDM2B was marked as current diagnostic
Added comment: 27 individuals from 22 families were recruited
13 SNV classified LP/P, all de novo except 2 familial cases
5 variants were classified as VUS if more than 1 het is present in gnomAD or does result in a KDM2B-specific episignature (therefore suggesting normal function)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5049 MAN2A2 Zornitza Stark gene: MAN2A2 was added
gene: MAN2A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAN2A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAN2A2 were set to 36357165
Phenotypes for gene: MAN2A2 were set to Congenital disorder of glycosylation, MONDO:0015286, MAN2A2-reated
Review for gene: MAN2A2 was set to RED
Added comment: Single consanguineous family reported with homozygous truncating variant in two brothers with ID. Supportive biochemical data only
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5047 CDK10 Zornitza Stark Publications for gene: CDK10 were set to
Intellectual disability syndromic and non-syndromic v0.5044 EXOSC3 Zornitza Stark Publications for gene: EXOSC3 were set to
Intellectual disability syndromic and non-syndromic v0.5041 ARPC4 Zornitza Stark gene: ARPC4 was added
gene: ARPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARPC4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARPC4 were set to 35047857
Phenotypes for gene: ARPC4 were set to Developmental delay, language impairment, and ocular abnormalities, MIM# 620141
Review for gene: ARPC4 was set to GREEN
Added comment: 7 affected individuals from 6 families (gonadal mosaicism was confirmed in the mother of the 2 affected siblings) with a recurrent missense variant (NM_005718.4:c.472C>T; p.R158C). 6/7 affected individuals had microcephaly. The variant was associated with a decreased amount of F-actin in cells from two affected individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods.
Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration, with functional effects of the mutation reproduced with knocked down endogenous expression of exosc3 in zebrafish embryos and subsequent rescue of the phenotype by co-injection with wild-type zebrafish exosc3 mRNA.
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across varying degrees of severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang edited their review of gene: EXOSC3: Added comment: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.; Changed phenotypes: Cerebellar atrophy, Developmental delay, Lower motor neuron degeneration, Upper motor neuron features, Spasticity/hyperreflexia (+/-)
Intellectual disability syndromic and non-syndromic v0.5040 EXOSC3 Michelle Dang changed review comment from: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy. Variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment (to varying degrees) reported in all cases across various severity.; to: Association with global developmental delay, hypotonia, hyperreflexia, cerebellar (+/- pontine) atrophy with variable severity. Assessment of cognitive function/IQ limited by motor and speech impairments. Severe forms associated with early deaths during infancy periods. Intellectual impairment/psychomotor retardation (to varying degrees) reported in all cases across various severity (23284067). Zanni et al (23975261) identified 2 individuals with compound heterozygous mutations resulting in intellectual impairment and early onset spasticity. Wan et al (22544365) described global developmental delay in addition to cerebellar features and spinal motor degeneration.
Intellectual disability syndromic and non-syndromic v0.5035 UBE3C Chirag Patel gene: UBE3C was added
gene: UBE3C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE3C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBE3C were set to PMID: 36401616
Phenotypes for gene: UBE3C were set to Neurodevelopmental disorder overlapping Angelman syndrome, no OMIM#
Review for gene: UBE3C was set to GREEN
Added comment: 3 patients/2 families with syndromic neurodevelopmental, seizure, and movement disorders and neurobehavioral phenotypes. WES found bi-allelic variants in UBE3C. The RNA studies in some patients with LoF variants provided evidence for the LoF effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5033 HECTD4 Chirag Patel gene: HECTD4 was added
gene: HECTD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HECTD4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HECTD4 were set to PMID: 36401616
Phenotypes for gene: HECTD4 were set to Neurodevelopmental disorder overlapping Angelman syndrome, no OMIM#
Review for gene: HECTD4 was set to GREEN
Added comment: 7 patients/5 families with syndromic neurodevelopmental, seizure, and movement disorders and neurobehavioral phenotypes. WES found bi-allelic variants in HECTD4. The RNA studies in some patients with LoF variants provided evidence for the LoF effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5031 KIF26A Chirag Patel gene: KIF26A was added
gene: KIF26A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KIF26A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF26A were set to PMID: 36228617
Phenotypes for gene: KIF26A were set to Congenital brain malformations, no OMIM #
Review for gene: KIF26A was set to GREEN
Added comment: 5 unrelated patients with biallelic loss-of-function variants in KIF26A (found through WES), exhibiting a spectrum of congenital brain malformations (schizencephaly, corpus callosum anomalies, polymicrgyria, and ventriculomegaly). Combining mice and human iPSC-derived organoid models, they discovered that loss of KIF26A causes excitatory neuron-specific defects in radial migration, localization, dendritic and axonal growth, and apoptosis, offering a convincing explanation of the disease etiology in patients. Single-cell RNA sequencing in KIF26A knockout organoids revealed transcriptional changes in MAPK, MYC, and E2F pathways.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5030 SPTAN1 Zornitza Stark Publications for gene: SPTAN1 were set to 20493457; 22258530; 32811770
Intellectual disability syndromic and non-syndromic v0.5028 SPTBN5 Zornitza Stark Publications for gene: SPTBN5 were set to 35782384
Intellectual disability syndromic and non-syndromic v0.5025 TPR Zornitza Stark gene: TPR was added
gene: TPR was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TPR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TPR were set to 34494102
Phenotypes for gene: TPR were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, TPR-related
Review for gene: TPR was set to RED
Added comment: Two siblings harbouring variants c.6625C>T/ p.Arg2209Ter (identified in heterozygous state in both siblings and father) and c.2610 + 5G > A (identified in heterozygous state in both siblings and mother) were reported with ataxia, microcephaly and severe intellectual disability. Functional analyses in patient fibroblasts provide evidence that the variants affect TPR splicing, reduce steady-state TPR levels, abnormal nuclear pore composition and density, and altered global RNA distribution.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5023 SMC5 Zornitza Stark gene: SMC5 was added
gene: SMC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SMC5 were set to 36333305
Phenotypes for gene: SMC5 were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID
Review for gene: SMC5 was set to GREEN
Added comment: Four individuals from three families with a chromosome breakage disorder and bi-allelic variants in this gene. However, three of the individuals had the same homozygous missense variant. Evidence for functional impact of the variant was limited. However, zebrafish model recapitulated the phenotype and was not rescued by the introduction of this variant, arguing for functional effect. Borderline Amber/Green.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5021 SLF2 Zornitza Stark gene: SLF2 was added
gene: SLF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLF2 were set to 36333305
Phenotypes for gene: SLF2 were set to Multiple congenital anomalies/dysmorphic syndrome, MONDO:0019042, SLF2-related; Atelis syndrome; microcephaly; short stature; ID
Review for gene: SLF2 was set to GREEN
Added comment: Seven individuals from 6 families with a chromosome breakage disorder and bi-allelic variants in this gene (LoF). Functional data including zebrafish model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5016 WDR5 Bryony Thompson gene: WDR5 was added
gene: WDR5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDR5 were set to DOI:https://doi.org/10.1016/j.xhgg.2022.100157
Phenotypes for gene: WDR5 were set to Neurodevelopmental disorder MONDO:0700092, WDR5-related
Mode of pathogenicity for gene: WDR5 was set to Other
Review for gene: WDR5 was set to GREEN
Added comment: Six different missense variants were identified (de novo) in 11 affected individuals with neurodevelopmental disorders, with a broad spectrum of additional features, including epilepsy, aberrant growth parameters, skeletal and cardiac abnormalities. 9/11 probands have ID. In vivo and in vitro functional suggest that loss-of-function is not the mechanism of disease. The mechanism of disease is yet to be established.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5013 PI4K2A Seb Lunke gene: PI4K2A was added
gene: PI4K2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PI4K2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4K2A were set to 30564627; 35880319; 19581584
Phenotypes for gene: PI4K2A were set to complex neurodevelopmental disorder with motor features, PI4K2A-related, MONDO:0100516
Review for gene: PI4K2A was set to GREEN
Added comment: Two reportedly unrelated, consanguine families with the same hom stop mutation in PI4K2A, p.(Arg309Ter). Probands with seizures, developmental delay, hypotonia/dystonia, myoclonus and developmental delay. MRI showed extensive brain abnormalities including dysgenesis of the corpus callosum, ventriculomegaly, and white matter volume loss.

Functional studies showed cellular mislocalisation of the Arg309Ter truncated protein construct compared to WT and an missense control.

An earlier paper from 2018 described two additional probands with a different stop mutation, p.(Ser22Ter), and overlapping phenotypic presentation.

in 2011, a Pi4k2a knock-out mouse model was described. "Knock-out animals initially appeared normal but later develop a progressive neurological dis-ease characterized by tremor, limb weakness, urinary incontinence and premature mortality. Histological analysis revealed massive axonal degeneration in the spinal cord in the descending corticospinal tracts."
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5011 CAMSAP1 Naomi Baker gene: CAMSAP1 was added
gene: CAMSAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAMSAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CAMSAP1 were set to 36283405
Phenotypes for gene: CAMSAP1 were set to lissencephaly spectrum disorders (MONDO:0018838), CAMSAP1-related
Review for gene: CAMSAP1 was set to GREEN
Added comment: Five unrelated families with bi-allelic loss-of-function variants. Clinical features of the syndrome include a characteristic craniofacial appearance, primary microcephaly, lissencephaly, agenesis or severe hypogenesis of the corpus callosum, severe neurodevelopmental delay, cortical visual impairment, and seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5008 KLHL20 Dean Phelan gene: KLHL20 was added
gene: KLHL20 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KLHL20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KLHL20 were set to PMID: 36214804
Phenotypes for gene: KLHL20 were set to Neurodevelopmental disorder (MONDO:0700092), KLHL20-related
Review for gene: KLHL20 was set to GREEN
Added comment: PMID: 36214804
- 14 patients with de novo missense variants in KLHL20. The patients had mild to severe ID, febrile seizures or epilepsy, autism spectrum disorder, hyperactivity and subtle dysmorphic facial features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5008 MYCBP2 Suliman Khan gene: MYCBP2 was added
gene: MYCBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MYCBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYCBP2 were set to PMID: 36200388
Phenotypes for gene: MYCBP2 were set to neurodevelopmental spectrum disorder with corpus callosum defects
Penetrance for gene: MYCBP2 were set to Complete
Review for gene: MYCBP2 was set to GREEN
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.5005 LETM1 Zornitza Stark Phenotypes for gene: LETM1 were changed from Mitochondrial disease MONDO#0044970, LETM1-related to Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089
Intellectual disability syndromic and non-syndromic v0.5004 LETM1 Zornitza Stark reviewed gene: LETM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.5002 AKT3 Zornitza Stark Publications for gene: AKT3 were set to
Intellectual disability syndromic and non-syndromic v0.4993 FRMD5 Zornitza Stark Publications for gene: FRMD5 were set to
Intellectual disability syndromic and non-syndromic v0.4991 FRMD5 Zornitza Stark gene: FRMD5 was added
gene: FRMD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FRMD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Review for gene: FRMD5 was set to GREEN
Added comment: Eight individuals reported with missense variants in this gene, de novo in 6 where parents were available. Clinical presentation was with ID, seizures, ataxia. Fly model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4990 GIGYF1 Elena Savva Publications for gene: GIGYF1 were set to 33057194
Intellectual disability syndromic and non-syndromic v0.4986 DPH5 Zornitza Stark gene: DPH5 was added
gene: DPH5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DPH5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DPH5 were set to Neurodevelopmental disorder with short stature, prominent forehead, and feeding difficulties 620070
Review for gene: DPH5 was set to GREEN
Added comment: 5 individuals from 3 unrelated families reported with severe ID, feeding difficulties, dysmorphic features and congenital anomalies, though there was no consistent pattern to these.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4979 GABRG1 Zornitza Stark Publications for gene: GABRG1 were set to
Intellectual disability syndromic and non-syndromic v0.4975 GABBR1 Zornitza Stark gene: GABBR1 was added
gene: GABBR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GABBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABBR1 were set to 36103875
Phenotypes for gene: GABBR1 were set to Neurodevelopmental disorder, GABBR1-related, MONDO:0700092
Review for gene: GABBR1 was set to GREEN
Added comment: Four individuals with de novo variants in this gene and varying severity of DD/ID, seizures and hypotonia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4974 LETM1 Ee Ming Wong gene: LETM1 was added
gene: LETM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LETM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LETM1 were set to 36055214
Phenotypes for gene: LETM1 were set to Mitochondrial disease MONDO#0044970, LETM1-related
Review for gene: LETM1 was set to GREEN
gene: LETM1 was marked as current diagnostic
Added comment: -18 affected individuals from 11 unrelated families harbouring ultra-rare bi-allelic missense and loss-of-function LETM1 variants
-Most of the affected individuals (14/18, 78%) had an infantile-onset disease manifestation,
and 4/18 (22%) presented first symptoms between the ages of 1.5 and 2 years
-Variant types included missense, frameshift, stop loss, in-frame deletion and splice defect
-From biochemical and morphological studies, bi-allelic LETM1 variants are associated with defective mitochondrial K efflux, swollen mitochondrial matrix structures, and loss of important mitochondrial oxidative phosphorylation protein components
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4973 MED11 Ain Roesley gene: MED11 was added
gene: MED11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED11 were set to 36001086
Phenotypes for gene: MED11 were set to neurodevelopmental disorder MONDO#0700092, MED11-related
Review for gene: MED11 was set to GREEN
gene: MED11 was marked as current diagnostic
Added comment: 7 affected from 5 families (3x consang) with the same recurrent variant of p.(Arg109*).

Protein truncating, NOT NMD as proven by RT-PCR and western blot. Zebrafish knockout model recapitulates key clinical phenotypes

NO evidence of founder effect from haplotype analysis

7/7 cerebral dysgyria, cortical atrophy
5/7 limb contracture
4/7 epilepsy
3/7 families with IUGR
3/7 GDD
3/7 hearing loss
3/7 undescended testis
2/7 nystagmus
1/7 congenital cataract
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4973 MED11 Ain Roesley gene: MED11 was added
gene: MED11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED11 were set to 36001086
Phenotypes for gene: MED11 were set to neurodevelopmental disorder MONDO#0700092, MED11-related
Review for gene: MED11 was set to GREEN
gene: MED11 was marked as current diagnostic
Added comment: 7 affected from 5 families (3x consang) with the same recurrent variant of p.(Arg109*).

Protein truncating, NOT NMD as proven by RT-PCR and western blot. Zebrafish knockout model recapitulates key clinical phenotypes

NO evidence of founder effect from haplotype analysis

7/7 cerebral dysgyria, cortical atrophy
5/7 limb contracture
4/7 epilepsy
3/7 families with IUGR
3/7 GDD
3/7 hearing loss
3/7 undescended testis
2/7 nystagmus
1/7 congenital cataract
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4968 SLC32A1 Lucy Spencer gene: SLC32A1 was added
gene: SLC32A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SLC32A1 were set to 36073542
Phenotypes for gene: SLC32A1 were set to developmental and epileptic encephalopathy MONDO:0100062, SLC32A1-related
Review for gene: SLC32A1 was set to GREEN
Added comment: PMID: 36073542- 4 patients with de novo missense. All have moderate to severe ID or developmental delay and seizures. 3 have a movement disorder. Developmental delay appears to be a new association for this gene described in this paper.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4966 GCSH Ain Roesley Publications for gene: GCSH were set to 1671321
Intellectual disability syndromic and non-syndromic v0.4965 MTSS1 Elena Savva gene: MTSS1 was added
gene: MTSS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTSS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MTSS1 were set to PMID: 36067766
Phenotypes for gene: MTSS1 were set to Intellectual disability, MTSS1-related (MONDO#0001071)
Review for gene: MTSS1 was set to GREEN
Added comment: Alt gene name: MTSS2

Huang (2022): recurring de novo missense variant (p.R671W) causing syndromic intellectual disability in 5 unrelated individuals.
- Individuals present with GDD, mild ID (5/5), nystagmus (3/5), optic atrophy (1/5), ptosis (2/5), sensorineural hearing loss (2/4), microcephaly or relative microcephaly (5/5), and shared mild facial dysmorphisms.
- Overexpression supports a DN mechanism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4964 MTSS1L Elena Savva gene: MTSS1L was added
gene: MTSS1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTSS1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MTSS1L were set to PMID: 36067766
Phenotypes for gene: MTSS1L were set to Intellectual disability, MTSS2-related (MONDO#0001071)
Review for gene: MTSS1L was set to GREEN
Added comment: Alt gene name: MTSS2

Huang (2022): recurring de novo missense variant (p.R671W) causing syndromic intellectual disability in 5 unrelated individuals.
- Individuals present with GDD, mild ID (5/5), nystagmus (3/5), optic atrophy (1/5), ptosis (2/5), sensorineural hearing loss (2/4), microcephaly or relative microcephaly (5/5), and shared mild facial dysmorphisms.
- Overexpression supports a DN mechanism
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4963 NAPB Paul De Fazio gene: NAPB was added
gene: NAPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAPB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAPB were set to 26235277; 28097321; 33189936
Phenotypes for gene: NAPB were set to Developmental and epileptic encephalopathy 107 MIM#620033
Review for gene: NAPB was set to GREEN
gene: NAPB was marked as current diagnostic
Added comment: PMID 26235277: homozygous nonsense variant identified in a 6 year old girl by trio WES with early-onset epileptic encephalopathy characterised by multifocal seizures and profound GDD

PMID 28097321: exome sequencing in 152 consanguineous families with at least one member affected with ID. Homozygous nonsense variant identified in a patient with profound ID, seizures, feeding difficulties in infancy, muscularhypotonia, microcephaly, and impaired vision

PMID 33189936: homozygous canonical splice variant identified by trio exome sequencing in two siblings with seizures, intellectual disability and global developmental delay, microcephaly (<-3SD), and muscular hypotonia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4962 RABGAP1 Zornitza Stark gene: RABGAP1 was added
gene: RABGAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RABGAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RABGAP1 were set to 36083289
Phenotypes for gene: RABGAP1 were set to Neurodevelopmental disorder, RABGAP1-related,MONDO:0700092
Review for gene: RABGAP1 was set to GREEN
Added comment: 5 individuals from three families reported with ID, microcephaly, SNHL and seizures. Mouse model recapitulated the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4960 NSD2 Zornitza Stark Publications for gene: NSD2 were set to 30345613; 31171569
Intellectual disability syndromic and non-syndromic v0.4959 FOSL2 Krithika Murali gene: FOSL2 was added
gene: FOSL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FOSL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOSL2 were set to 36197437
Phenotypes for gene: FOSL2 were set to Neurodevelopmental disorder, MONDO:0700092, FOSL2-related
Review for gene: FOSL2 was set to GREEN
Added comment: PMID 36197437 Cospain et al 2022 report 11 individuals from 10 families with heterozygous PTC variants in exon 4/4 of the FOSL2 gene. All variants were predicted to escape NMD resulting in a truncated protein, with the truncation occurring proximal to the C-terminal domain (supportive functional studies).

In 10/11 families the variant occurred de novo in a single affected proband. In one family with 2 affected siblings, the variant was present in the siblings but absent in the unaffected parent likely due to gonadal mosaicism.

Clinical features included:
- Cutis aplasia congenital of the scalp (10/11)
- Tooth enamel hypoplasia and discolouration (8/9)
- Multiple other ectodermal features also noted e.g. small brittle nails, hypotrichosis/hypertrichosis, lichen sclerosis
- 5 individuals had cataracts (mostly bilateral, congenital/early childhood onset)
- 6/9 IUGR
- 5/9 postnatal growth restriction
- 7/9 developmental delay/ID (mild to severe)
- 5/7 ADHD/ASD
- 2/9 seizures
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4943 ALDH7A1 Zornitza Stark Publications for gene: ALDH7A1 were set to
Intellectual disability syndromic and non-syndromic v0.4939 PTPA Konstantinos Varvagiannis changed review comment from: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below.

There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID.

Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports.

------

Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants.

These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation.

Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies.

Role of the gene:
As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders.

Variant studies:
Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt.

Drosophila / animal models:
Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment.
Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice.
Sources: Literature; to: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below.

There is currently no associated phenotype in OMIM, G2P, PanelApp UK or SysID.

Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports.

------

Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants.

These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation.

Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies.

Role of the gene:
As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders.

Variant studies:
Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt.

Drosophila / animal models:
Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment.
Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4939 PTPA Konstantinos Varvagiannis gene: PTPA was added
gene: PTPA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTPA were set to 36073231
Phenotypes for gene: PTPA were set to Intellectual disability; Parkinsonism
Penetrance for gene: PTPA were set to Complete
Review for gene: PTPA was set to AMBER
Added comment: Biallelic PTPA pathogenic variants lead to a form of ID with later-onset parkinsonism based on 4 individuals from 2 families in the literature. Affected individuals were homozygous for missense variants demonstrated to result to reduced mRNA and protein levels as well as PP2A complex activation. Drosophila studies support an age-dependent locomotor dysfunction. Variants in other PP2A-complex-related genes also lead to NDDs. Summary provided below.

There is currently no associated phenotype in OMIM, G2P, PanelApp Australia or SysID.

Consider inclusion in relevant panels (ID, Parkinsonism/movement disorders, etc) with amber rating pending further reports.

------

Fevga, Tesson et al (2022 - PMID: 36073231) describe the features of 4 individuals, from 2 unrelated families, with biallelic pathogenic PTPA variants.

These presented with normal or delayed early milestones, learning disability and ID (mild to moderate) followed by progressive signs of parkinsonism (at the age of 11 yrs in 2 sibs, 15 yrs in another individual). Motor symptoms were responsive to levodopa and later to deep brain stimulation.

Linkage analysis in one consanguineous family followed by exome revealed homozygosity for a missense PTPA variant (NM_178001:c.893T>G/p.Met298Arg). Exome sequencing in affected subjects from the 2nd family revealed homozygosity for a further missense variant (c.512C>A/p.Ala171Asp). There were no other candidate variants for the phenotype following parental / segregation studies.

Role of the gene:
As the authors discuss, PTPA (or PPP2R4) is ubiquitously expressed in all tissues incl. brain and encodes a phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase-2A (PP2A). PP2A in turn, is the major Ser/Thr phosphatase in brain targeting a large number of proteins involved in diverse functions. Activation of PP2A is dependent on its methylation, which is negatively regulated by the PP2A-specific methylesterase (PME-1). By binding to PME-1, PTPA counteracts the negative influence of the former on PP2A. Pathogenic variants in genes encoding subunits/regulators of the PP2A complex (e.g. PPP2R1A or PPP2CA) are associated with neurodevelopmental disorders.

Variant studies:
Upon overexpression of wt and both variants in a HEK-293 cell line the authors demonstrated that both variants resulted in significantly reduced mRNA and protein levels (which for Ala171Asp were attributed to increased proteasomal degradation). Both variants were shown to result in impaired PP2A complex activation compared to wt.

Drosophila / animal models:
Pan-neuronal RNAi-mediated knockdown of ptpa in Drosophila resulted in an age-dependent locomotor dysfunction, reversible with L-DOPA treatment.
Previous studies in mice suggest cognitive/electrophysiological impairments upon downregulation of PP2A activity in transgenic mice.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4938 PPP2R5C Zornitza Stark Publications for gene: PPP2R5C were set to
Intellectual disability syndromic and non-syndromic v0.4933 CAPRIN1 Zornitza Stark Publications for gene: CAPRIN1 were set to 35979925
Intellectual disability syndromic and non-syndromic v0.4928 UBAP2L Konstantinos Varvagiannis gene: UBAP2L was added
gene: UBAP2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBAP2L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: UBAP2L were set to 35977029
Phenotypes for gene: UBAP2L were set to Delayed speech and language development; Motor delay; Intellectual disability; Autistic behavior; Seizures; Microcephaly; Abnormality of head or neck; Short stature; Abnormality of the skeletal system
Penetrance for gene: UBAP2L were set to unknown
Review for gene: UBAP2L was set to GREEN
Added comment: Based on Jia et al (2022 - PMID: 35977029) speech, motor delay as well as ID are observed in individuals harboring de novo pLoF variants in UBAP2L. The gene encodes a regulator of the stress granule (SG) assembly. Extensive evidence is provided on the effect of variants as well as the role of UBAP2L and other genes for components and/or regulation of SG in pathogenesis of NDDs. Among others a Ubap2l htz deletion mouse model (behavioral and cognitive impairment, abnormal cortical development due to impaired SG assembly, etc). Data from 26 previous studies, aggregating 40,853 probands with NDDs (mostly DD/ID, also ASD) suggest enrichment for DNMs in UBAP2L or other genes previously known and further shown to be important for SG formation (incl. G3BP1/G3BP2, CAPRIN1).

Details provided below.

Not associated with any phenotype in OMIM, G2P or SysNDD.

--------

Jia et al (2022 - PMID: 35977029) describe 12 affected individuals with heterozygous de novo pLoF variants in UBAP2L.

Phenotype: Features included hypotonia, speech (11/11) and motor delay (8/12), ID (8/10 with formal evaluation), variable behavioral concerns (ADHD 5/11, ASD in 4/10, etc). Seizures were reported in 7/12 with 3/10 having a formal diagnosis of epilepsy. Few had microcephaly (3/10). Facial dysmorphisms were common (9/9) and included abnormal palpebral fissures, deep prominent concha, high broad forehead, hypertelorism, thin upper lip and mild synophrys (each in 4 or less individuals). Short stature or skeletal alterations were described in some (4/10 each).

Role of the gene: UBAP2L encodes an essential regulator of stress granule assembly. Stress granules are membraneless cytoplasmic compartments in eukaryotic cells, induced upon a variety of stressors and playing a role in regulation of gene expression.

Variants identified : 9 nonsense/frameshift UBAP2L variants and 3 splicing ones were reported, in all cases as de novo events, upon trio/quad exome sequencing. All were absent from gnomAD. There were no other causative variants.

Variant effect/studies (NM_014847.4 / NP_055662.3) :
- Minigene assays revealed that the 3 splice variants all resulted in out-of-frame exon skipping.
- In patient fibroblasts one of these splice variants was demonstrated to result to reduced protein levels.
- 8 of the 9 nonsense/frameshift variants were predicted to result to NMD.
- 1 nonsense variant (c.88C>T/p.Q30*) was shown to result to decreased protein expression in patient fibroblasts, with detection of the protein using an antibody for the C terminus but not the N terminus. Protein N-terminal sequencing confirmed that the protein lacked the N terminus, with utilization of an alternative start site (11 codons downstream).
- Generation of HeLa UBAP2L KO cell lines resulted in significant reduction of SG numbers which was also the case for 4 variants studied, under stress conditions.
- The protein has a DUF domain (aa 495-526) known to mediate interaction of UBAP2L with G3BP1 (a stress granule marker) with deletions of this domain leading to shuttling of UBAP2L from the cytoplasm to the nucleus. Truncating variants upstream of the DUF domain were shown to result in nuclear localization.

Mouse model :
- The authors generated Ubap2l KO model with hmz deletion of Ubap2l resulting in a lethal phenotype (2.6% survived) and htz deletion leading to behavioral issues (low preference for social novelty, anxious-like behaviors) and cognitive impairment.
- Ubap2l haploinsufficiency resulted in abnormal cortical development and lamination with reduction of neural progenitor proliferation.
- Ubap2l deficiency was shown to impair SG assembly during cortical development both under physiological stress conditions or upon utilization of an oxidative stress inducer.

Additional evidence of UBAP2L and SG overall in pathogenesis of NDDs:
- Based on DNMs from 40,853 individuals with NDDs from 26 studies (9,228 with ASD, 31,625 with DD/ID) the authors demonstrate significant excess of DNM in 31 genes encoding SG components, regulators or both, the latter being the case for UBAP2L and 2 further genes (G3BP1 and G3BP2 - both with crucial roles in SG assembly).
- Excess dn splice-site (N=3) and missense (N=5) variants in G3BP1 were observed in the above cohort [c.95+1G>A, c.353+1G>T, c.539+1G>A / p.S208C, R320C, V366M].
- Excess dn missense (N=7) variants in G3BP2 were observed in the above cohort [p.R13W, D151N, E158K, L209P, E399D, K408E, R438C].
- Generation of G3BP1 or G3BP2 KO HeLa cell lines and immunofluorescence upon use of oxidative stress inducer revealed significant reduction of stress granules.
- Generation of HeLa cell lines for 5 G3BP1 mutants (R78C*, R132I*, S208C*, R320C*, V366M) and 7 G3BP2 mutants (p.R13W*, D151N*, E158K, L209P*, E399D, K408E, R438C) revealed that several (those in asterisk) resulted in significantly fewer SG formation under oxidative stress compared to WT while the subcellular distribution of the proteins under stress was identical to WT.
- Among the identified genes for SG enriched for DNMs, CAPRIN1 was implicated in previous publications as a NDD risk gene with 3 dn missense SNVs reported (p.I373K, p.Q446H, p.L484P). CAPRIN1 binding to G3BP1/2 has been shown to promote SG formation. Significant reduction of SG was observed in CAPRIN1 KO HeLa lines. p.I373K abolished interaction with G3BP1/2 and disrupted SG formation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4925 PDZD8 Zornitza Stark gene: PDZD8 was added
gene: PDZD8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PDZD8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDZD8 were set to 35227461
Phenotypes for gene: PDZD8 were set to Intellectual developmental disorder with autism and dysmorphic facies, MIM# 620021
Review for gene: PDZD8 was set to GREEN
Added comment: Four individuals from two unrelated families, Drosophila and mouse models support gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4924 SLC31A1 Daniel Flanagan gene: SLC31A1 was added
gene: SLC31A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SLC31A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC31A1 were set to PMID: 35913762
Phenotypes for gene: SLC31A1 were set to Neurodevelopmental disorder, SLC31A1-related (MONDO#0700092)
Review for gene: SLC31A1 was set to RED
Added comment: SLC31A1 is also referred to as CTR1.
Monozygotic twins with hypotonia, global developmental delay, seizures, and rapid brain atrophy, consistent with profound central nervous system copper deficiency. Homozygous for a novel missense variant (p.(Arg95His)) in copper transporter CTR1, both parents heterozygous. A mouse knock-out model of CTR1 deficiency resulted in prenatal lethality.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4919 CEP104 Zornitza Stark Publications for gene: CEP104 were set to 26477546
Intellectual disability syndromic and non-syndromic v0.4915 TMEM147 Naomi Baker gene: TMEM147 was added
gene: TMEM147 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM147 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM147 were set to PMID: 36044892
Phenotypes for gene: TMEM147 were set to Neurodevelopmental disorder (MONDO:0700092), TMEM147-related
Review for gene: TMEM147 was set to GREEN
Added comment: PMID: 36044892; Twelve different variants reported in 23 affected individuals from 15 unrelated families with biallelic variants. All individuals had global developmental delay and intellectual disability. Consistent facial dysmorphisms included coarse facies, prominent forehead, board depressed nasal root, tented mouth, long smooth philtrum, and low-set ears. In vitro studies of missense variants demonstrated accelerated protein degradation via the autophagy-lysosomal pathway, while analysis of primary fibroblasts and granulocytes provided functional evidence of ER and nuclear envelope dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4915 COX11 Chern Lim gene: COX11 was added
gene: COX11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COX11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COX11 were set to 36030551
Phenotypes for gene: COX11 were set to Mitochondrial disease (MONDO:0044970), COX11-related
Review for gene: COX11 was set to GREEN
gene: COX11 was marked as current diagnostic
Added comment: PMID: 36030551
- Biallelic variants in COX11 associated with infantile-onset mitochondrial encephalopathies in two unrelated consanguineous families, one with homozygous missense variant, another with homozygous frameshift variant.
- Functional studies supported pathogenicity of the missense variant, and showed that mutant COX11 fibroblasts had decreased ATP levels which could be rescued by CoQ10.
- RNA studies suggested the mutant transcript with p.(Val12Glyfs*21) is not degraded by nonsense mediated decay.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4915 TMEM163 Teresa Zhao gene: TMEM163 was added
gene: TMEM163 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM163 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TMEM163 were set to PMID: 35953447
Phenotypes for gene: TMEM163 were set to Hypomyelinating leukodystrophy
Review for gene: TMEM163 was set to GREEN
Added comment: Four unrelated families with a hypomyelinating leukodystrophy phenotype. Genomic testing identified three distinct heterozygous missense variants in TMEM163 with two unrelated individuals sharing the same de novo variant.

All have global developmental delay, three of them have seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4914 GRIN2A Zornitza Stark Publications for gene: GRIN2A were set to 30544257
Intellectual disability syndromic and non-syndromic v0.4912 NOTCH1 Chern Lim changed review comment from: PMID: 35947102:
- Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1.
- Missense and small inframe insertion variants in the negative regulatory region.
Sources: Literature; to: PMID: 35947102:
- Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1.
- Other clinical features include intellectual disability, spasticity and etc. Childhood onset in most individuals however 15y and 40y reported in two individuals.
- Missense and small inframe insertion variants in the negative regulatory region.
Intellectual disability syndromic and non-syndromic v0.4912 NOTCH1 Chern Lim gene: NOTCH1 was added
gene: NOTCH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NOTCH1 were set to 35947102
Phenotypes for gene: NOTCH1 were set to Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related
Mode of pathogenicity for gene: NOTCH1 was set to Other
Review for gene: NOTCH1 was set to GREEN
gene: NOTCH1 was marked as current diagnostic
Added comment: PMID: 35947102:
- Seven unrelated patients with leukoencephalopathy and calcifications, germline heterozygous de novo gain-of-function variants in NOTCH1.
- Missense and small inframe insertion variants in the negative regulatory region.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4912 LGI3 Melanie Marty gene: LGI3 was added
gene: LGI3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LGI3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LGI3 were set to PMID: 35948005
Phenotypes for gene: LGI3 were set to Global developmental delay; Intellectual disability; Distal deformities; Diminished reflexes; Facial myokymia; Hyporeflexia/areflexi
Review for gene: LGI3 was set to GREEN
Added comment: Six individuals from eight unrelated families with loss-of-function (LoF) bi-allelic variants in LGI3.
Lgi3-null mice showed reduced and mis-local-ized Kv1 channel complexes in myelinated peripheral axons.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4912 CAPRIN1 Paul De Fazio gene: CAPRIN1 was added
gene: CAPRIN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAPRIN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CAPRIN1 were set to 35979925
Phenotypes for gene: CAPRIN1 were set to Neurodevelopmental disorder, CAPRIN1-related MONDO:0700092
Review for gene: CAPRIN1 was set to GREEN
gene: CAPRIN1 was marked as current diagnostic
Added comment: 12 individuals reported with ID and language impairment. Other features included seizures (4 individuals), hands and feet malformations (5 individuals), breathing problems (6 individuals), ocular problems (4 individuals) and hearing problems (3 individuals).

All of the variants were nonsense (NMD-predicted) or splicing variants. 10 were de novo, 1 was inherited from an affected father. Functional studies supported pathogenicity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4909 LNPK Zornitza Stark Publications for gene: LNPK were set to 30032983
Intellectual disability syndromic and non-syndromic v0.4907 CCDC82 Zornitza Stark Publications for gene: CCDC82 were set to PMID: 35373332, 35118659, 27457812
Intellectual disability syndromic and non-syndromic v0.4904 CCDC82 Chirag Patel gene: CCDC82 was added
gene: CCDC82 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC82 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC82 were set to PMID: 35373332, 35118659, 27457812
Phenotypes for gene: CCDC82 were set to Intellectual disability and spastic paraparesis, no OMIM #
Review for gene: CCDC82 was set to GREEN
Added comment: 4 consanguineous families with 9 affected individuals with developmental delay/intellectual disability, and 2 families had spasticity and 1 had epilepsy. WES identified 3 homozgyous truncating variants, segregating with disease and parents as carriers. No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4900 TAF4 Zornitza Stark Publications for gene: TAF4 were set to 33875846; 28191890
Intellectual disability syndromic and non-syndromic v0.4895 ZMYND8 Konstantinos Varvagiannis gene: ZMYND8 was added
gene: ZMYND8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZMYND8 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ZMYND8 were set to 35916866; 32530565
Phenotypes for gene: ZMYND8 were set to Delayed speech and language development; Motor delay; Intellectual disability; Abnormality of cardiovascular system morphology; Hearing abnormality; Abnormality of vision; Abnormality of the face; Seizures
Penetrance for gene: ZMYND8 were set to unknown
Review for gene: ZMYND8 was set to GREEN
Added comment: Dias et al (2022 - PMID: 35916866) describe the phenotype of 11 unrelated individuals with monoallelic de novo (or suspected de novo) missense (N=9) or truncating (N=2) ZMYND8 variants. One of these subjects was previously reported by Suzuki et al (2020 - PMID: 32530565).

Features included speech delay/language difficulties (9/11), motor delay (9/11), ID (in 10/11 - profound in 1, moderate in 2), CHD (7/11 - PDA, VSD, ASD, pulmonary stenosis, etc), hearing or vision impairment (7/11). Seizures were reported in few (in text 5/11, table 2/11). Variable non-familial facial features were present in (9/11).

As the authors discuss, ZMYND8 encodes a multidomain protein playing a role in transcription regulation, chromatin remodeling, regulation of super enhancers, DNA damage response/tumor suppression.

The protein is broadly expressed in brain and shows highest expression in early development.

Molecular modeling and/or a yeast two-hybrid system were suggestive of disrupted interaction of ZMYND8 with Drebrin (missense variants in PWWP domain) or GATAD2A (variants in MYND domain).

Neuronal Zmynd8 knockdown in Drosophila resulted in deficits in habituation learning.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4890 ACTB Zornitza Stark Publications for gene: ACTB were set to
Intellectual disability syndromic and non-syndromic v0.4887 ACO2 Zornitza Stark Publications for gene: ACO2 were set to
Intellectual disability syndromic and non-syndromic v0.4878 PAX5 Zornitza Stark Publications for gene: PAX5 were set to 35094443; 31452935; 28263302; 25418537; 8001127; 27626380
Intellectual disability syndromic and non-syndromic v0.4875 SMG9 Zornitza Stark Publications for gene: SMG9 were set to 27018474; 31390136
Intellectual disability syndromic and non-syndromic v0.4873 SPTBN5 Ee Ming Wong gene: SPTBN5 was added
gene: SPTBN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPTBN5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SPTBN5 were set to 35782384
Phenotypes for gene: SPTBN5 were set to Neurodevelopmental disorder, MONDO:0700092, SPTBN5-related
Review for gene: SPTBN5 was set to GREEN
gene: SPTBN5 was marked as current diagnostic
Added comment: - Four probands from unrelated families (1x Pakistani and 3x Italian) with de novo heterozygous SPTBN5 variants
- 3x missense variants and 1x LoF variant were reported
- Phenotypes include intellectual disability (mild to severe), aggressive tendencies and variable features such as craniofacial and physical dysmorphisms, autistic behavior, and
gastroesophageal reflux
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4872 PSMC1 Hazel Phillimore gene: PSMC1 was added
gene: PSMC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSMC1 were set to PMID: 35861243
Phenotypes for gene: PSMC1 were set to spastic paraplegia; severe developmental delay; severe intellectual disability; hearing loss; micropenis; undescended testes; Syndromic disease MONDO:0002254, PSMC1-related
Review for gene: PSMC1 was set to RED
Added comment: Homozygosity mapping on one large consanguineous Bedouin kindred showed three affected children (out of the ten) to be homozygous for NM_002802.3:c.983T>C; p.(Ile328Thr).

Drosophila rescue experiments were carried out. Transgenic studies using drosophila with the silenced ortholog Rpt2 gene were rescued by the human wild-type PSMC1.

Three of the ten offspring of healthy consanguineous parents of Bedouin Israeli ancestry were affected with a similar phenotype of failure to thrive, developmental delay and severe intellectual disability, spastic tetraplegia with central hypotonia, chorea, as well as hearing loss. None of the three achieved verbal communication or ambulation (sitting / standing) at any age. They had mild dysmorphism of borderline dolichocephaly and microcephaly, prominent bushy eyebrows, flat midface, long nasal bridge and micrognathia. All three had micropenis with undescended testes. One of the affected (as a toddler) underwent thorough endocrinological analysis: testosterone and gonadotropin levels were low.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4872 SARS Ain Roesley Publications for gene: SARS were set to 28236339; 34570399
Intellectual disability syndromic and non-syndromic v0.4870 PPFIBP1 Zornitza Stark Publications for gene: PPFIBP1 were set to https://www.medrxiv.org/content/10.1101/2022.04.04.22273309v1
Intellectual disability syndromic and non-syndromic v0.4868 C18orf32 Naomi Baker gene: C18orf32 was added
gene: C18orf32 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: C18orf32 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C18orf32 were set to PMID:35107634
Phenotypes for gene: C18orf32 were set to Neurodevelopmental disorder (MONDO:0700092), C18orf32-related
Review for gene: C18orf32 was set to RED
Added comment: Two siblings reported as affected, although sequencing only performed in one sibling, with homozygous loss-of-function variant identified. Clinical presentation included developmental delay, recurrent lower respiratory tract infections, sparse rough hair, roving eye movements, hypotonia, bilateral ankle contractures and inverted nipples.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4867 WARS Anna Ritchie gene: WARS was added
gene: WARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WARS were set to PMID: 35815345; 35790048
Phenotypes for gene: WARS were set to Neurodevelopmental disorder (MONDO:0700092), WARS-related
Review for gene: WARS was set to GREEN
Added comment: At least seven affected individuals from four families with biallelic variants, showing varying
severities of developmental delay, intellectual disability and microcephaly. Hearing impairment and, as well as brain anomalies, skeletal system, movement/gait, and behaviour were variable features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4867 SLITRK2 Paul De Fazio gene: SLITRK2 was added
gene: SLITRK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLITRK2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: SLITRK2 were set to 35840571
Phenotypes for gene: SLITRK2 were set to Neurodevelopmental disorder, SLITRK2-related MONDO:0700092
Review for gene: SLITRK2 was set to GREEN
gene: SLITRK2 was marked as current diagnostic
Added comment: 6 missense variants and 1 nonsense variant (NOT NMD-predicted, single-exon gene) reported in 7 males and 1 female with neurodevelopmental disorders. Phenotypes included dev delay, mild to severe ID, delayed or absent speech, seizures and brain MRI anomalies (in some patients).

The nonsense variant was identified in two affected brothers but not in the mother, suggesting it was de novo in the maternal germline. The variant in the one affected female was de novo. All other variants in hemizygous males were inherited from an unaffected mother. In one case, the variant was also identified in the unaffected grandmother.

Functional studies showed some but not all variants displayed impaired membrane transport and impaired excitatory synapse-promoting effects. Conditional knockout mice exhibited impaired long-term memory and abnormal gait.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4865 DOHH Daniel Flanagan gene: DOHH was added
gene: DOHH was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: DOHH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DOHH were set to PMID: 35858628
Phenotypes for gene: DOHH were set to Neurodevelopmental disorder, DOHH-related (MONDO#0700092)
Review for gene: DOHH was set to GREEN
Added comment: Bi-allelic missense and truncating DOHH variants segregating with disease in five affected individuals from four unrelated families. Clinical features were developmental delay and/or intellectual disability (5/5), microcephaly (5/5), visual impairment (nystagmus (3/5), strabismus (3/5), and cortical visual impairment (1/5)) and congenital heart malformations (3/5 individuals).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4865 ADGRL1 Elena Savva gene: ADGRL1 was added
gene: ADGRL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADGRL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ADGRL1 were set to PMID: 35907405
Phenotypes for gene: ADGRL1 were set to Neurodevelopmental disorder, ADGRL1-related (MONDO#0700092)
Review for gene: ADGRL1 was set to GREEN
Added comment: PMID: 35907405 - 9 patients w/ ADHD (3/9), autism (4/9), mild-moderate ID (5/9) and epilepsy (2/9) and facial dysmorphism (7/9). Variants include missense (4) and PTCs (5), and were either de novo (7/9) or inherited from parents with learning difficulties/ID (2/9).

Functional studies on both PTCs and missense variants show significant reductions in calcium signalling and surface protein.

Het null mouse model shows neurological and developmental abnormalities, with hom null mice non-viable.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4859 C20orf24 Zornitza Stark gene: C20orf24 was added
gene: C20orf24 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: C20orf24.
Mode of inheritance for gene: C20orf24 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C20orf24 were set to 35614220; 24194475
Phenotypes for gene: C20orf24 were set to Craniofacial dysmorphism, skeletal anomalies, and impaired intellectual development syndrome 2, MIM# 616994
Review for gene: C20orf24 was set to RED
Added comment: Bi-allelic LoF variant identified in patient originally reported in PMID 24194475. HGNC approved name is RAB5IF.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4856 KMT2B Zornitza Stark Phenotypes for gene: KMT2B were changed from Dystonia 28, childhood-onset, MIM#617284 to Dystonia 28, childhood-onset 617284; MONDO:0015004; Intellectual developmental disorder, autosomal dominant 68, MIM# 619934
Intellectual disability syndromic and non-syndromic v0.4855 KMT2B Zornitza Stark Publications for gene: KMT2B were set to
Intellectual disability syndromic and non-syndromic v0.4854 KMT2B Zornitza Stark changed review comment from: ID described as part of the phenotype in some patients.; to: Childhood-onset dystonia: ID described as part of the phenotype in some patients.
Intellectual disability syndromic and non-syndromic v0.4854 KMT2B Zornitza Stark edited their review of gene: KMT2B: Added comment: Nine individuals reported in PMID 33150406 with heterozygous variants in this gene and intellectual disability, speech delay, microcephaly, growth delay, feeding problems, and dysmorphic features, including epicanthic folds, posteriorly rotated ears, syndactyly/clinodactyly of toes, and fifth finger clinodactyly, normal MRIs and NO dystonia.; Changed publications: 33150406; Changed phenotypes: Dystonia 28, childhood-onset 617284, MONDO:0015004, Intellectual developmental disorder, autosomal dominant 68, MIM# 619934
Intellectual disability syndromic and non-syndromic v0.4849 PABPC1 Elena Savva gene: PABPC1 was added
gene: PABPC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PABPC1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PABPC1 were set to PMID: 35511136
Phenotypes for gene: PABPC1 were set to Neurodevelopmental disorder, PABPC1-related (MONDO#0700092)
Review for gene: PABPC1 was set to GREEN
Added comment: PMID: 35511136 - 4 probands with an overlapping phenotype of DD, expressive speech delay, and autistic features and heterozygous de novo variants that cluster in the PABP domain of PABPC1.
Electroporation of mouse embryo brains showed that Pabpc1 knockdown decreases the proliferation of neural progenitor cells. Wild-type Pabpc1 could rescue this disturbance, whereas 3 of the 4 variants did not.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4846 CHMP3 Chern Lim gene: CHMP3 was added
gene: CHMP3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHMP3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHMP3 were set to PMID: 35710109
Phenotypes for gene: CHMP3 were set to Hereditary spastic paraplegia (MONDO:0019064), CHMP3-related
Review for gene: CHMP3 was set to AMBER
gene: CHMP3 was marked as current diagnostic
Added comment: PMID: 35710109
- Single large family with consanguinity, homozygous missense variant in 5 affected individuals with intellectual and progressive motor disabilities, seizures and spastic quadriplegia.
- Functional studies showed reduced CHMP3 protein in patient's fibroblasts, lenti-rescue study showed improved cellular phenotypes associated with impaired autophagy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4846 ACOX1 Alison Yeung Publications for gene: ACOX1 were set to 32169171; 17458872
Intellectual disability syndromic and non-syndromic v0.4845 ACOX1 Alison Yeung Publications for gene: ACOX1 were set to
Intellectual disability syndromic and non-syndromic v0.4843 WNK3 Lucy Spencer gene: WNK3 was added
gene: WNK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WNK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: WNK3 were set to 35678782
Phenotypes for gene: WNK3 were set to Neurodevelopmental disorder, WNK3-related (MONDO#0700092)
Review for gene: WNK3 was set to GREEN
Added comment: 6 maternally inherited hemizygous variants, 3 missense, 2 canonical splice, and a nonsense. Seen in 14 individuals from 6 families, all 14 are male who inherited hemizygous variants from their unaffected heterozygous mothers. The variants cosegregated with disease in 3 families with multiple affected individuals. All 14 patients have ID, 11 have speech delay, 10 have facial abnormalities, 5 have seizures, 6 with microcephaly and 7 with anomalies in brain imaging.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4841 TMEM63C Elena Savva gene: TMEM63C was added
gene: TMEM63C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM63C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM63C were set to PMID: 35718349
Phenotypes for gene: TMEM63C were set to Hereditary spastic paraplegia, MONDO:0019064, TMEM63C-related
Review for gene: TMEM63C was set to GREEN
Added comment: PMID: 35718349 - Four NMD PTCs observed in at least 3 unrelated patients. Two segregated strongly in highly consanguineous families.
Common clinical details include mild ID, spastic paraplegia, hypereflexia, spasticity, delayed motor development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4840 MAL Zornitza Stark gene: MAL was added
gene: MAL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAL were set to 35217805
Phenotypes for gene: MAL were set to Leukodystrophy MONDO:0019046, MAL-related
Review for gene: MAL was set to AMBER
Added comment: Single family with two affected siblings reported, with homozygous missense variant, some functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4837 TAF8 Zornitza Stark Publications for gene: TAF8 were set to PMID: 29648665
Intellectual disability syndromic and non-syndromic v0.4835 KCNK9 Zornitza Stark Publications for gene: KCNK9 were set to 28333430; 27151206; 24980697; 18678320
Intellectual disability syndromic and non-syndromic v0.4828 NR4A2 Zornitza Stark Phenotypes for gene: NR4A2 were changed from Intellectual disability; rolandic epilepsy; autism to Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911
Intellectual disability syndromic and non-syndromic v0.4826 KCNC2 Zornitza Stark gene: KCNC2 was added
gene: KCNC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: KCNC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNC2 were set to 32392612; 31972370; 35314505
Phenotypes for gene: KCNC2 were set to Developmental and epileptic encephalopathy 103, MIM# 619913
Review for gene: KCNC2 was set to GREEN
Added comment: More than 10 unrelated families reported. ID ranges from mild to severe.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4821 IREB2 Zornitza Stark Publications for gene: IREB2 were set to 30915432; 31243445; 11175792
Intellectual disability syndromic and non-syndromic v0.4818 PAN2 Naomi Baker gene: PAN2 was added
gene: PAN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PAN2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PAN2 were set to PMID:35304602; 29620724
Phenotypes for gene: PAN2 were set to Syndromic disease MONDO:0002254
Review for gene: PAN2 was set to GREEN
Added comment: PMID:35304602 reports five individuals from 3 families with biallelic (homozygous) loss-of-function variants. Clinical presentation incudes mild-moderate intellectual disability, hypotonia, sensorineural hearing loss, EEG abnormalities, congenital heart defects (tetralogy of Fallot, septal defects, dilated aortic root), urinary tract malformations, ophthalmological anomalies, short stature with other skeletal anomalies, and craniofacial features including flat occiput, ptosis, long philtrum, and short neck.

PMID:29620724 reports one individual with biallelic (homozygous) loss-of-function variant who presented with global developmental delay, mild hypotonia, craniosynostosis, severe early-onset scoliosis, imperforate anus, and double urinary collecting system.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4814 PRPF8 Krithika Murali gene: PRPF8 was added
gene: PRPF8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRPF8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRPF8 were set to 35543142
Phenotypes for gene: PRPF8 were set to Intellectual disability; epilepsy; Retinitis pigmentosa 13 - MIM#600059
Review for gene: PRPF8 was set to GREEN
Added comment: PMID 35543142 O'Grady et al 2022 report 14 unrelated individuals with heterozygous PRPF8 variants and ID, dymorphic features and epilepsy (7/14). Short stature, abnormal gait and cardiac anomalies also reported. 11 variants identified were de novo, 1 variant - maternal mosaicism, 1 variant - duo sequencing (not identified in mother, father could not be sequenced). 1 individual did not have parental testing. Cardiac anomalies varied and included benign cardiac tumour, dilated cardiomyopathy, dilated aortic root (COL5A2 VUS also identified), bicuspid aortic valve, cardiac arrest, self-resolving ASD/VSD.

Heterozygous PRPF8 variants previously associated with retinitis pigmentosa. 1 out of the 14 individuals in this cohort had a diagnosis of RP. RP variants noted to cluster in the C'terminal MPN domain. The individual with RP in this paper had a variant in the preceding RNAase H homology domain near the C-terminus. Not all of the individuals in this paper had formal ophthalmological examination
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4814 BUB1 Paul De Fazio gene: BUB1 was added
gene: BUB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BUB1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BUB1 were set to 35044816; 19772675; 19117986; 23209306
Phenotypes for gene: BUB1 were set to Neurodevelopmental disorder, BUB1-related MONDO:0700092; Intellectual disability and microcephaly
Review for gene: BUB1 was set to GREEN
gene: BUB1 was marked as current diagnostic
Added comment: 2 unrelated patients with ID, microcephaly, short stature, dysmorphic features reported with biallelic variants:

P1 (3yo male): homozygous start-loss variant (2 hets and 0 hom in gnomAD). Functional testing showed a small amount of full-length protein was translated, and BUB1 recruitment to kinetochores was nearly undetectable.
P2 (16yo female): compound heterozygous for a canonical splice variant (1 het and no hom in gnomAD) and an NMD-predicted frameshift variant (absent from gnomAD). The splice variant was shown to result in an in-frame deletion of 54 amino acids in the kinase domain. P2 cells have reduced protein levels but essentially no kinase activity.

BUB1 patient cells have impaired mitotic fidelity.

Homozygous Bub1 disruption in mice is embryonic lethal (PMID:19772675). A hypomorphic mouse is viable with increased tumourigenesis with ageing and aneuploidy (PMID:19117986). A kinase-dead mouse does not show increased tumourigenesis but does have a high frequency of aneuploid cells (PMID:23209306)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4814 SEMA6B Dean Phelan gene: SEMA6B was added
gene: SEMA6B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SEMA6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SEMA6B were set to PMID: 35604360
Phenotypes for gene: SEMA6B were set to Intellectual disability, MONDO:0001071, SEMA6B related
Penetrance for gene: SEMA6B were set to Complete
Review for gene: SEMA6B was set to GREEN
Added comment: PMID: 35604360
- 14 heterozygous variants were observed in 16 unrelated individuals referred for intellectual disability. Majority of the variants 9/14 were PTCs in the last exon and predicted to escape NMD. Functional studies of selected variants and shRNA knock down studies showed mislocalisation and abnormal protein function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4813 HEATR3 Chern Lim gene: HEATR3 was added
gene: HEATR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HEATR3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HEATR3 were set to PMID: 35213692
Phenotypes for gene: HEATR3 were set to Bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability; Diamond Blackfan anaemia MONDO:0015253, HEATR3 related
Review for gene: HEATR3 was set to AMBER
gene: HEATR3 was marked as current diagnostic
Added comment: PMID: 35213692:
- 4 unrelated individuals with biallelic HEATR3 variants (missense and splice site variants), exhibiting bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability.
- Functional analysis showed HEATR3 variants destabilised the protein, resulting in a reduction of nuclear uL18 and impaired ribosome biogenesis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4810 TCTN2 Zornitza Stark Publications for gene: TCTN2 were set to
Intellectual disability syndromic and non-syndromic v0.4803 LRP2 Zornitza Stark Publications for gene: LRP2 were set to
Intellectual disability syndromic and non-syndromic v0.4801 GEMIN4 Zornitza Stark Publications for gene: GEMIN4 were set to 25558065; 30237576
Intellectual disability syndromic and non-syndromic v0.4800 GFM2 Zornitza Stark Publications for gene: GFM2 were set to PMID: 22700954, 26016410, 29075935
Intellectual disability syndromic and non-syndromic v0.4797 COPB2 Zornitza Stark Phenotypes for gene: COPB2 were changed from Osteoporosis and developmental delay to Osteoporosis, childhood- or juvenile-onset, with developmental delay, MIM# 619884
Intellectual disability syndromic and non-syndromic v0.4796 COPB2 Zornitza Stark edited their review of gene: COPB2: Changed phenotypes: Osteoporosis, childhood- or juvenile-onset, with developmental delay, MIM# 619884
Intellectual disability syndromic and non-syndromic v0.4790 GFM2 Chirag Patel gene: GFM2 was added
gene: GFM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GFM2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GFM2 were set to PMID: 22700954, 26016410, 29075935
Phenotypes for gene: GFM2 were set to Combined oxidative phosphorylation deficiency 39, OMIM #618397
Review for gene: GFM2 was set to GREEN
Added comment: Combined oxidative phosphorylation deficiency-39 (COXPD39) is an autosomal recessive multisystem disorder resulting from a defect in mitochondrial energy metabolism. Affected individuals show global developmental delay, sometimes with regression after normal early development, axial hypotonia with limb spasticity or abnormal involuntary movements, and impaired intellectual development with poor speech. More variable features may include hypotonia, seizures, and features of Leigh syndrome on brain imaging. There are variable deficiencies of the mitochondrial respiratory chain enzyme complexes in patient tissues.

4 families reported with biallelic variants with functional evidence in 1 family.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4788 MOCS3 Zornitza Stark gene: MOCS3 was added
gene: MOCS3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: MOCS3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MOCS3 were set to 33897766; 28544736
Phenotypes for gene: MOCS3 were set to Molybdenum cofactor deficiency MONDO:0020480
Review for gene: MOCS3 was set to AMBER
Added comment: Two unrelated families reported.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4785 MFF Zornitza Stark Publications for gene: MFF were set to
Intellectual disability syndromic and non-syndromic v0.4782 OPHN1 Zornitza Stark Publications for gene: OPHN1 were set to
Intellectual disability syndromic and non-syndromic v0.4780 GRIA4 Ain Roesley Publications for gene: GRIA4 were set to 35518358; 29220673
Intellectual disability syndromic and non-syndromic v0.4779 GRIA4 Ain Roesley Publications for gene: GRIA4 were set to
Intellectual disability syndromic and non-syndromic v0.4778 GRID2 Ain Roesley Publications for gene: GRID2 were set to
Intellectual disability syndromic and non-syndromic v0.4776 ADD1 Chirag Patel gene: ADD1 was added
gene: ADD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADD1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: ADD1 were set to PMID: 34906466
Phenotypes for gene: ADD1 were set to Intellectual disability, corpus callosum dysgenesis, and ventriculomegaly; no OMIM #
Review for gene: ADD1 was set to GREEN
Added comment: 4 unrelated individuals affected by ID and/or complete or partial agenesis of corpus callosum, and enlarged lateral ventricles. WES found loss-of-function variants - 1 recessive missense variant and 3 de novo variants. The recessive variant is associated with ACC and enlarged lateral ventricles, and the de novo variants were associated with complete or partial agenesis of corpus callosum, mild ID and attention deficit. Human variants impair ADD1 protein expression and/or dimerization with ADD2. Add1 knockout mice recapitulate corpus callosum dysgenesis and ventriculomegaly phenotypes. Three adducin genes (ADD1, ADD2, and ADD3) encode cytoskeleton proteins that are critical for osmotic rigidity and cell shape. ADD1, ADD2, and ADD3 form heterodimers (ADD1/ADD2, ADD1/ADD3), which further form heterotetramers. Adducins interconnect spectrin and actin filaments to form polygonal scaffolds beneath the cell membranes and form ring-like structures in neuronal axons. Adducins regulate mouse neural development, but their function in the human brain is unknown.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4775 PROSER1 Chirag Patel gene: PROSER1 was added
gene: PROSER1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PROSER1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PROSER1 were set to PMID: 35229282
Phenotypes for gene: PROSER1 were set to Developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, and genitourinary malformations, no OMIM #
Review for gene: PROSER1 was set to RED
Added comment: 4 children from 3 related families with developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, genitourinary malformations, and common facial features (arched eyebrows, prominent eyes, broad nasal bridge, low-hanging columella, open mouth, thick lower lip, protruding tongue, large low-set ears, and parietal bossing). WES revealed a homozygous frame-shift variant (p.Thr612Glnfs*22) in PROSER1. This encodes the proline and serine rich protein 1, part of the histone methyltransferases KMT2C/KMT2D complexes. PROSER1 stabilizes TET2, a member of the TET family of DNA demethylases which is involved in recruiting the enhancer-associated KMT2C/KMT2D complexes and mediating DNA demethylation, activating gene expression. Therefore, PROSER1 may play vital and potentially general roles in gene regulation. No functional assays and 3 related families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4773 MTOR Zornitza Stark Publications for gene: MTOR were set to
Intellectual disability syndromic and non-syndromic v0.4769 WASF1 Zornitza Stark Publications for gene: WASF1 were set to PMID: 29961568
Intellectual disability syndromic and non-syndromic v0.4768 FTO Bryony Thompson Publications for gene: FTO were set to 19559399; 26378117
Intellectual disability syndromic and non-syndromic v0.4765 RBM28 Zornitza Stark Publications for gene: RBM28 were set to 18439547
Intellectual disability syndromic and non-syndromic v0.4761 DEPDC5 Zornitza Stark Publications for gene: DEPDC5 were set to
Intellectual disability syndromic and non-syndromic v0.4758 DCHS1 Zornitza Stark Publications for gene: DCHS1 were set to
Intellectual disability syndromic and non-syndromic v0.4753 DCAF17 Zornitza Stark Publications for gene: DCAF17 were set to
Intellectual disability syndromic and non-syndromic v0.4750 CYC1 Ain Roesley Publications for gene: CYC1 were set to 23910460; 34252606
Intellectual disability syndromic and non-syndromic v0.4749 CYC1 Ain Roesley Publications for gene: CYC1 were set to
Intellectual disability syndromic and non-syndromic v0.4743 PRDM13 Zornitza Stark Publications for gene: PRDM13 were set to 34730112
Intellectual disability syndromic and non-syndromic v0.4741 CTR9 Dean Phelan gene: CTR9 was added
gene: CTR9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CTR9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CTR9 were set to PMID: 35499524
Phenotypes for gene: CTR9 were set to Neurodevelopmental disorder (MONDO:0700092), CTR9-related; Intellectual disability (MONDO:0001071); hypotonia (HP:0001252); joint hyperlaxity (HP:0001388); speech delay; coordination problems; tremor (HP:0001337); autism spectrum disorder (MONDO:0005258)
Review for gene: CTR9 was set to GREEN
Added comment: PMID: 35499524 - Thirteen individuals with variables degrees of intellectual disability, hypotonia, joint hyperlaxity, speech delay, coordination problems, tremor, autism spectrum disorder. Mild dysmorphism and cardiac anomalies were less frequent. Eleven of the variants were shown to be de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4741 DNAH14 Chern Lim gene: DNAH14 was added
gene: DNAH14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DNAH14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAH14 were set to PMID: 35438214
Phenotypes for gene: DNAH14 were set to Neurodevelopmental disorder, DNAH14-related (MONDO#0700092)
Review for gene: DNAH14 was set to GREEN
gene: DNAH14 was marked as current diagnostic
Added comment: PMID: 35438214:
- Three previously unreported patients with compound heterozygous DNAH14 variants, including one nonsense, one frameshift, and four missense variants. A spectrum of neurological and developmental phenotypes was observed, including seizures, global developmental delay, microcephaly, and hypotonia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4740 DROSHA Lucy Spencer gene: DROSHA was added
gene: DROSHA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DROSHA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DROSHA were set to 35405010
Phenotypes for gene: DROSHA were set to Neurodevelopmental disorder (MONDO#0700092), DROSHA-related
Review for gene: DROSHA was set to AMBER
Added comment: 2 individuals with profound intellectual disability, epilepsy, white matter atrophy, microcephaly, and dysmorphic features, who carry damaging de novo heterozygous variants in DROSHA. Both variants are missense, absent from gnomad. Both individuals noted to have Rett-like features.

Functional studies in patient fibroblasts showed one of the missense altered the expression of mature miRNA. Fruit fly models with homozygous LOF variants die during larval stages. introduction of the missense seen in the patients was able to partially rescue this phenotype suggesting LOF is not the mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4739 DTYMK Zornitza Stark Phenotypes for gene: DTYMK were changed from Intellectual disability; microcephaly to Neurodegeneration, childhood-onset, with progressive microcephaly (MIM# 619847)
Intellectual disability syndromic and non-syndromic v0.4738 DTYMK Zornitza Stark Publications for gene: DTYMK were set to 31271740
Intellectual disability syndromic and non-syndromic v0.4736 KCNH5 Elena Savva gene: KCNH5 was added
gene: KCNH5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNH5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KCNH5 were set to https://www.medrxiv.org/content/10.1101/2022.04.26.22274147v1
Phenotypes for gene: KCNH5 were set to Neurodevelopmental disorder MONDO#0700092, KCNH5-related
Mode of pathogenicity for gene: KCNH5 was set to Other
Review for gene: KCNH5 was set to GREEN
Added comment: Happ (2022), preprint: Screen of 893 patients with DEE found 17 patients with missense variants (16/17 de novo, 1/17 inherited). GOF mechanism suggested.
Patient phenotypes included focal/generalized seizures, Cognitive outcome for the ten individuals >5 years ranged from normal (3/10) to mild (3/10), moderate (2/10), severe (1/10) and profound (1/10) intellectual disability (ID)

p.Arg327His (7 probands), p.Arg333His (4 probands) were recurring
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4733 STX1A Ain Roesley gene: STX1A was added
gene: STX1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: STX1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: STX1A were set to neurodevelopmental disorder MONDO#0700092, STX1A-related
Review for gene: STX1A was set to GREEN
gene: STX1A was marked as current diagnostic
Added comment: Preprint: https://www.medrxiv.org/content/10.1101/2022.04.20.22274073v1
8 individuals - 2x hom (related) and 6x hets (all de novo except 1x unknown)

7 unrelated since the 2 siblings share similar features:
7/7 ID, 7/7 motor delay, 4/7 epilepsy, 5/7 neonatal hypotonia 2/7 regression, 2/7 ASD excluding 1 with features but did not meet criteria
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4732 PPFIBP1 Zornitza Stark gene: PPFIBP1 was added
gene: PPFIBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: PPFIBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPFIBP1 were set to https://www.medrxiv.org/content/10.1101/2022.04.04.22273309v1
Phenotypes for gene: PPFIBP1 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIBP1-related
Review for gene: PPFIBP1 was set to GREEN
Added comment: 16 individuals from 10 unrelated families reported with moderate to profound developmental delay, often refractory early-onset epilepsy and progressive microcephaly. Drosophila model.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4731 DTYMK Daniel Flanagan reviewed gene: DTYMK: Rating: GREEN; Mode of pathogenicity: None; Publications: 34918187; Phenotypes: Neurodegeneration, childhood-onset, with progressive microcephaly (MIM# 619847); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4731 CPS1 Ain Roesley Publications for gene: CPS1 were set to 8486760; 17310273; 21120950; 31268178
Intellectual disability syndromic and non-syndromic v0.4730 CPS1 Ain Roesley Publications for gene: CPS1 were set to
Intellectual disability syndromic and non-syndromic v0.4727 MCCC2 Zornitza Stark Publications for gene: MCCC2 were set to
Intellectual disability syndromic and non-syndromic v0.4723 SIK1 Zornitza Stark Publications for gene: SIK1 were set to
Intellectual disability syndromic and non-syndromic v0.4719 HERC1 Zornitza Stark Publications for gene: HERC1 were set to
Intellectual disability syndromic and non-syndromic v0.4715 LINS1 Alison Yeung Publications for gene: LINS1 were set to
Intellectual disability syndromic and non-syndromic v0.4712 HCN1 Zornitza Stark Publications for gene: HCN1 were set to
Intellectual disability syndromic and non-syndromic v0.4709 AP1S2 Zornitza Stark Publications for gene: AP1S2 were set to
Intellectual disability syndromic and non-syndromic v0.4706 ENTPD1 Zornitza Stark gene: ENTPD1 was added
gene: ENTPD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ENTPD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ENTPD1 were set to 35471564
Phenotypes for gene: ENTPD1 were set to Spastic paraplegia 64, autosomal recessive, MIM# 615683
Review for gene: ENTPD1 was set to GREEN
Added comment: 27 individuals from 17 families published, expanding the phenotype to a complex neurodevelopmental disorder characterised by ID, white matter abnormalities and spastic paraplegia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4703 CNNM2 Ain Roesley Publications for gene: CNNM2 were set to
Intellectual disability syndromic and non-syndromic v0.4702 PIGC Zornitza Stark Publications for gene: PIGC were set to 27694521
Intellectual disability syndromic and non-syndromic v0.4700 PIGW Zornitza Stark Publications for gene: PIGW were set to
Intellectual disability syndromic and non-syndromic v0.4697 CIT Zornitza Stark Publications for gene: CIT were set to
Intellectual disability syndromic and non-syndromic v0.4695 CIC Ain Roesley Publications for gene: CIC were set to
Intellectual disability syndromic and non-syndromic v0.4693 PDE4D Zornitza Stark Publications for gene: PDE4D were set to
Intellectual disability syndromic and non-syndromic v0.4687 GLRA2 Zornitza Stark gene: GLRA2 was added
gene: GLRA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GLRA2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: GLRA2 were set to 26370147; 20479760; 35294868
Phenotypes for gene: GLRA2 were set to Intellectual developmental disorder, X-linked, syndromic, Pilorge type, MIM# 301076
Review for gene: GLRA2 was set to GREEN
Added comment: More than 10 unrelated families reported. Both males and females affected, though some mothers are asymptomatic or mild. Zebrafish model.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4686 FASTKD2 Bryony Thompson Publications for gene: FASTKD2 were set to 18771761; 28499982
Intellectual disability syndromic and non-syndromic v0.4683 PPP1R15B Zornitza Stark Publications for gene: PPP1R15B were set to
Intellectual disability syndromic and non-syndromic v0.4679 PRMT7 Zornitza Stark Publications for gene: PRMT7 were set to
Intellectual disability syndromic and non-syndromic v0.4676 PRSS12 Zornitza Stark Publications for gene: PRSS12 were set to
Intellectual disability syndromic and non-syndromic v0.4672 PSMD12 Zornitza Stark Publications for gene: PSMD12 were set to
Intellectual disability syndromic and non-syndromic v0.4669 PYCR2 Zornitza Stark Publications for gene: PYCR2 were set to
Intellectual disability syndromic and non-syndromic v0.4667 SET Zornitza Stark Marked gene: SET as ready
Intellectual disability syndromic and non-syndromic v0.4667 SET Zornitza Stark Gene: set has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4667 SET Zornitza Stark Phenotypes for gene: SET were changed from to Intellectual developmental disorder, autosomal dominant 58, MIM#618106; intellectual disability, autosomal dominant 58, MONDO:0020847
Intellectual disability syndromic and non-syndromic v0.4666 SET Zornitza Stark Publications for gene: SET were set to
Intellectual disability syndromic and non-syndromic v0.4665 SET Zornitza Stark Mode of inheritance for gene: SET was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4664 SET Zornitza Stark reviewed gene: SET: Rating: GREEN; Mode of pathogenicity: None; Publications: 29688601, 29907757, 25356899; Phenotypes: Intellectual developmental disorder, autosomal dominant 58, MIM#618106, intellectual disability, autosomal dominant 58, MONDO:0020847; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4663 PIGA Zornitza Stark Publications for gene: PIGA were set to 24706016; 24259184; 29159939
Intellectual disability syndromic and non-syndromic v0.4658 CACNA2D1 Michelle Torres gene: CACNA2D1 was added
gene: CACNA2D1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACNA2D1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CACNA2D1 were set to 35293990
Phenotypes for gene: CACNA2D1 were set to developmental and epileptic encephalopathy disorder MONDO:0100062 CACNA2D1-related
Review for gene: CACNA2D1 was set to GREEN
Added comment: PMID 35293990: WES of 2x unrelated individuals with early-onset developmental epileptic encephalopathy, microcephaly, severe hypotonia, absent speech, spasticity, choreiform movements, orofacial dyskinesia, and 2 cortical visual impairment, corpus callosum hypoplasia and progressive volume loss. Patient 2 also had a tiny patent foramen ovale.

Patient 1 is homozygous for p.(Ser275Asnfs*13). mRNA and protein expression were reduced to ~10% of WT in fibroblasts

Patient 2 is cHet for p.(Leu9Alafs*5) and p.(Gly209Asp). mRNA expression in patients fibroblasts was similar to controls, and protein expression reduced to 31-38%. Functional of the p.(Gly209Asp) showed impaired localization and mutagenesis showed complete loss of channel function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4658 TRAPPC10 Naomi Baker gene: TRAPPC10 was added
gene: TRAPPC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRAPPC10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC10 were set to PMID: 35298461; 30167849
Phenotypes for gene: TRAPPC10 were set to neurodevelopmental disorder (MONDO:0700092), TRAPPC10-related
Review for gene: TRAPPC10 was set to GREEN
Added comment: PMID: 35298461 – two Pakistani families reported with homozygous variants. Family 1 has frameshift variant in 8 affected individual and family 2 has missense variant in 2 affected individuals. Patients present with microcephaly, short stature, hypotonia, severe ID and behavioural abnormalities. Seizures also reported in 4/10 individuals. Paper also reported brain abnormalities in null mouse model and other functional in transfected cell lines.

PMID: 30167849 – initial report of family 2 above.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4658 ATP2B1 Daniel Flanagan gene: ATP2B1 was added
gene: ATP2B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ATP2B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP2B1 were set to PMID: 35358416
Phenotypes for gene: ATP2B1 were set to Neurodevelopmental disorder, MONDO:0700092, ATP2B1-related
Review for gene: ATP2B1 was set to GREEN
Added comment: 12 unrelated individuals with variants in ATP2B1 and an overlapping phenotype of mild to moderate global development delay. Additional common symptoms include autism (5), seizures (6), and distal limb abnormalities (4). 9 variants proven to be de novo, other 3 variants had unknown inheritance. 9 missense and 3 nonsense. Supporting functional analysis for missense.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4656 AHSG Elena Savva gene: AHSG was added
gene: AHSG was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AHSG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AHSG were set to PMID: 28054173; 9395485; 31288248; 17389622
Phenotypes for gene: AHSG were set to ?Alopecia-intellectual disability syndrome 1 MIM#203650; infantile cortical hyperostosis
Review for gene: AHSG was set to RED
Added comment: PMID: 28054173 - 7 relatives within a large consanguinous fam w/ alopecia and ID, and a hom missense (p.Arg317His). Modelling predicts this variant to be a phosphorylation site, functional studies show a difference in protein size. Unclear biological significance.
Alt change with stronger GS (p.(Arg317Cys)) is a common poly with 19 homozygotes in gnomAD.

No hom PTCs in gnomAD

PMID: 9395485 - K/O mouse model shows no gross anatomical abnormalities, were fertile and "healthy". No mentioned of ID, alopecia
PMID: 17389622 - K/O mouse model on the calcification resistant genetic background C57BL/6, shows uraemia and phosphate challenge. No mentioned of ID, alopecia

PMID: 31288248 - 1 hom infant (p.K2*, within 5' NMD escape region) with infantile cortical hyperostosis, loss of enzyme in patient serum shown by ELISA. No mentioned of ID, alopecia
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4654 VPS16 Ain Roesley gene: VPS16 was added
gene: VPS16 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VPS16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS16 were set to 33938619; 34013567; 34901436
Phenotypes for gene: VPS16 were set to mucopolysaccharidosis-like disorder, VPS16-related MONDO#0100365
Review for gene: VPS16 was set to GREEN
gene: VPS16 was marked as current diagnostic
Added comment: for AR MPS - developmental delay reported
3 unrelated families - 2x hom c.2272‐18C>A and 1x hom p.Trp180Cys

RNA and functional studies done on the splice variant

also associated with AD dystonia
PMID:34901436 suggests dystonia is transcript specific
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4651 TSPAN7 Zornitza Stark Publications for gene: TSPAN7 were set to
Intellectual disability syndromic and non-syndromic v0.4646 SLC6A17 Zornitza Stark Publications for gene: SLC6A17 were set to
Intellectual disability syndromic and non-syndromic v0.4642 RBMX Zornitza Stark gene: RBMX was added
gene: RBMX was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: RBMX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: RBMX were set to 25256757; 34260915
Phenotypes for gene: RBMX were set to Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238
Review for gene: RBMX was set to AMBER
Added comment: Hemizygous truncating variant reported segregating in multiple affected individuals in a single family. Some supportive functional data.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4640 WDR11 Elena Savva Publications for gene: WDR11 were set to 34413497
Intellectual disability syndromic and non-syndromic v0.4637 RAB3GAP2 Zornitza Stark Publications for gene: RAB3GAP2 were set to
Intellectual disability syndromic and non-syndromic v0.4635 KCND3 Elena Savva Publications for gene: KCND3 were set to 32823520
Intellectual disability syndromic and non-syndromic v0.4633 NUBPL Zornitza Stark Publications for gene: NUBPL were set to
Intellectual disability syndromic and non-syndromic v0.4630 NTRK1 Zornitza Stark Publications for gene: NTRK1 were set to
Intellectual disability syndromic and non-syndromic v0.4626 NSUN2 Zornitza Stark Publications for gene: NSUN2 were set to
Intellectual disability syndromic and non-syndromic v0.4623 NRXN1 Zornitza Stark Publications for gene: NRXN1 were set to
Intellectual disability syndromic and non-syndromic v0.4620 SMARCE1 Zornitza Stark Publications for gene: SMARCE1 were set to
Intellectual disability syndromic and non-syndromic v0.4617 SNX14 Zornitza Stark Publications for gene: SNX14 were set to
Intellectual disability syndromic and non-syndromic v0.4614 SMS Zornitza Stark Publications for gene: SMS were set to
Intellectual disability syndromic and non-syndromic v0.4611 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to 29365063; 27164704; 27164704; 28051072
Intellectual disability syndromic and non-syndromic v0.4609 TBL1XR1 Zornitza Stark Publications for gene: TBL1XR1 were set to
Intellectual disability syndromic and non-syndromic v0.4606 TBCK Zornitza Stark Publications for gene: TBCK were set to
Intellectual disability syndromic and non-syndromic v0.4603 TBC1D23 Zornitza Stark Publications for gene: TBC1D23 were set to
Intellectual disability syndromic and non-syndromic v0.4600 NONO Zornitza Stark Publications for gene: NONO were set to
Intellectual disability syndromic and non-syndromic v0.4597 LAS1L Alison Yeung Publications for gene: LAS1L were set to 25644381; 26358559
Intellectual disability syndromic and non-syndromic v0.4594 STAG1 Zornitza Stark Publications for gene: STAG1 were set to
Intellectual disability syndromic and non-syndromic v0.4591 NLGN3 Zornitza Stark Publications for gene: NLGN3 were set to
Intellectual disability syndromic and non-syndromic v0.4588 NHS Zornitza Stark Publications for gene: NHS were set to
Intellectual disability syndromic and non-syndromic v0.4587 NHS Zornitza Stark Mode of inheritance for gene: NHS was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4585 NFIA Zornitza Stark Publications for gene: NFIA were set to
Intellectual disability syndromic and non-syndromic v0.4582 STX1B Zornitza Stark Publications for gene: STX1B were set to
Intellectual disability syndromic and non-syndromic v0.4580 NLGN3 Krithika Murali reviewed gene: NLGN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28584888, 12669065, 25167861; Phenotypes: {Asperger syndrome susceptibility, X-linked 1} - MIM#300494, {Autism susceptibility, X-linked 1} - MIM#300425; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4580 NHS Krithika Murali reviewed gene: NHS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31755796, 25266737; Phenotypes: Nance-Horan syndrome - MIM#302350, Cataract 40, X-linked - MIM#302200; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4579 SYNJ1 Zornitza Stark Publications for gene: SYNJ1 were set to
Intellectual disability syndromic and non-syndromic v0.4577 SZT2 Zornitza Stark Publications for gene: SZT2 were set to
Intellectual disability syndromic and non-syndromic v0.4574 NDST1 Zornitza Stark Publications for gene: NDST1 were set to
Intellectual disability syndromic and non-syndromic v0.4572 ITCH Zornitza Stark Publications for gene: ITCH were set to 20170897
Intellectual disability syndromic and non-syndromic v0.4570 ITPA Zornitza Stark Publications for gene: ITPA were set to
Intellectual disability syndromic and non-syndromic v0.4568 C12orf57 Ain Roesley Publications for gene: C12orf57 were set to
Intellectual disability syndromic and non-syndromic v0.4566 C12orf4 Ain Roesley Publications for gene: C12orf4 were set to 34967075; 31334606; 27311568; 25558065; 28097321
Intellectual disability syndromic and non-syndromic v0.4566 C12orf4 Ain Roesley Publications for gene: C12orf4 were set to 34967075; 31334606; 27311568; 25558065; 28097321
Intellectual disability syndromic and non-syndromic v0.4565 C12orf4 Ain Roesley Publications for gene: C12orf4 were set to
Intellectual disability syndromic and non-syndromic v0.4563 KCND3 Zornitza Stark Publications for gene: KCND3 were set to
Intellectual disability syndromic and non-syndromic v0.4561 KCND3 Zornitza Stark changed review comment from: Progressive neurological condition; ID only reported in some, most however reported as having normal cognition.; to: Progressive neurological condition; ID only reported in some. Recent review of all published patients, PMID 32823520 defined a group with early onset of disease, where DD/ID are the predominant presenting symptoms, with ataxia developing later.
Intellectual disability syndromic and non-syndromic v0.4560 KCNJ10 Zornitza Stark Publications for gene: KCNJ10 were set to
Intellectual disability syndromic and non-syndromic v0.4557 KCNK3 Zornitza Stark gene: KCNK3 was added
gene: KCNK3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: KCNK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNK3 were set to 33057194
Phenotypes for gene: KCNK3 were set to Neurodevelopmental disorder, MONDO:0700092, KCNK3-related
Review for gene: KCNK3 was set to AMBER
Added comment: Established pulmonary hypertension gene.

PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 8 de novo variants (7 missense, 1 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided).
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4549 KIAA1109 Zornitza Stark Publications for gene: KIAA1109 were set to
Intellectual disability syndromic and non-syndromic v0.4546 NAT8L Krithika Murali gene: NAT8L was added
gene: NAT8L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAT8L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAT8L were set to 11310630; 19807691; 32275776
Phenotypes for gene: NAT8L were set to ?N-acetylaspartate deficiency - MIM#614063
Review for gene: NAT8L was set to AMBER
Added comment: Absence of brain N-acetylaspartate, has been described in only one patient, with truncal ataxia, marked developmental delay, seizures and secondary microcephaly (first described by - PMID: 11310630 Martin et al 2001). PMID: 19807691 - Wiame et al 2009 identified in this patient a homozygous 19 bp NAT8L gene deletion, resulting in a change in reading frame and the absence of production of a functional protein. The affected individual is adopted and testing of the biological parents was not possible. The authors provide supportive functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4545 NANS Zornitza Stark Publications for gene: NANS were set to
Intellectual disability syndromic and non-syndromic v0.4542 NACC1 Zornitza Stark Publications for gene: NACC1 were set to
Intellectual disability syndromic and non-syndromic v0.4539 NAA15 Zornitza Stark Publications for gene: NAA15 were set to
Intellectual disability syndromic and non-syndromic v0.4537 IRX5 Zornitza Stark Publications for gene: IRX5 were set to 22581230; 27453922
Intellectual disability syndromic and non-syndromic v0.4533 NFE2L1 Zornitza Stark gene: NFE2L1 was added
gene: NFE2L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NFE2L1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NFE2L1 were set to 35112409
Phenotypes for gene: NFE2L1 were set to Syndromic disease, MONDO:0002254
Review for gene: NFE2L1 was set to RED
Added comment: A single patient with developmental delay, hypotonia, hypospadias, bifid scrotum, and failure to thrive, with a heterozygous nonsense variant in the last exon. In vitro functional assays suggest a dominant-negative effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4531 QDPR Zornitza Stark Publications for gene: QDPR were set to
Intellectual disability syndromic and non-syndromic v0.4522 HIST1H4C Zornitza Stark Publications for gene: HIST1H4C were set to 28920961
Intellectual disability syndromic and non-syndromic v0.4520 CPSF3 Belinda Chong gene: CPSF3 was added
gene: CPSF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CPSF3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CPSF3 were set to 35121750
Phenotypes for gene: CPSF3 were set to Intellectual disability syndrome
Review for gene: CPSF3 was set to GREEN
gene: CPSF3 was marked as current diagnostic
Added comment: Study of a deficit of observed homozygous carriers of missense variants, versus an expected number in a set of 153,054 chip-genotyped Icelanders, to identify potentially pathogenic genotypes

Six homozygous carriers of missense variants in CPSF3 show severe intellectual disability, seizures, microcephaly, and abnormal muscle tone.

- Four identified through Icelandic geneology (p.Gly468Glu), three carrier couples total of four children who had died prematurely. Tested archival samples for two of these children, and confirm a homozygous genotype.
- Two of Mexican descent (p.Ile354Thr), first-degree cousins
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 HIST1H4E Paul De Fazio gene: HIST1H4E was added
gene: HIST1H4E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4E was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIST1H4E were set to 35202563
Phenotypes for gene: HIST1H4E were set to Neurodevelopmental disorder, HIST1H4E-related MONDO:0700092
Review for gene: HIST1H4E was set to GREEN
gene: HIST1H4E was marked as current diagnostic
Added comment: 17 patients identified with de novo missense variants affecting Lys31, Pro32, Arg35, Leu37, Arg40 (recurrent), Arg45 (recurrent), Tyr98 (recurrent). All individuals had ID/dev delay. Additional phenotypes in some but not all individuals included epilepsy, hypotonia, facial dysmorphism. Most had reduced birth length, OFC, weight (-1 to -3SD).
A zebrafish model has developmental defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 NRCAM Ee Ming Wong gene: NRCAM was added
gene: NRCAM was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NRCAM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NRCAM were set to PMID: 35108495
Phenotypes for gene: NRCAM were set to neurodevelopmental disorder, MONDO:0700092
Penetrance for gene: NRCAM were set to unknown
Review for gene: NRCAM was set to GREEN
gene: NRCAM was marked as current diagnostic
Added comment: -Ten individuals from 8 families with developmental delay/intellectual disability, hypotonia, peripheral neuropathy, and/or spasticity
- Affected individuals are biallelic for missense and/or LoF variants which are mainly in the fibronectin type III (Fn-III) domain
- Zebrafish mutants lacking the third Fn-III domain displayed significantly altered swimming behavior compared to wild-type larvae (p < 0.03) and a trend toward increased amounts of alpha-tubulin fibers in the dorsal telencephalon, demonstrating an alteration in white matter tracts and projections
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 HIST1H4D Paul De Fazio gene: HIST1H4D was added
gene: HIST1H4D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4D was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIST1H4D were set to 35202563
Phenotypes for gene: HIST1H4D were set to Neurodevelopmental disorder, HIST1H4D-related MONDO:0700092
Review for gene: HIST1H4D was set to AMBER
gene: HIST1H4D was marked as current diagnostic
Added comment: Single individual described with a de novo missense variant Arg41His (Arg40 in H4 nomenclature). Apart from langauge delay and moderate ID, phenotypes included facial dysmorphisms and cochlear abnormalities and arhinencephaly on MRI. Hearing was normal. Birth length, OFC, weight were all reduced (-2 to -2.5SD).
A zebrafish model has developmental defects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 CRLS1 Michelle Torres gene: CRLS1 was added
gene: CRLS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CRLS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRLS1 were set to 35147173
Phenotypes for gene: CRLS1 were set to Mitochondrial disease MONDO:0044970 CRLS1-related
Added comment: - Three families (4 individuals) with cardiolipin deficiency.
- Two families (one consanguineous with 2 affected siblings) with homozygous the p.(Ile109Asn) had infantile progressive encephalopathy, bull’s eye maculopathy, auditory neuropathy, diabetes insipidus, autonomic instability, cardiac defects and early death.
- The fourth individual cHet p.(Ala172Asp) and p.(Leu217Phe) presented with chronic encephalopathy with neurodevelopmental regression, congenital nystagmus with decreased vision, sensorineural hearing loss, failure to thrive and acquired microcephaly.
- Functional studies on patient cells showed increased levels of the substrate of CRLS1 and impaired mitochondrial morphology and biogenesis
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4519 ZBTB7A Daniel Flanagan gene: ZBTB7A was added
gene: ZBTB7A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ZBTB7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZBTB7A were set to 34515416; 31645653
Phenotypes for gene: ZBTB7A were set to Macrocephaly, neurodevelopmental delay, lymphoid hyperplasia, and persistent fetal hemoglobin (MIM#619769)
Review for gene: ZBTB7A was set to GREEN
Added comment: PMID: 34515416. Monoallelic ZBTB7A variants identified in 12 individuals from 11 families, with macrocephaly (11/12), some degree of ID (12/12), autistic features (7/12) and hypertrophy of pharyngeal lymphoid tissue (12/12). Variants included LoF variants and missense, 8 variants were de novo.

PMID: 31645653. De novo ZBTB7A missense identified in a boy with macrocephaly, intellectual disability, and sleep apnea.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4517 HIST1H4F Elena Savva gene: HIST1H4F was added
gene: HIST1H4F was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4F was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIST1H4F were set to PMID: 35202563
Phenotypes for gene: HIST1H4F were set to Neurodevelopmental disorders
Review for gene: HIST1H4F was set to GREEN
Added comment: PMID: 35202563 - single de novo missense in a patient with neurodevelopmental features of intellectual disability and motor and/or gross developmental delay.
- zebrafish studies show a significant increase in all of mild dev delay, necrosis, defective organogenesis and pre-gastrulation failure
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4515 HIST1H4I Elena Savva gene: HIST1H4I was added
gene: HIST1H4I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4I was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIST1H4I were set to PMID: 35202563
Phenotypes for gene: HIST1H4I were set to Neurodevelopmental syndrome
Review for gene: HIST1H4I was set to GREEN
Added comment: PMID: 35202563
- 3 unrelated de novo patients, p.His75Arg was recurring and observed in 2/3 probands.
- Zebrafish study shows both variants resulted in a significant increases in developmental issues such as in mild dev delay, necrosis and defective organogenesis.
- All patients had intellectual disability and motor and/or gross developmental delay and dysmorphisms.
- 2/3 patients showed bilateral conductive hearing loss
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4513 ATP6V0A1 Zornitza Stark Publications for gene: ATP6V0A1 were set to 30842224; 33057194
Intellectual disability syndromic and non-syndromic v0.4511 TIAM1 Alison Yeung gene: TIAM1 was added
gene: TIAM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TIAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TIAM1 were set to Neurodevelopmental disorder, TIAM1-related, MONDO:0700092
Review for gene: TIAM1 was set to GREEN
Added comment: Reported in 4 unrelated individuals. Phenotype of developmental delay/intellectual disability and seizures. Loss of ortholog in Drosophila reduces the survival rate, and the surviving adults exhibit climbing defects, are prone to severe seizures, and have a short lifespan. Functional studies in 3 variants from two probands showed loss of function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4510 ATP6V0A1 Chern Lim reviewed gene: ATP6V0A1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:34909687; Phenotypes: Early-onset progressive myoclonus epilepsy with ataxia, AR, severe developmental and epileptic encephalopathy, AD.; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4507 CHKA Konstantinos Varvagiannis gene: CHKA was added
gene: CHKA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHKA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHKA were set to 35202461
Phenotypes for gene: CHKA were set to Abnormal muscle tone; Global developmental delay; Intellectual disability; Seizures; Microcephaly; Abnormality of movement; Abnormality of nervous system morphology; Short stature
Penetrance for gene: CHKA were set to Complete
Review for gene: CHKA was set to GREEN
Added comment: Klöckner (2022 - PMID: 35202461) describe the phenotype of 6 individuals (from 5 unrelated families) harboring biallelic CHKA variants.

Shared features incl. abnormal muscle tone(6/6 - hypertonia or hypotonia, 3/6 each), DD/ID (6/6,severe in 4, severe/profound in 2), epilepsy (6/6 - onset: infancy - 3y2m | epileptic spasms or GS at onset), microcephaly (6/6), movement disorders (3/6 - incl. dyskinesia, rigidity, choreoatetotic movements). 2/5 individuals exhibited MRI abnormalities, notably hypomyelination. Short stature was observed in 4/6.

Eventual previous genetic testing was not discussed.

Exome sequencing (quattro ES for 2 sibs, trio ES for 1 individual, singleton for 3 probands) revealed biallelic CHKA variants in all affected individuals. Sanger sequencing was performed for confirmation and segregation studies.

Other variants (in suppl.) were not deemed to be causative for the neurodevelopmental phenotype.

3 different missense, 1 start-loss and 1 truncating variant were identified, namely (NM_0012772.2):
- c.421C>T/p.(Arg141Trp) [3 hmz subjects from 2 consanguineous families],
- c.580C>T/p.Pro194Ser [1 hmz individual born to consanguineous parents],
- c.2T>C/p.(Met1?) [1 hmz individual born to related parents],
- c.14dup/p.(Cys6Leufs*19) in trans with c.1021T>C/p.(Phe341Leu) in 1 individual.

CHKA encodes choline kinase alpha, an enzyme catalyzing the first step of phospholipid synthesis in the Kennedy pathway. The pathway is involved in de novo synthesis of glycerophospholipids, phosphatidylcholine and phosphatidylethanolamine being the most abundant in eukaryotic membranes.

CHKA with its paralog (CHKB) phosphorylates either choline or ethanolamine to phosphocholine or phosphoethanolamine respectively with conversion of ATP to ADP.

As the authors comment, biallelic pathogenic variants in CHKB cause a NDD with muscular dystrophy, hypotonia, ID, microcephaly and structural mitochondrial anomalies (MIM 602541). [Prominent mitochondrial patterning was observed in a single muscle biopsy available from an individual with biallelic CHKA variants].

Other disorders of the Kennedy pathway (due to biallelic PCYT2, SELENOI, PCYT1A variants) present with overlapping features incl. variable DD/ID (no-severe), microcephaly, seizures, visual impairment etc.

CHKA variants were either absent or observed once in gnomAD, affected highly conserved AAs with multiple in silico predictions in favor of a deleterious effect.

In silico modeling suggests structural effects for several of the missense variants (Arg141Trp, Pro194Ser presumably affect ADP binding, Phe341 lying close to the binding site of phosphocholine).

Each of the missense variants was expressed in yeast cells and W. Blot suggested expression at the expected molecular weight at comparative levels. The 3 aforementioned variants exhibited reduced catalytic activity (20%, 15%, 50% respectively).

NMD is thought to underly the deleterious effect of the frameshift one (not studied).

The start-loss variant is expected to result in significantly impaired expression and protein function as eventual utilization of the next possible start codon - occurring at position 123 - would remove 26% of the protein.

Chka(-/-) is embryonically lethal in mice, suggesting that complete loss is not compatible with life. Reduction of choline kinase activity by 30% in heterozygous mice did not appear to result in behavioral abnormalities although this was not studied in detail (PMID cited: 18029352). Finally, screening of 1566 mouse lines identified 198 genes whose disruption yields neuroanatomical phenotypes, Chka(+/-) mice being among these (PMID cited: 31371714).

There is no associated phenotype in OMIM, Gene2Phenotype or SysID.

Overall this gene can be considered for inclusion in the ID and epilepsy panes with green or amber rating (>3 individuals, >3 variants, variant studies, overlapping phenotype of disorders belonging to the same pathway, etc). Consider also inclusion in the microcephaly panel (where available this seemed to be of postnatal onset).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4505 THOC6 Zornitza Stark Publications for gene: THOC6 were set to
Intellectual disability syndromic and non-syndromic v0.4502 SYP Zornitza Stark Publications for gene: SYP were set to
Intellectual disability syndromic and non-syndromic v0.4495 THUMPD1 Chern Lim gene: THUMPD1 was added
gene: THUMPD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: THUMPD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: THUMPD1 were set to Syndromic form of intellectual disability associated with developmental delay, behavioral abnormalities, hearing loss and facial dysmorphism, AR
gene: THUMPD1 was marked as current diagnostic
Added comment: Broly, M. et al. (2022) manuscript accepted in AJHG:
- 13 individuals from 8 families, loss of function variants (PTVs, one missense, one single AA del).
- Common phenotypic findings included global developmental delay, speech delay, moderate to severe intellectual deficiency, behavioral abnormalities such as angry outbursts, facial dysmorphism and ophthalmological abnormalities.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.4494 PAX5 Bryony Thompson gene: PAX5 was added
gene: PAX5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PAX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PAX5 were set to 35094443; 31452935; 28263302; 25418537; 8001127; 27626380
Phenotypes for gene: PAX5 were set to neurodevelopmental disorder MONDO:0700092
Review for gene: PAX5 was set to GREEN
Added comment: 5 individuals from 4 families with large deletions involving PAX5 and 11 individuals from 9 families with frameshift/stopgain/missense variants and neurodevelopmental phenotypes that included delayed developmental milestones (DD), intellectual disability (ID), and/or ASD. 6 of the variants are de novo. Null mouse have retarded growth and altered patterning of the posterior midbrain. Pax5+/− mice of both sexes are hyperactive and have abnormal auditory brainstem responses.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4492 EEF1B2 Bryony Thompson Publications for gene: EEF1B2 were set to 31845318; 21937992
Intellectual disability syndromic and non-syndromic v0.4489 CENPJ Zornitza Stark Publications for gene: CENPJ were set to 20522431; 23166506; 15793586; 20978018; 22775483; 32677750; 32549991
Intellectual disability syndromic and non-syndromic v0.4486 ATP5E Ain Roesley gene: ATP5E was added
gene: ATP5E was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP5E was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATP5E were set to 34954817; 20566710; 27626380; 20026007
Phenotypes for gene: ATP5E were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 3 MIM#614053
Penetrance for gene: ATP5E were set to Complete
Review for gene: ATP5E was set to AMBER
gene: ATP5E was marked as current diagnostic
Added comment: 3 unrelated with the same Tyr12Cys avriant

3/3 with dev delay. 2/3 with ID (the other NA)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4485 BAP1 Anna Ritchie gene: BAP1 was added
gene: BAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BAP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BAP1 were set to PMID: 35051358
Phenotypes for gene: BAP1 were set to syndromic intellectual disability MONDO:0000508
Penetrance for gene: BAP1 were set to unknown
Review for gene: BAP1 was set to GREEN
Added comment: 11 de novo germline heterozygous missense BAP1 variants associated with a rare syndromic neurodevelopmental disorder. Functional analysis showed that most of the variants cannot rescue the consequences of BAP1 inactivation, suggesting a loss-of-function mechanism. All affected individuals harboring a de novo BAP1 variant had DD or ID (11/11) characterized notably by speech (11/ 11) and motor delay (6/11). Most of them had hypotonia (7/11), seizures (6/11), and abnormal behavior (8/10), including autism spectrum disorder, attention deficit hyperactivity disorder, and hypersensitivity. Almost all individuals showed dysmorphic facial features (10/11), and more than half (6/11) had skeletal malformations (involving the hands [4/11], feet [3/11], or spine [2/11]). Most of the individuals had growth failure (9/11), including four individuals with a very short stature.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4484 SOD1 Naomi Baker gene: SOD1 was added
gene: SOD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SOD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SOD1 were set to PMID: 31314961; 31332433; 34788402
Phenotypes for gene: SOD1 were set to Spastic tetraplegia and axial hypotonia, progressive, MIM#618598
Review for gene: SOD1 was set to GREEN
Added comment: Phenotypes include one individual with axial hypotonia and loss of gross and fine motor function beginning at 6 months of age, after which severe, progressive spastic tetraparesis developed and Babinski’s sign was present in both feet. MRI of brain detected mild frontoparietal atrophy.

The second individual had severe and marked by progressive loss of motor abilities from 9 months of age, tetraspasticity with predominance in the lower extremities, mild cerebellar atrophy, and hyperekplexia-like symptoms. Dysmorphic features such as low set, posteriorly rotated ears, and overlapping toes

The third individual is an infant with severe global developmental delay, axial hypotonia and limb spasticity. No dysmorphic facial features were noted, but she had a high arched palate, bilateral 5th finger clinodactyly, partial toe syndactyly of the second and third toes, and a single hyperpigmented macule tongue fasciculations, axial hypotonia with limb spasticity (more pronounced in the lower limbs), ankle clonus, and brisk patellar deep tendon reflexes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4484 ITSN1 Ee Ming Wong gene: ITSN1 was added
gene: ITSN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ITSN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ITSN1 were set to PMID: 34707297
Phenotypes for gene: ITSN1 were set to neurodevelopmental disorder MONDO:0700092 ITSN1-related
Penetrance for gene: ITSN1 were set to unknown
gene: ITSN1 was marked as current diagnostic
Added comment: -10 individuals from eight unrelated with neurodevelopmental disorder spectrum including ASD, ID, major behavioral difficulties and/or verbal impairment.
-variants included heterozygous premature truncating and missense variants
-Majority of variants were de novo; in two patients the reported variant was inherited from paucisymptomatic father
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4482 MAN2C1 Michelle Torres gene: MAN2C1 was added
gene: MAN2C1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAN2C1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAN2C1 were set to 35045343
Phenotypes for gene: MAN2C1 were set to neurodevelopmental disorder MONDO:0700092 MAN2C1-related
Review for gene: MAN2C1 was set to GREEN
Added comment: Six individuals from four different families, including two fetuses, exhibiting dysmorphic facial features, congenital anomalies such as tongue hamartoma, variable degrees of intellectual disability, and brain anomalies including polymicrogyria, interhemispheric cysts, hypothalamic hamartoma, callosal anomalies, and hypoplasia of brainstem and cerebellar vermis. Variants include PTC and missense.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4482 SLC38A3 Ain Roesley gene: SLC38A3 was added
gene: SLC38A3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC38A3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC38A3 were set to 34605855
Phenotypes for gene: SLC38A3 were set to developmental epileptic encephalopathy, SLC38A3-related MONDO:0100062
Penetrance for gene: SLC38A3 were set to Complete
Review for gene: SLC38A3 was set to GREEN
gene: SLC38A3 was marked as current diagnostic
Added comment: 7 families 6 of whom are consanguineous but unique variants in all of them

10/10 with GDD/ID
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4481 FRA10AC1 Zornitza Stark gene: FRA10AC1 was added
gene: FRA10AC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FRA10AC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FRA10AC1 were set to 34694367
Phenotypes for gene: FRA10AC1 were set to Neurodevelopmental disorder, MONDO:0700092, FRA10AC1-related
Review for gene: FRA10AC1 was set to GREEN
Added comment: PMID 34694367: 5 individuals from 3 unrelated families reported.

Variable ID, possibly related to variant type with LoF variants associated with more severe ID. All individuals had microcephaly, hypoplasia or agenesis of the corpus callosum, growth retardation, and craniofacial dysmorphism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4479 PLAA Zornitza Stark Publications for gene: PLAA were set to
Intellectual disability syndromic and non-syndromic v0.4476 PGAP1 Zornitza Stark Publications for gene: PGAP1 were set to
Intellectual disability syndromic and non-syndromic v0.4468 CAMK2G Zornitza Stark Publications for gene: CAMK2G were set to 30184290
Intellectual disability syndromic and non-syndromic v0.4465 CAMK2G Zornitza Stark gene: CAMK2G was added
gene: CAMK2G was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CAMK2G was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CAMK2G were set to 30184290
Phenotypes for gene: CAMK2G were set to Intellectual disability
Mode of pathogenicity for gene: CAMK2G was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: CAMK2G was set to AMBER
Added comment: Two unrelated individuals reported with de novo (p.Arg292Pro) variant. Functional data suggests GoF.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4463 CSNK2B Zornitza Stark Publications for gene: CSNK2B were set to
Intellectual disability syndromic and non-syndromic v0.4460 GDI1 Zornitza Stark Publications for gene: GDI1 were set to
Intellectual disability syndromic and non-syndromic v0.4459 GDI1 Zornitza Stark Mode of inheritance for gene: GDI1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4458 GDI1 Zornitza Stark reviewed gene: GDI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28863211, 22002931, 9620768, 9668174; Phenotypes: Intellectual developmental disorder, X-linked 41 MIM#300849; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4456 FMN2 Zornitza Stark Publications for gene: FMN2 were set to
Intellectual disability syndromic and non-syndromic v0.4453 MDH2 Zornitza Stark Publications for gene: MDH2 were set to
Intellectual disability syndromic and non-syndromic v0.4450 SIN3A Zornitza Stark Publications for gene: SIN3A were set to
Intellectual disability syndromic and non-syndromic v0.4446 SOX11 Zornitza Stark Publications for gene: SOX11 were set to 24886874; 33785884; 33430815; 33086258; 31530938
Intellectual disability syndromic and non-syndromic v0.4446 SOX11 Zornitza Stark Publications for gene: SOX11 were set to
Intellectual disability syndromic and non-syndromic v0.4443 OTUD6B Zornitza Stark Publications for gene: OTUD6B were set to
Intellectual disability syndromic and non-syndromic v0.4438 ANAPC7 Zornitza Stark gene: ANAPC7 was added
gene: ANAPC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ANAPC7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ANAPC7 were set to 34942119
Phenotypes for gene: ANAPC7 were set to Ferguson-Bonni neurodevelopmental syndrome, MIM# 619699
Review for gene: ANAPC7 was set to AMBER
Added comment: 11 individuals of Amish heritage reported homozygous for an intragenic deletion. Clinical features included ID, hypotonia, deafness in 5, relatively small head size (but microcephaly only in 1), and occasional congenital anomalies.

Supportive mouse model.

Amber rating in light of this being a founder variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4431 HNRNPH2 Zornitza Stark Publications for gene: HNRNPH2 were set to
Intellectual disability syndromic and non-syndromic v0.4430 HNRNPH2 Zornitza Stark Mode of inheritance for gene: HNRNPH2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4429 HNRNPH2 Zornitza Stark reviewed gene: HNRNPH2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34907471, 33728377, 31670473, 31236915, 30887513; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, Bain type MIM#300986; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4429 TCTN1 Ain Roesley gene: TCTN1 was added
gene: TCTN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TCTN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TCTN1 were set to 31302911; 28631893; 21725307; 26477546; 34980503
Phenotypes for gene: TCTN1 were set to Joubert syndrome 13, MIM# 614173; MONDO:0013608
Penetrance for gene: TCTN1 were set to Complete
Review for gene: TCTN1 was set to GREEN
gene: TCTN1 was marked as current diagnostic
Added comment: Rare cause of JBS, at least 6 families reported, mouse model.

ID/developmental delay described in at least 3 of them
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4428 PRKAR1B Zornitza Stark Publications for gene: PRKAR1B were set to https://doi.org/10.1101/2020.09.10.20190314; 33057194
Intellectual disability syndromic and non-syndromic v0.4425 NAA10 Zornitza Stark Publications for gene: NAA10 were set to
Intellectual disability syndromic and non-syndromic v0.4424 NAA10 Zornitza Stark Mode of inheritance for gene: NAA10 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4423 SLC35F1 Zornitza Stark gene: SLC35F1 was added
gene: SLC35F1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC35F1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC35F1 were set to 33821533
Phenotypes for gene: SLC35F1 were set to Neruodevelopmental disorder, MONDO:0700092, SLC35F1-associated; Rett-like syndrome
Review for gene: SLC35F1 was set to RED
Added comment: WES found a de novo heterozygous c.1037T>C; p.(I346T) (absent in gnomad v2 and v3) in a female described to have Rett-like syndrome.

Global developmental delay, generalized tonic andtonic–clonic seizure, never acquired independent walking and developed spastictetraplegia in adulthood and limited speech

No functional data
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4418 NAA10 Ain Roesley reviewed gene: NAA10: Rating: GREEN; Mode of pathogenicity: None; Publications: 34075687; Phenotypes: syndromic intellectual disability MONDO:0000508; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4416 PRDM13 Seb Lunke gene: PRDM13 was added
gene: PRDM13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
founder tags were added to gene: PRDM13.
Mode of inheritance for gene: PRDM13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PRDM13 were set to 34730112
Phenotypes for gene: PRDM13 were set to intellectual disability, MONDO:0001071, PRDM13-associated; ataxia with cerebellar hypoplasia
Review for gene: PRDM13 was set to AMBER
Added comment: Recessive disease causing ID and DSD described in three supposedly unrelated families (2 consanguine), but all are from Malta, and all share the same 13bp deletion spanning an exon-intron boundary. Mouse KO is embryonically lethal, and tissue specific KO failed to replicate many of the patients phenotypes, other than hypoplasia of the cerebellar vermis and hemispheres at P21.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4414 RAB23 Zornitza Stark Publications for gene: RAB23 were set to
Intellectual disability syndromic and non-syndromic v0.4411 DPF2 Zornitza Stark Publications for gene: DPF2 were set to
Intellectual disability syndromic and non-syndromic v0.4408 NAA20 Chirag Patel gene: NAA20 was added
gene: NAA20 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NAA20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAA20 were set to PMID: 34230638
Phenotypes for gene: NAA20 were set to Autosomal recessive developmental delay, intellectual disability, and microcephaly
Added comment: 2 consanguineous families with 5 affected individuals with developmental delay, intellectual disability, and microcephaly (-2-4SD). Exome and genome sequencing identified 2 different homozygous variants in NAA20 gene (p.Met54Val and p.Ala80Val), and segregated with affected individuals. N-terminal acetyltransferases modify proteins by adding an acetyl moiety to the first amino acid and are vital for protein and cell function. The NatB complex acetylates 20% of the human proteome and is composed of the catalytic subunit NAA20 and the auxiliary subunit NAA25. Both NAA20-M54V and NAA20-A80V were impaired in their capacity to form a NatB complex with NAA25, and in vitro acetylation assays revealed reduced catalytic activities toward different NatB substrates.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4406 KCNC1 Zornitza Stark Publications for gene: KCNC1 were set to
Intellectual disability syndromic and non-syndromic v0.4404 SGPL1 Seb Lunke Publications for gene: SGPL1 were set to
Intellectual disability syndromic and non-syndromic v0.4401 COX15 Zornitza Stark Publications for gene: COX15 were set to
Intellectual disability syndromic and non-syndromic v0.4398 BRWD3 Zornitza Stark Publications for gene: BRWD3 were set to
Intellectual disability syndromic and non-syndromic v0.4397 BRWD3 Zornitza Stark Mode of inheritance for gene: BRWD3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4396 BRWD3 Zornitza Stark reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: 17668385, 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, MIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4394 ALDH4A1 Zornitza Stark Publications for gene: ALDH4A1 were set to
Intellectual disability syndromic and non-syndromic v0.4391 CSTF2 Zornitza Stark gene: CSTF2 was added
gene: CSTF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSTF2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: CSTF2 were set to 32816001
Phenotypes for gene: CSTF2 were set to Intellectual disability
Review for gene: CSTF2 was set to AMBER
Added comment: Four individuals from a single family, spanning two generations, segregating a missense variant. Functional data, including a mouse model and a gene reporter assay.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4389 FLVCR2 Zornitza Stark Publications for gene: FLVCR2 were set to
Intellectual disability syndromic and non-syndromic v0.4386 VPS53 Zornitza Stark Publications for gene: VPS53 were set to
Intellectual disability syndromic and non-syndromic v0.4383 YY1 Zornitza Stark Publications for gene: YY1 were set to
Intellectual disability syndromic and non-syndromic v0.4379 COL4A3BP Zornitza Stark Publications for gene: COL4A3BP were set to
Intellectual disability syndromic and non-syndromic v0.4376 ZBTB18 Zornitza Stark Publications for gene: ZBTB18 were set to
Intellectual disability syndromic and non-syndromic v0.4373 ZBTB20 Zornitza Stark Publications for gene: ZBTB20 were set to
Intellectual disability syndromic and non-syndromic v0.4370 KCND2 Zornitza Stark gene: KCND2 was added
gene: KCND2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCND2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCND2 were set to 24501278; 16934482; 29581270; 34245260
Phenotypes for gene: KCND2 were set to Neurodevelopmental disorder MONDO:0700092; global developmental delay, HP:0001263; seizure, HP:0001250
Review for gene: KCND2 was set to GREEN
Added comment: 6 new unrelated cases with developmental delay reported in PMID: 34245260 (Zhang et al 2021), 3 of whom had seizures. All had heterozygous missense variants of KCND2 in sites known to be critical for channel gating (E323K, P403A, two individuals, V404L, two individuals and V404M). Functional studies suggest that these missense changes cause both a partial loss-of-function (LOF) and gain-of-function (GOF). The V404 change appears to increase epileptic seizure susceptibility with the 3 patients with a V404 change showing this phenotype.

PMID:24501278 - Lee et al, 2014 - reports pair of monozygotic twin boys with infantile onset severe refractory epilepsy and autism. A de novo heterozygous missense variant was identified by WES - V404M.

PMID: 29581270 - Lin et al, 2018 - performed functional work that shows V404M enhances inactivation of channels that have not yet opened and dramatically impairs the inactivation of channels that have opened.

PMID:16934482 - Singh et al, 2006 - reports a patient with cognative impairment who also went on to have seizures starting from age 13 with a 5 bp deletion in KCND2 leading to premature stop codon. The proband's asymptomatic father also shared this variant.
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4367 CHD8 Zornitza Stark Publications for gene: CHD8 were set to
Intellectual disability syndromic and non-syndromic v0.4364 CCDC22 Zornitza Stark Publications for gene: CCDC22 were set to
Intellectual disability syndromic and non-syndromic v0.4361 ADCY5 Zornitza Stark Publications for gene: ADCY5 were set to 22782511; 24700542; 33051786; 32647899; 33704598
Intellectual disability syndromic and non-syndromic v0.4357 CAMK2A Zornitza Stark Publications for gene: CAMK2A were set to
Intellectual disability syndromic and non-syndromic v0.4353 ASXL2 Zornitza Stark Publications for gene: ASXL2 were set to
Intellectual disability syndromic and non-syndromic v0.4350 ARFGEF2 Zornitza Stark Publications for gene: ARFGEF2 were set to
Intellectual disability syndromic and non-syndromic v0.4347 BLOC1S1 Zornitza Stark gene: BLOC1S1 was added
gene: BLOC1S1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BLOC1S1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BLOC1S1 were set to 33875846
Phenotypes for gene: BLOC1S1 were set to severe intellectual disability; severe global developmental delay; epilepsy
Review for gene: BLOC1S1 was set to GREEN
Added comment: 4 individuals reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4345 CLCN7 Zornitza Stark gene: CLCN7 was added
gene: CLCN7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLCN7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CLCN7 were set to 31155284
Phenotypes for gene: CLCN7 were set to Hypopigmentation, organomegaly, and delayed myelination and development, MIM# 618541
Mode of pathogenicity for gene: CLCN7 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: CLCN7 was set to AMBER
Added comment: Two individuals reported with same missense variant and hypopigmentation, organomegaly, and delayed myelination and development. Variant is GoF. No osteopetrosis, biopsy findings from skin and other organs are consistent with a lysosomal storage disorder. IUGR, prematurity and polyhydramnios are features. Bi-allelic variants in this gene are associated with osteopetrosis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4342 TAF4 Zornitza Stark gene: TAF4 was added
gene: TAF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TAF4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAF4 were set to 33875846; 28191890
Phenotypes for gene: TAF4 were set to Neurodevelopmental disorder
Review for gene: TAF4 was set to AMBER
Added comment: Three individuals reported with de novo LoF variants as part of large cohorts, limited phenotypic information available.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4338 PLK1 Zornitza Stark gene: PLK1 was added
gene: PLK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLK1 were set to 33875846
Phenotypes for gene: PLK1 were set to Epilepsy; microcephaly; intellectual disability
Review for gene: PLK1 was set to GREEN
Added comment: More than 5 individuals reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4337 RAP1GDS1 Zornitza Stark Publications for gene: RAP1GDS1 were set to 32431071
Intellectual disability syndromic and non-syndromic v0.4334 TMEM218 Zornitza Stark gene: TMEM218 was added
gene: TMEM218 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: TMEM218 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM218 were set to 33791682; 25161209
Phenotypes for gene: TMEM218 were set to Joubert syndrome 39, MIM#619562
Review for gene: TMEM218 was set to GREEN
Added comment: 11 cases in 6 families with homozygous or compound heterozygous missense and nonsense (1) variants, with a Joubert/Meckel syndrome phenotype. Clinical features included the molar tooth sign (N=2), occipital encephalocele (N=5, all fetuses), retinal dystrophy (N=4, all living individuals), polycystic kidneys (N=2), and polydactyly (N=2), without liver involvement. A null mouse model had nephronophthisis and retinal degeneration. No OMIM entry.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4333 ATP9A Zornitza Stark Publications for gene: ATP9A were set to http://dx.doi.org/10.1136/jmedgenet-2021-107843
Intellectual disability syndromic and non-syndromic v0.4330 CNKSR2 Zornitza Stark Publications for gene: CNKSR2 were set to
Intellectual disability syndromic and non-syndromic v0.4329 CNKSR2 Zornitza Stark Mode of inheritance for gene: CNKSR2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4328 CNKSR2 Zornitza Stark edited their review of gene: CNKSR2: Changed mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4322 OGDHL Melanie Marty gene: OGDHL was added
gene: OGDHL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: OGDHL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OGDHL were set to PMID: 34800363
Phenotypes for gene: OGDHL were set to Neurodevelopmental disorder featuring epilepsy, hearing loss and visual impairment
Added comment: Nine individuals from eight unrelated families carrying bi-allelic variants in OGDHL with a range of neurological and neurodevelopmental phenotypes including epilepsy, hearing
loss, visual impairment, gait ataxia, microcephaly, and hypoplastic corpus callosum.

Homozygous and compound heterozygous variants reported. Variant types reported include missense, PTCs and a synonymous variant that was shown to affect splicing.

Functional studies with a CRISPR-Cas9-mediated tissue knockout with cDNA rescue system showed that the missense variants result in loss-of-function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4322 FOXR1 Paul De Fazio gene: FOXR1 was added
gene: FOXR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FOXR1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FOXR1 were set to 34723967
Phenotypes for gene: FOXR1 were set to Postnatal microcephaly, progressive brain atrophy and global developmental delay
Mode of pathogenicity for gene: FOXR1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: FOXR1 was set to AMBER
gene: FOXR1 was marked as current diagnostic
Added comment: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype.

In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation).

A mouse knockout has comparable phenotypes, and a severe survival deficit.

Rated amber (1 patient, functional evidence, mouse model).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4322 FOXR2 Paul De Fazio gene: FOXR2 was added
gene: FOXR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FOXR2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FOXR2 were set to 34723967
Phenotypes for gene: FOXR2 were set to Postnatal microcephaly, progressive brain atrophy and global developmental delay
Review for gene: FOXR2 was set to AMBER
gene: FOXR2 was marked as current diagnostic
Added comment: 1 patient described with a de novo missense variant. Phenotypes include: postnatal microcephaly, progressive brain atrophy, skeletal abnormalities, brain abnormalities, ophthalmic abnormalities, neuromuscular abnormalities, and dysmorphic features. A variant in ATP1A3 was considered to have contributed to the final phenotype.

In vitro functional evidence is supportive of pathogenicity (variant causes protein instability and abnormal nuclear aggregation).

A mouse knockout has comparable phenotypes, and a severe survival deficit.

Rated amber (1 patient, functional evidence, mouse model).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4321 RNF125 Zornitza Stark Publications for gene: RNF125 were set to
Intellectual disability syndromic and non-syndromic v0.4318 GTPBP3 Zornitza Stark Publications for gene: GTPBP3 were set to
Intellectual disability syndromic and non-syndromic v0.4315 CWC27 Zornitza Stark Publications for gene: CWC27 were set to
Intellectual disability syndromic and non-syndromic v0.4312 ELAC2 Zornitza Stark Publications for gene: ELAC2 were set to
Intellectual disability syndromic and non-syndromic v0.4309 CUL4B Zornitza Stark Publications for gene: CUL4B were set to
Intellectual disability syndromic and non-syndromic v0.4306 CTNNB1 Zornitza Stark Publications for gene: CTNNB1 were set to
Intellectual disability syndromic and non-syndromic v0.4303 CSNK2A1 Zornitza Stark Publications for gene: CSNK2A1 were set to
Intellectual disability syndromic and non-syndromic v0.4300 MAF Zornitza Stark Publications for gene: MAF were set to
Intellectual disability syndromic and non-syndromic v0.4297 CRB2 Zornitza Stark Publications for gene: CRB2 were set to
Intellectual disability syndromic and non-syndromic v0.4294 COLEC11 Zornitza Stark Publications for gene: COLEC11 were set to
Intellectual disability syndromic and non-syndromic v0.4290 MEIS2 Zornitza Stark Publications for gene: MEIS2 were set to
Intellectual disability syndromic and non-syndromic v0.4286 CNTNAP2 Zornitza Stark Publications for gene: CNTNAP2 were set to
Intellectual disability syndromic and non-syndromic v0.4283 CKAP2L Zornitza Stark Publications for gene: CKAP2L were set to
Intellectual disability syndromic and non-syndromic v0.4280 IL1RAPL1 Zornitza Stark Publications for gene: IL1RAPL1 were set to
Intellectual disability syndromic and non-syndromic v0.4277 CHKB Zornitza Stark Publications for gene: CHKB were set to
Intellectual disability syndromic and non-syndromic v0.4274 CHAMP1 Zornitza Stark Publications for gene: CHAMP1 were set to
Intellectual disability syndromic and non-syndromic v0.4271 CEP290 Zornitza Stark Publications for gene: CEP290 were set to
Intellectual disability syndromic and non-syndromic v0.4268 CENPJ Zornitza Stark Publications for gene: CENPJ were set to
Intellectual disability syndromic and non-syndromic v0.4265 CDKL5 Zornitza Stark Publications for gene: CDKL5 were set to
Intellectual disability syndromic and non-syndromic v0.4264 CDKL5 Zornitza Stark Mode of inheritance for gene: CDKL5 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4263 CDKL5 Zornitza Stark reviewed gene: CDKL5: Rating: GREEN; Mode of pathogenicity: None; Publications: 19793311; Phenotypes: Developmental and epileptic encephalopathy 2, MIM# 300672; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4261 DDX3X Zornitza Stark Publications for gene: DDX3X were set to
Intellectual disability syndromic and non-syndromic v0.4260 DDX3X Zornitza Stark Mode of inheritance for gene: DDX3X was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4260 DDX3X Zornitza Stark Mode of inheritance for gene: DDX3X was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4259 DDX3X Zornitza Stark reviewed gene: DDX3X: Rating: GREEN; Mode of pathogenicity: None; Publications: 30266093, 26235985, 25533962, 33528536, 30936465, 31274575, 30817323; Phenotypes: Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4257 ASXL1 Zornitza Stark Publications for gene: ASXL1 were set to
Intellectual disability syndromic and non-syndromic v0.4255 MYH10 Krithika Murali gene: MYH10 was added
gene: MYH10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list,Literature
Mode of inheritance for gene: MYH10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYH10 were set to 24825879; 24901346; 25356899; 22495309; 25003005
Phenotypes for gene: MYH10 were set to Microcephaly; Intellectual Disability
Review for gene: MYH10 was set to GREEN
Added comment: De novo variants were identified in 5 unrelated individuals with moderate-severe ID and developmental delay.

Other reported phenotypic features include microcephaly (4/5), IUGR/failure to thrive (4/5), cerebral atrophy (3/5), hydrocephalus (2/5), congenital bilateral hip dysplasia (2/5), cerebellar atrophy (1/5), congenital diaphragmatic hernia (1/5), cranial nerve palsy (1/5), nystagmus (1/5), dysplastic kidney (1/5).

Defects in heart development, body wall closure and other birth defects noted in mouse models.
Sources: Expert list, Literature
Intellectual disability syndromic and non-syndromic v0.4254 CSF1R Zornitza Stark gene: CSF1R was added
gene: CSF1R was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSF1R was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSF1R were set to 30982609; 33749994; 34135456
Phenotypes for gene: CSF1R were set to Brain abnormalities, neurodegeneration, and dysosteosclerosis, MIM# 618476; BANDDOS
Review for gene: CSF1R was set to AMBER
Added comment: Brain abnormalities, neurodegeneration, and dysosteosclerosis (BANDDOS) is an autosomal recessive disorder characterized by brain abnormalities, progressive neurologic deterioration, and sclerotic bone dysplasia similar to dysosteosclerosis (DOS). The age at onset is highly variable: some patients may present in infancy with hydrocephalus, global developmental delay, and hypotonia, whereas others may have onset of symptoms in the late teens or early twenties after normal development. Neurologic features include loss of previous motor and language skills, cognitive impairment, spasticity, and focal seizures. Brain imaging shows periventricular white matter abnormalities and calcifications, large cisterna magna or Dandy-Walker malformation, and sometimes agenesis of the corpus callosum.

Four unrelated families reported.

Note mono-allelic variants cause an adult-onset disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4252 RNPC3 Zornitza Stark gene: RNPC3 was added
gene: RNPC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNPC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNPC3 were set to 29866761; 32462814; 33650182
Phenotypes for gene: RNPC3 were set to Growth hormone deficiency; Intellectual disability
Review for gene: RNPC3 was set to AMBER
Added comment: Three families reported, ID in two.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4250 KCNQ2 Zornitza Stark Publications for gene: KCNQ2 were set to
Intellectual disability syndromic and non-syndromic v0.4247 OTUD7A Zornitza Stark Publications for gene: OTUD7A were set to PMID: 31997314; 29395075; 29395074
Intellectual disability syndromic and non-syndromic v0.4244 NUP85 Zornitza Stark gene: NUP85 was added
gene: NUP85 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NUP85 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NUP85 were set to 34170319; 30179222
Phenotypes for gene: NUP85 were set to Intellectual disability
Review for gene: NUP85 was set to AMBER
Added comment: Bi-allelic variants in this gene are associated with nephrotic syndrome in 3 families.

Phenotype expansion:

PMID: 34170319 - Ravindran et al 2021 report two pedigrees with an MCPH-SCKS phenotype spectrum without SRNS. In the first family, a 9 yo female, with consanguineous parents, is reported to have a missense variant in NUP85 (c.932G > A; p.R311Q). Intrauterine growth restriction was noticed. At birth microcephaly was observed (OFC < 3rd centile, < −3.6 SD) as well as hypotrophy [weight −2.8 SD), length 45 cm (−2.7 SD), both <3rd centile], facial dysmorphism, syndactyly, long and thin fingers, and bilateral pes adductus. She has severe developmental delay with strongly delayed motor milestones and absent speech. Drug-resistant, genetic epilepsy with focal-onset seizures started in the first year of life. She had no clinical, laboratory or radiological findings indicative of kidney dysfunction. In the second family, compound heterozygous missense variants in NUP85 were detected (c.1109A > G, c.1589 T > C;p.N370S, p.M530T ) in a fetus. MRI of the fetal brain at 24 + 2 GW indicated complete agenesis of the corpus callosum, abnormal sulcation in the left frontal lobe, nodularity of the frontal horn and trigone with focal puckering of the left lateral ventricle.

PMID: 30179222 - Braun et al 2018 - 2 individuals from 1 of the families reported with steroid-resistant nephrotic syndrome were also reported to have intellectual disability but showed no structural brain defects. The degree of intellectual disability is not stated. They were found to have 2 compound heterozygous alleles (c.405+1G>A and c.1741G>C, p.Ala581Pro) in NUP85.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4242 ALG1 Zornitza Stark Publications for gene: ALG1 were set to
Intellectual disability syndromic and non-syndromic v0.4240 STT3A Zornitza Stark Publications for gene: STT3A were set to PMID: 23842455; 30701557; 28424003
Intellectual disability syndromic and non-syndromic v0.4234 KIAA0391 Lucy Spencer gene: KIAA0391 was added
gene: KIAA0391 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KIAA0391 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIAA0391 were set to PMID: 34715011
Phenotypes for gene: KIAA0391 were set to Hearing loss, intellectual disability
Review for gene: KIAA0391 was set to RED
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4233 SPRED2 Dean Phelan gene: SPRED2 was added
gene: SPRED2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPRED2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPRED2 were set to PMID: 34626534
Phenotypes for gene: SPRED2 were set to developmental delay; intellectual disability; cardiac defects; short stature; skeletal anomalies; a typical facial gestalt
Review for gene: SPRED2 was set to GREEN
Added comment: PMID: 34626534
Homozygosity for three different variants c.187C>T (p.Arg63∗), c.299T>C (p.Leu100Pro), and c.1142_1143delTT (p.Leu381Hisfs∗95) were identified in four subjects from three families. All variants severely affected protein stability, causing accelerated degradation, and variably perturbed SPRED2 functional behaviour. The clinical phenotype of the four affected individuals included developmental delay, intellectual disability, cardiac defects, short stature, skeletal anomalies, and a typical facial gestalt as major features, without the occurrence of the distinctive skin signs characterizing Legius syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4233 SPATA5L1 Paul De Fazio changed review comment from: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly.

In 25 patients for whom full phenotype datasets were available, all 25 had ID.
Sources: Literature; to: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly.

~53% of patients had ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4233 SPATA5L1 Paul De Fazio gene: SPATA5L1 was added
gene: SPATA5L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPATA5L1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPATA5L1 were set to 34626583
Phenotypes for gene: SPATA5L1 were set to Intellectual disability; spastic-dystonic cerebral palsy; epilepsy; hearing loss
Review for gene: SPATA5L1 was set to GREEN
gene: SPATA5L1 was marked as current diagnostic
Added comment: 47 individuals from 26 unrelated families from various ethnicities with biallelic variants reported. Phenotypes include ID, hearing impairment, movement disorder, abnormal MRI, hypotonia, visual impairment, epilepsy, and microcephaly.

In 25 patients for whom full phenotype datasets were available, all 25 had ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4232 PHF6 Zornitza Stark Publications for gene: PHF6 were set to
Intellectual disability syndromic and non-syndromic v0.4228 AHDC1 Zornitza Stark Publications for gene: AHDC1 were set to
Intellectual disability syndromic and non-syndromic v0.4225 ACY1 Zornitza Stark Publications for gene: ACY1 were set to
Intellectual disability syndromic and non-syndromic v0.4221 ETHE1 Zornitza Stark Publications for gene: ETHE1 were set to
Intellectual disability syndromic and non-syndromic v0.4214 ZNHIT3 Zornitza Stark gene: ZNHIT3 was added
gene: ZNHIT3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNHIT3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNHIT3 were set to 28335020; 28335020; 31048081
Phenotypes for gene: ZNHIT3 were set to PEHO syndrome, MIM# 260565
Review for gene: ZNHIT3 was set to GREEN
Added comment: PEHO is a severe autosomal recessive neurodevelopmental disorder characterized by extreme cerebellar atrophy due to almost total loss of granule neurons. Affected individuals present in early infancy with hypotonia, profoundly delayed psychomotor development, optic atrophy, progressive atrophy of the cerebellum and brainstem, and dysmyelination. Most patients also develop infantile seizures that are often associated with hypsarrhythmia on EEG, and many have peripheral oedema. More than 20 affected individuals reported of Finnish origin, p.Ser31Leu is a founder variant. One compound het reported and supportive animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4213 KIAA0556 Paul De Fazio gene: KIAA0556 was added
gene: KIAA0556 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KIAA0556 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIAA0556 were set to 26714646; 27245168
Phenotypes for gene: KIAA0556 were set to Joubert syndrome 26, MIM# 616784
Review for gene: KIAA0556 was set to GREEN
gene: KIAA0556 was marked as current diagnostic
Added comment: 5 individuals from two families reported, supportive mouse model. Individuals were reported to have (global) developmental delay.

New HGNC approved name is KATNIP.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4212 FGF12 Zornitza Stark Publications for gene: FGF12 were set to
Intellectual disability syndromic and non-syndromic v0.4207 NDUFA8 Krithika Murali gene: NDUFA8 was added
gene: NDUFA8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NDUFA8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA8 were set to 32385911; 33153867
Phenotypes for gene: NDUFA8 were set to Mitochondrial complex I deficiency, nuclear type 37- 619272; Epilepsy; Microcephaly; Developmental Delay
Review for gene: NDUFA8 was set to AMBER
Added comment: 3 individuals from 2 unrelated families reported with phenotypic features including microcephaly (1/3), seizures (2/3), developmental delay (3/3) and MRI-B changes (3/3).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4206 MAGEL2 Zornitza Stark Publications for gene: MAGEL2 were set to
Intellectual disability syndromic and non-syndromic v0.4203 NSRP1 Krithika Murali gene: NSRP1 was added
gene: NSRP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSRP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NSRP1 were set to 34385670
Phenotypes for gene: NSRP1 were set to Epilepsy; Cerebral palsy; microcephaly; Intellectual disability
Review for gene: NSRP1 was set to AMBER
Added comment: Novel gene regulating splicing. Biallelic LoF pathogenic variants reported in 6 individuals from 3 unrelated families associated with a phenotype characterized by developmental delay, epilepsy, microcephaly, and spastic cerebral palsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4202 GABRD Zornitza Stark gene: GABRD was added
gene: GABRD was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GABRD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABRD were set to 15115768; 34633442
Phenotypes for gene: GABRD were set to Intellectual disability; Epilepsy; Susceptibility to epilepsy, MIM#613060
Review for gene: GABRD was set to GREEN
Added comment: Susceptibility to epilepsy, MIM#613060: Limited reports. The variant originally reported in PMID 15115768 in association with epilepsy is present in >4,000 hets in gnomad and 55 homs which is not consistent with a Mendelian disorder.

PMID 34633442: 10 individuals with 7 unique variants reported in individuals with neurodevelopmental disorders and epilepsy. Six of the variants were demonstrated to be GoF, and those individuals with neurodevelopmental disorders with behavioural issues, various degrees of intellectual disability, generalized epilepsy with atypical absences and generalized myoclonic and/or bilateral tonic-clonic seizures. In contrast, the one individual carrying a loss-of-function variant had normal intelligence, no seizure history but has a diagnosis of autism spectrum disorder and suffering from elevated internalizing psychiatric symptoms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4199 KCTD3 Zornitza Stark Publications for gene: KCTD3 were set to
Intellectual disability syndromic and non-syndromic v0.4195 TARS2 Krithika Murali gene: TARS2 was added
gene: TARS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TARS2 were set to 33153448; 24827421; 34508595
Phenotypes for gene: TARS2 were set to Combined oxidative phosphorylation deficiency 21 - 615918; Epilepsy; Developmental Delay
Review for gene: TARS2 was set to GREEN
Added comment: 8 cases from 7 unrelated families are reported in the literature with a heterogenous phenotype characterised by either early-onset illness within the first months, of severe hypotonia, failure to thrive, epilepsy and early death, or onset after six months with a milder course and longer survival. Other phenotypic features include developmental delay (at least 3 out of 8 cases), MRI-B abnormalities and more rarely dystonia, regression, hyperhidrosis and hearing impairment.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4194 THG1L Krithika Murali gene: THG1L was added
gene: THG1L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: THG1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: THG1L were set to 33682303
Phenotypes for gene: THG1L were set to Spinocerebellar ataxia, autosomal recessive 28 - 618800; Epilepsy; Intellectual Disability
Review for gene: THG1L was set to AMBER
Added comment: 3 individuals from 2 unrelated families of Ashkenazi Jewish descent with compound heterozygous variants ( p.Cys51Trp and p.Val55Ala) presented with profound developmental delays, microcephaly, intractable epilepsy, and cerebellar hypoplasia.

Homozygous variants associated with ataxia phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4192 CACNA1C Zornitza Stark Publications for gene: CACNA1C were set to
Intellectual disability syndromic and non-syndromic v0.4189 SHANK1 Zornitza Stark Publications for gene: SHANK1 were set to 22503632; 25188300
Intellectual disability syndromic and non-syndromic v0.4184 PLXNA1 Chirag Patel gene: PLXNA1 was added
gene: PLXNA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLXNA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: PLXNA1 were set to PMID: 34054129
Phenotypes for gene: PLXNA1 were set to Neurodevelopmental disorder with cerebral and eye anomalies
Review for gene: PLXNA1 was set to GREEN
Added comment: Dworschak et al. (2021) via WES reported 10 patients from 7 families with biallelic (n=7) or de novo (n=3) PLXNA1 variants. Shared phenotypic features include global developmental delay (9/10), brain anomalies (6/10), and eye anomalies (7/10). Seizures were predominantly reported in patients with monoallelic variants. Zebrafish studies showed an embryonic role of plxna1a in the development of the central nervous system and the eye. Biallelic variants in the extracellular Plexin-A1 domains lead to impaired dimerization or lack of receptor molecules, whereas monoallelic variants in the intracellular Plexin-A1 domains might impair downstream signaling through a dominant-negative effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4183 HNRNPD Zornitza Stark Publications for gene: HNRNPD were set to 33057194
Intellectual disability syndromic and non-syndromic v0.4180 BPTF Zornitza Stark Publications for gene: BPTF were set to 28942966; 33522091
Intellectual disability syndromic and non-syndromic v0.4180 BPTF Zornitza Stark Publications for gene: BPTF were set to 28942966
Intellectual disability syndromic and non-syndromic v0.4178 BCL11A Zornitza Stark Publications for gene: BCL11A were set to
Intellectual disability syndromic and non-syndromic v0.4176 SNIP1 Zornitza Stark Publications for gene: SNIP1 were set to 22279524
Intellectual disability syndromic and non-syndromic v0.4173 LONP1 Zornitza Stark Publications for gene: LONP1 were set to
Intellectual disability syndromic and non-syndromic v0.4171 WIPI2 Zornitza Stark Phenotypes for gene: WIPI2 were changed from Intellectual developmental disorder with short stature and variable skeletal anomalies 618453 to Intellectual developmental disorder with short stature and variable skeletal anomalies 618453; global developmental delay; intellectual disability; refractory infantile/childhood-onset epilepsy; progressive tetraplegia with joint contractures; dyskinesia; speech and visual impairment; autistic features; ataxic gait
Intellectual disability syndromic and non-syndromic v0.4171 WIPI2 Zornitza Stark Publications for gene: WIPI2 were set to 30968111
Intellectual disability syndromic and non-syndromic v0.4168 ZDHHC15 Zornitza Stark Publications for gene: ZDHHC15 were set to
Intellectual disability syndromic and non-syndromic v0.4164 WIPI2 Dean Phelan reviewed gene: WIPI2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30968111, 34557665; Phenotypes: global developmental delay, intellectual disability, refractory infantile/childhood-onset epilepsy, progressive tetraplegia with joint contractures, dyskinesia, speech and visual impairment, autistic features, ataxic gait; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.4163 ABHD16A Lucy Spencer gene: ABHD16A was added
gene: ABHD16A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABHD16A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ABHD16A were set to PMID: 34587489
Phenotypes for gene: ABHD16A were set to Spastic paraplegia
Added comment: 11 individuals from 6 families with a complicated form of hereditary spastic paraplegia who carry bi-allelic deleterious variants in ABHD16A. Affected individuals present with a similar phenotype consisting of global developmental delay/intellectual disability, progressive spasticity affecting the upper and lower limbs, and corpus callosum and white matter anomalies. Immunoblot analysis on extracts from fibroblasts from four affected individuals demonstrated little to no ABHD16A protein levels compared to controls.
In 5 of the families the affected members were homozygous, 3 of these families were consanguineous. 2 families have the same variant- both families are French-Canadian.
4 missense variants, 1 frameshift, 1 nonsense.
From PMID: 34587489
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4162 ATP11A Elena Savva gene: ATP11A was added
gene: ATP11A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ATP11A were set to PMID: 34403372
Phenotypes for gene: ATP11A were set to Neurological disorder
Mode of pathogenicity for gene: ATP11A was set to Other
Review for gene: ATP11A was set to AMBER
Added comment: PMID: 34403372:
- Single de novo missense variant reported in a patient with developmental delay and neurological deterioration.
- Patient MRI showed severe cerebral atrophy, ventriculomegaly, hypomyelination leukodystrophy, thinned corpus callosum. Axonal neuropathy suggested.
- K/I heterozygous mice died perinatally.
- Functional studies on missense variant show plasma membrane lipid content impairment, reduced ATPase activity etc.

gnomAD: some NMD PTCs present, good quality variants found with 4-5 hets.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4162 ERBB4 Ain Roesley gene: ERBB4 was added
gene: ERBB4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ERBB4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ERBB4 were set to 33603162
Penetrance for gene: ERBB4 were set to unknown
Review for gene: ERBB4 was set to GREEN
Added comment: CNVs reported only
exonic deletions:
3x families with ID, speech delays, aggressive outbursts (including 1x de novo)
1x family with global dev delay inherited from unaffected parent

exonic del with limited clinical info:
1x severe expressive language delay
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4161 SARS Bryony Thompson gene: SARS was added
gene: SARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SARS were set to 28236339; 34570399
Phenotypes for gene: SARS were set to Intellectual disability
Review for gene: SARS was set to AMBER
Added comment: Summary - 2 unrelated families with overlapping ID phenotype, and supporting in vitro and patient cell assays.
PMID: 28236339 - an Iranian family (distantly related) segregating a homozygous missense (c.514G>A, p.Asp172Asn) with moderate ID, microcephaly, ataxia, speech impairment, and aggressive behaviour. Also, supporting in vitro functional assays demonstrating altered protein function.
PMID: 34570399 - a consanguineous Turkish family segregating a homozygous missense (c.638G>T, p.(Arg213Leu)) with developmental delay, central deafness, cardiomyopathy, and metabolic decompensation during fever leading to death. Also, reduced protein level and enzymatic activity in patient cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4158 RNF113A Zornitza Stark Publications for gene: RNF113A were set to PMID: 25612912; 31793730
Intellectual disability syndromic and non-syndromic v0.4156 RNF113A Zornitza Stark Mode of inheritance for gene: RNF113A was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4155 EIF3F Zornitza Stark Publications for gene: EIF3F were set to 30409806
Intellectual disability syndromic and non-syndromic v0.4153 CDH15 Zornitza Stark Publications for gene: CDH15 were set to
Intellectual disability syndromic and non-syndromic v0.4150 CPE Zornitza Stark Publications for gene: CPE were set to 26120850; 32936766
Intellectual disability syndromic and non-syndromic v0.4147 HCFC1 Zornitza Stark Publications for gene: HCFC1 were set to
Intellectual disability syndromic and non-syndromic v0.4144 CSTB Zornitza Stark Publications for gene: CSTB were set to
Intellectual disability syndromic and non-syndromic v0.4140 ATP6V0C Zornitza Stark gene: ATP6V0C was added
gene: ATP6V0C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: ATP6V0C.
Mode of inheritance for gene: ATP6V0C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V0C were set to 33190975; 33090716
Phenotypes for gene: ATP6V0C were set to Epilepsy; Intellectual Disability; microcephaly
Review for gene: ATP6V0C was set to AMBER
Added comment: 9 individuals reported with deletions and ID/seizures/microcephaly, minimum overlapping region implicates ATP6V0C as the causative gene. Single case report of de novo SNV and ID/seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4138 ARFGEF1 Zornitza Stark gene: ARFGEF1 was added
gene: ARFGEF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARFGEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARFGEF1 were set to 34113008
Phenotypes for gene: ARFGEF1 were set to Intellectual disability; Epilepsy
Review for gene: ARFGEF1 was set to GREEN
Added comment: 13 individuals reported with variants in this gene and a neurodevelopmental disorder characterised by variable ID, seizures present in around half. Variants were inherited from mildly affected parents in 40% of families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4135 ZC4H2 Zornitza Stark Publications for gene: ZC4H2 were set to
Intellectual disability syndromic and non-syndromic v0.4134 ZC4H2 Zornitza Stark Mode of inheritance for gene: ZC4H2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4133 ZC4H2 Zornitza Stark reviewed gene: ZC4H2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23623388, 34322088, 33949289, 31885220, 31206972; Phenotypes: Wieacker-Wolff syndrome, MIM# 314580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4133 KIF4A Zornitza Stark Publications for gene: KIF4A were set to 24812067; 34346154
Intellectual disability syndromic and non-syndromic v0.4133 KIF4A Zornitza Stark Publications for gene: KIF4A were set to 24812067
Intellectual disability syndromic and non-syndromic v0.4130 FAM149B1 Michelle Torres gene: FAM149B1 was added
gene: FAM149B1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FAM149B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM149B1 were set to 30905400
Phenotypes for gene: FAM149B1 were set to Joubert; Ciliopathy
Review for gene: FAM149B1 was set to GREEN
gene: FAM149B1 was marked as current diagnostic
Added comment: Four unrelated, but consanguineous, families reported with 2 truncating variants. Developmental delay with hypotonia and intellectual disability are typical features, and many children have characteristic facies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4128 BCAP31 Zornitza Stark Publications for gene: BCAP31 were set to
Intellectual disability syndromic and non-syndromic v0.4125 AMPD2 Zornitza Stark Publications for gene: AMPD2 were set to
Intellectual disability syndromic and non-syndromic v0.4122 DDX23 Zornitza Stark Publications for gene: DDX23 were set to 33057194
Intellectual disability syndromic and non-syndromic v0.4121 TAF2 Zornitza Stark Publications for gene: TAF2 were set to 21937992; 22633631; 26350204
Intellectual disability syndromic and non-syndromic v0.4119 HMGB1 Chirag Patel gene: HMGB1 was added
gene: HMGB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HMGB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HMGB1 were set to PMID: 34164801
Phenotypes for gene: HMGB1 were set to Developmental delay and microcephaly, no OMIM #
Review for gene: HMGB1 was set to GREEN
Added comment: 13q12.3 microdeletion syndrome is a rare cause of syndromic ID. Previous studies identified four genes within the ~300 Kb minimal critical region including two candidate protein coding genes: KATNAL1 and HMGB1. Uguen et al. (2021) report 6 patients with LOF variants involving HMGB1 with features similar to 13q12.3 microdeletion syndrome (i.e. developmental delay, language delay, microcephaly, obesity and dysmorphic features). In silico analyses suggest that HMGB1 is likely to be intolerant to LOF, and previous in vitro data are in line with the role of HMGB1 in neurodevelopment. They suggest that haploinsufficiency of the HMGB1 gene may play a critical role in the pathogenesis of the 13q12.3 microdeletion syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4114 MTRR Zornitza Stark Publications for gene: MTRR were set to
Intellectual disability syndromic and non-syndromic v0.4111 MTR Zornitza Stark Publications for gene: MTR were set to
Intellectual disability syndromic and non-syndromic v0.4108 UMPS Zornitza Stark Publications for gene: UMPS were set to
Intellectual disability syndromic and non-syndromic v0.4104 PRICKLE2 Hazel Phillimore gene: PRICKLE2 was added
gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRICKLE2 were set to PMID: 34092786
Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms
Review for gene: PRICKLE2 was set to GREEN
Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease.

Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)).

Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4104 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4102 COPB2 Belinda Chong gene: COPB2 was added
gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COPB2 were set to PMID: 34450031
Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay
Review for gene: COPB2 was set to AMBER
Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis

3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4102 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4101 GRIK2 Zornitza Stark Publications for gene: GRIK2 were set to
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4097 ARF1 Zornitza Stark gene: ARF1 was added
gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF1 were set to 28868155; 34353862
Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185
Review for gene: ARF1 was set to GREEN
Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4093 CHRM1 Bryony Thompson gene: CHRM1 was added
gene: CHRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218
Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism
Review for gene: CHRM1 was set to AMBER
Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways.
PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu)
PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4090 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4084 WDR11 Zornitza Stark Publications for gene: WDR11 were set to
Intellectual disability syndromic and non-syndromic v0.4080 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Intellectual disability syndromic and non-syndromic v0.4077 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Intellectual disability syndromic and non-syndromic v0.4074 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Intellectual disability syndromic and non-syndromic v0.4070 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4068 NIPBL Zornitza Stark Publications for gene: NIPBL were set to
Intellectual disability syndromic and non-syndromic v0.4065 IGF1 Zornitza Stark Publications for gene: IGF1 were set to
Intellectual disability syndromic and non-syndromic v0.4062 TCN2 Zornitza Stark Publications for gene: TCN2 were set to
Intellectual disability syndromic and non-syndromic v0.4059 RNF220 Konstantinos Varvagiannis changed review comment from: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.
Sources: Literature, Other; to: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.

Consider inclusion in panels for leukodystrophies, childhood onset ataxia, sensorineural hearing loss, corpus callosum anomalies, cardiomyopathies, hepatopathies, etc in all cases with green rating.

Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4059 RNF220 Konstantinos Varvagiannis gene: RNF220 was added
gene: RNF220 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Penetrance for gene: RNF220 were set to Complete
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.
Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4058 ARF3 Konstantinos Varvagiannis gene: ARF3 was added
gene: ARF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ARF3 were set to 34346499
Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Penetrance for gene: ARF3 were set to unknown
Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality.

Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu.

Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both.

ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively.

Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons.

There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185).

In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val).

This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia.

Evidence to support the effect of each variant include:

Arg99Leu:
Had identical Golgi localization to that of wt
Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF)
In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF).
In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu)

Asp67Val:
Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant)
Displayed decreased protein stability
In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF)
In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye.

There is no associated phenotype in OMIM, G2P or SysID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4057 CEP57 Zornitza Stark Publications for gene: CEP57 were set to
Intellectual disability syndromic and non-syndromic v0.4053 PLXNA2 Konstantinos Varvagiannis gene: PLXNA2 was added
gene: PLXNA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLXNA2 were set to 34327814
Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology
Penetrance for gene: PLXNA2 were set to Incomplete
Review for gene: PLXNA2 was set to AMBER
Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants.

The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members.

Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)).

Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed).

The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed).

Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved.

Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele.

As the authors discuss:
*PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration.
*Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch.
*Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD.
*Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus.

Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg:
- Cyanotic heart disease explaining discordance in cognitive outcome among sibs
- Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or
- Additional pathogenic variants possibly explaining the CHD in the first subject.

There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes.
Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4053 HNMT Zornitza Stark Publications for gene: HNMT were set to 26206890; 30744146
Intellectual disability syndromic and non-syndromic v0.4051 VPS50 Konstantinos Varvagiannis gene: VPS50 was added
gene: VPS50 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Penetrance for gene: VPS50 were set to Complete
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.

Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4050 ROGDI Zornitza Stark Publications for gene: ROGDI were set to
Intellectual disability syndromic and non-syndromic v0.4045 TCF7L2 Zornitza Stark Publications for gene: TCF7L2 were set to 33057194
Intellectual disability syndromic and non-syndromic v0.4041 JAKMIP1 Seb Lunke gene: JAKMIP1 was added
gene: JAKMIP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: JAKMIP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: JAKMIP1 were set to 29158550; 26627310; 27799067
Phenotypes for gene: JAKMIP1 were set to Intellectual disability; Seizures
Review for gene: JAKMIP1 was set to AMBER
Added comment: Identified in two independent patients in the literature with a mouse model. Patient 1 (27799067) with developmental delay, speech delay, and cognitive impairment; self-injurious and aggressive behaviour, seizures, dysmorphic features. De-novo missense JAKMIP1 (p.D586H). Patient 2 (29158550) with feeding difficulties, hypotonia, epilepsy, severe ID, no active speech, kyphoscoliosis, constipation, autism, short stature. Splice variant c.1432-2A>G, no segregation or RNA data available. KO mouse model (27799067) displays social deficits, stereotyped activity, abnormal postnatal vocalizations, and other autistic-like behaviors.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4040 PIDD1 Konstantinos Varvagiannis gene: PIDD1 was added
gene: PIDD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIDD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIDD1 were set to 28397838; 29302074; 33414379; 34163010
Phenotypes for gene: PIDD1 were set to Global developmental delay; Intellectual disability; Seizures; Autism; Behavioral abnormality; Psychosis; Pachygyria; Lissencephaly; Abnormality of the corpus callosum
Penetrance for gene: PIDD1 were set to Complete
Review for gene: PIDD1 was set to GREEN
Added comment: There is enough evidence to include this gene in the current panel with green rating.

Biallelic PIDD1 pathogenic variants have been reported in 26 individuals (11 families) with DD (all), variable degrees of ID (mild to severe), behavioral (eg. aggression/self-mutilation in several, ADHD) and/or psychiatric abnormalities (ASD, psychosis in 5 belonging to 3 families), well-controlled epilepsy is some (9 subjects from 6 families) and MRI abnormalities notably abnormal gyration pattern (pachygyria with predominant anterior gradient) as well as corpus callosum anomalies (commonly thinning) in several. Dysmorphic features have been reported in almost all, although there has been no specific feature suggested.

The first reports on the phenotype associated with biallelic PIDD1 mutations were made by Harripaul et al (2018 - PMID: 28397838) and Hu et al (2019 - PMID: 29302074) [both studies investigating large cohorts of individuals with ID from consanguineous families].

Sheikh et al (2021 - PMID: 33414379) provided details on the phenotype of 15 individuals from 5 families including those from the previous 2 reports and studied provided evidence on the role of PIDD1 and the effect of variants.

Zaki et al (2021 - PMID: 34163010) reported 11 additional individuals from 6 consanguineous families, summarize the features of all subjects published in the literature and review the neuroradiological features of the disorder.

PIDD1 encodes p53-induced death domain protein 1. The protein is part of the PIDDosome, a multiprotein complex also composed of the bipartite linker protein CRADD (also known as RAIDD) and the proform of caspase-2 and induces apoptosis in response to DNA damage.

There are 5 potential PIDD1 mRNA transcript variants with NM_145886.4 corresponding to the longest. Similar to the protein encoded by CRADD, PIDD1 contains a death domain (DD - aa 774-893). Constitutive post-translational processing gives PIDD1-N, PIDD1-C the latter further processed into PIDD1-CC (by auto-cleavage). Serine residues at pos. 446 and 588 are involved in this autoprocessing generating PIDD1-C (aa 446-910) and PIDD1-CC (aa 774-893). The latter is needed for caspase-2 activation.

Most (if not all) individuals belonged to consanguineous families of different origins and harbored pLoF or missense variants.

Variants reported so far include : c.2587C>T; p.Gln863* / c.1909C>T ; p.Arg637* / c.2443C>T / p.Arg815Trp / c.2275-1G>A which upon trap assay was shown to lead to skipping of ex15 with direct splicing form exon14 to the terminal exon 16 (resulting to p.Arg759Glyfs*1 with exlcusion of the entire DD) / c.2584C>T; p.Arg862Trp / c.1340G>A; p.Trp447* / c.2116_2120del; p.Val706His*, c.1564_1565del; p.Gly602fs*26

Evidence so far provided includes:
- Biallelic CRADD variants cause a NDD disorder and a highly similar gyration pattern.
- Confirmation of splicing effect (eg. for c.2275-1G>A premature stop in position 760) or poor expression (NM_145886.3:c.2587C>T; p.Gln863*). Arg815Trp did not affect autoprocessing or protein stability.
- Abnormal localization pattern, loss of interaction with CRADD and failure to activate caspase-2 (MDM2 cleavage assay) [p.Gln863* and Arg815Trp]
- Available expression data from GTEx (PIDD1 having broad expression in multiple tissues, but higher in brain cerebellum) as well as BrainSpan and PsychEncode studies suggesting high coexpression of PIDD1, CRADD and CASP2 in many regions in the developing human brain.
- Variants in other genes encoding proteins interacting with PIDD1 (MADD, FADD, DNAJ, etc) are associated with NDD.

Pidd-1 ko mice (ex3-15 removal) lack however CNS-related phenotypes. These show decreased anxiety but no motor anomalies. This has also been the case with Cradd-/- mice displaying no significant CNS phenotypes without lamination defects.

There is currently no associated phenotype in OMIM, PanelApp Australia. PIDD1 is listed in the DD panel of G2P (PIDD1-related NDD / biallelic / loss of function / probable) . SysID includes PIDD1 among the current primary ID genes.

Overall the gene appears to be relevant for the epilepsy panel, panels for gyration and/or corpus callosum anomalies etc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4039 SHOC2 Zornitza Stark Publications for gene: SHOC2 were set to
Intellectual disability syndromic and non-syndromic v0.4035 UBR1 Zornitza Stark Publications for gene: UBR1 were set to
Intellectual disability syndromic and non-syndromic v0.4032 SNRPB Zornitza Stark Publications for gene: SNRPB were set to
Intellectual disability syndromic and non-syndromic v0.4028 MAST3 Zornitza Stark gene: MAST3 was added
gene: MAST3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAST3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAST3 were set to 34185323
Phenotypes for gene: MAST3 were set to Developmental and epileptic encephalopathy
Review for gene: MAST3 was set to GREEN
Added comment: Eleven individuals reported with de novo missense variants in the STK domain, including two recurrent variants p.G510S (n = 5) and p.G515S (n = 3). All 11 individuals had developmental and epileptic encephalopathy, with 8 having normal development prior to seizure onset at <2 years of age. All patients developed multiple seizure types, 9 of 11 patients had seizures triggered by fever and 9 of 11 patients had drug-resistant seizures. Limited functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4023 AP1G1 Zornitza Stark gene: AP1G1 was added
gene: AP1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AP1G1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: AP1G1 were set to 34102099
Phenotypes for gene: AP1G1 were set to Neurodevelopmental disorder (NDD); Intellectual Disability; Epilepsy
Review for gene: AP1G1 was set to GREEN
Added comment: Two bi-allelic homozygous missense variants were found in two distinct families with Italian and Pakistani origins; homozygous missense variants.

Eight de novo heterozygous variants were identified in nine isolated affected individuals from nine families; including five missense, two frameshift, and one intronic variant that disrupts the canonical splice acceptor site.

Knocking out AP1G1 Zebrafish model resulted in severe developmental abnormalities and increased lethality.

All individuals had neurodevelopmental disorder (NDD) including global developmental delay and ID, which varied in severity from mild to severe.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4020 CLCN3 Zornitza Stark gene: CLCN3 was added
gene: CLCN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLCN3 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: CLCN3 were set to 34186028
Phenotypes for gene: CLCN3 were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CLCN3 was set to Other
Review for gene: CLCN3 was set to GREEN
Added comment: 11 individuals reported, 9 that carried 8 different rare heterozygous missense variants in CLCN3, and 2 siblings that were homozygous for an NMD-predicted frameshift variant likely abolishing ClC-3 function. All missense variants were confirmed to be de novo in eight individuals for whom parental data was available.

The 11 individuals in the cohort share clinical features of variable severity. All 11 have GDD or ID and dysmorphic features, and a majority has mood or behavioural disorders and structural brain abnormalities:
- Structural brain abnormalities on MRI (9/11) included partial or full agenesis of the corpus callosum (6/9), disorganized cerebellar folia (4/9), delayed myelination (3/9), decreased white matter volume (3/9), pons hypoplasia (3/9), and dysmorphic dentate nuclei (3/9). Six of those with brain abnormalities also presented with seizures.
- Nine have abnormal vision, including strabismus in four and inability to fix or follow in the two with homozygous loss-of-function variants.
- Hypotonia ranging from mild to severe was reported in 7 of the 11 individuals.
- Six have mood or behavioural disorders, particularly anxiety (3/6).
- Consistent dysmorphic facial features included microcephaly, prominent forehead, hypertelorism, down-slanting palpebral fissures, full cheeks, and micrognathia.

The severity of disease in the two siblings with homozygous disruption of ClC-3 is consistent with the drastic phenotype seen in Clcn3 KO mice. The disease was more severe in two siblings carrying homozygous loss-of-function variants with the presence of GDD, absent speech, seizures, and salt and pepper fundal pigmentation in both individuals, with one deceased at 14 months of age. The siblings also had significant neuroanatomical findings including diffusely decreased white matter volume, thin corpora callosa, small hippocampi, and disorganized cerebellar folia. Supporting biallelic inheritance for LoF variants, disruption of mouse Clcn3 results in drastic neurodegeneration with loss of the hippocampus a few months after birth and early retinal degeneration. Clcn3−/− mice display severe neurodegeneration, whereas heterozygous Clcn3+/− mice appear normal.

Patch-clamp studies were used to investigate four of the missense variants. These suggested a gain of function in two variants with increased current in HEK cells, however they also showed reduced rectification of voltage and a loss of transient current, plus decreased current amplitude, glycosylation and surface expression when expressed in oocytes, and were suspected to interfere with channel gating and a negative feedback mechanism. These effects were also shown to vary depending on pH levels. The current of the remaining two variants did not differ from WT. For heterozygous missense variants, the disruption induced may be at least partially conferred to mutant/WT homodimers and mutant/ClC-4 heterodimers.

Both loss and gain of function in this gene resulted in the same phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4017 TNPO2 Elena Savva gene: TNPO2 was added
gene: TNPO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TNPO2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TNPO2 were set to PMID: 34314705
Phenotypes for gene: TNPO2 were set to Developmental delays, neurologic deficits and dysmorphic features
Mode of pathogenicity for gene: TNPO2 was set to Other
Review for gene: TNPO2 was set to GREEN
Added comment: PMID: 34314705 - all de novo missense variants with intellectual disability (9/9), speech impairment (15/15), motor impairment (15/15), ophthalmologic abnormalities (10/15), muscle tone abnormalities (11/15, primarily hypotonia), seizures (6/15, febrile to non-febrile), microcephaly (5/15) and MRI anomalies (7/13, 3/13 had cerebellar hypoplasia/dysplasia).

Null fly model was homozygous lethal, no obvious phenotypes in heterozygotes. Upregulated gene expression also resulted in lethality. Overexpression of some human variants in fly models resulted in "toxicity" and phenotypic defects, authors speculate two variants are GOF, 1 variant is LOF.

gnomAD: minimal PTCs present
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4017 TP73 Seb Lunke Publications for gene: TP73 were set to 31130284
Intellectual disability syndromic and non-syndromic v0.4016 SPTBN1 Belinda Chong changed review comment from: PMID: 34211179
- Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features.
- Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics.

PMID: 33847457
- Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset.
- identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities).
- Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis.
Sources: Literature
Sources: Literature; to: PMID: 34211179
- Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures (9/29); behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features.
- Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics.

PMID: 33847457
- Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset.
- identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities).
- Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis.
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4015 SPTBN1 Belinda Chong gene: SPTBN1 was added
gene: SPTBN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPTBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SPTBN1 were set to PMID: 34211179 PMID: 33847457
Phenotypes for gene: SPTBN1 were set to Neurodevelopmental Syndrome
Review for gene: SPTBN1 was set to GREEN
Added comment: PMID: 34211179
- Heterozygous SPTBN1 variants in 29 individuals with developmental, language and motor delays; mild to severe intellectual disability; autistic features; seizures; behavioral and movement abnormalities; hypotonia; and variable dysmorphic facial features.
- Show that these SPTBN1 variants lead to effects that affect βII-spectrin stability, disrupt binding to key molecular partners, and disturb cytoskeleton organization and dynamics.

PMID: 33847457
- Common features include global developmental delays, intellectual disability, and behavioral disturbances. Autistic features (4/6) and epilepsy (2/7) or abnormal electroencephalogram without overt seizures (1/7) were present in a subset.
- identified seven unrelated individuals with heterozygous SPTBN1 variants: two with de novo missense variants and five with predicted loss-of-function variants (found to be de novo in two, while one was inherited from a mother with a history of learning disabilities).
- Identification of loss-of-function variants suggests a haploinsufficiency mechanism, but additional functional studies are required to fully elucidate disease pathogenesis.
Sources: Literature
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4013 EDEM3 Michelle Torres gene: EDEM3 was added
gene: EDEM3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EDEM3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EDEM3 were set to 34143952
Phenotypes for gene: EDEM3 were set to EDEM3-congenital disorder of glycosylation
Review for gene: EDEM3 was set to GREEN
Added comment: PMID: 34143952: 7 families (11 individuals) with 6x PTV and 2x missense variants with neurodevelopmental delay and variable facial dysmorphisms. The unaffected parents were all heterozygous carriers. Functional show LoF of EDEM3 enzymatic activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4012 ANK2 Zornitza Stark Publications for gene: ANK2 were set to 22542183; 25363768; 27479843; 28554332; 30564305; 30755392; 31981491; 33004838; 33057194
Intellectual disability syndromic and non-syndromic v0.4010 ANK2 Zornitza Stark Publications for gene: ANK2 were set to 22542183, 25363768, 27479843, 28554332, 30564305, 30755392, 31981491
Intellectual disability syndromic and non-syndromic v0.4009 ANK2 Anna Le Fevre gene: ANK2 was added
gene: ANK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: ANK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANK2 were set to 22542183, 25363768, 27479843, 28554332, 30564305, 30755392, 31981491
Phenotypes for gene: ANK2 were set to intellectual disability
Penetrance for gene: ANK2 were set to unknown
Added comment: Curated by ClinGen 2020 as definitively associated
? consider taking gene off incidentalome gene list
Sources: Other
Intellectual disability syndromic and non-syndromic v0.4008 EIF4A3 Zornitza Stark Publications for gene: EIF4A3 were set to
Intellectual disability syndromic and non-syndromic v0.4005 HSD17B4 Zornitza Stark Publications for gene: HSD17B4 were set to
Intellectual disability syndromic and non-syndromic v0.4002 SYNCRIP Konstantinos Varvagiannis gene: SYNCRIP was added
gene: SYNCRIP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SYNCRIP were set to 34157790; 30504930; 27479843; 23020937
Phenotypes for gene: SYNCRIP were set to Global developmental delay; Intellectual disability; Autism; Myoclonic atonic seizures; Abnormality of nervous system morphology
Review for gene: SYNCRIP was set to AMBER
Added comment: Semino et al (2021 - PMID: 34157790) provide clinical details on 3 unrelated individuals with de novo SYNCRIP variants and provide a review of 5 additional subjects previously identified within large cohorts in the literature and databases.

Features included DD, ID (7/7 for whom this information was available), ASD or autistic features (4/7). MRI abnormalities were observed in 3 (widening of CSF spaces, periventricular nodular heterotopia, prominent lat. ventricles). Epilepsy (myoclonic-astatic epilepsy / Doose syndrome) was reported for 2(/8) individuals.

The 3 patients here reported were identified following trio/singleton exome with Sanger confirmation of the variants and their de novo occurrence.

Variants are in almost all cases de novo (7/7 for whom this was known) and in 5/8 cases were pLoF, in 2/8 missense SNVs while a case from DECIPHER had a 77.92 kb whole gene deletion not involving other genes with unknown inheritance.

Overall the variants reported to date include [NM_006372.5]:
1 - c.858_859del p.(Gly287Leufs*5)
2 - c.854dupA p.(Asn285Lysfs*8)
3 - c.734T>C p.(Leu245Pro)
4 - chr6:85605276-85683190 deletion (GRCh38)
5 - c.629T>C p.(Phe210Ser)
6 - c.1573_1574delinsTT p.(Gln525Leu)
7 - c.1247_1250del p.(Arg416Lysfs*145)
8 - c.1518_1519insC p.(Ala507Argfs*14)

[P1-3: this report, P4: DECIPHER 254774, P5-6: Guo et al 2019 - PMID: 30504930, P7: Lelieveld et al 2016 - PMID: 27479843, P8: Rauch et al 2012 - PMID: 23020937 / all other Refs not here reviewed, clinical details summarized by Semino et al in table 1]

SYNCRIP (also known as HNRNPQ) encodes synaptotagmin‐binding cytoplasmic RNA‐interacting protein. As the authors note, this RNA-binding protein is involved in multiple pathways associated with neuronal/muscular developmental disorders. Several references are provided for its involvement in regulation of RNA metabolism, among others sequence recognition, pre-mRNA splicing, translation, transport and degradation.

Mutations in other RNA-interacting proteins and hnRNP members (e.g. HNRNPU, HNRNPD) are associated with NDD.

The missense variant (p.Leu245Pro) is within RRM2 one of the 3 RNA recognition motif (RRM) domains of the protein. These 3 domains, corresponding to the central part of the protein (aa 150-400), are relatively intolerant to variation (based on in silico predictions and/or variation in gnomAD). Leu245 localizes within an RNA binding pocket and in silico modeling suggests alteration of the tertiary structure and RNA-binding capacity of RRM2.

There are no additional studies performed.

Overall haploinsufficiency appears to be the underlying disease mechanism based on the truncating variants and the gene deletion. [pLI in gnomAD : 1, %HI : 2.48%]

Animal models are not discussed.

There is no associated phenotype in OMIM. This gene is included in the DD panel of G2P (monoallelic LoF variants / SYNCRIP-related developmental disorder). SysID also lists SYNCRIP within the current primary ID genes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4001 CAMK4 Konstantinos Varvagiannis gene: CAMK4 was added
gene: CAMK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: CAMK4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CAMK4 were set to 30262571; 33098801; 33211350
Phenotypes for gene: CAMK4 were set to Global developmental delay; Intellectual disability; Autism; Behavioral abnormality; Abnormality of movement; Dystonia; Ataxia; Chorea; Myoclonus
Penetrance for gene: CAMK4 were set to Complete
Review for gene: CAMK4 was set to GREEN
Added comment: 3 publications by Zech et al (2018, 2020 - PMIDs : 30262571, 33098801, 33211350) provide clinical details on 3 individuals, each harboring a private de novo CAMK4 variant.

Overlapping features included DD, ID, behavoral issues, autism and abnormal hyperkinetic movements. Dystonia and chorea in all 3 appeared 3-20 years after initial symptoms.

CAMK4 encodes Calcium/Calmodulin-dependent protein kinase IV, an important mediator of calcium-mediated activity and dynamics, particularly in the brain. It is involved in neuronal transmission, synaptic plasticity, and neuronal gene expression required for brain development and neuronal homeostasis (summary by OMIM based on Zech et al, 2018).

The 473 aa enzyme has a protein kinase domain (aa 46-300) and a C-terminal autoregulatory domain (aa 305-341) the latter comprising an autoinhibitory domain (AID / aa 305-321) and a calmodulin-binding domain (CBD / aa 322-341) [NP_001735.1 / NM_001744.4 - also used below].

Variants in all 3 subjects were identified following trio-WES and were in all cases protein-truncating, mapping to exon 10 or exon 10-intron 10 junction, expected to escape NMD and cause selective abrogation of the autoinhibitory domain (aa 305-321) leading overall to gain-of-function.

Variation databases include pLoF CAMK4 variants albeit in all cases usptream or downstream of this region (pLI of this gene in gnomAD: 0.51). Variants leading to selective abrogation of the autoregulatory domain have not been reported.

Extensive evidence for the GoF effect of the variant has been provided in the first publication. Several previous studies have demonstrated that abrogation of the AID domain leads to consitutive activation (details below).

Mouse models - though corresponding to homozygous loss of function - support a role for CAMKIV in cognitive and motor symptoms. Null mice display tremulous and ataxic movements, deficiencies in balance and sensorimotor performance associated with reduced number of Purkinje neurons (Ribar et al 2000, PMID: 11069976 - not reviewed). Wei et al (2002, PMID: 12006982 - not reviewed) provided evidence for alteration in hippocampal physiology and memory function.

Heterozygous mutations in other genes for calcium/calmodulin-dependent protein kinases (CAMKs) e.g. CAMK2A/CAMK2B (encoding subunits of CAMKII) have been reported in individuals with ID.

---

The proband in the first publication (PMID: 30262571) was a male with DD, ID, behavioral difficulties (ASD, autoaggression, stereotypies) and hyperkinetic movement disorder (myoclonus, chorea, ataxia) with severe generalized dystonia (onset at the age of 13y). Brain MRI demonstrated cerebellar atrophy.

Extensive work-up incl. karyotyping, CMA, DYT-TOR1A, THAP1, GCH1, SCA1/2/3/6/7/8/12/17, Friedreich's ataxia and FMR1 analysis was negative.F

Trio WES identified a dn splice site variant (c.981+1G>A) in the last exon-intron junction. RT-PCR followed by gel electrophoresis and Sanger in fibroblasts from an affected and control subject revealed that the proband had - as predicted by the type/location of the variant - in equal amount 2 cDNA products, a normal as well as a truncated one.

Sequencing of the shortest revealed utilization of a cryptic donor splice site upstream of the mutated donor leading to a 77bp out-of-frame deletion and introduction of a premature stop codon in the last codon (p.Lys303Serfs*28). Western blot in fibroblast cell lines revealed 2 bands corresponding to the normal protein product as well as to the p.Lys303Serfs*28 although expression of the latter was lower than that of the full length protein.

Several previous studies have shown that mutant CAMKIV species that lack the autoinhibitory domain are consitutively active (several Refs provided). Among others Chatila et al (1996, PMID: 8702940) studied an in vitro-engineered truncation mutant (Δ1-317 - truncation at position 317 of the protein) with functionally validated gain-of-function effect.

To prove enhanced activity of the splicing variant, Zech et al assessed phosphorylation of CREB (cyclic AMP-responsive element binding protein), a downstream substrate of CAMKIV. Immunobloting revealed significant increase of CREB phosphorylation in patient fibroblasts compared to controls. Overactivation of CAMKIV signaling was reversed when cells were treated with STO-609 an inhibitor of CAMKK, the ustream activator of CAMKIV.

Overall the authors demonstrated that loss of CAMKIV autoregulatory domain due to this splice variant had a gain-of-function effect.

----

Following trio-WES, Zech et al (2020 - PMID: 33098801) identified another relevant subject within cohort of 764 individuals with dystonia. This 12-y.o. male, harboring a different variant affecting the same donor site (c.981+1G>T), presented DD, ID, dystonia (onset at 3y) and additional movement disorders (myoclonus, ataxia) as well as similar behavior (ASD, autoaggression, stereotypies). [Details in suppl. p20].

----

Finally Zech et al (2020 - PMID: 33211350) reported on a 24-y.o. woman with adolescence onset choreodystonia. Other features included DD, moderate ID, absence seizures in infancy, OCD with anxiety and later diagnosis of ASD. Trio WES revealed a dn stopgain variant (c.940C>T; p.Gln314*).

----

There is no associated phenotype in OMIM, G2P.

In SysID CAMK4 is listed among the current primary ID genes.

----

Please consider inclusion in other relevant panels.
Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.3998 WDR26 Zornitza Stark Publications for gene: WDR26 were set to
Intellectual disability syndromic and non-syndromic v0.3994 ABCD4 Zornitza Stark Publications for gene: ABCD4 were set to
Intellectual disability syndromic and non-syndromic v0.3991 CCBE1 Zornitza Stark Publications for gene: CCBE1 were set to
Intellectual disability syndromic and non-syndromic v0.3988 SUFU Zornitza Stark Publications for gene: SUFU were set to 28965847
Intellectual disability syndromic and non-syndromic v0.3985 SUFU Zornitza Stark edited their review of gene: SUFU: Added comment: Heterozygous truncating variants in SUFU in 15 subjects from 6 unrelated families of various ethnic backgrounds (familial and de novo cases). Clinical features of early-onset (congenital) ocular ataxia and developmental delay, with some phenotypic variability. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign of Joubert syndrome. Paper reports that condition reported here and SUFU-associated Basal cell nevus syndrome (Gorlin) are likely allelic disorders, as there is currently no convincing evidence for a clinical overlap.

Functional studies showed no differences in cilia occurrence, morphology, or localization of ciliary proteins, such as smoothened. However, analysis of expression of HH signaling target genes detected a significant increase in the general signaling activity in COMA patient–derived fibroblasts compared with control cells. We observed higher basal HH signaling activity resulting in increased basal expression levels of GLI1, GLI2, GLI3, and Patched1. Neuroimaging revealed subtle cerebellar changes, but no full-blown molar tooth sign. Knockout mice with SuFu deficiency demonstrated that SuFu is required for proper midhindbrain patterning and controls cerebellar patterning.; Changed rating: GREEN; Changed publications: 28965847, 33024317; Changed phenotypes: Joubert syndrome 32, MIM#617757, SUFU-related neurodevelopmental syndrome; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3984 PCDHGC4 Zornitza Stark gene: PCDHGC4 was added
gene: PCDHGC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PCDHGC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCDHGC4 were set to 34244665
Phenotypes for gene: PCDHGC4 were set to Intellectual disability; Seizures
Review for gene: PCDHGC4 was set to GREEN
Added comment: Eight variants reported in 19 members of nine unreleted families with a neurodevelopmental syndrome. Severe or moderate intellectual disabilty in eight families and seizures in four families. Four of the variants were LoF, in silico analysis of the remaining missense (n=3) and splice variants were predicted to be pathogenic.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3982 CEP85L Zornitza Stark gene: CEP85L was added
gene: CEP85L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CEP85L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CEP85L were set to 32097630
Phenotypes for gene: CEP85L were set to Lissencephaly, posterior predominant
Review for gene: CEP85L was set to GREEN
Added comment: Thirteen individuals reported with mono allelic variants in this gene, inherited in two of the families. Mouse model had neuronal migration defects.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.3978 LINGO4 Laura Raiti gene: LINGO4 was added
gene: LINGO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LINGO4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LINGO4 were set to PMID: 33098801
Phenotypes for gene: LINGO4 were set to Developmental Delay, Intellectual disability, speech disorder
Review for gene: LINGO4 was set to GREEN
Added comment: 3 unrelated individuals
1 x individual compound heterozygous for 2x missense variants:
c.679C>A; c.1262G>A p.Leu227Met; p.Arg421Gln comp het. Phenotype: infancy-onset
generalized dystonia; DD/hypo, ID, speech disorder (isolated plus non-MD symptoms) NDD

1 x individual homozygous for missense variant: c.679C>A p.Leu227Met Phenotype: DD/hypo, ID, speech disorder

1 x individual homozygous for missense variant: c.1673G>A p.Ser558Asn Phenotype: DD/hypo, ID, speech disorder
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3978 IMPDH2 Laura Raiti gene: IMPDH2 was added
gene: IMPDH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IMPDH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: IMPDH2 were set to PMID: 33098801
Added comment: 6 unrelated individuals
1x individual in a dystonia cohort index case with infancy-onset dystonia and other neurological manifestations with a de-novo missense variant, c.338G>A (p.Gly113Glu) in IMPDH2, predicted to disrupt an invariant residue within the cystathionine-β-synthase (CBS) domain pair of the encoded protein.
IMPDH2 encodes IMPDH2, a key enzyme in the purine biosynthetic pathway, expressed throughout the brain and not linked previously to any human Mendelian condition.
1x individual with a de-novo substitution, c.337G>A (p.Gly113Arg), was found in in-house whole-exome sequencing data from 500 individuals with neurodevelopmental disorders. Through GeneMatcher, de novo variants identified:
3 x missense: c.729G>C (p.Gln243His), c.619G>C (p.Gly207Arg), and c.619G>A (p.Gly207Arg)
1 x deletion: c.478_480delTCC (p.Ser160del)
The six variants were predicted to be deleterious and none of them seen in control databases. All affected conserved amino acids and resided in and around the cystathionine-β-synthase domain pair.
The described variants are situated in and around the CBS domain pair, a regulatory element in which clustering of pathogenic missense variants has already been shown for the homologue of IMPDH2, IMPDH1.

The variant carriers shared similar neurodevelopmental phenotypes. Apart from the dystonia cohort index case, one participant had evidence of dystonic posturing. Modelling of the variants on 3D protein structures revealed spatial clustering near specific functional sites, predicted to result in deregulation of IMPDH2 activity. Additionally, thermal-shift assays showed that the c.619G>A (p.Gly207Arg) variant, identified as within the CBS domain pair, and c.729G>C (p.Gln243His), which is in close vicinity, affected the stability or folding behaviour of IMPDH2.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3978 ATG7 Zornitza Stark changed review comment from: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature; to: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3978 ATG7 Zornitza Stark changed review comment from: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The ore severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature; to: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The more severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3977 ATG7 Zornitza Stark gene: ATG7 was added
gene: ATG7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATG7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATG7 were set to 34161705
Phenotypes for gene: ATG7 were set to Spinocerebellar ataxia, SCAR31, MIM#619422
Review for gene: ATG7 was set to GREEN
Added comment: 12 individuals from 5 unrelated families reported with a complex neurodevelopmental disorder and bi-allelic variants in this gene. Age range from 21 months to 71 years of age. Main clinical features included axial hypotonia, variably impaired intellectual development with poor or absent speech, and delayed walking (up to 7 years of age) or inability to walk. All had ataxia, often with tremor or dyskinesia, as well as dysarthria associated with cerebellar hypoplasia on brain imaging. Most had optic atrophy, and some had ptosis, chronic progressive external ophthalmoplegia, retinopathy, and strabismus; 1 had early-onset cataracts. The ore severely affected individuals had spastic paraplegia and inability to walk.

Functional data including mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3975 C2orf69 Zornitza Stark gene: C2orf69 was added
gene: C2orf69 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: C2orf69 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C2orf69 were set to 34038740; 33945503
Phenotypes for gene: C2orf69 were set to Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423
Review for gene: C2orf69 was set to GREEN
Added comment: PMID 34038740: 20 affected children from 8 unrelated families reported, presenting with fatal syndrome consisting of severe autoinflammation and progredient leukoencephalopathy with recurrent seizures; 12 of these subjects, whose DNA was available, segregated homozygous loss-of-function C2orf69 variants. Endogenous C2ORF69 was found to be (1) loosely bound to mitochondria, (2) affects mitochondrial membrane potential and oxidative respiration in cultured neurons, and (3) controls the levels of the glycogen branching enzyme 1 (GBE1) consistent with a glycogen-storage-associated mitochondriopathy. Zebrafish model.

PMID 33945503: 8 individuals from 5 families reported with muscle hypotonia, developmental delay, progressive microcephaly, and brain MRI abnormalities. Age at onset ranged from birth to 6 months of age. Six patients had vision impairment, liver abnormalities, inflammation/inflammatory arthritis, and 5 patients had seizures.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3973 YARS Zornitza Stark Phenotypes for gene: YARS were changed from Intellectual disability; deafness; nystagmus; liver dysfunction to Infantile-onset multisystem neurologic, endocrine, and pancreatic disease 2, MIM# 619418
Intellectual disability syndromic and non-syndromic v0.3972 YARS Zornitza Stark edited their review of gene: YARS: Changed phenotypes: Infantile-onset multisystem neurologic, endocrine, and pancreatic disease 2, MIM# 619418
Intellectual disability syndromic and non-syndromic v0.3971 ERGIC3 Zornitza Stark Publications for gene: ERGIC3 were set to ERGIC3
Intellectual disability syndromic and non-syndromic v0.3970 ZC3H14 Zornitza Stark Publications for gene: ZC3H14 were set to 21734151; 33710394
Intellectual disability syndromic and non-syndromic v0.3968 RNF2 Zornitza Stark gene: RNF2 was added
gene: RNF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNF2 were set to 33864376
Phenotypes for gene: RNF2 were set to epilepsy; intellectual disability; intrauterine growth retardation
Review for gene: RNF2 was set to AMBER
Added comment: Not associated with any phenotype in OMIM. PMID:33864376 (Luo et al 2021) report 2 cases of children with de novo missense variants (p.R70H and p.S82R) in RNF2 and a phenotype of intrauterine growth retardation, severe intellectual disabilities, behavioral problems, seizures, feeding difficulties and dysmorphic features. Seizures started in infancy. Both variants are absent from gnomad. Functional studies in Drosophila showed that the disease-linked variants (p.R70H and p.S82R) behave as LoF alleles.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3967 RING1 Zornitza Stark gene: RING1 was added
gene: RING1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RING1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RING1 were set to 29386386
Phenotypes for gene: RING1 were set to microcephaly; intellectual disability
Review for gene: RING1 was set to RED
Added comment: Not associated with any phenotype in OMIM. PMID: 29386386 - Pierce et al 2018 - report a 13 yo female with a de novo RING1 p.R95Q variant and syndromic neurodevelopmental disabilities. Early motor and language development were normal but were delayed after the first year of life. Cognitive testing showed a verbal IQ of 55 and a visual performance IQ of 63. Head circumference at birth was -4.9 SD, and -4.2 SD at age 13 which falls into the severe microcephaly category. C. elegans with either the missense mutation or complete knockout of spat-3 (the suggested RING1 ortholog) were defective in monoubiquitylation of histone H2A and had defects in neuronal migration and axon guidance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3965 IRX5 Zornitza Stark Publications for gene: IRX5 were set to
Intellectual disability syndromic and non-syndromic v0.3961 RAB3GAP1 Zornitza Stark Publications for gene: RAB3GAP1 were set to
Intellectual disability syndromic and non-syndromic v0.3959 GNB2 Zornitza Stark Publications for gene: GNB2 were set to 31698099
Intellectual disability syndromic and non-syndromic v0.3955 HID1 Zornitza Stark gene: HID1 was added
gene: HID1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HID1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HID1 were set to 33999436
Phenotypes for gene: HID1 were set to Syndromic infantile encephalopathy; Hypopituitarism
Review for gene: HID1 was set to GREEN
Added comment: 7 individuals from 6 unrelated families reported. Clinical features included: hypopituitarism in combination with brain atrophy, thin corpus callosum, severe developmental delay, visual impairment, and epilepsy
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3952 ERGIC3 Seb Lunke gene: ERGIC3 was added
gene: ERGIC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ERGIC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERGIC3 were set to ERGIC3
Phenotypes for gene: ERGIC3 were set to 33710394; 31585110
Review for gene: ERGIC3 was set to AMBER
Added comment: PMID: 33710394 - two homozygous sibs with mild ID, a novel canonical splice (c.717+1G>A). Absent in gnomAD, no splice studies. Classed as a VUS.

PMID: 31585110 - 1 hom (p.Gln233Argfs*10) in a male 8yo with Growth retardation, Microcephaly, Learning disability, Facial dysmorphism, Abnormal pigmentation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3951 JPH3 Seb Lunke gene: JPH3 was added
gene: JPH3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: JPH3 was set to Unknown
Publications for gene: JPH3 were set to 33824468
Phenotypes for gene: JPH3 were set to Intellectual disability; dystonia
Review for gene: JPH3 was set to RED
Added comment: One homozygous truncating variant (NM_020655.4: c.1740dup; p.(Val581Argfs*137)) found in a female individual affected with genetically undetermined neurodevelopmental anomalies (including delayed motor milestones, abnormal social communication, language difficulties and borderline cognitive impairment) and paroxysmal attacks of dystonia since her early infancy. No functional work were performed.

Only STRs disease causing, see separate STR list. No evidence for SNVs etc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3947 HEATR5B Seb Lunke gene: HEATR5B was added
gene: HEATR5B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HEATR5B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HEATR5B were set to 33824466
Phenotypes for gene: HEATR5B were set to pontocerebellar hypoplasia; intellectual disability; seizures
Review for gene: HEATR5B was set to AMBER
Added comment: Four affected children from two families presenting with pontocerebellar hypoplasiawith neonatal seizures, severe ID and motor delay. Two homozygous splice variants were reported (c.5051–1G>A and c.5050+4A>G) in intron 31 of HEATR5B gene. Aberrant splicing was found in patient fibroblasts, which correlated with reduced levels of HEATR5B protein. Homozygous knockout mice were not viable. *NOTE: gene (and alias) not found in OMIM
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3946 ATP1A2 Zornitza Stark Publications for gene: ATP1A2 were set to
Intellectual disability syndromic and non-syndromic v0.3944 ATP1A3 Zornitza Stark Publications for gene: ATP1A3 were set to
Intellectual disability syndromic and non-syndromic v0.3943 ZC3H14 Seb Lunke Publications for gene: ZC3H14 were set to PubMed: 21734151
Intellectual disability syndromic and non-syndromic v0.3942 SAMD9L Zornitza Stark Publications for gene: SAMD9L were set to
Intellectual disability syndromic and non-syndromic v0.3937 EPHA7 Zornitza Stark gene: EPHA7 was added
gene: EPHA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: EPHA7.
Mode of inheritance for gene: EPHA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHA7 were set to 34176129
Phenotypes for gene: EPHA7 were set to Intellectual disability
Review for gene: EPHA7 was set to AMBER
Added comment: Lévy et al (2021 - PMID: 34176129) provide evidence that haploinssuficiency of EPHA7 results in a neurodevelopmental disorder.

The authors report on 12 individuals belonging to 9 unrelated families, all harboring with 6q microdeletions spanning EPHA7.

Overlapping features included DD (13/13), ID (10/10 - mild in most cases, individuals with larger CNVs/additional variants had more severe phenotype), speech delay and behavioral disorders. Variable other features incl. hypotonia (70%), non specific facial features, eye abnormalities (40%) and cardiac defects (25%).

The CNVs ranged from 152 kb to few Mb in size but in 4 subjects (P5-8) were only minimal, involving only EPHA7.



9 out of 12 individuals had inherited the deletion (5 subjects paternal, 4 maternal), in 1 subject (P12) this occured de novo, while for 2 others inheritance was not specified. Most deletions were inherited from an unaffected parent (in 6/7 families), with unclear contribution in a further one.

The authors discuss on previous studies suggesting an important role for EphA7 in brain development (modulation of cell-cell adhesion and repulsion, regulation of dendrite morphogenesis in early corticogenesis, role in dendritic spine formation later in development. EphA7 has also been proposed to drive neuronal maturation and synaptic function).

Haploinsufficiency for other ephrins or ephrin receptors has been implicated in other NDDs.

Overall Lévy et al promote incomplete penetrance and variable expressivity with haploinsufficiency of this gene being a risk factor for NDD. [The gene has also an %HI of 2.76% and a pLI of 1].
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3935 DNM1 Zornitza Stark Publications for gene: DNM1 were set to
Intellectual disability syndromic and non-syndromic v0.3932 TTC8 Zornitza Stark Publications for gene: TTC8 were set to
Intellectual disability syndromic and non-syndromic v0.3929 ATP9A Zornitza Stark gene: ATP9A was added
gene: ATP9A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP9A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATP9A were set to http://dx.doi.org/10.1136/jmedgenet-2021-107843
Phenotypes for gene: ATP9A were set to Neurodevelopmental delay; Postnatal microcephaly; Failure to thrive; Gastrointestinal symptoms
Review for gene: ATP9A was set to AMBER
Added comment: Vogt et al. 2021 report on 3 individuals from 2 unrelated consanguineous families with different homozygous truncating variants in ATP9A, presenting with DD/ID of variable degree (2 mild, 1 severe), postnatal microcephaly (OFC range: −2.33 SD to −3.58 SD), failure to thrive, and gastrointestinal symptoms. Patient-derived fibroblasts showed reduced expression of ATP9A, and consistent with previous findings also overexpression of interacting partners, ARPC3 and SNX3.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3928 ATP2C2 Zornitza Stark gene: ATP2C2 was added
gene: ATP2C2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP2C2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP2C2 were set to 33864365; 28440294
Phenotypes for gene: ATP2C2 were set to language impairment, HP:0002463
Review for gene: ATP2C2 was set to RED
Added comment: PMID: 33864365 - Martinelli et al 2021 - report a family with a missense variant NM_001286527.2:c.304G>A, p.(Val102Met) in ATP2C2 in a father and two siblings with specific language impairment. However two other affected siblings did not have this variant. This variant was also reported by Chen et al. They found that the variant had a higher frequency in language cases (1.8%, N = 360) compared with cohorts selected for dyslexia (0.8%, N = 520) and ADHD (0.7%, N = 150), which presented frequencies comparable to reference databases (0.9%, N = 24 046 gnomAD controls). They postulate that variant is not sufficient on its own to cause a disorder but is a susceptibility factor which increases the risk for language impairment. PMID: 28440294 - Chen et al 2017 - report 2 probands with severe learning impairment, and missense variants in ATP2C2 (NM_001286527: c.G304A:p.V102M and NM_001291454:exon21: c.C1936T:p.R646W).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3926 TMEM67 Zornitza Stark Publications for gene: TMEM67 were set to
Intellectual disability syndromic and non-syndromic v0.3923 SDCCAG8 Zornitza Stark Publications for gene: SDCCAG8 were set to
Intellectual disability syndromic and non-syndromic v0.3921 KIF1B Paul De Fazio gene: KIF1B was added
gene: KIF1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KIF1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF1B were set to 33710394
Phenotypes for gene: KIF1B were set to Hypotonia; coloboma; hypoplasia of the corpus callosum; severe neurodevelopmental delay
Review for gene: KIF1B was set to RED
gene: KIF1B was marked as current diagnostic
Added comment: Compound heterozygous missense variants reported in a woman with severe hypotonia, hypsarrhythmia, coloboma, hypoplasia of corpus callosum, severe neurodevelopmental delay.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3921 MYT1 Paul De Fazio gene: MYT1 was added
gene: MYT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MYT1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MYT1 were set to 33710394
Phenotypes for gene: MYT1 were set to Intellectual disability
Review for gene: MYT1 was set to RED
gene: MYT1 was marked as current diagnostic
Added comment: Missense variant reported de novo in a patient with mild ID. Patient also had a COL9A2 variant and skeletal features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3921 SAMD9L Paul De Fazio gene: SAMD9L was added
gene: SAMD9L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SAMD9L was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for gene: SAMD9L were set to Intellectual disability
Review for gene: SAMD9L was set to RED
gene: SAMD9L was marked as current diagnostic
Added comment: Missense variant reported de novo in a patient with moderate ID, in a large cohort study. Author described it as a phenotype expansion as ataxia-pancytopenia not found in that patient.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3920 ARHGEF9 Zornitza Stark Publications for gene: ARHGEF9 were set to
Intellectual disability syndromic and non-syndromic v0.3919 ARHGEF9 Zornitza Stark Mode of inheritance for gene: ARHGEF9 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3918 ARHGEF9 Zornitza Stark reviewed gene: ARHGEF9: Rating: GREEN; Mode of pathogenicity: None; Publications: 31942680, 30048823, 29130122, 28620718, 33600053, 32939676; Phenotypes: Developmental and epileptic encephalopathy 8, MIM# 300607; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3916 CEP83 Zornitza Stark Publications for gene: CEP83 were set to
Intellectual disability syndromic and non-syndromic v0.3913 CEP164 Zornitza Stark gene: CEP164 was added
gene: CEP164 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CEP164 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP164 were set to 34132027; 34013113; 32055034; 27708425; 22863007
Phenotypes for gene: CEP164 were set to Bardet-Biedl syndrome; Nephronophthisis 15, MIM# 614845; Oro-facio-digital syndrome
Review for gene: CEP164 was set to GREEN
Added comment: More than 10 unrelated families reported. Although this is labelled as a nephronophthisis gene in OMIM, some of the reported individuals have had features such as retinal involvement, ID and polydactyly to suggest a more BBS-like phenotype. Also note one individual reported with OFD-like phenotype.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.3910 C5orf42 Zornitza Stark Publications for gene: C5orf42 were set to
Intellectual disability syndromic and non-syndromic v0.3906 BBS9 Zornitza Stark Publications for gene: BBS9 were set to
Intellectual disability syndromic and non-syndromic v0.3903 BBS7 Zornitza Stark Publications for gene: BBS7 were set to
Intellectual disability syndromic and non-syndromic v0.3900 BBS5 Zornitza Stark Publications for gene: BBS5 were set to
Intellectual disability syndromic and non-syndromic v0.3897 BBS4 Zornitza Stark Publications for gene: BBS4 were set to
Intellectual disability syndromic and non-syndromic v0.3894 ARL6 Zornitza Stark Publications for gene: ARL6 were set to
Intellectual disability syndromic and non-syndromic v0.3891 PPP2R1A Zornitza Stark Publications for gene: PPP2R1A were set to
Intellectual disability syndromic and non-syndromic v0.3888 CLPB Zornitza Stark Publications for gene: CLPB were set to
Intellectual disability syndromic and non-syndromic v0.3884 ARCN1 Zornitza Stark Publications for gene: ARCN1 were set to
Intellectual disability syndromic and non-syndromic v0.3881 SLC13A5 Zornitza Stark Publications for gene: SLC13A5 were set to
Intellectual disability syndromic and non-syndromic v0.3875 IFT74 Zornitza Stark gene: IFT74 was added
gene: IFT74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IFT74 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT74 were set to 27486776; 32144365; 33531668
Phenotypes for gene: IFT74 were set to Bardet-Biedl syndrome 20, MIM# 617119; Joubert syndrome
Review for gene: IFT74 was set to GREEN
Added comment: Two individuals reported with BBS phenotype.

PMID 33531668: Identified IFT74 as a JBTS-associated gene in 3 unrelated families through WES. All the affected individuals carried truncated variants and shared one missense variant (p.Q179E) found only in East Asians. The expression of the human p.Q179E-IFT74 variant displayed compromised rescue effects in zebrafish ift74 morphants. Attenuated ciliogenesis; altered distribution of IFT proteins and ciliary membrane proteins, including ARL13B, INPP5E, and GPR161; and disrupted hedgehog signaling were observed in patient fibroblasts with IFT74 variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3872 DLG4 Zornitza Stark Publications for gene: DLG4 were set to 27479843; 25123844; 19617690; 29460436; 23020937; 28135719
Intellectual disability syndromic and non-syndromic v0.3869 GNAI1 Zornitza Stark Publications for gene: GNAI1 were set to 28135719
Intellectual disability syndromic and non-syndromic v0.3864 RFX4 Chirag Patel gene: RFX4 was added
gene: RFX4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RFX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RFX4 were set to PMID: 33658631
Phenotypes for gene: RFX4 were set to ID, ASD, ADHD
Review for gene: RFX4 was set to GREEN
Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3864 RFX3 Chirag Patel gene: RFX3 was added
gene: RFX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RFX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RFX3 were set to PMID: 33658631
Phenotypes for gene: RFX3 were set to ID, ASD, ADHD
Review for gene: RFX3 was set to GREEN
Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3864 RFX7 Chirag Patel gene: RFX7 was added
gene: RFX7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RFX7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RFX7 were set to PMID: 33658631
Phenotypes for gene: RFX7 were set to ID, ASD, ADHD
Review for gene: RFX7 was set to GREEN
Added comment: Report of 38 individuals (from 33 unrelated families) with de novo or inherited loss of function variants in RFX3 (15 families), RFX4 (4 families), and RFX7 (14 families), identified through WES. Individuals share neurobehavioural features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. These genes are potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3862 FARSA Chirag Patel gene: FARSA was added
gene: FARSA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FARSA were set to PMID: 33598926
Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2
Review for gene: FARSA was set to GREEN
gene: FARSA was marked as current diagnostic
Added comment: FARSA is a subunit with FARSB to form FARS1 enzyme. Bi-allelic mutations in FARSB are well described.
Schuch et al. (2021) report 3 unrelated individuals with bi-allelic variants in FARSA. Identified through WES and variants segregated with disease. Functional evidence was obtained with reduced FARS1 enzyme activity levels in fibroblasts or EBV-transformed lymphoblastoid cell lines (EBV-LCLs) of patients. Common to all was a chronic interstitial lung disease starting early in life and characterized by bilateral ground-glass opacification on HR-CT, and cholesterol pneumonitis in lung histology. Additional abnormalities in other organ systems include liver disease, neurological manifestations, and growth restriction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3860 ZNF81 Zornitza Stark Publications for gene: ZNF81 were set to
Intellectual disability syndromic and non-syndromic v0.3857 FOXP1 Zornitza Stark Publications for gene: FOXP1 were set to 26633542; 28741757
Intellectual disability syndromic and non-syndromic v0.3856 PARP6 Zornitza Stark Publications for gene: PARP6 were set to Cells 2021, 10(6), 1289; https://doi.org/10.3390/cells10061289
Intellectual disability syndromic and non-syndromic v0.3854 SRCAP Zornitza Stark Publications for gene: SRCAP were set to
Intellectual disability syndromic and non-syndromic v0.3847 LTBP1 Chern Lim gene: LTBP1 was added
gene: LTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LTBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LTBP1 were set to 33991472
Phenotypes for gene: LTBP1 were set to cutis laxa syndrome
Review for gene: LTBP1 was set to GREEN
gene: LTBP1 was marked as current diagnostic
Added comment: PMID:33991472
- Premature truncating variants in multiple affected individuals from 4 unrelated consanguineous families.
- Affected individuals present with connective tissue features (cutis laxa and inguinal hernia), craniofacial dysmorphology, variable heart defects, and prominent skeletal features (craniosynostosis, short stature, brachydactyly, and syndactyly).
- Most of the affected individuals have developmental delay and other neurological features.
- Functional studies done on patient fibroblasts and zebrafish models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3847 PGM2L1 Chern Lim gene: PGM2L1 was added
gene: PGM2L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PGM2L1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PGM2L1 were set to 33979636
Phenotypes for gene: PGM2L1 were set to Neurodevelopmental disorder
Review for gene: PGM2L1 was set to GREEN
gene: PGM2L1 was marked as current diagnostic
Added comment: PMID: 33979636:
- Hom/chet PTVs in 4 unrelated individuals. All four affected individuals had severe developmental and speech delay, dysmorphic facial features, ear anomalies, high arched palate, strabismus, hypotonia, and keratosis pilaris. Early obesity and seizures were present in three individuals.
- Studies on patient fibroblasts and cell lines indicated that PGM2L1 deficiency causes a decrease, but not a disappearance, of the sugar bisphosphates needed for the formation of NDP-sugars and that there is no evidence that this leads to a glycosylation defect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3846 ATXN2L Sue White gene: ATXN2L was added
gene: ATXN2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATXN2L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATXN2L were set to 33283965; 33057194
Phenotypes for gene: ATXN2L were set to macrocephaly; intellectual disability
Penetrance for gene: ATXN2L were set to Complete
Review for gene: ATXN2L was set to AMBER
Added comment: Combined data from three large exome groups identified several de novo variants, including frameshift and missense, in ATXN2L in patients with developmental delay (Kaplanis et al., 2020). pLI=1.0
Single case report of a novel de novo missense variant in a child with macrocephaly and developmental delay. No functional work.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3845 BCAS3 Paul De Fazio gene: BCAS3 was added
gene: BCAS3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BCAS3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BCAS3 were set to 34022130
Phenotypes for gene: BCAS3 were set to Syndromic neurodevelopmental disorder
Review for gene: BCAS3 was set to GREEN
gene: BCAS3 was marked as current diagnostic
Added comment: 15 individuals from eight unrelated families with germline bi-allelic loss-of-function variants in BCAS3. All probands share a global developmental delay accompanied by pyramidal tract involvement, microcephaly, short stature, strabismus, dysmorphic facial features, and seizures. Patient fibroblasts confirmed absence of BCAS3 protein.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3844 UBTF Zornitza Stark Phenotypes for gene: UBTF were changed from to Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672; MONDO:0044701
Intellectual disability syndromic and non-syndromic v0.3843 UBTF Zornitza Stark Publications for gene: UBTF were set to
Intellectual disability syndromic and non-syndromic v0.3841 UBTF Zornitza Stark reviewed gene: UBTF: Rating: GREEN; Mode of pathogenicity: None; Publications: 28777933, 29300972; Phenotypes: Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672, MONDO:0044701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3839 SLC9A6 Zornitza Stark Publications for gene: SLC9A6 were set to
Intellectual disability syndromic and non-syndromic v0.3836 SHANK3 Zornitza Stark Publications for gene: SHANK3 were set to
Intellectual disability syndromic and non-syndromic v0.3833 SATB2 Zornitza Stark Publications for gene: SATB2 were set to
Intellectual disability syndromic and non-syndromic v0.3830 MEF2C Zornitza Stark Publications for gene: MEF2C were set to
Intellectual disability syndromic and non-syndromic v0.3827 MBD5 Zornitza Stark Publications for gene: MBD5 were set to
Intellectual disability syndromic and non-syndromic v0.3824 IQSEC2 Zornitza Stark Publications for gene: IQSEC2 were set to
Intellectual disability syndromic and non-syndromic v0.3823 IQSEC2 Zornitza Stark Mode of inheritance for gene: IQSEC2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3821 EHMT1 Zornitza Stark Publications for gene: EHMT1 were set to
Intellectual disability syndromic and non-syndromic v0.3819 EEF1A2 Zornitza Stark Publications for gene: EEF1A2 were set to 32160274
Intellectual disability syndromic and non-syndromic v0.3817 MASP1 Zornitza Stark Publications for gene: MASP1 were set to
Intellectual disability syndromic and non-syndromic v0.3814 BRPF1 Zornitza Stark Publications for gene: BRPF1 were set to
Intellectual disability syndromic and non-syndromic v0.3811 POGZ Zornitza Stark Publications for gene: POGZ were set to
Intellectual disability syndromic and non-syndromic v0.3808 UBE3B Zornitza Stark Publications for gene: UBE3B were set to
Intellectual disability syndromic and non-syndromic v0.3805 TAF6 Zornitza Stark Publications for gene: TAF6 were set to
Intellectual disability syndromic and non-syndromic v0.3802 PSMC3 Zornitza Stark gene: PSMC3 was added
gene: PSMC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSMC3 were set to 32500975
Phenotypes for gene: PSMC3 were set to Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354
Review for gene: PSMC3 was set to AMBER
Added comment: Three affected individuals from a single consanguineous family reported with homozygous intronic variant. Animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3800 GEMIN5 Zornitza Stark gene: GEMIN5 was added
gene: GEMIN5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GEMIN5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GEMIN5 were set to 33963192
Phenotypes for gene: GEMIN5 were set to Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, MIM# 619333
Review for gene: GEMIN5 was set to GREEN
Added comment: Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction (NEDCAM) is an autosomal recessive disorder characterized by global developmental delay with prominent motor abnormalities, mainly axial hypotonia, gait ataxia, and appendicular spasticity. Affected individuals have cognitive impairment and speech delay; brain imaging shows cerebellar atrophy.

30 individuals from 22 unrelated families reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3797 NFU1 Zornitza Stark Publications for gene: NFU1 were set to
Intellectual disability syndromic and non-syndromic v0.3794 RAB11B Zornitza Stark Publications for gene: RAB11B were set to
Intellectual disability syndromic and non-syndromic v0.3790 ADNP Zornitza Stark Publications for gene: ADNP were set to
Intellectual disability syndromic and non-syndromic v0.3787 PARP6 Zornitza Stark gene: PARP6 was added
gene: PARP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PARP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PARP6 were set to Cells 2021, 10(6), 1289; https://doi.org/10.3390/cells10061289
Phenotypes for gene: PARP6 were set to Intellectual disability; Epilepsy; Microcephaly
Review for gene: PARP6 was set to GREEN
Added comment: Four unrelated individuals reported with de novo variants in this gene and a neurodevelopmental phenotype. Supportive functional data. One pair of siblings with a homozygous missense: limited evidence for bi-allelic variants causing disease.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3786 UFSP2 Konstantinos Varvagiannis changed review comment from: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)].

Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3).

Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2.

The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity.

Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8).

UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided]

UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1).

Additional studies were carried to provide evidence for pathogenicity of this variant.

Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability.

The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization.

Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers.

Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain.

Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants.

Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance.

In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes.

You may consider inclusion in the current panel with amber/green rating.
Sources: Literature; to: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)].

Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3).

Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2.

The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity.

Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8).

UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided]

UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1).

Additional studies were carried to provide evidence for pathogenicity of this variant.

Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability.

The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization.

Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers.

Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain.

Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants.

**Monoallelic** (correction to previous review) UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance.

In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes.

You may consider inclusion in the current panel with amber/green rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3785 UFSP2 Konstantinos Varvagiannis gene: UFSP2 was added
gene: UFSP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UFSP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFSP2 were set to 33473208
Phenotypes for gene: UFSP2 were set to Abnormal muscle tone; Seizures; Global developmental delay; Delayed speech and language development; Intellectual disability; Strabismus
Penetrance for gene: UFSP2 were set to Complete
Review for gene: UFSP2 was set to AMBER
Added comment: Ni et al (2021 - PMID: 33473208) describe the phenotype of 8 children (belonging to 4 families - 2 of which consanguineous) homozygous for a UFSP2 missense variant [NM_018359.5:c.344T>A; p.(Val115Glu)].

Members of a broader consanguineous pedigree from Pakistan with 3 affected children with epilepsy and DD and ID underwent exome sequencing. All affected individuals were homozygous for the specific SNV with their parents (2 parent pairs, in both cases first cousins) being heterozygous. An unaffected sib was homozygous for the wt allele. Through genematching platforms 3 additional families with similarly affected individuals and homozygosity for the same variant were recruited. These additional families were from Pakistan (1/3) and Afganistan (2/3).

Based on ROH analysis from the broader first pedigree and an additional family the authors concluded on a single shared region of homozygosity on chr 4q. Lack of ES data did not allow verification of whether 2/4 families shared the same haplotype with the other 2.

The authors calculated the probability of the genotype-phenotype cosegragation occurring by chance (0.009) and this was lower than the recommended criterion (0.06) for strong evidence of pathogenicity.

Shared features included abnormal tone in most (hypotonia 6/8, limb hypertonia 1/8), seizures (8/8 - onset 2d - 7m), severe DD with speech delay/absent speech (8/8), ID (8/8), strabismus (6/8).

UFSP2 encodes UFM1-specific protease 2 involved in UFmylation, a post-translational protein modification. As summarized by the authors the cysteine protease encoded by this gene (as is also the case for UFSP1) cleaves UFM1 in the initial step of UFMylation. Apart from producing mature UFM1, the 2 proteases have also the ability to release UFM1 from UFMylated proteins, in the process of de-UFMylation. [several refs. provided]

UFMylation is important in brain development with mutations in genes encoding other components of the pathway reported in other NDD disorders (incl. UFM1, UBA5, UFC1).

Additional studies were carried to provide evidence for pathogenicity of this variant.

Skin biopsies from 3 individuals were carried out to establish fibroblast cultures. Immunoblotting revealed reduced UFSP2 levels relative to controls. mRNA levels measured by qRT-PCR revealed no differences compared to controls altogether suggesting normal mRNA but reduced protein stability.

The authors demonstrated increased levels of UFM1-conjugated proteins (incl. DDRGK1, or TRIP4). Ectopic expression of wt UFSP2 normalized the levels of UFMylated proteins in the fibroblasts which was not the case for the V115E variant. Further the variant was difficult to detect by immunoblotting consistent with an effect on protein destabilization.

Although disruption of UFMylation induces ER stress, this was not shown to occur in patient fibroblast lines, when assessed for ER stress markers.

Evaluation of data from the GTEx project, concerning UFSP2 as well as well as DDRGK1 or TRIP4 - an UFMylation target - revealed relevant expression in multiple regions of the human brain.

Overall the authors provide evidence for defective de-UFMylation in patient fibroblasts (presence of increased UFMylation marks). The authors stress out that the effect of the variant in UFMylation in brain is unknown, as UFSP1 or other enzymes might compensate in the presence of hypomorphic UFSP2 mutants.

Biallelic UFSP2 variants have previously been reported in 2 skeletal dysplasias [# 142669. BEUKES HIP DYSPLASIA; BHD and # 617974. SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE; SEMDDR]. These disorders are not characterized by neurological dysfunction or epilepsy. The authors underscore the fact that variants identified in these disorders (Y290H, D526A, H428R) localize within the C-terminal catalytic (peptidase) domain [aa 278 – 461] while the variant here identified lies in the N-terminal substrate binding domain affecting protein stability/abundance.

In OMIM, only the 2 aforementioned disorders are currently associated with biallelic UFSP2 mutations. There is no associated phenotype in G2P. SysID includes UFSP2 among the primary ID genes.

You may consider inclusion in the current panel with amber/green rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3778 THOC2 Zornitza Stark Publications for gene: THOC2 were set to
Intellectual disability syndromic and non-syndromic v0.3775 CPE Zornitza Stark gene: CPE was added
gene: CPE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CPE was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CPE were set to 26120850; 32936766
Phenotypes for gene: CPE were set to Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326
Review for gene: CPE was set to AMBER
Added comment: Four affected individuals from two unrelated families reported, bi-allelic LoF variants.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.3771 SMARCA5 Zornitza Stark gene: SMARCA5 was added
gene: SMARCA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCA5 were set to 33980485
Phenotypes for gene: SMARCA5 were set to Neurodevelopmental disorder; microcephaly; dysmorphic features
Review for gene: SMARCA5 was set to GREEN
Added comment: 12 individuals reported with either de novo or appropriately segregating variants in this gene and mild developmental delay, frequent postnatal short stature and microcephaly, and recurrent dysmorphic features. Functional data supports gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3770 FBXW7 Zornitza Stark gene: FBXW7 was added
gene: FBXW7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXW7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FBXW7 were set to 33057194
Phenotypes for gene: FBXW7 were set to FBXW7-related neurodevelopmental syndrome
Review for gene: FBXW7 was set to GREEN
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio developmental disorder study. 12 de novo missense and 1 de novo synonymous variant identified in ~10,000 cases with developmental disorders (no other phenotype info provided).

We are aware of additional cases pending publication.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3768 SPG11 Zornitza Stark Publications for gene: SPG11 were set to
Intellectual disability syndromic and non-syndromic v0.3765 SPTAN1 Zornitza Stark Publications for gene: SPTAN1 were set to
Intellectual disability syndromic and non-syndromic v0.3763 SPEN Zornitza Stark Publications for gene: SPEN were set to 33057194
Intellectual disability syndromic and non-syndromic v0.3760 AFF3 Zornitza Stark Publications for gene: AFF3 were set to
Intellectual disability syndromic and non-syndromic v0.3756 CAPN15 Zornitza Stark gene: CAPN15 was added
gene: CAPN15 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAPN15 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CAPN15 were set to 33410501; 32885237
Phenotypes for gene: CAPN15 were set to Oculogastrointestinal neurodevelopmental syndrome, MIM# 619318
Review for gene: CAPN15 was set to GREEN
Added comment: 5 families reported, including DD/ID in 3. Profound in one family with bi-allelic LoF variant, PMID 33410501.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3753 TMEM222 Konstantinos Varvagiannis gene: TMEM222 was added
gene: TMEM222 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM222 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM222 were set to 33824500
Phenotypes for gene: TMEM222 were set to Motor delay; Delayed speech and language development; Intellectual disability; Generalized hypotonia; Broad-based gait; Abnormality of nervous system morphology; Seizures; Microcephaly; Behavioral abnormality
Penetrance for gene: TMEM222 were set to Complete
Review for gene: TMEM222 was set to GREEN
Added comment: Polla et al (2021 - PMID: 33824500) report 17 individuals from 9 unrelated families, with biallelic TMEM222 pathogenic variants.

The phenotype included motor, speech delay and moderate to severe ID (as universal features). Other manifestations included hypotonia (10/15), broad gait (5/12), seizures (7/17 - belonging to 6/9 families), MRI abnormalities (5/8). Variable behavioral abnormalities were observed (aggressive behavior, shy character, stereotypic movements etc). Abnormal OFC was a feature in several with microcephaly in 7 subjects from 4 families (measurements not available for all 17). Nonspecific facial features were reported in 10/17. Rare features incl. body tremors, decreased lower extremity muscle mass or disorder of motor neurons.

TMEM222 variants were identified following exome sequencing. Previous investigations incl. metabolic studies, FMR1, chromosomes by standard karyotype or CMA, SMA, CMT1A were reported to be normal (available for some individuals).

TMEM222 variants missense and pLoF ones mostly found in homozygosity (7/9 families were consanguineous, compound heterozygosity reported in a single case from the 9 families). Sanger sequencing was used for confirmation of variants, parental carrier state as well as testing of sibs (unaffected sibs tested in 4 families).

Few individuals had additional genetic findings in other genes, though classified as VUS (3 families).

The gene encodes transmembrane protein 222 (208 residues) which however has unknown function. The protein comprises 3 transmembrane domains and a domain of unknown function. TMEMs are a group of transmembrane proteins spanning membranes with - most commonly - unclear function.

The authors measured expression by qPCR mRNA analysis, demonstrating highest fetal and adult brain expression (incl. parietal and occipital cortex). Expression levels from GTEx data also support a role in neurodevelopment.

Immunocytochemistry revealed highest levels in mature human iPSC-derived glutaminergic cortical neurons and moderate in immature ones. Additional studies supported that the gene is highly expressed in dendrites and might play a role in postsynaptic vesicles (colocalization with postsynaptic and early endosomal markers).

A previous study by Riazuddin et al (2017 - PMID: 27457812) had identified TMEM222 as a candidate gene for ID. This family (PKMR213) however appears to be included as family 2 in the aforementioned publication (same pedigree, variant and phenotype in both articles).

In OMIM there is currently no associated phenotype.

The gene is listed among the primary ID genes in SysID.

Please consider inclusion in the ID panel with green (or amber) rating. This gene may also be included in other panels e.g. for epilepsy, microcephaly, etc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3752 CHD5 Zornitza Stark gene: CHD5 was added
gene: CHD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHD5 were set to 33944996
Phenotypes for gene: CHD5 were set to Intellectual disability; Epilepsy
Review for gene: CHD5 was set to GREEN
Added comment: 16 unrelated individuals reported with language deficits (81%), behavioral symptoms (69%), intellectual disability (64%), epilepsy (62%), and motor delay (56%).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3750 FBXO31 Zornitza Stark Publications for gene: FBXO31 were set to 24623383; 32989326
Intellectual disability syndromic and non-syndromic v0.3746 DPYSL5 Zornitza Stark gene: DPYSL5 was added
gene: DPYSL5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DPYSL5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DPYSL5 were set to 33894126
Phenotypes for gene: DPYSL5 were set to Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities
Review for gene: DPYSL5 was set to GREEN
Added comment: Nine individuals with brain malformations, including corpus callosum agenesis and/or posterior fossa abnormalities, associated with variable degrees of intellectual disability. The recurrent de novo p.Glu41Lys was found in eight unrelated patients, and a p.Gly47Arg variant was identified in one individual from the first family reported with Ritscher-Schinzel syndrome. Both impaired DPYSL5 function on dendritic outgrowth regulation by preventing the formation of the ternary complex with MAP2 and βIII-tubulin, ultimately leading to abnormal brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3743 VPS41 Zornitza Stark Publications for gene: VPS41 were set to 32808683
Intellectual disability syndromic and non-syndromic v0.3741 ANKRD17 Zornitza Stark Publications for gene: ANKRD17 were set to
Intellectual disability syndromic and non-syndromic v0.3738 PTPN4 Bryony Thompson gene: PTPN4 was added
gene: PTPN4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTPN4 were set to 17953619; 25424712; 30238967; DOI: https://doi.org/10.1016/j.xhgg.2021.100033
Phenotypes for gene: PTPN4 were set to Intellectual disability; developmental delay
Review for gene: PTPN4 was set to GREEN
Added comment: >3 unrelated probands and supporting mouse model
PMID: 17953619 - knockout mouse model has impaired motor learning and cerebellar synaptic plasticity
PMID: 25424712 - twins with a de novo whole gene deletion and a Rett-like neurodevelopmental disorder
PMID: 30238967 - mosaic de novo variant (p.Leu72Ser) identified in a child with developmental delay, autistic features, hypotonia, increased immunoglobulin E and dental problems. Also supporting mouse assays demonstrating loss of protein expression in dendritic spines
DOI: https://doi.org/10.1016/j.xhgg.2021.100033 - missense and truncating variants in six unrelated individuals with varying degrees of intellectual disability or developmental delay. 5 were able to undergo segregation analysis and found to be de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3736 YWHAG Zornitza Stark Publications for gene: YWHAG were set to
Intellectual disability syndromic and non-syndromic v0.3734 HTT Zornitza Stark Publications for gene: HTT were set to 26740508; 27329733
Intellectual disability syndromic and non-syndromic v0.3732 MED25 Zornitza Stark Publications for gene: MED25 were set to
Intellectual disability syndromic and non-syndromic v0.3730 SIN3B Elena Savva gene: SIN3B was added
gene: SIN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SIN3B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SIN3B were set to PMID: 33811806
Phenotypes for gene: SIN3B were set to Syndromic intellectual disability/autism spectrum disorder
Review for gene: SIN3B was set to GREEN
Added comment: PMID: 33811806
- 9 affected patients, all de novo (2 PTCs, 2 missense, multigenic CNVs)
- syndrome hallmarked by intellectual disability, developmental delay, and dysmorphic facial features with variably penetrant ASD, congenital malformations, corpus callosum defects, and impaired growth.
- All SNV carriers had mild/mod ID
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3727 KCNQ5 Zornitza Stark Publications for gene: KCNQ5 were set to
Intellectual disability syndromic and non-syndromic v0.3724 KCNK9 Zornitza Stark Publications for gene: KCNK9 were set to
Intellectual disability syndromic and non-syndromic v0.3721 PPP2R5C Sue White gene: PPP2R5C was added
gene: PPP2R5C was added to Intellectual disability syndromic and non-syndromic. Sources: Research
Mode of inheritance for gene: PPP2R5C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PPP2R5C were set to macrocephaly; intellectual disability
Penetrance for gene: PPP2R5C were set to Complete
Review for gene: PPP2R5C was set to AMBER
Added comment: Emerging unpublished evidence of monoallelic missense variants causing intellectual disability and macrocephaly
Sources: Research
Intellectual disability syndromic and non-syndromic v0.3720 ADCY5 Zornitza Stark Publications for gene: ADCY5 were set to
Intellectual disability syndromic and non-syndromic v0.3718 KCNJ6 Zornitza Stark Publications for gene: KCNJ6 were set to 25620207
Intellectual disability syndromic and non-syndromic v0.3716 KCNJ6 Zornitza Stark Publications for gene: KCNJ6 were set to
Intellectual disability syndromic and non-syndromic v0.3713 JMJD1C Chris Richmond gene: JMJD1C was added
gene: JMJD1C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: JMJD1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: JMJD1C were set to 26181491; 32996679
Phenotypes for gene: JMJD1C were set to Intellectual disability
Penetrance for gene: JMJD1C were set to unknown
Review for gene: JMJD1C was set to GREEN
Added comment: Reported in ID cohort (with Rett-like phenotypic overlap) with supporting functional studies (PMID: 26181491) "Functional study of the JMJD1C mutant Rett syndrome patient demonstrated that the altered protein had abnormal subcellular localization, diminished activity to demethylate the DNA damage-response protein MDC1, and reduced binding to MECP2. We confirmed that JMJD1C protein is widely expressed in brain regions and that its depletion compromises dendritic activity."

Splice-disrupting JMJD1C variant reported in association with learning disability and myoclonic epilepsy (PMID 32996679)

Disruption of gene due to balanced translocation (PMID 33591602) implicated in autism spectrum disease phenotype.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.3712 AFF4 Zornitza Stark Publications for gene: AFF4 were set to 25730767
Intellectual disability syndromic and non-syndromic v0.3710 AFF4 Zornitza Stark Publications for gene: AFF4 were set to
Intellectual disability syndromic and non-syndromic v0.3704 TGIF1 Zornitza Stark Publications for gene: TGIF1 were set to
Intellectual disability syndromic and non-syndromic v0.3700 NEUROD2 Zornitza Stark gene: NEUROD2 was added
gene: NEUROD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NEUROD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NEUROD2 were set to 33438828; 30323019
Phenotypes for gene: NEUROD2 were set to Epileptic encephalopathy, early infantile, 72, MIM# 618374
Review for gene: NEUROD2 was set to GREEN
Added comment: Four unrelated individuals altogether with de novo variants in this gene, two presenting predominantly with seizures, and two with ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3698 MPLKIP Zornitza Stark Publications for gene: MPLKIP were set to
Intellectual disability syndromic and non-syndromic v0.3692 ERCC5 Zornitza Stark Publications for gene: ERCC5 were set to
Intellectual disability syndromic and non-syndromic v0.3689 ERCC1 Zornitza Stark Publications for gene: ERCC1 were set to
Intellectual disability syndromic and non-syndromic v0.3686 KCNH1 Zornitza Stark Publications for gene: KCNH1 were set to
Intellectual disability syndromic and non-syndromic v0.3683 EMC10 Zornitza Stark Publications for gene: EMC10 were set to PMID: 32869858
Intellectual disability syndromic and non-syndromic v0.3681 HDAC4 Bryony Thompson Publications for gene: HDAC4 were set to 24715439; 20691407; 31209962
Intellectual disability syndromic and non-syndromic v0.3679 PLCH1 Zornitza Stark gene: PLCH1 was added
gene: PLCH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PLCH1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLCH1 were set to 33820834
Phenotypes for gene: PLCH1 were set to Holoprosencephaly spectrum; Severe developmental delay; Brain malformations
Review for gene: PLCH1 was set to AMBER
Added comment: PMID: 33820834 (2021) - Two sibling pairs from two unrelated families with a holoprosencephaly spectrum phenotype and different homozygous PLCH1 variants (c.2065C>T, p.Arg689* and c.4235delA, p.Cys1079ValfsTer16, respectively). One family presented with congenital hydrocephalus, epilepsy, significant developmental delay and a monoventricle or fused thalami; while sibs from the second family had alobar holoprosencephaly and cyclopia. 3/4 individuals also displayed a cleft palate and congenital heart disease. Human embryo immunohistochemistry showed PLCH1 to be expressed in the notorcord, developing spinal cord (in a ventral to dorsal gradient), dorsal root ganglia, cerebellum and dermatomyosome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3677 PIGC Zornitza Stark Publications for gene: PIGC were set to
Intellectual disability syndromic and non-syndromic v0.3674 DDX11 Zornitza Stark Publications for gene: DDX11 were set to
Intellectual disability syndromic and non-syndromic v0.3671 FAR1 Zornitza Stark Publications for gene: FAR1 were set to 25439727
Intellectual disability syndromic and non-syndromic v0.3668 FAR1 Zornitza Stark edited their review of gene: FAR1: Added comment: PMID 33239752: 12 patients with paediatric onset spastic paraparesis and bilateral congenital/juvenile cataracts. Most also had speech and gross motor developmental delay and truncal hypotonia. Exome sequencing identified de novo variants affecting the Arg480 residue in FAR1 (p.Arg480Cys/His/Leu). Further functional studies in fibroblasts showed that these variants cause a disruption of the plasmalogen-dependent feedback regulation of FAR1 protein levels leading to uncontrolled ether lipid production.; Changed rating: GREEN; Changed publications: 25439727, 33239752; Changed phenotypes: Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154, spastic paraparesis and bilateral cataracts; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.3667 GRIA3 Zornitza Stark Publications for gene: GRIA3 were set to
Intellectual disability syndromic and non-syndromic v0.3664 MAPKAPK5 Chirag Patel gene: MAPKAPK5 was added
gene: MAPKAPK5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAPKAPK5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAPKAPK5 were set to PMID: 3344202
Phenotypes for gene: MAPKAPK5 were set to Developmental delay, variable brain anomalies, congenital heart defects, dysmorphic
Review for gene: MAPKAPK5 was set to GREEN
Added comment: 3 individuals from 2 families with severe developmental delay, variable brain anomalies, congenital heart defects, dysmorphic facial features, and a distinctive type of synpolydactyly with an additional hypoplastic digit between the fourth and fifth digits of hands and/or feet. Exome sequencing identified different homozygous truncating variants in MAPKAPK5 in both families, segregating with disease and unaffected parents as carriers.

Patient-derived cells showed no expression of MAPKAPK5 protein isoforms and reduced levels of the MAPKAPK5-interacting protein ERK3. F-actin recovery after latrunculin B treatment was found to be less efficient in patient-derived fibroblasts than in control cells, supporting a role of MAPKAPK5 in F-actin polymerization.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3662 UBE4A Chirag Patel gene: UBE4A was added
gene: UBE4A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE4A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBE4A were set to PMID: 33420346
Phenotypes for gene: UBE4A were set to Intellectual disability and global developmental delay
Review for gene: UBE4A was set to GREEN
Added comment: 8 individuals, from 4 unrelated families, with syndromic intellectual disability and global developmental delay (other clinical features included hypotonia, short stature, seizures, and behaviour disorder. Exome sequencing identified biallelic loss-of-function variants in UBE4A in the 4 families, with variants segregating with disease and parents carriers. They demonstrated that UBE4A loss-of-function variants reduced RNA expression and protein levels in clinical samples. Mice generated to mimic patient-specific Ube4a loss-of-function variant exhibited muscular and neurological/behavioural abnormalities, some of which are suggestive of the clinical abnormalities seen in the affected individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3660 SGSH Zornitza Stark Publications for gene: SGSH were set to
Intellectual disability syndromic and non-syndromic v0.3657 SMPD1 Zornitza Stark Publications for gene: SMPD1 were set to
Intellectual disability syndromic and non-syndromic v0.3654 MFSD8 Zornitza Stark Publications for gene: MFSD8 were set to
Intellectual disability syndromic and non-syndromic v0.3645 USP18 Zornitza Stark Publications for gene: USP18 were set to
Intellectual disability syndromic and non-syndromic v0.3642 TSPOAP1 Ain Roesley gene: TSPOAP1 was added
gene: TSPOAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TSPOAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TSPOAP1 were set to 33539324
Phenotypes for gene: TSPOAP1 were set to Dystonia, intellectual disability and cerebellar atrophy
Penetrance for gene: TSPOAP1 were set to unknown
Review for gene: TSPOAP1 was set to GREEN
Added comment: 7 affecteds from 3 families (1 consanguineous)
2x null, 1x missense

Affecteds with the null variants presented with juvenile-onset progressive generalized dystonia, associated with intellectual disability and cerebellar atrophy while those with the missense p.(Gly1808Ser) presented with isolated adult-onset focal dystonia (mild cognitive impairment noted)

mice KO models were investigated
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3641 NCDN Ain Roesley gene: NCDN was added
gene: NCDN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NCDN was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: NCDN were set to 33711248
Phenotypes for gene: NCDN were set to neurodevelopmental delay, intellectual disability, and epilepsy
Penetrance for gene: NCDN were set to unknown
Added comment: 4x families all missense and de novo except for 1 consag family where 3 affecteds were homozygous and carrier parents unaffected

ID ranged from mild to severe
3/4 probands had seizures
only 3 affecteds had MRI done, with 1 delayed myelination

in vitro studies were done
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3635 SLC45A1 Zornitza Stark Publications for gene: SLC45A1 were set to
Intellectual disability syndromic and non-syndromic v0.3628 PIK3R2 Zornitza Stark Publications for gene: PIK3R2 were set to
Intellectual disability syndromic and non-syndromic v0.3625 NPHP3 Zornitza Stark Publications for gene: NPHP3 were set to 18371931
Intellectual disability syndromic and non-syndromic v0.3625 NPHP3 Zornitza Stark Publications for gene: NPHP3 were set to
Intellectual disability syndromic and non-syndromic v0.3616 HGSNAT Zornitza Stark Publications for gene: HGSNAT were set to
Intellectual disability syndromic and non-syndromic v0.3611 GNPTG Zornitza Stark Publications for gene: GNPTG were set to
Intellectual disability syndromic and non-syndromic v0.3608 CDH11 Zornitza Stark Publications for gene: CDH11 were set to
Intellectual disability syndromic and non-syndromic v0.3604 NMNAT1 Zornitza Stark gene: NMNAT1 was added
gene: NMNAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV, founder tags were added to gene: NMNAT1.
Mode of inheritance for gene: NMNAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NMNAT1 were set to 32533184; 33668384
Phenotypes for gene: NMNAT1 were set to Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual disability, and Leber congenital amaurosis (SHILCA), MIM#619260; Leber congenital amaurosis 9, MIM# 608553
Review for gene: NMNAT1 was set to AMBER
Added comment: Three families reported, but two are distantly related (shared haplotype). The affected children in those two families were homozygous for 7.4-kb duplication involving the last 2 exons of the NMNAT1 gene, spanning the beginning of intron 3 to the middle of the 3-prime UTR (chr1:10,036,359-10,043,727, GRCh37). The third affected individual was compound het for the duplication and a splicing variant.

Note bi-allelic variants in this gene are associated with non-syndromic LCA, multiple families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3602 CLN5 Zornitza Stark Publications for gene: CLN5 were set to
Intellectual disability syndromic and non-syndromic v0.3599 ARSB Zornitza Stark Publications for gene: ARSB were set to
Intellectual disability syndromic and non-syndromic v0.3594 WDR62 Zornitza Stark Publications for gene: WDR62 were set to
Intellectual disability syndromic and non-syndromic v0.3591 TRMT10A Zornitza Stark Publications for gene: TRMT10A were set to
Intellectual disability syndromic and non-syndromic v0.3589 TRAIP Zornitza Stark Publications for gene: TRAIP were set to
Intellectual disability syndromic and non-syndromic v0.3587 STIL Zornitza Stark Publications for gene: STIL were set to
Intellectual disability syndromic and non-syndromic v0.3584 STAMBP Zornitza Stark Publications for gene: STAMBP were set to
Intellectual disability syndromic and non-syndromic v0.3581 RTTN Zornitza Stark Publications for gene: RTTN were set to
Intellectual disability syndromic and non-syndromic v0.3577 NDE1 Zornitza Stark Publications for gene: NDE1 were set to
Intellectual disability syndromic and non-syndromic v0.3574 MSMO1 Zornitza Stark Publications for gene: MSMO1 were set to
Intellectual disability syndromic and non-syndromic v0.3571 MCPH1 Zornitza Stark Publications for gene: MCPH1 were set to
Intellectual disability syndromic and non-syndromic v0.3568 LARP7 Zornitza Stark Publications for gene: LARP7 were set to
Intellectual disability syndromic and non-syndromic v0.3565 KNL1 Zornitza Stark Publications for gene: KNL1 were set to
Intellectual disability syndromic and non-syndromic v0.3560 KIF11 Zornitza Stark Publications for gene: KIF11 were set to 24281367
Intellectual disability syndromic and non-syndromic v0.3558 IER3IP1 Zornitza Stark Publications for gene: IER3IP1 were set to
Intellectual disability syndromic and non-syndromic v0.3555 EFTUD2 Zornitza Stark Publications for gene: EFTUD2 were set to
Intellectual disability syndromic and non-syndromic v0.3552 CEP152 Zornitza Stark Publications for gene: CEP152 were set to
Intellectual disability syndromic and non-syndromic v0.3549 DDB1 Zornitza Stark Publications for gene: DDB1 were set to
Intellectual disability syndromic and non-syndromic v0.3548 ZNF711 Zornitza Stark Mode of inheritance for gene: ZNF711 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.3546 ZNF711 Zornitza Stark Publications for gene: ZNF711 were set to
Intellectual disability syndromic and non-syndromic v0.3545 ZNF711 Zornitza Stark Mode of inheritance for gene: ZNF711 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3544 ZNF711 Chirag Patel reviewed gene: ZNF711: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 27993705, 19377476; Phenotypes: Mental retardation, X-linked 97, OMIM #300803; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3543 DM1 Bryony Thompson STR: DM1 was added
STR: DM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: DM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM1 were set to 20301344; 29325606
Phenotypes for STR: DM1 were set to Myotonic dystrophy 1 MIM#160900
Review for STR: DM1 was set to GREEN
STR: DM1 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_001081560.2:c.*224_*226CTG[X]
RNA toxic gain of function is mechanism of disease
Premutation: 35-49 repeats, no clinical signs
Mild: 50-~150 repeats, age of onset 20-70 yrs, clinical signs - cataracts, mild myotonia
Classic: ~100-~1,000 repeats, age of onset 10-30 yrs, clinical signs - weakness, myotonia, cataracts, balding, cardiac arrhythmia
Congenital: >1,000 repeats, age of onset birth-10 yrs , clinical signs - infantile hypotonia, respiratory deficits, intellectual disability, classic signs in adults
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.3540 INPP4A Zornitza Stark gene: INPP4A was added
gene: INPP4A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INPP4A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: INPP4A were set to 31978615; 31938306; 25338135; 20011524
Phenotypes for gene: INPP4A were set to Intellectual disability
Review for gene: INPP4A was set to AMBER
Added comment: Two families reported with bi-allelic variants and a neurological phenotype. Supportive mouse model and expression data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3538 SATB1 Zornitza Stark edited their review of gene: SATB1: Added comment: Kohlschutter-Tonz syndrome-like (KTZSL) is characterized by global developmental delay with moderately to severely impaired intellectual development, poor or absent speech, and delayed motor skills. Although the severity of the disorder varies, many patients are nonverbal and have hypotonia with inability to sit or walk. Early-onset epilepsy is common and may be refractory to treatment, leading to epileptic encephalopathy and further interruption of developmental progress. Most patients have feeding difficulties with poor overall growth and dysmorphic facial features, as well as significant dental anomalies resembling amelogenesis imperfecta. This phenotype was reported in 28 patients (patients 13 to 40, PMID 33513338), including 9 patients from 3 families. Most variants were de novo, though some were inherited, suggestive of incomplete penetrance and variable expressivity.

Developmental delay with dysmorphic facies and dental anomalies (DEFDA) is characterized by generally mild global developmental delay with variably impaired intellectual development, walking by 2 to 3 years, and slow language acquisition. The severity of the disorder ranges from moderate cognitive deficits to mild learning difficulties or behavioral abnormalities. Most patients have dysmorphic facial features, often with abnormal dentition and nonspecific visual defects, such as myopia, astigmatism, and strabismus. Although rare, involvement of other systems, such as skeletal, cardiac, and gastrointestinal, may be present. 12 individuals from 11 families reported (one inherited variant, affected parent).; Changed phenotypes: Kohlschutter-Tonz syndrome-like, MIM# 619229, Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228, Developmental disorders
Intellectual disability syndromic and non-syndromic v0.3537 INPP5E Zornitza Stark Publications for gene: INPP5E were set to 19668216; 32139166; 29230161; 29052317; 27998989; 27401686
Intellectual disability syndromic and non-syndromic v0.3535 INPP5E Zornitza Stark Publications for gene: INPP5E were set to
Intellectual disability syndromic and non-syndromic v0.3532 CSPP1 Zornitza Stark Publications for gene: CSPP1 were set to
Intellectual disability syndromic and non-syndromic v0.3529 KDM5B Zornitza Stark Publications for gene: KDM5B were set to
Intellectual disability syndromic and non-syndromic v0.3526 TPP2 Zornitza Stark gene: TPP2 was added
gene: TPP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TPP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TPP2 were set to 25525876; 25414442; 33586135; 18362329
Phenotypes for gene: TPP2 were set to Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220
Review for gene: TPP2 was set to GREEN
Added comment: Immunodeficiency-78 with autoimmunity and developmental delay (IMD78) is an autosomal recessive systemic disorder characterized by onset of symptoms in early childhood. Affected individuals present with features of immune deficiency, such as recurrent sinopulmonary or skin infections, as well as autoimmunity, including autoimmune cytopenias, hemolytic anemia, and thrombocytopenia. Autoimmune hepatitis or thyroid disease and central nervous system vasculitis with stroke may also occur. There is increased susceptibility to bacterial, viral, and fungal infections. Laboratory studies show lymphopenia with advanced differentiation and premature senescence of CD8+ T cells and B cells; some patients may have hypergammaglobulinemia. The findings indicate immune dysregulation. Patients also have global developmental delay with speech delay and variable intellectual disability. Five unrelated families and a mouse model.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.3523 DOCK7 Zornitza Stark Publications for gene: DOCK7 were set to
Intellectual disability syndromic and non-syndromic v0.3520 COPB1 Zornitza Stark gene: COPB1 was added
gene: COPB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COPB1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COPB1 were set to 33632302
Phenotypes for gene: COPB1 were set to Severe intellectual disability; variable microcephaly; cataracts
Review for gene: COPB1 was set to AMBER
Added comment: Two unrelated families, some supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3517 WDR45B Zornitza Stark Publications for gene: WDR45B were set to
Intellectual disability syndromic and non-syndromic v0.3514 NT5C2 Zornitza Stark Publications for gene: NT5C2 were set to
Intellectual disability syndromic and non-syndromic v0.3511 HACE1 Zornitza Stark Publications for gene: HACE1 were set to
Intellectual disability syndromic and non-syndromic v0.3508 KIDINS220 Zornitza Stark Publications for gene: KIDINS220 were set to
Intellectual disability syndromic and non-syndromic v0.3505 KDM5C Zornitza Stark Publications for gene: KDM5C were set to
Intellectual disability syndromic and non-syndromic v0.3504 KDM5C Zornitza Stark Mode of inheritance for gene: KDM5C was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3503 KDM5C Zornitza Stark reviewed gene: KDM5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 15586325, 32279304; Phenotypes: Mental retardation, X-linked, syndromic, Claes-Jensen type, MIM# 300534, MONDO:0010355; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3502 AP4M1 Zornitza Stark Publications for gene: AP4M1 were set to
Intellectual disability syndromic and non-syndromic v0.3499 AP4B1 Zornitza Stark Publications for gene: AP4B1 were set to
Intellectual disability syndromic and non-syndromic v0.3496 AP4S1 Zornitza Stark Publications for gene: AP4S1 were set to
Intellectual disability syndromic and non-syndromic v0.3493 AIMP1 Zornitza Stark Publications for gene: AIMP1 were set to
Intellectual disability syndromic and non-syndromic v0.3490 CC2D1A Zornitza Stark Publications for gene: CC2D1A were set to
Intellectual disability syndromic and non-syndromic v0.3487 CDK5RAP2 Zornitza Stark Publications for gene: CDK5RAP2 were set to
Intellectual disability syndromic and non-syndromic v0.3482 SIAH1 Zornitza Stark gene: SIAH1 was added
gene: SIAH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SIAH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SIAH1 were set to 32430360
Phenotypes for gene: SIAH1 were set to Developmental delay; Infantile hypotonia; Dysmorphic features; Laryngomalacia
Review for gene: SIAH1 was set to GREEN
Added comment: - PMID: 32430360 (2021) - Five unrelated individuals with shared features of developmental delay, infantile hypotonia, dysmorphic features and laryngomalacia. All had speech delay and where cognitive assessment was age appropriate individuals exhibited learning difficulties. Trio WES revealed distinct de novo variants in SIAH1. In vitro assays demonstrated that SIAH1 mutants induce loss of Wnt stimulatory activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3480 EEF2 Zornitza Stark gene: EEF2 was added
gene: EEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EEF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EEF2 were set to 33355653
Phenotypes for gene: EEF2 were set to Neurodevelopmental disorder; macrocephaly; hydrocephalus
Review for gene: EEF2 was set to GREEN
Added comment: De novo EEF2 missense variants reported in 3 unrelated children (3, 6 and 9 years of age) with a mild neurodevelopmental phenotype comprising motor delay and relative macrocephaly associated with ventriculomegaly.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3478 DLK1 Zornitza Stark Publications for gene: DLK1 were set to PMID: 28324015
Intellectual disability syndromic and non-syndromic v0.3476 DLK1 Natasha Brown Source Genetic Health Queensland was removed from DLK1.
Source Literature was added to DLK1.
Mode of inheritance for gene DLK1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Phenotypes for gene: DLK1 were changed from to central precocious puberty
Penetrance for gene DLK1 was set from to None
Publications for gene DLK1 were changed from PMID: 28324015 to PMID: 28324015
Intellectual disability syndromic and non-syndromic v0.3474 EIF5A Zornitza Stark gene: EIF5A was added
gene: EIF5A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF5A were set to 33547280
Phenotypes for gene: EIF5A were set to Intellectual disability; microcephaly; dysmorphism
Review for gene: EIF5A was set to GREEN
Added comment: 7 unrelated individuals reported with de novo variants in this gene and variable combinations of developmental delay, microcephaly, micrognathia and dysmorphism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3472 POLRMT Zornitza Stark gene: POLRMT was added
gene: POLRMT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLRMT was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: POLRMT were set to 33602924
Phenotypes for gene: POLRMT were set to Mitochondrial disorder; intellectual disability; hypotonia
Review for gene: POLRMT was set to GREEN
Added comment: 8 individuals from 7 families reported. 5 families with bi-allelic variants and 2 with heterozygous variants. Affected individuals presented with global developmental delay, hypotonia, short stature, and speech/intellectual disability in childhood; one subject displayed an indolent progressive external ophthalmoplegia phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3467 MED27 Alison Yeung gene: MED27 was added
gene: MED27 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED27 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED27 were set to 33443317
Phenotypes for gene: MED27 were set to Intellectual disability; cerebellar hypoplasia; dystonia
Review for gene: MED27 was set to GREEN
gene: MED27 was marked as current diagnostic
Added comment: 16 patients from 11 families reported
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3465 FOXP2 Zornitza Stark Publications for gene: FOXP2 were set to
Intellectual disability syndromic and non-syndromic v0.3462 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439; 32453716
Phenotypes for gene: TOGARAM1 were set to Joubert syndrome 37, MIM# 619185
Review for gene: TOGARAM1 was set to GREEN
Added comment: Six families reported with features of ciliopathy, including molar tooth sign consistent with Joubert syndrome. In some of the families the disorder presented prenatally; however, severe ID in survivors including absent speech.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3457 LMNB1 Zornitza Stark Phenotypes for gene: LMNB1 were changed from Global developmental delay, Intellectual disability, Microcephaly, Short stature, Seizures, Abnormality of the corpus callosum, Cortical gyral simplification, Feeding difficulties, Scoliosis; Leukodystrophy, adult-onset, autosomal dominant, MIM#169500 to Microcephaly 26, primary, autosomal dominant, MIM# 619179; Global developmental delay, Intellectual disability, Microcephaly, Short stature, Seizures, Abnormality of the corpus callosum, Cortical gyral simplification, Feeding difficulties, Scoliosis; Leukodystrophy, adult-onset, autosomal dominant, MIM#169500
Intellectual disability syndromic and non-syndromic v0.3454 MSL3 Zornitza Stark Publications for gene: MSL3 were set to
Intellectual disability syndromic and non-syndromic v0.3453 MSL3 Zornitza Stark Mode of inheritance for gene: MSL3 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3452 MSL3 Zornitza Stark reviewed gene: MSL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 33173220; Phenotypes: Basilicata-Akhtar syndrome, OMIM # 301032; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3451 TOE1 Zornitza Stark Publications for gene: TOE1 were set to
Intellectual disability syndromic and non-syndromic v0.3448 CLP1 Zornitza Stark Publications for gene: CLP1 were set to
Intellectual disability syndromic and non-syndromic v0.3445 CHMP1A Zornitza Stark Publications for gene: CHMP1A were set to
Intellectual disability syndromic and non-syndromic v0.3442 BRF1 Zornitza Stark Publications for gene: BRF1 were set to
Intellectual disability syndromic and non-syndromic v0.3440 CLCN6 Zornitza Stark Phenotypes for gene: CLCN6 were changed from Developmental delay; neurodegeneration to Neurodegeneration, childhood-onset, hypotonia, respiratory insufficiency and brain imaging abnormalities, MIM# 619173; Developmental delay; neurodegeneration
Intellectual disability syndromic and non-syndromic v0.3439 CLCN6 Zornitza Stark edited their review of gene: CLCN6: Changed phenotypes: Neurodegeneration, childhood-onset, hypotonia, respiratory insufficiency and brain imaging abnormalities, MIM# 619173, Developmental delay, neurodegeneration
Intellectual disability syndromic and non-syndromic v0.3438 OTUD5 Zornitza Stark Publications for gene: OTUD5 were set to PMID: 33131077
Intellectual disability syndromic and non-syndromic v0.3435 SLC46A1 Zornitza Stark Publications for gene: SLC46A1 were set to
Intellectual disability syndromic and non-syndromic v0.3432 PRUNE1 Zornitza Stark Publications for gene: PRUNE1 were set to
Intellectual disability syndromic and non-syndromic v0.3429 TRIM8 Zornitza Stark Publications for gene: TRIM8 were set to 30244534; 27346735; 23934111
Intellectual disability syndromic and non-syndromic v0.3427 PIGF Paul De Fazio gene: PIGF was added
gene: PIGF was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIGF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGF were set to 33386993
Phenotypes for gene: PIGF were set to Glycosylphosphatidylinositol deficiency, onychodystrophy, osteodystrophy, intellectual disability, and seizures
Review for gene: PIGF was set to RED
gene: PIGF was marked as current diagnostic
Added comment: The same homozygous missense variant identified in 2 individuals from different families from the same region of India. Individuals had a phenotype similar to DOORS syndrome without deafness. Impaired glycosylphosphatidylinositol (GPI) biosynthesis was demonstrated.

Rated Red as the two families are likely to be related (founder mutation?).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3426 HIRA Paul De Fazio gene: HIRA was added
gene: HIRA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIRA was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HIRA were set to 33417013; 28135719; 25363760
Phenotypes for gene: HIRA were set to Neurodevelopmental disorder
Review for gene: HIRA was set to GREEN
gene: HIRA was marked as current diagnostic
Added comment: Two unrelated patients with different de novo loss of function variants identified in PMID 33417013:

Individual 1: intragenic deletion, phenotype included psychomotor retardation, ID, growth retardation, microcephaly, and facial features reminiscent of 22q deletion syndrome.
Individual 2: canonical splice variant, phenotype mostly confined to ASD

Another two de novo variants were identified in the literature by the authors of that paper, one stop-gain (DDD study, PMID 28135719) and one missense (large autism cohort, PMID 25363760).

PMID 33417013 also showed that HIRA knockdown in mice results in neurodevelopmental abnormalities.

Rated Green due to 4 unrelated individuals (albeit 2 in large cohort studies) and a mouse model. NB: HIRA is within the common 22q deletion region.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3422 SATB1 Zornitza Stark Publications for gene: SATB1 were set to 33057194
Intellectual disability syndromic and non-syndromic v0.3420 METAP1 Paul De Fazio gene: METAP1 was added
gene: METAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: METAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: METAP1 were set to 32764695
Phenotypes for gene: METAP1 were set to Intellectual disability, aggression, neurodevelopmental delay
Review for gene: METAP1 was set to RED
gene: METAP1 was marked as current diagnostic
Added comment: Biallelic nonsense (NMD-predicted) variant identified in 4 sibs in a consanguineous family with dev delay. One sib had bilateral clinodactyly of her toes and her left 3rd finger, other sibs were not dysmorphic. Rated red due to single consanguineous family.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3420 KCNN2 Ain Roesley gene: KCNN2 was added
gene: KCNN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNN2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KCNN2 were set to 33242881
Phenotypes for gene: KCNN2 were set to neurodevelopmental movement disorders
Penetrance for gene: KCNN2 were set to unknown
Review for gene: KCNN2 was set to GREEN
Added comment: - 11 probands all de novo except for 1 mother-daughter pair.
- a mix of null and missense variants
- 2/11 with microcephaly, 10/11 motor delay, 7/11 language delay (excluding 2 with regression), all with varying degrees of ID, 3/11 seizures, 7/11 movement disorder, 4/11 cerebellar ataxia, 6/11 MRI anomalies

additional variants were noted in 2 patients: 1x cHet for variants in MED12L and 1x de novo TNK2 variant

patch clamp functional studies were also done
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3420 OTUD5 Chirag Patel gene: OTUD5 was added
gene: OTUD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: OTUD5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: OTUD5 were set to PMID: 33131077
Phenotypes for gene: OTUD5 were set to X-linked severe neurodevelopmental delay, hydrocephalus, and early lethality
Review for gene: OTUD5 was set to RED
Added comment: 13 male patients from a single family with three generations affected. Patients presented prenatally or during the neonatal period with IUGR, ventriculomegaly, hydrocephalus, hypotonia, congenital heart defects, hypospadias, and severe neurodevelopmental delay. The disease is typically fatal during infancy, mainly due to sepsis (pneumonias). Female carriers are asymptomatic. WGS in four individuals identified a unique candidate variant in the OTUD5 gene (NM_017602.3:c.598G > A, p.Glu200Lys). The variant cosegregated with the disease in 10 tested individuals. No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3418 NBEA Zornitza Stark Phenotypes for gene: NBEA were changed from Intellectual disability; Seizures to Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157; Intellectual disability; Seizures
Intellectual disability syndromic and non-syndromic v0.3417 NBEA Zornitza Stark edited their review of gene: NBEA: Changed phenotypes: Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157, Intellectual disability, Seizures
Intellectual disability syndromic and non-syndromic v0.3416 SDHAF1 Zornitza Stark Publications for gene: SDHAF1 were set to
Intellectual disability syndromic and non-syndromic v0.3413 UPB1 Zornitza Stark Publications for gene: UPB1 were set to
Intellectual disability syndromic and non-syndromic v0.3409 UROC1 Zornitza Stark Publications for gene: UROC1 were set to
Intellectual disability syndromic and non-syndromic v0.3405 LAS1L Zornitza Stark Publications for gene: LAS1L were set to 25644381; 25644381
Intellectual disability syndromic and non-syndromic v0.3401 CBY1 Bryony Thompson gene: CBY1 was added
gene: CBY1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CBY1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CBY1 were set to 33131181; 25103236; 25220153
Phenotypes for gene: CBY1 were set to intellectual disability; cerebellar ataxia; molar tooth sign; polydactyly; Joubert syndrome
Review for gene: CBY1 was set to GREEN
Added comment: Three cases in two unrelated consanguineous families with homozygous loss of function variants, with ID as a feature of the phenotype. Multiple null model organisms recapitulate the human phenotype: Null mouse model had cystic kidneys, a phenotype common to ciliopathies. Reducing Cby levels in Xenopus laevis model reduced the density of multiciliated cells, the number of basal bodies per multiciliated cell, and the numbers of neural tube primary cilia; it also led to abnormal development of the neural crest, central nervous system, and pronephros. Depletion of cby1 in zebrafish results in ciliopathy‐related phenotypes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3399 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Intellectual disability syndromic and non-syndromic v0.3396 HIST1H1E Zornitza Stark Publications for gene: HIST1H1E were set to
Intellectual disability syndromic and non-syndromic v0.3393 EED Zornitza Stark Publications for gene: EED were set to
Intellectual disability syndromic and non-syndromic v0.3390 PPP2R5D Zornitza Stark Publications for gene: PPP2R5D were set to
Intellectual disability syndromic and non-syndromic v0.3385 SCAMP5 Zornitza Stark Publications for gene: SCAMP5 were set to PMID: 31439720
Intellectual disability syndromic and non-syndromic v0.3384 SCAMP5 Zornitza Stark edited their review of gene: SCAMP5: Added comment: PMID 33390987: Four unrelated individuals reported with same de novo missense variant, p. Gly180Trp. The onset age of seizures was ranged from 6 to 15 months. Patients had different types of seizures, including focal seizures, generalized tonic-clonic seizures and tonic seizure. One patient showed typical autism spectrum disorder (ASD) symptoms. Electroencephalogram (EEG) findings presented as focal or multifocal discharges, sometimes spreading to generalization. Brain magnetic resonance imaging (MRI) abnormalities were present in each patient. Severe intellectual disability and language and motor developmental disorders were found in our patients, with all patients having poor language development and were nonverbal at last follow-up. All but one of the patients could walk independently in childhood, but the ability to walk independently in one patient had deteriorated with age. All patients had abnormal neurological exam findings, mostly signs of extrapyramidal system involvement. Dysmorphic features were found in 2/4 patients, mainly in the face and trunk.; Changed rating: GREEN; Changed publications: 33390987; Changed phenotypes: Intellectual disability, seizures, autism; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.3383 ZNF526 Zornitza Stark gene: ZNF526 was added
gene: ZNF526 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF526 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF526 were set to 21937992; 25558065; 33397746
Phenotypes for gene: ZNF526 were set to Intellectual disability; Microcephaly; Cataracts; Epilepsy; Hypertonia; Dystonia
Review for gene: ZNF526 was set to GREEN
Added comment: Currently not associated with any phenotype in OMIM (last updated on 09/12/2011), but has a 'possible' disease confidence rating for 'Autosomal Recessive Mental Retardation' in Gene2Phenotype.

- PMID: 21937992 (2011) - Two unrelated families (with 4 affected individuals in each) with non-syndromic ID (mild or moderate, respectively) identified harbouring different biallelic missense variants in the ZNF526 gene.

- PMID: 25558065 (2015) - One family with ID, Noonan-like facies, pulmonary stenosis and a homozygous missense variant in this gene. No further details provided.

- PMID: 33397746 (2021) - Five individuals from four unrelated families with homozygous ZNF526 variants. Four harboured truncating variants, and were all affected by profound DD and severe ID, microcephaly (ranging from -4 SD to -8 SD), bilateral progressive cataracts, hypertonic-dystonic movements, epilepsy and brain MRI anomalies. The fifth patient had a homozygous missense variant and a slightly less severe disorder, with postnatal microcephaly (-2 SD), progressive bilateral cataracts, severe ID, and normal brain MRI. Zebrafish model demonstrated brain and eye malformations resembling findings seen in the human holoprosencephaly spectrum
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3380 CELF2 Zornitza Stark gene: CELF2 was added
gene: CELF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CELF2 were set to 33131106
Phenotypes for gene: CELF2 were set to Developmental and epileptic encephalopathy
Review for gene: CELF2 was set to GREEN
Added comment: Five unrelated individuals reported. Four with de novo variants, and one inherited from a mosaic mother. Notably, all identified variants, except for c.272‐1G>C, were clustered within 20 amino acid residues of the C‐terminus, which might be a nuclear localization signal.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3378 FGF13 Zornitza Stark gene: FGF13 was added
gene: FGF13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FGF13 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: FGF13 were set to 33245860
Phenotypes for gene: FGF13 were set to Intellectual disability; epilepsy
Mode of pathogenicity for gene: FGF13 was set to Other
Review for gene: FGF13 was set to GREEN
Added comment: Two sibling pairs and three unrelated males reported who presented in infancy with intractable focal seizures and severe developmental delay. The variants were located in the N-terminal domain of the A isoform of FGF13/FHF2 (FHF2A). The X-linked FHF2 gene (also known as FGF13) has alternative first exons which produce multiple protein isoforms that differ in their N-terminal sequence. The variants were located at highly conserved residues in the FHF2A inactivation particle that competes with the intrinsic fast inactivation mechanism of Nav channels. Functional characterization of mutant FHF2A co-expressed with wild-type Nav1.6 (SCN8A) revealed that mutant FHF2A proteins lost the ability to induce rapid-onset, long-term blockade of the channel while retaining pro-excitatory properties. These gain-of-function effects are likely to increase neuronal excitability consistent with the epileptic potential of FHF2 variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3376 UBR7 Zornitza Stark gene: UBR7 was added
gene: UBR7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBR7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBR7 were set to 33340455
Phenotypes for gene: UBR7 were set to Intellectual disability; epilepsy; hypothyroidism; congenital anomalies; dysmorphic features
Review for gene: UBR7 was set to GREEN
Added comment: Seven individuals from 6 unrelated families. All had developmental delay, and all males had urogenital anomalies, namely cryptorchidism in 5/6 and small penis in 1/6. Six individuals had seizures and hypotonia. Hypothyroidism was present in 4/7 individuals, and ptosis was noted in 6/7 individuals. Five individuals exhibited cardiac abnormalities: two had ventricular septal defect, one had atrial septal defect, one had a patent ductus arteriosus requiring surgery, and the other had a patent ductus arteriosus and a patent foramen ovale that both closed spontaneously. Five individuals had short stature (height < 3rd percentile). Physical examination revealed various dysmorphic features, including prominent forehead (3/7), hypertelorism (4/7), telecanthus (1/7), epicanthus(1/7), downslanting palpebral fissures (3/7), thick eyebrow (1/7), low-set ears (3/7), long philtrum (2/7), unilateral single transverse palmar crease (1/7), and hypertrichosis (1/7).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3370 CAMK2B Zornitza Stark Publications for gene: CAMK2B were set to
Intellectual disability syndromic and non-syndromic v0.3368 RALGAPB Elena Savva gene: RALGAPB was added
gene: RALGAPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RALGAPB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RALGAPB were set to PMID: 32853829
Phenotypes for gene: RALGAPB were set to Neurodevelopmental disorders, autism
Review for gene: RALGAPB was set to RED
Added comment: PMID: 32853829 - Reviews previous publications and identifies 10 de novo variants (5 PTCs, 5 missense) in patients with ASD (7/10), epilepsy (2/10) and developmental delay (1/10).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3368 RNU7-1 Paul De Fazio gene: RNU7-1 was added
gene: RNU7-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU7-1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNU7-1 were set to 33230297
Phenotypes for gene: RNU7-1 were set to Aicardi–Goutières syndrome-like
Review for gene: RNU7-1 was set to GREEN
gene: RNU7-1 was marked as current diagnostic
Added comment: Review originally submitted by Ming Wong
- 16 affected individuals from 11 families
- Compared to control fibroblasts, patient fibroblasts were enriched for misprocessed forms of
replication-dependent histone (RDH) mRNAs
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3368 LSM11 Ee Ming Wong gene: LSM11 was added
gene: LSM11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LSM11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LSM11 were set to PMID: 33230297
Phenotypes for gene: LSM11 were set to type I interferonopathy Aicardi–Goutières syndrome
Review for gene: LSM11 was set to RED
gene: LSM11 was marked as current diagnostic
Added comment: - Two affected siblings from a consanguineous family carrying a homozygous variant in LSM11
- Compared to control fibroblasts, patient fibroblasts were enriched for misprocessed forms of
replication-dependent histone (RDH) mRNAs
- Knockdown of LSM11 in THP-1 cells results in an increase in misprocessed RDH mRNA and
interferon signaling

(added as Red as per discussion with Seb)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3367 DPH2 Paul De Fazio gene: DPH2 was added
gene: DPH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DPH2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DPH2 were set to 32576952; 27421267
Phenotypes for gene: DPH2 were set to Diphthamide-deficiency syndrome
Review for gene: DPH2 was set to AMBER
gene: DPH2 was marked as current diagnostic
Added comment: One 19 month old reported (PMID:32576952) with biallelic (one missense, one nonsense) variants in DPH2, with phenotype similar to DPH1 deficiency (gross motor delay, not walking, fine motor and expressive language delays, macrocephaly)

Another family (sibs) was previously reported with biallelic nonsense variants (PMID:27421267) with a comparable phenotype, this family also has biallelic variants in KALRN and the authors thought those variants more likely causative. Patients had ID and microcephaly (in contrast to the 19 month old above).

In vitro functional assays support reduced diphthamide synthesis activity for the variants identified in PMID:32576952.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3367 FBRSL1 Elena Savva gene: FBRSL1 was added
gene: FBRSL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBRSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FBRSL1 were set to PMID: 32424618
Phenotypes for gene: FBRSL1 were set to Malformation and intellectual disability syndrome
Review for gene: FBRSL1 was set to GREEN
Added comment: Three children with de novo PTCs that escape NMD, and an overlapping syndromic phenotype with respiratory insufficiency, postnatal growth restriction, microcephaly, global developmental delay and other malformations. 2/3 had heart defects, cleft palate and hearing impairement.
Supported by Xenopus oocyte functional studies
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3366 MLYCD Zornitza Stark Publications for gene: MLYCD were set to
Intellectual disability syndromic and non-syndromic v0.3363 KCNQ3 Zornitza Stark Publications for gene: KCNQ3 were set to
Intellectual disability syndromic and non-syndromic v0.3358 ATIC Zornitza Stark Publications for gene: ATIC were set to
Intellectual disability syndromic and non-syndromic v0.3355 SOX2 Zornitza Stark Publications for gene: SOX2 were set to
Intellectual disability syndromic and non-syndromic v0.3352 RERE Zornitza Stark Publications for gene: RERE were set to
Intellectual disability syndromic and non-syndromic v0.3349 RARB Zornitza Stark Publications for gene: RARB were set to
Intellectual disability syndromic and non-syndromic v0.3346 SMOC1 Zornitza Stark Publications for gene: SMOC1 were set to
Intellectual disability syndromic and non-syndromic v0.3343 MAB21L2 Zornitza Stark Publications for gene: MAB21L2 were set to
Intellectual disability syndromic and non-syndromic v0.3340 PDSS1 Zornitza Stark Publications for gene: PDSS1 were set to
Intellectual disability syndromic and non-syndromic v0.3334 TUSC3 Zornitza Stark Publications for gene: TUSC3 were set to
Intellectual disability syndromic and non-syndromic v0.3331 TMEM165 Zornitza Stark Publications for gene: TMEM165 were set to
Intellectual disability syndromic and non-syndromic v0.3329 EXT2 Zornitza Stark Publications for gene: EXT2 were set to
Intellectual disability syndromic and non-syndromic v0.3327 ST3GAL5 Zornitza Stark Publications for gene: ST3GAL5 were set to PubMed: 15502825; 22990144; 24026681; 27232954; 30185102; 24026681
Intellectual disability syndromic and non-syndromic v0.3325 RFT1 Zornitza Stark Publications for gene: RFT1 were set to
Intellectual disability syndromic and non-syndromic v0.3322 MGAT2 Zornitza Stark Publications for gene: MGAT2 were set to
Intellectual disability syndromic and non-syndromic v0.3319 MPI Zornitza Stark Publications for gene: MPI were set to
Intellectual disability syndromic and non-syndromic v0.3315 PGM3 Zornitza Stark Publications for gene: PGM3 were set to
Intellectual disability syndromic and non-syndromic v0.3312 PGAP3 Zornitza Stark Publications for gene: PGAP3 were set to 24439110; 29620724; 30345601; 30217754
Intellectual disability syndromic and non-syndromic v0.3311 PGAP3 Zornitza Stark Publications for gene: PGAP3 were set to
Intellectual disability syndromic and non-syndromic v0.3308 PGAP2 Zornitza Stark Publications for gene: PGAP2 were set to
Intellectual disability syndromic and non-syndromic v0.3305 PIGV Zornitza Stark Publications for gene: PIGV were set to
Intellectual disability syndromic and non-syndromic v0.3301 PIGO Zornitza Stark Publications for gene: PIGO were set to
Intellectual disability syndromic and non-syndromic v0.3298 PIGN Zornitza Stark Publications for gene: PIGN were set to
Intellectual disability syndromic and non-syndromic v0.3295 PIGL Zornitza Stark Publications for gene: PIGL were set to
Intellectual disability syndromic and non-syndromic v0.3292 B3GALNT2 Zornitza Stark Publications for gene: B3GALNT2 were set to
Intellectual disability syndromic and non-syndromic v0.3289 MPDU1 Zornitza Stark Publications for gene: MPDU1 were set to
Intellectual disability syndromic and non-syndromic v0.3286 DPAGT1 Zornitza Stark Publications for gene: DPAGT1 were set to
Intellectual disability syndromic and non-syndromic v0.3283 DOLK Zornitza Stark Publications for gene: DOLK were set to
Intellectual disability syndromic and non-syndromic v0.3280 EZH2 Zornitza Stark Publications for gene: EZH2 were set to
Intellectual disability syndromic and non-syndromic v0.3277 COG5 Zornitza Stark Publications for gene: COG5 were set to
Intellectual disability syndromic and non-syndromic v0.3273 PPIL1 Zornitza Stark gene: PPIL1 was added
gene: PPIL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPIL1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPIL1 were set to 33220177
Phenotypes for gene: PPIL1 were set to Pontocerebellar hypoplasia; microcephaly; seizures
Review for gene: PPIL1 was set to GREEN
Added comment: 17 individuals from 9 unrelated families reported with bi-allelic variants in the gene and PCH, microcephaly, hypotonia, seizures, severe DD/ID. Mouse models support gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3270 FRA12A Bryony Thompson STR: FRA12A was added
STR: FRA12A was added to Intellectual disability syndromic and non-syndromic. Sources: Other
5'UTR tags were added to STR: FRA12A.
Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA12A were set to 17236128
Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630
Review for STR: FRA12A was set to AMBER
Added comment: NM_173602.2:c.-137CGG[X]
All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp.
70 controls used to determine the "normal" repeat range.
Sources: Other
Intellectual disability syndromic and non-syndromic v0.3268 FRAXE Bryony Thompson STR: FRAXE was added
STR: FRAXE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FRAXE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXE were set to 8334699; 8673085; 11388762
Phenotypes for STR: FRAXE were set to Fragile X syndrome, FRAXE type (OMIM 309548)
Review for STR: FRAXE was set to GREEN
STR: FRAXE was marked as clinically relevant
STR: FRAXE was marked as current diagnostic
Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25)
Loss of function through methylation silencing is the mechanism of disease
Normal - 5-44 repeats
Inconclusive - 45-54 repeats
Premutation - 55-200 repeats
Abnormal - >200 or >230 repeats
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.3267 RAP1B Zornitza Stark Publications for gene: RAP1B were set to PMID: 32627184
Intellectual disability syndromic and non-syndromic v0.3264 RAP1B Chirag Patel gene: RAP1B was added
gene: RAP1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAP1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAP1B were set to PMID: 32627184
Phenotypes for gene: RAP1B were set to RAP1B‐associated phenotype, no OMIM #
Review for gene: RAP1B was set to RED
Added comment: De novo variants in the RAP1B gene (c.35G>T p.(Gly12Val) and c.178G>C p.(Gly60Arg)) in two unrelated patients with thrombocytopenia, microcephaly, learning difficulties, renal malformations, structural anomalies of the brain and other features (not Kabuki like).

RAP1B is a member of the RAS superfamily of small GTPases. There is strong evidence that the p.Gly12Val and p.Gly60Arg variants in the RAP1B gene lead into a dysregulation of the downstream pathway. Both substitutions have been described previously as dominant constitutively active in RAS‐related proteins (gain of function variants).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3263 EMC10 Chirag Patel gene: EMC10 was added
gene: EMC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EMC10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EMC10 were set to PMID: 32869858
Phenotypes for gene: EMC10 were set to Developmental delay and intellectual disability, no OMIM#
Review for gene: EMC10 was set to RED
Added comment: Homozygous variants of EMC1 are associated with GDD, scoliosis, and cerebellar atrophy, indicating the relevance of this pathway for neurogenetic disorders.

One Saudi family with 2 affected individuals with mild ID, speech delay, and GDD.
WES and Sanger sequencing revealed a homozygous splice acceptor site variant (c.679‐1G>A) in EMC10 . Variant segregated within the family. RT‐qPCR showed a substantial decrease in the relative EMC10 gene expression in the patients.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3262 FBXO28 Zornitza Stark changed review comment from: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All patients had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features.
Sources: Literature; to: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3261 FBXO28 Zornitza Stark gene: FBXO28 was added
gene: FBXO28 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXO28 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FBXO28 were set to 33280099
Phenotypes for gene: FBXO28 were set to Developmental and epileptic encephalopathy
Review for gene: FBXO28 was set to GREEN
Added comment: Nine new individuals with FBXO28 pathogenic variants (four missense, including one recurrent, three nonsense, and one frameshift) and all 10 known cases reviewed to delineate the phenotypic spectrum. All patients had epilepsy and 9 of 10 had DEE, including infantile spasms (3) and a progressive myoclonic epilepsy (1). Median age at seizure onset was 22.5 months (range 8 months to 5 years). Nine of 10 patients had intellectual disability, which was profound in six of nine and severe in three of nine. Movement disorders occurred in eight of 10 patients, six of 10 had hypotonia, four of 10 had acquired microcephaly, and five of 10 had dysmorphic features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3260 RLIM Zornitza Stark Publications for gene: RLIM were set to 29728705; 25735484; 25644381
Intellectual disability syndromic and non-syndromic v0.3257 CLCN6 Zornitza Stark gene: CLCN6 was added
gene: CLCN6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CLCN6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CLCN6 were set to 33217309
Phenotypes for gene: CLCN6 were set to Developmental delay; neurodegeneration
Review for gene: CLCN6 was set to GREEN
Added comment: Three unrelated families reported with recurrent GOF de novo c.1658A>G (p.Tyr553Cys) and severe developmental delay with pronounced generalized hypotonia, respiratory insufficiency, and variable neurodegeneration and diffusion restriction in cerebral peduncles, midbrain, and/or brainstem in MRI scans.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3254 SMG8 Zornitza Stark Publications for gene: SMG8 were set to 31130284
Intellectual disability syndromic and non-syndromic v0.3250 VPS4A Kristin Rigbye gene: VPS4A was added
gene: VPS4A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VPS4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: VPS4A were set to 33186543; 33186545
Phenotypes for gene: VPS4A were set to Neurodevelopmental disorder
Review for gene: VPS4A was set to GREEN
Added comment: PMID: 33186543 - 2x de novo hetorozygous missense variants in the AAA (large ATPase) domain.
1x homozygous missense in the MIT domain (milder phenotype and unaffected parents - possibly just a simple LoF mechanism for AR inheritance).
Demonstrated defective CD71 trafficking in all 3 patients.

PMID: 33186545 - 6x probands with de novo missense variants in the AAA domain. 5 of the variants were at amino acid position 284 (changes to Trp and Gly).
Demonstrated that the variants had a dominant-negative effect on VPS4A function.

"The six probands with de novo substitutions affecting Glu206 or Arg284 had a consistent phenotype characterized by severe DD, profound ID, and dystonia. Children were very delayed in establishing head control and none achieved independent walking. Other common findings were cerebellar hypoplasia (five individuals out of six, the other showing uncharacterized severe cerebral atrophy) with a variable degree of corpus callosum hypoplasia. One individual also had bilateral polymicrogyria. Epilepsy was present in three and dystonia in five subjects. Eye involvement was also a common finding, including congenital cataract, retinal dystrophy, and in one case congenital Leber amaurosis. Four individuals were diagnosed with hepatosplenomegaly and/or steatosis. Three subjects had anemia, which was characterized as dyserythropoietic in two. Severe feeding difficulties were present in four individuals, requiring assisted feeding in three. Two had sensorineural deafness. Severe growth retardation, generally for all parameters, was present in most cases. Notably, severe microcephaly (typically with Z scores < −5) was universal. Overall, the disorder seems to have a poor prognosis as two affected individuals died in childhood or early adult life."
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3249 HS2ST1 Ain Roesley gene: HS2ST1 was added
gene: HS2ST1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HS2ST1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HS2ST1 were set to 33159882
Penetrance for gene: HS2ST1 were set to unknown
Added comment: - 4 affected from 3 unrelated families
- 3 unique missense and 2 PTCs
- Developmental Delay, Corpus Callosum Hypoplasia or Aplasia, and Skeletal and Renal Abnormalities
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3248 KDM4B Kristin Rigbye gene: KDM4B was added
gene: KDM4B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KDM4B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KDM4B were set to PMID: 33232677
Phenotypes for gene: KDM4B were set to Global developmental delay, intellectual disability and neuroanatomical defects
Review for gene: KDM4B was set to GREEN
Added comment: Nine individuals with mono-allelic de novo or inherited variants in KDM4B.

All individuals presented with dysmorphic features and global developmental delay (GDD) with language and motor skills most affected. Three individuals had a history of seizures, and four had anomalies on brain imaging ranging from agenesis of the corpus callosum with hydrocephalus to cystic formations, abnormal hippocampi, and polymicrogyria.

In a knockout mouse the total brain volume was significantly reduced with decreased
size of the hippocampal dentate gyrus, partial agenesis of the corpus callosum, and ventriculomegaly.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3248 BICRA Paul De Fazio gene: BICRA was added
gene: BICRA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BICRA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BICRA were set to 33232675
Phenotypes for gene: BICRA were set to Developmental delay, intellectual disability, autism spectrum disorder,behavioral abnormalities, dysmorphic features
Review for gene: BICRA was set to GREEN
gene: BICRA was marked as current diagnostic
Added comment: 12 individuals reported, 11 de novo (1 not resolved), "with neurodevelopmental phenotypes—developmental delay (HP:0001263), intellectual disability (HP:0001249), autism spectrum disorder (HP:0000729), and/or behavioral phenotypes (HP:0000708)—and variable structural birth defects and dysmorphic features". Mostly LoF or gene deletions, but 2 missense reported. Zebrafish model supports the gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3246 AGO2 Zornitza Stark gene: AGO2 was added
gene: AGO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AGO2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AGO2 were set to 33199684
Phenotypes for gene: AGO2 were set to Intellectual disability
Review for gene: AGO2 was set to GREEN
Added comment: 21 individuals reported, five variants (p.L192P, p.G201V, p.T357M, p.M364T, p.C751Y) were recurrent. Variable ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3243 H3F3B Zornitza Stark Publications for gene: H3F3B were set to
Intellectual disability syndromic and non-syndromic v0.3239 H3F3A Zornitza Stark Publications for gene: H3F3A were set to
Intellectual disability syndromic and non-syndromic v0.3235 HIVEP2 Zornitza Stark Publications for gene: HIVEP2 were set to
Intellectual disability syndromic and non-syndromic v0.3233 TFE3 Zornitza Stark Mode of inheritance for gene: TFE3 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3232 TFE3 Zornitza Stark Publications for gene: TFE3 were set to 30595499; 31833172
Intellectual disability syndromic and non-syndromic v0.3228 USP7 Zornitza Stark Publications for gene: USP7 were set to 30679821
Intellectual disability syndromic and non-syndromic v0.3227 TFE3 Arina Puzriakova reviewed gene: TFE3: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 32409512; Phenotypes: TFE3-related intellectual disability with pigmentary mosaicism; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3224 GPAA1 Zornitza Stark Publications for gene: GPAA1 were set to
Intellectual disability syndromic and non-syndromic v0.3220 OGT Zornitza Stark Publications for gene: OGT were set to
Intellectual disability syndromic and non-syndromic v0.3216 ALG9 Zornitza Stark Publications for gene: ALG9 were set to
Intellectual disability syndromic and non-syndromic v0.3213 ALG8 Zornitza Stark Publications for gene: ALG8 were set to
Intellectual disability syndromic and non-syndromic v0.3210 ALG3 Zornitza Stark Publications for gene: ALG3 were set to
Intellectual disability syndromic and non-syndromic v0.3207 USP9X Zornitza Stark Publications for gene: USP9X were set to
Intellectual disability syndromic and non-syndromic v0.3206 USP9X Zornitza Stark Mode of inheritance for gene: USP9X was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3204 ALG6 Zornitza Stark Publications for gene: ALG6 were set to
Intellectual disability syndromic and non-syndromic v0.3201 MOGS Zornitza Stark Publications for gene: MOGS were set to
Intellectual disability syndromic and non-syndromic v0.3199 USP9X Paul De Fazio reviewed gene: USP9X: Rating: GREEN; Mode of pathogenicity: None; Publications: 31443933, 26833328; Phenotypes: Mental retardation, X-linked 99, XLR (MIM#300919) and XLD (MIM#300968); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males); Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.3195 RLIM Zornitza Stark Publications for gene: RLIM were set to
Intellectual disability syndromic and non-syndromic v0.3192 B4GALT7 Zornitza Stark Publications for gene: B4GALT7 were set to
Intellectual disability syndromic and non-syndromic v0.3186 JAM3 Zornitza Stark Publications for gene: JAM3 were set to
Intellectual disability syndromic and non-syndromic v0.3183 NCKAP1 Zornitza Stark Publications for gene: NCKAP1 were set to
Intellectual disability syndromic and non-syndromic v0.3180 ACAD9 Zornitza Stark Publications for gene: ACAD9 were set to
Intellectual disability syndromic and non-syndromic v0.3178 ITFG2 Zornitza Stark Publications for gene: ITFG2 were set to 28397838; https://doi.org/10.1038/s41525-020-00150-z
Intellectual disability syndromic and non-syndromic v0.3176 UNC80 Zornitza Stark Publications for gene: UNC80 were set to 26708751; 26708753; 26545877; 32620897; 30167850; 30167850
Intellectual disability syndromic and non-syndromic v0.3176 UNC80 Zornitza Stark Publications for gene: UNC80 were set to
Intellectual disability syndromic and non-syndromic v0.3173 ZFHX4 Zornitza Stark gene: ZFHX4 was added
gene: ZFHX4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZFHX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZFHX4 were set to 33057194; 24038936; 21802062
Phenotypes for gene: ZFHX4 were set to Developmental disorders; intellectual disability, dysmorphic features
Review for gene: ZFHX4 was set to GREEN
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 16 de novo variants (5 frameshift, 5 missense, 4 stopgain, 2 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided).
PMID: 24038936 - a single case with developmental delay, macrocephaly, ventriculomegaly, hypermetropia, recurrent infections, dysmorphism and a de novo deletion of the last 7 exons of the gene.
PMID:21802062 (2011) report 8 individuals with ID and overlapping deletions of 8q21.11 (0.66-13.55 Mb in size); the smallest region of overlap encompasses 3 genes including ZFHX4.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3171 UPF1 Zornitza Stark gene: UPF1 was added
gene: UPF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UPF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UPF1 were set to 33057194
Phenotypes for gene: UPF1 were set to Developmental disorders
Review for gene: UPF1 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 16 de novo variants (1 frameshift, 11 missense, 4 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided, hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3169 U2AF2 Zornitza Stark gene: U2AF2 was added
gene: U2AF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: U2AF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: U2AF2 were set to 33057194
Phenotypes for gene: U2AF2 were set to Developmental disorders
Review for gene: U2AF2 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 10 de novo variants (1 in-frame, 8 missense, 1 synoymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided, hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3167 TCF7L2 Zornitza Stark gene: TCF7L2 was added
gene: TCF7L2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TCF7L2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TCF7L2 were set to 33057194
Phenotypes for gene: TCF7L2 were set to Developmental disorders
Review for gene: TCF7L2 was set to AMBER
Added comment: A diabetes susceptibility locus associated with common SNVs, see OMIM for details.

PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 12 de novo variants (2 frameshift, 6 missense, 1 splice acceptor, 2 stopgain, 1 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided, hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3165 SRRM2 Zornitza Stark gene: SRRM2 was added
gene: SRRM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRRM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SRRM2 were set to 33057194
Phenotypes for gene: SRRM2 were set to Developmental disorders
Review for gene: SRRM2 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 28 de novo variants (11 frameshift, 7 missense, 1 splice acceptor, 5 stopgain, 4 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3163 SPEN Zornitza Stark gene: SPEN was added
gene: SPEN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPEN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SPEN were set to 33057194
Phenotypes for gene: SPEN were set to Developmental disorders
Review for gene: SPEN was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 25 de novo variants (6 frameshift, 1 in-frame, 7 missense, 8 stopgain, 3 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3161 SATB1 Zornitza Stark gene: SATB1 was added
gene: SATB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SATB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SATB1 were set to 33057194
Phenotypes for gene: SATB1 were set to Developmental disorders
Review for gene: SATB1 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 12 de novo (2 frameshift, 7 missense, 1 stopgain, 2 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3159 RAB14 Zornitza Stark gene: RAB14 was added
gene: RAB14 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB14 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB14 were set to 33057194
Phenotypes for gene: RAB14 were set to Developmental disorders
Review for gene: RAB14 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 8 de novo variants (1 in-frame, 7 missense) identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3157 PSMC5 Zornitza Stark gene: PSMC5 was added
gene: PSMC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMC5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PSMC5 were set to 33057194
Phenotypes for gene: PSMC5 were set to Developmental disorders
Review for gene: PSMC5 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 10 de novo variants (1 in-frame, 9 missense) identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3155 MSL2 Zornitza Stark gene: MSL2 was added
gene: MSL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MSL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MSL2 were set to 31332282; 33057194
Phenotypes for gene: MSL2 were set to Developmental disorders; autism
Review for gene: MSL2 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 13 de novo variants (9 frameshift, 4 missense) identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
PMID: 31332282 - candidate gene in a single autism study, with recurrent de novo variants in a potential oligogenic model
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3153 MMGT1 Zornitza Stark gene: MMGT1 was added
gene: MMGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MMGT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MMGT1 were set to 33057194
Phenotypes for gene: MMGT1 were set to Developmental disorders
Review for gene: MMGT1 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 3 de novo missense identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3151 HNRNPD Zornitza Stark gene: HNRNPD was added
gene: HNRNPD was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HNRNPD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HNRNPD were set to 33057194
Phenotypes for gene: HNRNPD were set to Developmental disorders
Review for gene: HNRNPD was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 8 de novo variants (5 frameshift, 1 missense, 1 splice acceptor, 1 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3149 GIGYF1 Zornitza Stark gene: GIGYF1 was added
gene: GIGYF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GIGYF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GIGYF1 were set to 33057194
Phenotypes for gene: GIGYF1 were set to Developmental disorder
Review for gene: GIGYF1 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio study from the Deciphering Developmental Disorders study. 14 de novo variants (4 frameshift, 5 missense, 1 splice donor, 3 stopgain, 1 synonymous) identified in ~10,000 cases with developmental disorders (no other phenotype info provided, hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3147 AP2S1 Zornitza Stark gene: AP2S1 was added
gene: AP2S1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: AP2S1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AP2S1 were set to 33057194
Phenotypes for gene: AP2S1 were set to Developmental disorder
Review for gene: AP2S1 was set to AMBER
Added comment: Established hypercalcaemia gene. PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio developmental disorder study. 5 de novo missense identified in ~10,000 cases with developmental disorders (no other phenotype info provided, hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3145 ARHGAP35 Zornitza Stark gene: ARHGAP35 was added
gene: ARHGAP35 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARHGAP35 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARHGAP35 were set to 33057194
Phenotypes for gene: ARHGAP35 were set to Developmental disorder
Review for gene: ARHGAP35 was set to AMBER
Added comment: Has been identified as a gene with significant de novo enrichment in a large trio developmental disorder study. 16 de novo variants (3 frameshift, 2 in-frame, 10 missense, 1 stopgain) identified in ~10,000 cases with developmental disorders (no other phenotype info provided hence Amber rating).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3143 ATP6V0A1 Zornitza Stark gene: ATP6V0A1 was added
gene: ATP6V0A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP6V0A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP6V0A1 were set to 30842224; 33057194
Phenotypes for gene: ATP6V0A1 were set to Developmental disorder; Rett syndrome-like
Review for gene: ATP6V0A1 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio developmental disorder study. 11 de novo missense identified in ~10,000 cases with developmental disorders (no other phenotype info provided, hence Amber rating).
PMID: 30842224 - identified a de novo missense variant in a single individual with atypical Rett syndrome phenotype
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3141 DDX23 Zornitza Stark gene: DDX23 was added
gene: DDX23 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX23 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DDX23 were set to 33057194
Phenotypes for gene: DDX23 were set to Developmental disorder
Review for gene: DDX23 was set to AMBER
Added comment: PMID: 33057194 - Has been identified as a gene with significant de novo enrichment in a large trio developmental disorder study. 6 de novo missense identified in ~10,000 cases with developmental disorders. Rated Amber as no other phenotype info provided.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3139 FOXP4 Zornitza Stark gene: FOXP4 was added
gene: FOXP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FOXP4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOXP4 were set to 33110267
Phenotypes for gene: FOXP4 were set to Neurodevelopmental disorder; multiple congenital abnormalities
Review for gene: FOXP4 was set to GREEN
Added comment: Six unrelated individuals reported, 5 with missense variants in the forkhead box DNA-binding domain of FOXP4, and one individual with a truncating variant. Overlapping features included speech and language delays, growth abnormalities, congenital diaphragmatic hernia, cervical spine abnormalities, and ptosis.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3135 FBXO31 Zornitza Stark Publications for gene: FBXO31 were set to 24623383
Intellectual disability syndromic and non-syndromic v0.3132 DHX32 Dean Phelan gene: DHX32 was added
gene: DHX32 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DHX32 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DHX32 were set to PMID: 32989326
Phenotypes for gene: DHX32 were set to Intellectual disability, spastic diplegia, dystonia, brain abnormalities
Review for gene: DHX32 was set to AMBER
Added comment: PMID: 32989326 - Large cohort study of cerebral palsy cases identified two de novo variants in two unrelated patients with intellectual disability, one with spastic diplegia, and the other characterised as generalised dystonia. Brain abnormalities were identified also.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3131 STN1 Sue White gene: STN1 was added
gene: STN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: STN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: STN1 were set to 32627942; 27432940
Phenotypes for gene: STN1 were set to cerebral calcification; premature ageing; bone marrow failure; retinal telangiactasia; hepatic fibrosis
Penetrance for gene: STN1 were set to Complete
Added comment: 3 unrelated patients reported with Coats-plus syndrome. Developmental delay noted in two.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3128 PRKAR1B Konstantinos Varvagiannis gene: PRKAR1B was added
gene: PRKAR1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRKAR1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PRKAR1B were set to https://doi.org/10.1101/2020.09.10.20190314; 33057194
Phenotypes for gene: PRKAR1B were set to Global developmental delay; Intellectual disability; Autism; Attention deficit hyperactivity disorder; Aggressive behavior; Abnormality of movement; Upslanted palpebral fissure
Penetrance for gene: PRKAR1B were set to unknown
Review for gene: PRKAR1B was set to AMBER
Added comment: Please consider inclusion of this gene with amber rating pending publication of the preprint and/or additional evidence.

Marbach et al. (2020 - medRxiv : https://doi.org/10.1101/2020.09.10.20190314 - last author : C. Schaaf) report 6 unrelated individuals with heterozygous missense PRKAR1B variants.

All presented formal ASD diagnosis (6/6), global developmental delay (6/6) and intellectual disability (all - formal evaluations were lacking though). Additional features included neurologic anomalies (movement disorders : dyspraxia, apraxia, clumsiness in all, with tremor/dystonia or involuntary movements as single occurrences). Three displayed high pain tolerance. Regression in speech was a feature in two. Additional behavior anomalies included ADHD (4-5/6) or aggression (3/6). There was no consistent pattern of malformations, physical anomalies or facial features (with the exception of uplsanted palpebral fissures reported in 4).

3 different missense variants were identified (NM_00116470:c.1003C>T - p.Arg335Trp, c.586G>A - p.Glu196Lys, c.500_501delAAinsTT - p.Gln167Leu) with Arg355Trp being a recurrent one within this cohort (4/6 subjects). A possible splicing effect may apply for the MNV. All variants are absent from gnomAD and the SNVs had CADD scores > 24.

In all cases were parental samples were available (5/6), the variant had occurred as a de novo event.

Protein kinase A (PKA) is a tetrameric holoenzyme formed by the association of 2 catalytic (C) subunits with a regulatory (R) subunit dimer. Activation of PKA is achieved through binding of 2 cAMP molecules to each R-subunit, and unleashing(/dissociation) of C-subunits to engage substrates. PRKACA/B genes encode the Cα- and Cβ-subunits while the 4 functionally non-redundant regulatory subunits are encoded by PRKAR1A/1B/2A/2B genes. As the authors comment, the RIβ subunit is primarily expressed in brain with higher expression in cortex and hypothalamus.

The functional consequences of the variants at cellular level were not studied.

Previous studies have demonstrated that downregulation of RIβ in murine hippocampal cultures, reduced phosphorylation of CREB, a transcription factor involved in long-term memory formation. The authors speculate that a similar effect on cAMP/PKA/CREB cascade may mediate the cognitive effects in humans. RIβ deficient mice also display diminished nociceptive pain, similar to the human phenotype. [Several refs provided].

The authors cite the study by Kaplanis et al (2020 - PMID: 33057194), where in a large sample of 31,058 trio exomes of children with developmental disorders, PRKAR1B was among the genes with significant enrichment for de novo missense variants. [The gene has a pLI score of 0.18 in gnomAD / o/e = 0.26 - so pLoF variants may not be deleterious].

Please note that a specific PRKAR1B variant (NM_002735.2:c.149T>G - p.Leu50Arg) has been previous reported to segregate with a late-onset neurodegenerative disorder characterized by dementia and/or parkinsonism within a large pedigree with 12 affected individuals [Wong et al 2014 - PMID: 25414040].
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3127 MPP5 Konstantinos Varvagiannis gene: MPP5 was added
gene: MPP5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MPP5 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MPP5 were set to 33073849
Phenotypes for gene: MPP5 were set to Global developmental delay; Intellectual disability; Delayed speech and language development; Developmental regression; Behavioral abnormality
Penetrance for gene: MPP5 were set to unknown
Review for gene: MPP5 was set to GREEN
Added comment: Sterling et al (2020 - PMID: 33073849) provide information on the phenotype of 3 individuals with de novo MPP5 variants.

Common features included global developmental delay, intellectual disability (3/3 - severe in 2/3), speech delay/regression (the latter in at least 2) and behavioral abnormalities. Variable other features were reported, among others microcephaly (1/3), abnormal vision (1/3 : CVI, retinal dystrophy, nystagmus), brain MRI abnormalities (2/3), late-onset seizures (1/3). These subjects displayed variable and non-specific dysmorphic features.

All were investigated by exome sequencing (previous investigations not mentioned).

One subject was found to harbor a de novo mosaic (5/25 reads) stopgain variant, further confirmed by Sanger sequencing [NM_022474.4:c.1555C>T - p.(Arg519Ter). The specific variant is reported once in gnomAD (1/251338). Two de novo missense variants were identified in the remaining individuals [c.1289A>G - p.Glu430Gly / c.974A>C - p.His325Pro). All variants had in silico predictions in favor of a deleterious effect (CADD score >24).

The authors comment that MPP5 encodes an apical complex protein with asymmetric localization to the apical side of polarized cells. It is expressed in brain, peripheral nervous system and other tissues. MPP5 is a member of the membrane-associated guanylate kinase family of proteins (MAGUK p55 subfamily), determining cell polarity at tight junctions.

Previous animal models suggest that complete Mpp5(Pals1) KO in mice leads to near absence of cerebral cortical neurons. Htz KO display reduction in size of cerebral cortex and hippocampus. The gene is expressed in proliferating cell populations of cerebellum and important for establishment cerebellar architecture. Conditional KO of Mpp5(Pals1) in retinal progenitor cells mimics the retinal pathology observed in LCA. [Several refs. provided]

The authors studied a heterozygous CNS-specific Mpp5 KO mouse model. These mice presented microcephaly, decreased cerebellar volume and cortical thickness, decreased ependymal cells and Mpp5 at the apical surface of cortical vertrical zone. The proportion of cortical cells undergoing apoptotic cell death was increased. Mice displayed behavioral abnormalities (hyperactivity) and visual deficits, with ERG traces further suggesting retinal blindness.

Overall the mouse model was thought to recapitulate the behavioral abnormalities observed in affected subjects as well as individual rare features such as microcephaly and abnormal vision.

Haploinsufficiency (rather than a dominant negative effect) is favored as the underlying disease mechanism. This is also in line with a dose dependent effect observed in mice.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3127 ODC1 Zornitza Stark Publications for gene: ODC1 were set to 30475435
Intellectual disability syndromic and non-syndromic v0.3122 COG8 Zornitza Stark Publications for gene: COG8 were set to
Intellectual disability syndromic and non-syndromic v0.3119 SLC35A3 Zornitza Stark Publications for gene: SLC35A3 were set to PMID: 28328131; 24031089
Intellectual disability syndromic and non-syndromic v0.3116 APOPT1 Zornitza Stark Publications for gene: APOPT1 were set to
Intellectual disability syndromic and non-syndromic v0.3109 COX6B1 Zornitza Stark Publications for gene: COX6B1 were set to
Intellectual disability syndromic and non-syndromic v0.3105 SCO1 Zornitza Stark Publications for gene: SCO1 were set to
Intellectual disability syndromic and non-syndromic v0.3102 PRKACB Konstantinos Varvagiannis gene: PRKACB was added
gene: PRKACB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRKACB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PRKACB were set to 33058759
Phenotypes for gene: PRKACB were set to Postaxial hand polydactyly; Postaxial foot polydactyly; Common atrium; Atrioventricular canal defect; Narrow chest; Abnormality of the teeth; Intellectual disability
Penetrance for gene: PRKACB were set to Complete
Review for gene: PRKACB was set to AMBER
Added comment: ID was a feature in 2/4 individuals with PRKACB pathogenic variant reported to date.
------
Palencia-Campos et al (2020 - PMID: 33058759) report on the phenotype of 3 individuals heterozygous for PRKACA and 4 individuals heterozygous for PRKACB pathogenic variants.

The most characteristic features in all individuals with PRKACA/PRKACB mutation, included postaxial polydactyly of hands (6/7 bilateral, 1/7 unilateral) and feet (4/7 bilateral, 1/7 unilateral), brachydactyly and congenital heart defects (CHD 5/7) namely a common atrium or AVSD. Two individuals with PRKACA variant who did not have CHD had offspring with the same variant and an AVSD.

Other variably occurring features included short stature, limbs, narrow chest, abnormal teeth, oral frenula, nail dysplasia. One individual with PRKACB variant presented tumors.

Intellectual disability was reported in 2/4 individuals with PRKACB variant (1/4: mild, 1/4: severe). The 3 individuals with PRKACA variant did not present ID.

As the phenotype was overall suggestive of Ellis-van Creveld syndrome (or the allelic Weyers acrofacial dysostosis), although these diagnoses were ruled out following analysis of EVC and EVC2 genes.

WES was carried out in all.

PRKACA : A single heterozygous missense variant was identified in 3 individuals from 3 families (NM_002730.4:c.409G>A / p.Gly137Arg) with 1 of the probands harboring the variant in mosaic state (28% of reads) and having 2 similarly affected offspring. The variant was de novo in one individual and inherited in a third one having a similarly affected fetus (narrow thorax, postaxial polyd, AVSD).

PRKACB : 4 different variants were identified (NM_002731.3: p.His88Arg/Asn, p.Gly235Arg, c.161C>T - p.Ser54Leu). One of the individuals was mosaic for the latter variant, while in all other cases the variant had occurred de novo.

Protein kinase A (PKA) is a tetrameric holoenzyme formed by the association of 2 catalytic (C) subunits with a regulatory (R) subunit dimer. Activation of PKA is achieved through binding of 2 cAMP molecules to each R-subunit, and unleashing(/dissociation) of C-subunits to engage substrates. PRKACA/B genes encode the Cα- and Cβ-subunits while the 4 functionally non-redundant regulatory subunits are encoded by PRKAR1A/1B/2A/2B genes.

The authors provide evidence that the variants confer increased sensitivity of PKA holoenzymes to activation by cAMP (compared to wt).

By performing ectopic expression of wt or mt PRKACA/B (variants studied : PRKACA p.Gly137Arg / PRKACB p.Gly235Arg) in NIH 3T3 fibroblasts, the authors demonstrate that inhibition of hedgehog signaling likely underlyies the developmental defects observed in affected individuals.

As for PRKACA, the authors cite another study where a 31-month old female with EvC syndrome diagnosis was found to harbor the aforementioned variant (NM_001304349.1:c.637G>A:p.Gly213Arg corresponding to NM_002730.4:c.409G>A / p.Gly137Arg) as a de novo event. Without additional evidence at the time, the variant was considered to be a candidate for this subject's phenotype (Monies et al 2019 – PMID: 31130284).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3101 COX10 Zornitza Stark Publications for gene: COX10 were set to
Intellectual disability syndromic and non-syndromic v0.3099 DPH1 Zornitza Stark Publications for gene: DPH1 were set to 25558065; 26220823
Intellectual disability syndromic and non-syndromic v0.3098 DPH1 Zornitza Stark edited their review of gene: DPH1: Added comment: Four unrelated families reported, 11 affected individuals. Common clinical features include abnormal skull shape (trigonocephaly, scaphocephaly, or prominent forehead accompanied with metopic ridge), distinctive face (downslanted palpebral fissures, low set ears, depressed nasal bridge, and sparse hair on the scalp, eyelashes, and/or eyebrows), short stature, developmental delay, and intellectual disability. Heart and brain malformations are also frequently observed.; Changed publications: 29362492, 29410513, 25558065, 26220823
Intellectual disability syndromic and non-syndromic v0.3098 SETD1A Zornitza Stark changed review comment from: OMIM has assigned a second phenotype in relation to the syndromic ID cohort reported in PMID 32346159. All variants were predicted to disrupt or delete the SET catalytic domain, and LOF is the established mechanism.

In addition, there are 3 families reported with a predominantly seizure phenotype without ID, PMID 31197650. All the variants are missense and mechanism of pathogenicity is not clearly established, hence it is difficult to know whether these are two distinct conditions or part of a spectrum of severity for SETD1A-related disorders.; to: OMIM has assigned a second phenotype in relation to the syndromic ID cohort reported in PMID 32346159. All variants were predicted to disrupt or delete the SET catalytic domain, and LOF is the established mechanism.

In addition, there are 4 families reported with a predominantly seizure phenotype without ID, PMID 31197650. All the variants are missense and mechanism of pathogenicity is not clearly established, hence it is difficult to know whether these are two distinct conditions or part of a spectrum of severity for SETD1A-related disorders.
Intellectual disability syndromic and non-syndromic v0.3098 SETD1A Zornitza Stark Phenotypes for gene: SETD1A were changed from Epilepsy, early-onset, with or without developmental delay, MIM# 618832 to Epilepsy, early-onset, with or without developmental delay, MIM# 618832; Neurodevelopmental disorder with speech impairment and dysmorphic facies, MIM# 619056
Intellectual disability syndromic and non-syndromic v0.3097 SETD1A Zornitza Stark edited their review of gene: SETD1A: Added comment: OMIM has assigned a second phenotype in relation to the syndromic ID cohort reported in PMID 32346159. All variants were predicted to disrupt or delete the SET catalytic domain, and LOF is the established mechanism.

In addition, there are 3 families reported with a predominantly seizure phenotype without ID, PMID 31197650. All the variants are missense and mechanism of pathogenicity is not clearly established, hence it is difficult to know whether these are two distinct conditions or part of a spectrum of severity for SETD1A-related disorders.; Changed phenotypes: Epilepsy, early-onset, with or without developmental delay, MIM# 618832, Neurodevelopmental disorder with speech impairment and dysmorphic facies, MIM# 619056
Intellectual disability syndromic and non-syndromic v0.3097 JARID2 Zornitza Stark Publications for gene: JARID2 were set to 23294540
Intellectual disability syndromic and non-syndromic v0.3094 NUDT2 Zornitza Stark Publications for gene: NUDT2 were set to 27431290; 30059600
Intellectual disability syndromic and non-syndromic v0.3091 AFF2 Zornitza Stark Publications for gene: AFF2 were set to
Intellectual disability syndromic and non-syndromic v0.3088 AUTS2 Zornitza Stark Publications for gene: AUTS2 were set to
Intellectual disability syndromic and non-syndromic v0.3085 ZEB2 Zornitza Stark Publications for gene: ZEB2 were set to
Intellectual disability syndromic and non-syndromic v0.3083 HECW2 Zornitza Stark Publications for gene: HECW2 were set to 27389779
Intellectual disability syndromic and non-syndromic v0.3079 LMNB1 Zornitza Stark changed review comment from: Adult-onset neurodegenerative condition, not truly ID.; to: Adult-onset neurodegenerative condition, not truly ID. Associated with CNV of this gene, suggestive of haploinsufficiency.
Intellectual disability syndromic and non-syndromic v0.3079 LMNB1 Zornitza Stark Publications for gene: LMNB1 were set to 32910914
Intellectual disability syndromic and non-syndromic v0.3078 CSNK1G1 Konstantinos Varvagiannis gene: CSNK1G1 was added
gene: CSNK1G1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSNK1G1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CSNK1G1 were set to 33009664
Phenotypes for gene: CSNK1G1 were set to Global developmental delay; Intellectual disability; Autism; Seizures; Abnormality of the face; Abnromality of limbs
Penetrance for gene: CSNK1G1 were set to unknown
Review for gene: CSNK1G1 was set to AMBER
Added comment: Gold et al (2020 - PMID: 33009664) report 5 individuals with CSNK1G1 variants, including updated information on a previously reported subject (Martin et al 2014 - PMID: 24463883).

Features included DD (5/5) with associated expressive language delay, ASD (in at least 3/5), seizures (2/5), dysmorphic facial features (4/5 arched eyebrows, 3/5 prominent central incisors, 2/5 epicanthus) and limb anomalies (2/5 - proximally placed thumb, 5th f. clinodactyly, asymmetric overgrowth - the other individual had tapering fingers). GI problems were observed in 4/5. Two individuals had macrocephaly and one had microcephaly. There was no formal developmental assessment although ID might be implied in at least 3 individuals (p1: 20y - single words/regression in walking following a seizure episode, p2: 8y - first words at 5y, assistance to feed, dress and bathe, ASD, p4: 13y - regression, assistance to feed and dress).

CSNK1G1 encodes the gamma-1 isoform of casein kinase 1, a protein involved in growth and cell morphogenesis. The gene has ubiquitous expression, incl. brain. As commented, in brain it regulates phosphorylation of NMDA receptors, playing a role in synaptic transmission (4 articles cited).

One individual had a 1.2 kb deletion spanning exon 3 of CSNK1G1 [chr15:64550952-64552120 - GRCh37]. Parental samples were unavailable for this individual. Four individuals were found to harbor de novo CSNK1G1 variants [NM_022048.3: c.688C>T - p.(Arg230Trp) dn | c.1255C>T - p.(Gln419*) dn | c.1214+5G>A dn with in silico predictions in favor of splice disruption | c.419C>T - p.(Thr140Met) dn].

Arg230Trp is however present once in gnomAD. The stopgain variant is located in the last exon and predicted to skip NMD.

There were no variant studies performed.

The Drosophila gish gene encodes a CK1γ homolog with preferential expression in the mushroom body. Heterozygous and homozygous mutants exhibit impairment in memory retention, more severe in homozygous flies. gish was also identified as a seizure modifier in a fly epilepsy model (heterozygous para mt flies).

The authors also speculate that impaired transduction of LRP6 (and WNT signaling) might be implicated.

Finally the authors discuss the phenotype of individuals in Decipher one of whom (327861) harbors a frameshift variant and presenting ID, epilepsy and progressive spasticity. [NB. Inheritance of this variant is not specified, while this individual has a further inherited SCN2A missense SNV]. Two further Decipher cases with microdeletions spanning CSNK1G1 (and additional variants) also discussed.

Overall, this gene can be considered for inclusion with probably amber rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3078 LMNB2 Konstantinos Varvagiannis gene: LMNB2 was added
gene: LMNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LMNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: LMNB2 were set to 33033404
Phenotypes for gene: LMNB2 were set to Congenital microcephaly; Global developmental delay; Intellectual disability
Penetrance for gene: LMNB2 were set to Complete
Mode of pathogenicity for gene: LMNB2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: LMNB2 was set to GREEN
Added comment: Please consider inclusion of LMNB2 in the ID panel with amber/green rating.

Parry et al (2020 - PMID: 33033404) in a study to identify novel microcephaly genes using the DDD and 100k genomes project (100kGP) patient cohort, report on the phenotype of 13 individuals with heterozygous variant in LMNB1 (N=7) and LMNB2 (N=6).

LMNB1 : The authors identified 3 recurrent variants (c.97A>G - p.Lys33Glu (3), c.97_99del - p.Lys33del (2) , c.269G>C - p.Arg90Pro (2) / NM_005573.4) in seven individuals (3 from the DDD study, 4 from the 100kGP). In all cases were segregation studies were possible, the variant had occurred as a de novo event.

LMNB2 : 4 individuals from the DDD cohort and 1 from the 100kGP were found to harbor the same missense SNV (NM_032737.4:c.1192G>A, p.Glu398Lys). The variant had occurred de novo in 3 subjects and was inherited from a mosaic - unaffected - parent in a further case. Another individual was found to harbor c.160A>C - p.Asn54His.

LMNB1/2 common phenotypes :
All cases had congenital microcephaly (OFC -5.85 +/- 1.14 SD) appart from one individual, without history of IUGR or postnatally abnormal height (the latter in most).

Neuroimaging suggested structurally normal brain without abnormal migration. Gyral simplification / global reduction in white matter / increased extra axial spaces / enlarged ventricles were reported in 2.

LMNB1 - Global developmental delay was a feature in all (mild to severe) with some having occasional words at 7y (P3), absent speech (P9 - age category 5-10y) or ID not further specified (P13).

LMNB2 - DD was a feature in all 6 subjects (5/6 moderate to severe - 1/6 GDD). 5/6 were 10y or older with language (in 3 language not achieved) and motor deficits (walking not achieved in 1/6 - occured at the age of 6y in 1/6).

Facial features were not consistent nor suggestive of a syndromic diagnosis (sloping forehead in some).

Overall, as the authors comment, the phenotype corresponded to a severe nonsyndromic microcephaly (although additional features were reported in some).

Animal model:
Microcephaly is supported by Lmnb1 ko mouse model. Lmnb1/2 ko mice however display migration defects, while Lmnb2 ko mice do not have reduced size at birth. Heterozygous Lmnb1 mice do not present microcephaly. It is suggested that while animal models support a similar (to the human) phenotype the underlying mechanism is different.

Variant effect :
variants were shown to affect highly conserved residues within the lamin a-helical rod-domain. As affected residues are conserved in LMNA, modelling with available LMNA PDB structures, suggested disrupted interactions required for higher-order assembly of lamin filaments.

Recurrence of specific variants at specific residues, absence of pLoF ones, the htz mouse Lmnb1 phenotype (absence of microcephaly) and the proposed mechanism (perturbation of complex formation) suggest a gain-of-function/dominant-negative effect rather than happloinsufficiency.

[Please also note the additional OMIM phenotypes for LMNB1 / LMNB2 - not here reviewed]
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3077 MICU1 Zornitza Stark Publications for gene: MICU1 were set to
Intellectual disability syndromic and non-syndromic v0.3074 PIBF1 Zornitza Stark Publications for gene: PIBF1 were set to PubMed: 26167768; 30858804; 29695797
Intellectual disability syndromic and non-syndromic v0.3073 WDPCP Zornitza Stark Publications for gene: WDPCP were set to
Intellectual disability syndromic and non-syndromic v0.3069 TRAPPC9 Zornitza Stark Publications for gene: TRAPPC9 were set to 30853973
Intellectual disability syndromic and non-syndromic v0.3067 EPG5 Zornitza Stark Publications for gene: EPG5 were set to
Intellectual disability syndromic and non-syndromic v0.3062 ITFG2 Konstantinos Varvagiannis gene: ITFG2 was added
gene: ITFG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ITFG2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ITFG2 were set to 28397838; https://doi.org/10.1038/s41525-020-00150-z
Phenotypes for gene: ITFG2 were set to Neurodevelopmental abnormality; Intellectual disability; Developmental regression; Ataxia
Penetrance for gene: ITFG2 were set to Complete
Review for gene: ITFG2 was set to AMBER
Added comment: ITFG2 was suggested to be a candidate gene for autosomal recessive ID in the study by Harripaul et al (2018 - PMID: 28397838). The authors performed microarray and exome sequencing in 192 consanguineous families and identified a homozygous ITGF2 stopgain variant (NM_018463.3:c.472G>T / p.Glu158*) along with 3 additional variants segregating with ID within an investigated family (PK51).

Cheema et al (2020 - https://doi.org/10.1038/s41525-020-00150-z) report briefly on a male, born to consanguineous parents presenting with NDD, seizures, regression and ataxia. There was a similarly affected female sibling. Evaluation of ROH revealed a homozygous ITFG2 nonsense variant [NM_018463.3:c.361C>T / p.(Gln121*)]. Families in this study were investigated by trio WES or WGS.

Evaluation of data of the same lab revealed 3 additional unrelated subjects with overlapping phenotypes, notably NDD and ataxia. These individuals were - each - homozygous for pLoF variants [NM_018463.3:c.848-1G>A; NM_018463.3:c.704dupC, p.(Ala236fs), NM_018463.3:c.1000_1001delAT, p.(Ile334fs)].

As discussed in OMIM, ITFG2 encodes a subunit of the KICSTOR protein complex, having a role in regulating nutrient sensing by MTOR complex-1 (Wolfson et al 2017 - PMID : 28199306).

Please consider inclusion in the ID panel with amber rating, pending further details.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3062 SHMT2 Konstantinos Varvagiannis gene: SHMT2 was added
gene: SHMT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SHMT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SHMT2 were set to 33015733
Phenotypes for gene: SHMT2 were set to Congenital microcephaly; Infantile axial hypotonia; Spastic paraparesis; Global developmental delay; Intellectual disability; Abnormality of the corpus callosum; Abnormal cortical gyration; Hypertrophic cardiomyopathy; Abnormality of the face; Proximal placement of thumb; 2-3 toe syndactyly
Penetrance for gene: SHMT2 were set to Complete
Review for gene: SHMT2 was set to GREEN
Added comment: García‑Cazorla et al. (2020 - PMID: 33015733) report 5 individuals (from 4 families) with a novel brain and heart developmental syndrome caused by biallelic SHMT2 pathogenic variants.

All affected subjects presented similar phenotype incl. microcephaly at birth (5/5 with OFC < -2 SD though in 2/5 cases N OFC was observed later), DD and ID (1/5 mild-moderate, 1/5 moderate, 3/5 severe), motor dysfunction in the form of spastic (5/5) paraparesis, ataxia/dysmetria (3/4), intention tremor (in 3/?) and/or peripheral neuropathy (2 sibs). They exhibited corpus callosum hypoplasia (5/5) and perisylvian microgyria-like pattern (4/5). Cardiac problems were reported in all, with hypertrophic cardiomyopathy in 4/5 (from 3 families) and atrial-SD in the 5th individual (1/5). Common dysmorphic features incl. long palpebral/fissures, eversion of lateral third of lower eylids, arched eyebrows, long eyelashes, thin upper lip, short Vth finger, fetal pads, mild 2-3 toe syndactyly, proximally placed thumbs.

Biallelic variants were identified following exome sequencing in all (other investigations not mentioned). Identified variants were in all cases missense SNVs or in-frame del, which together with evidence from population databases and mouse model might suggest a hypomorphic effect of variants and intolerance/embryonic lethality for homozygous LoF ones.

SHMT2 encodes the mitohondrial form of serine hydroxymethyltransferase. The enzyme transfers one-carbon units from serine to tetrahydrofolate (THF) and generates glycine and 5,10,methylene-THF.

Mitochondrial defect was suggested by presence of ragged red fibers in myocardial biopsy of one patient. Quadriceps and myocardial biopsies of the same individual were overall suggestive of myopathic changes.

While plasma metabolites were within N range and SHMT2 protein levels not significantly altered in patient fibroblasts, the authors provide evidence for impaired enzymatic function eg. presence of the SHMT2 substrate (THF) in patient but not control (mitochondria-enriched) fibroblasts , decrease in glycine/serine ratios, impared folate metabolism. Patient fibroblasts displayed impaired oxidative capacity (reduced ATP levels in a medium without glucose, diminished oxygen consumption rates). Mitochondrial membrane potential and ROS levels were also suggestive of redox malfunction.

Shmt2 ko in mice was previously shown to be embryonically lethal attributed to severe mitochondrial respiration defects, although there was no observed brain metabolic defect.

The authors performed Shmt2 knockdown in motoneurons in Drosophila, demonstrating neuromuscular junction (# of satellite boutons) and motility defects (climbing distance/velocity).

Overall this gene can be considered for inclusion with (probably) green rating in gene panels for ID, metabolic / mitochondrial disorders, cardiomyopathy, congenital microcephaly, corpus callosum anomalies, etc.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3062 VPS41 Zornitza Stark gene: VPS41 was added
gene: VPS41 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VPS41 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS41 were set to 32808683
Phenotypes for gene: VPS41 were set to Dystonia; intellectual disability
Review for gene: VPS41 was set to RED
Added comment: Single individual reported with homozygous canonical splice site variant resulting in exon 7 skipping, and global developmental delay and generalized dystonia. He attained a few words and voluntary limb movements but never sat unsupported. He had pale optic discs and an axonal neuropathy. From 6 years of age, his condition began to deteriorate, with reduced motor abilities and alertness. An MRI of the brain showed atrophy of the superior cerebellar vermis and slimming of the posterior limb of the corpus callosum. VPS41 is component of the HOPS complex and other genes in the complex have been implicated in movement disorders.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3059 QRICH1 Zornitza Stark Publications for gene: QRICH1 were set to
Intellectual disability syndromic and non-syndromic v0.3056 SON Zornitza Stark Publications for gene: SON were set to
Intellectual disability syndromic and non-syndromic v0.3052 SETD1A Zornitza Stark Marked gene: SETD1A as ready
Intellectual disability syndromic and non-syndromic v0.3052 SETD1A Zornitza Stark Gene: setd1a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.3052 SETD1A Zornitza Stark Classified gene: SETD1A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.3052 SETD1A Zornitza Stark Gene: setd1a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.3051 SETD1A Zornitza Stark gene: SETD1A was added
gene: SETD1A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SETD1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SETD1A were set to 31197650; 32346159
Phenotypes for gene: SETD1A were set to Epilepsy, early-onset, with or without developmental delay, MIM# 618832
Review for gene: SETD1A was set to GREEN
Added comment: 19 unrelated individuals reported with de novo variants in this gene and a neurodevelopmental phenotype, primarily manifesting and ID and seizures. LOF mechanism supported by functional data. Three mouse models.

SNPs in this gene have also been associated with risk of developing schizophrenia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3050 HPDL Zornitza Stark changed review comment from: Intellectual impairment is variable, ranging from poor visual contact with inability to walk or speak to milder intellectual disability with the ability to say some words.; to: 17 individuals from 13 families, with a spectrum of neurologic impairment ranging from a severe congenital form without any neurological development (n = 2/17, 12%) to infantile-onset presentations (n = 10/17, 59%) with moderate to severe neurodevelopmental issues, partly with a pathology reminiscent of mitochondrial disease (Leigh-like syndrome), to juvenile-onset spastic paraplegia (n = 5/17, 29%).

Intellectual impairment is variable, ranging from poor visual contact with inability to walk or speak to milder intellectual disability with the ability to say some words.

Frequently observed additional clinical findings included chronic progression of neurological signs (n = 16/17, 94%), microcephaly (n = 9/16, 56%), and seizures/epilepsy (n = 9/17, 53%). Other relevant clinical findings were visual disturbances/strabismus (n = 9/17, 53%) and loss of developmental milestones (n = 6/17, 35%).

Acute central respiratory failure leading to life-threatening events requiring partly mechanically assisted ventilation occurred in half of individuals with infantile presentation (n = 5/10, 50%), respectively one third of all individuals (n = 5/17, 29%).

Demyelinating neuropathy was present in three individuals (n = 3/11, 27%), with reduced sensory nerve conduction velocity (NCV) in all and severely reduced motor NCV in one.
Intellectual disability syndromic and non-syndromic v0.3049 PRKD1 Zornitza Stark Publications for gene: PRKD1 were set to 27479907
Intellectual disability syndromic and non-syndromic v0.3046 KPTN Zornitza Stark Publications for gene: KPTN were set to
Intellectual disability syndromic and non-syndromic v0.3043 TTI2 Zornitza Stark Publications for gene: TTI2 were set to
Intellectual disability syndromic and non-syndromic v0.3040 ARID2 Zornitza Stark Publications for gene: ARID2 were set to
Intellectual disability syndromic and non-syndromic v0.3037 PIGT Zornitza Stark Publications for gene: PIGT were set to
Intellectual disability syndromic and non-syndromic v0.3034 ALG13 Zornitza Stark Publications for gene: ALG13 were set to
Intellectual disability syndromic and non-syndromic v0.3033 ALG13 Zornitza Stark Mode of inheritance for gene: ALG13 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3032 ALG13 Zornitza Stark reviewed gene: ALG13: Rating: GREEN; Mode of pathogenicity: None; Publications: 23033978, 23934111, 24781210, 24896178, 25732998, 26138355, 26482601, 28940310, 32238909; Phenotypes: Congenital disorder of glycosylation, type Is (MIM# 300884); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.3032 GPSM2 Zornitza Stark Publications for gene: GPSM2 were set to
Intellectual disability syndromic and non-syndromic v0.3029 CNOT1 Zornitza Stark Publications for gene: CNOT1 were set to 31006510; 21679367; 31006513
Intellectual disability syndromic and non-syndromic v0.3026 SECISBP2 Anna Le Fevre gene: SECISBP2 was added
gene: SECISBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SECISBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SECISBP2 were set to 16228000; 19602558; 21084748; 22247018
Phenotypes for gene: SECISBP2 were set to #609698 THYROID HORMONE METABOLISM, ABNORMAL
Penetrance for gene: SECISBP2 were set to unknown
Review for gene: SECISBP2 was set to RED
Added comment: Multiple families with biallelic loss of function variants have been reported with a disorder of thyroid hormone metabolism involving synthesis of selenoproteins. Features include short stature with delayed bone age, muscle weakness with fatty infiltration of skeletal muscle, azoospermia, and mild developmental delay. Photosensitivity and high frequency SNHL have been reported. Thyroid function tests show elevated FT4 and rT3, low FT3 and normal or mildly elevated TSH. Incomplete loss of SECISBP2 function has been hypothesized to cause a milder phenotype.

At least two reports of children with delayed milestones.
One report of an affected adult with mild ID.
Further reports may clarify if this phenotype typically includes ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3024 UPF3B Zornitza Stark Publications for gene: UPF3B were set to
Intellectual disability syndromic and non-syndromic v0.3020 MADD Zornitza Stark Publications for gene: MADD were set to 28940097
Intellectual disability syndromic and non-syndromic v0.3019 SLC12A2 Zornitza Stark Publications for gene: SLC12A2 were set to 30740830
Intellectual disability syndromic and non-syndromic v0.3016 TECPR2 Zornitza Stark Publications for gene: TECPR2 were set to
Intellectual disability syndromic and non-syndromic v0.3013 ZMYM2 Konstantinos Varvagiannis gene: ZMYM2 was added
gene: ZMYM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZMYM2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ZMYM2 were set to 32891193
Phenotypes for gene: ZMYM2 were set to Abnormality of the urinary system; Global developmental delay; Intellectual disability; Microcephaly; Abnormality of the cardiovascular system; Autism; Seizures; Abnormality of the head or neck; Abnormality of the nail; Small hand; Short foot; Clinodactyly
Penetrance for gene: ZMYM2 were set to unknown
Review for gene: ZMYM2 was set to AMBER
Added comment: Heterozygous pathogenic (pLoF) ZMYM2 variants have been reported in individuals with syndromic presentation including CAKUT (in several cases) and variable neurological manifestations among extra-renal features. DD and ID were reported in some of the families described to date as summarized below. You might consider inclusion with green/amber rating in the ID panel and green in the panel for CAKUT.

--

Connaughton et al (2020 - PMID: 32891193) report on 19 individuals (from 15 unrelated families) with heterozygous pathogenic ZMYM2 variants. [Article not reviewed in detail].

Affected individuals from 7 families presented with CAKUT while all of them displayed extra-renal features. Neurological manifestations were reported in 16 individuals from 14 families (data not available for 1 fam), among others hypotonia (3/14 fam), speech delay (4/14 fam), global DD (9/14 fam), ID (4/14 fam), microcephaly (4/14 fam). ASD was reported in 4 fam (4 indiv). Seizures were reported in 2 fam (2 indiv). Variable other features included cardiac defects, facial dysmorphisms, small hands and feet with dys-/hypo-plastic nails and clinodactyly.

14 pLoF variants were identified, in most cases as de novo events (8 fam). In 2 families the variant was inherited from an affected parent. Germline mosaicism occurred in 1 family.

The human disease features were recapitulated in a X. tropicalis morpholino knockdown, with expression of truncating variants failing to rescue renal and craniofacial defects. Heterozygous Zmym2-deficient mice also recapitulated the features of CAKUT.

ZMYM2 (previously ZNF198) encodes a nuclear zinc finger protein localizing to the nucleus (and PML nuclear body).

It has previously been identified as transcriptional corepressor interacting with nuclear receptors and the LSD1-CoREST-HDAC1 complex. It has also been shown to interact with FOXP transcription factors.

The authors provide evidence for loss of interaction of the truncated ZMYM2 with FOXP1 (mutations in the latter having recently been reported in syndromic CAKUT).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3012 NEMF Zornitza Stark gene: NEMF was added
gene: NEMF was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NEMF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NEMF were set to 32934225
Phenotypes for gene: NEMF were set to Intellectual disability; neuropathy
Review for gene: NEMF was set to GREEN
Added comment: Nine individuals from 7 unrelated families reported with a mixed CNS/PNS phenotype. 7/9 had ID, 4/9 had formal assessments demonstrating axonal neuropathy, 3/9 had ataxia; muscular atrophy, hypotonia, respiratory distress, scoliosis also described in some. Three independently generated mouse models had progressive motor neuron degeneration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.3011 LMNB1 Zornitza Stark Added comment: Comment when marking as ready: Note different mechanism for LMNB1-related neurodevelopmental phenotype cf Adult-onset leukodystrophy phenotype previously associated with this gene.
Intellectual disability syndromic and non-syndromic v0.3011 LMNB1 Zornitza Stark Phenotypes for gene: LMNB1 were changed from Leukodystrophy, adult-onset, autosomal dominant, MIM#169500 to Global developmental delay, Intellectual disability, Microcephaly, Short stature, Seizures, Abnormality of the corpus callosum, Cortical gyral simplification, Feeding difficulties, Scoliosis; Leukodystrophy, adult-onset, autosomal dominant, MIM#169500
Intellectual disability syndromic and non-syndromic v0.3010 LMNB1 Zornitza Stark Publications for gene: LMNB1 were set to
Intellectual disability syndromic and non-syndromic v0.3007 MAPK8IP3 Zornitza Stark Publications for gene: MAPK8IP3 were set to 30612693
Intellectual disability syndromic and non-syndromic v0.3005 KCNA2 Zornitza Stark Publications for gene: KCNA2 were set to
Intellectual disability syndromic and non-syndromic v0.3002 EBF3 Zornitza Stark Publications for gene: EBF3 were set to
Intellectual disability syndromic and non-syndromic v0.2999 DOCK3 Zornitza Stark Publications for gene: DOCK3 were set to
Intellectual disability syndromic and non-syndromic v0.2996 ALDH5A1 Zornitza Stark Publications for gene: ALDH5A1 were set to
Intellectual disability syndromic and non-syndromic v0.2993 SPRED1 Zornitza Stark Publications for gene: SPRED1 were set to
Intellectual disability syndromic and non-syndromic v0.2990 SOS1 Zornitza Stark Publications for gene: SOS1 were set to
Intellectual disability syndromic and non-syndromic v0.2986 HRAS Zornitza Stark Publications for gene: HRAS were set to
Intellectual disability syndromic and non-syndromic v0.2981 SLC16A2 Zornitza Stark Publications for gene: SLC16A2 were set to
Intellectual disability syndromic and non-syndromic v0.2978 HECW2 Zornitza Stark Publications for gene: HECW2 were set to
Intellectual disability syndromic and non-syndromic v0.2975 NR2F1 Zornitza Stark Publications for gene: NR2F1 were set to
Intellectual disability syndromic and non-syndromic v0.2971 HSPA9 Sue White gene: HSPA9 was added
gene: HSPA9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSPA9 were set to 32869452; 26598328
Phenotypes for gene: HSPA9 were set to OMIM 616854; skeletal anomalies; congenital cardiac and renal anom
Penetrance for gene: HSPA9 were set to Complete
Review for gene: HSPA9 was set to AMBER
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2968 MYT1L Zornitza Stark Publications for gene: MYT1L were set to 28859103
Intellectual disability syndromic and non-syndromic v0.2966 GTPBP2 Zornitza Stark Publications for gene: GTPBP2 were set to
Intellectual disability syndromic and non-syndromic v0.2963 GNB1 Zornitza Stark Publications for gene: GNB1 were set to
Intellectual disability syndromic and non-syndromic v0.2960 FITM2 Zornitza Stark gene: FITM2 was added
gene: FITM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: FITM2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FITM2 were set to 28067622; 30214770; 30288795
Phenotypes for gene: FITM2 were set to Siddiqi syndrome MIM#618635
Review for gene: FITM2 was set to GREEN
Added comment: Autosomal recessive condition characterised by global developmental delay, early-onset progressive sensorineural hearing impairment, regression of motor skills, dystonia, poor overall growth, and low body mass index (BMI). More variable features may include ichthyosis-like skin abnormalities or sensory neuropathy. 7 individuals from three unrelated families reported, supportive Drosophila model.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2959 FDXR Zornitza Stark Publications for gene: FDXR were set to
Intellectual disability syndromic and non-syndromic v0.2958 FDXR Zornitza Stark changed review comment from: ID is not part of the phenotype.; to: Bi-allelic variants in FDXR cause an autosomal recessive neurologic disorder characterised by onset of visual and hearing impairment in the first or second decades. Two individuals described with a more severe phenotype, including one with intellectual disability.
Intellectual disability syndromic and non-syndromic v0.2957 EIF2S3 Zornitza Stark Publications for gene: EIF2S3 were set to
Intellectual disability syndromic and non-syndromic v0.2955 SETD1B Zornitza Stark Phenotypes for gene: SETD1B were changed from SETD1B-related neurodevelopmental disorder to Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000
Intellectual disability syndromic and non-syndromic v0.2954 TRIP13 Zornitza Stark changed review comment from: Early-onset Wilms tumor and either aneuploidy or premature chromatid separation in cells. Some individuals described as having additional developmental features, such as microcephaly, growth retardation, or developmental delay but these are highly variable.; to: Early-onset Wilms tumor and either aneuploidy or premature chromatid separation in cells. Some individuals described as having additional developmental features, such as microcephaly, growth retardation, or developmental delay but these are highly variable. Also note 5/6 reported families had the same homozygous variant, p.Arg354X, suggestive of founder effect.
Intellectual disability syndromic and non-syndromic v0.2953 TRAPPC6B Zornitza Stark Publications for gene: TRAPPC6B were set to
Intellectual disability syndromic and non-syndromic v0.2949 DHX37 Naomi Baker gene: DHX37 was added
gene: DHX37 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DHX37 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: DHX37 were set to PMID: 26539891; 31256877
Phenotypes for gene: DHX37 were set to Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731
Review for gene: DHX37 was set to GREEN
Added comment: Two unrelated patients from consanguineous families reported with biallelic missense variants. Clinical presentation included severe microcephaly, DD/ID, and cortical atrophy (PMID: 26539891).

Five individuals who share a phenotype of DD and/or ID and CNS dysfunction. Three out of five individuals also have scoliosis, and two have cardiac phenotypes (PMID: 31256877). Three of the patients had bialleleic missense variants, while two patients had a de novo monoallelic missense variant.

Note that OMIM lists inheritance as biallelic, however two monoallelic cases reportes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2948 PAK3 Zornitza Stark Publications for gene: PAK3 were set to
Intellectual disability syndromic and non-syndromic v0.2945 CLTC Zornitza Stark Publications for gene: CLTC were set to
Intellectual disability syndromic and non-syndromic v0.2942 PLK4 Zornitza Stark Publications for gene: PLK4 were set to
Intellectual disability syndromic and non-syndromic v0.2939 TRAPPC2L Zornitza Stark gene: TRAPPC2L was added
gene: TRAPPC2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to AMBER
Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2937 DPP6 Zornitza Stark Publications for gene: DPP6 were set to
Intellectual disability syndromic and non-syndromic v0.2933 PCGF2 Zornitza Stark Publications for gene: PCGF2 were set to
Intellectual disability syndromic and non-syndromic v0.2930 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Intellectual disability syndromic and non-syndromic v0.2927 CREBBP Zornitza Stark Publications for gene: CREBBP were set to
Intellectual disability syndromic and non-syndromic v0.2924 CDC6 Seb Lunke Publications for gene: CDC6 were set to
Intellectual disability syndromic and non-syndromic v0.2920 CTNND1 Zornitza Stark gene: CTNND1 was added
gene: CTNND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CTNND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CTNND1 were set to 28301459; 32196547
Phenotypes for gene: CTNND1 were set to Blepharocheilodontic syndrome 2, MIM# 617681
Review for gene: CTNND1 was set to AMBER
Added comment: 4 individuals from 3 unrelated families with blepharocheilodontic syndrome and mutations in the CTNND1 gene reported originally in PMID 28301459. All had eyelid anomalies, including ectropion of the lower lids, euryblepharon, lagophthalmia, and distichiasis. In addition, all 4 showed typical facial dysmorphism with hypertelorism, flat face, and high forehead, and all had conical teeth and tooth agenesis. Three had cleft lip and palate, 3 had hair anomalies, and 1 had hypothyroidism due to hypoplasia or aplasia of the thyroid gland. None of the patients exhibited anal atresia or neural tube defects.

PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13).

This more recent publication suggests a broader phenotype associated with CTNND1 variants including dev delay, ADHD/ASD, behavioural issues. Unclear from description whether significant ID present.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2918 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Intellectual disability syndromic and non-syndromic v0.2916 KIF14 Zornitza Stark Publications for gene: KIF14 were set to
Intellectual disability syndromic and non-syndromic v0.2913 MOCS1 Zornitza Stark Publications for gene: MOCS1 were set to
Intellectual disability syndromic and non-syndromic v0.2910 KDM1A Zornitza Stark Publications for gene: KDM1A were set to
Intellectual disability syndromic and non-syndromic v0.2908 NSD2 Zornitza Stark Publications for gene: NSD2 were set to
Intellectual disability syndromic and non-syndromic v0.2904 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Intellectual disability syndromic and non-syndromic v0.2899 AASS Zornitza Stark Publications for gene: AASS were set to
Intellectual disability syndromic and non-syndromic v0.2896 AARS Zornitza Stark Publications for gene: AARS were set to
Intellectual disability syndromic and non-syndromic v0.2893 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Intellectual disability syndromic and non-syndromic v0.2890 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Intellectual disability syndromic and non-syndromic v0.2887 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Intellectual disability syndromic and non-syndromic v0.2884 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Intellectual disability syndromic and non-syndromic v0.2882 HARS Zornitza Stark Publications for gene: HARS were set to 32296180
Intellectual disability syndromic and non-syndromic v0.2880 ALG12 Zornitza Stark Publications for gene: ALG12 were set to
Intellectual disability syndromic and non-syndromic v0.2877 ALG11 Zornitza Stark Publications for gene: ALG11 were set to
Intellectual disability syndromic and non-syndromic v0.2874 PDE2A Zornitza Stark gene: PDE2A was added
gene: PDE2A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PDE2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDE2A were set to 32467598; 32196122; 29392776
Phenotypes for gene: PDE2A were set to Paroxysmal dyskinesia
Review for gene: PDE2A was set to AMBER
Added comment: Four unrelated families reported with childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. One of the reports characterises the disorder as 'Rett-like'. Unclear at this time what proportion of affected individuals have ID as part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2872 CRADD Zornitza Stark Publications for gene: CRADD were set to
Intellectual disability syndromic and non-syndromic v0.2869 TMTC3 Zornitza Stark Publications for gene: TMTC3 were set to
Intellectual disability syndromic and non-syndromic v0.2866 MAOA Zornitza Stark Publications for gene: MAOA were set to
Intellectual disability syndromic and non-syndromic v0.2863 GABRG2 Zornitza Stark Publications for gene: GABRG2 were set to
Intellectual disability syndromic and non-syndromic v0.2860 GABRB3 Zornitza Stark Publications for gene: GABRB3 were set to
Intellectual disability syndromic and non-syndromic v0.2857 FOLR1 Zornitza Stark Publications for gene: FOLR1 were set to
Intellectual disability syndromic and non-syndromic v0.2853 KAT5 Zornitza Stark Publications for gene: KAT5 were set to
Intellectual disability syndromic and non-syndromic v0.2849 LMBRD2 Konstantinos Varvagiannis gene: LMBRD2 was added
gene: LMBRD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LMBRD2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: LMBRD2 were set to 32820033; https://doi.org/10.1101/797787
Phenotypes for gene: LMBRD2 were set to Global developmental delay; Intellectual disability; Microcephaly; Seizures; Abnormality of nervous system morphology; Abnormality of the eye
Penetrance for gene: LMBRD2 were set to unknown
Mode of pathogenicity for gene: LMBRD2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: LMBRD2 was set to AMBER
Added comment: You may consider inclusion with green (13 individuals with dn missense SNVs overall, overlapping features for 10 with available phenotype / a recurring variant has been identified in 2 different studies) or amber rating (role of the gene not known, no variant studies, animal model probably not available).

► Malhotra et al (2020 - PMID: 32820033) report on 10 unrelated individuals with de novo missense LMBRD2 variants.

Features included DD (9/10), ID (6/8 of relevant age), microcephaly (7/10), seizures (5/10 - >=3 different variants), structural brain abnormalities (e.g. thin CC in 6/9), highly variable ocular abnormalities (5/10) and dysmorphic features in some (7/10 - nonspecific).

All had variable prior non-diagnostic genetic tests (CMA, gene panel, mendeliome, karyotype). WES/WGS revealed LMBRD2 missense variants, in all cases de novo. A single individual had additional variants with weaker evidence of pathogenicity.

5 unique missense SNVs and 2 recurrent ones (NM_001007527:c.367T>C - p.Trp123Arg / c.1448G>A - p.Arg483His) were identified. These occurred in different exons. Variants were not present in gnomAD and all had several in silico predictions in favor of a deleterious effect.

There was phenotypic variability among individuals with the same variant (e.g. seizures in 1/3 and microchephaly in 2/3 of those harboring R483H).

The gene has a pLI of 0 (although o/e ranges from 0.23 to 0.55), %HI of 15.13 and z-score of 2.27. The authors presume that haploinsufficiency may not apply, and consider a gain-of-function/dominant-negative effect more likely.

As the authors comment LMBRD2 (LMBR1 domain containing 2) encodes a membrane bound protein with poorly described function. It is widely expressed across tissues with notable expression in human brain (also in Drosophila, or Xenopus laevis). It displays high interspecies conservation.

It has been suggested (Paek et al - PMID: 28388415) that LMBRD2 is a potential regulator of β2 adrenoreceptor signalling through involvement in GPCR signalling.

► Kaplanis et al (2020 - https://doi.org/10.1101/797787) in a dataset of 31058 parent-offspring trios (WES) previously identified 3 individuals with developmental disorder, harboring c.1448G>A - p.Arg483His. These individuals (1 from the DDD study, and 2 GeneDx patients) appear in Decipher. [ https://decipher.sanger.ac.uk/ddd/research-variant/40e17c78cc9655a6721006fc1e0c98db/overview ]. The preprint by Kaplanis et al is cited by Malhotra et al, with Arg483His reported in 6 patients overall in both studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2848 TMEM237 Zornitza Stark Publications for gene: TMEM237 were set to
Intellectual disability syndromic and non-syndromic v0.2845 KANSL1 Zornitza Stark Publications for gene: KANSL1 were set to
Intellectual disability syndromic and non-syndromic v0.2842 TAOK1 Zornitza Stark Publications for gene: TAOK1 were set to
Intellectual disability syndromic and non-syndromic v0.2839 RAI1 Zornitza Stark Publications for gene: RAI1 were set to
Intellectual disability syndromic and non-syndromic v0.2836 TAF1C Konstantinos Varvagiannis gene: TAF1C was added
gene: TAF1C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TAF1C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TAF1C were set to 32779182
Phenotypes for gene: TAF1C were set to Global developmental delay; Intellectual disability; Spasticity; Strabismus; Seizures; Abnormality of nervous system morphology
Penetrance for gene: TAF1C were set to Complete
Review for gene: TAF1C was set to AMBER
Added comment: Knuutinen et al (2020 - PMID: 32779182) report on 2 individuals from 2 consanguineous families, homozygous for TAF1C missense variants.

Both presented with an early onset neurological phenotype with severe global DD, ID (2/2 - moderate and profound), spasticity (2/2), ophthalmic findings (strabismus 2/2, nystagmus 1/2). Epilepsy, abnormal brain MRI (cerebral and cerebellar atrophy and white matter hyperintensities) as well and additional findings were reported in one (always the same individual).

Following a normal CMA, exome in the first case revealed a homozygous missense SNV (NM_005679.3:c.1165C>T / p.Arg389Cys) supported by in silico predictions. mRNA and protein levels were substantially reduced in fibroblasts from this subject. Only the patient and parents were tested for the variant but not 3 unaffected sibs (fig1).

The second individual was homozygous for another missense variant (p.Arg405Cys) also supported by in silico predictions. The girl was the single affected person within the family with an unaffected sib and parents heterozygous for the variant. Several other unaffected relatives in the extended pedigree were either carriers for this variant or homozygous for the wt allele.

TAF1C encodes the TATA-box binding protein associated factor (TAF) RNA polymerase I subunit.

RNA polymerase I (Pol I) transcribes genes to produce rRNA. For Pol I to initiate transcription, two transcription factors are required : UBF (upstream binding factor encoded by UBTF) and SL1 (selectivity factor 1). The latter is formed by TBP (TATA-binding protein) and 3 Pol I-specific TBP-associated factors (TAFs).

A recurrent de novo missense variant in UBTF (encoding the other Pol I transcription factor) causes a disorder with highly similar features. The specific variant acts through a gain-of-function mechanism (and not by LoF which appears to apply for TAF1C based on expression data).

The authors hypothesize that altered Pol I activity and resulting ribosomal stress could cause the microcephaly and leukodystrophy (both reported in 1 - the same - individual).

As a result, TAF1C may be considered for inclusion in the ID panel with amber rating pending further evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2835 SLC5A6 Zornitza Stark Phenotypes for gene: SLC5A6 were changed from Developmental delay; epilepsy; neurodegeneration to Developmental delay; epilepsy; neurodegeneration; Neurodegeneration, infantile-onset, biotin-responsive, MIM# 618973
Intellectual disability syndromic and non-syndromic v0.2833 FAM50A Konstantinos Varvagiannis gene: FAM50A was added
gene: FAM50A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FAM50A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: FAM50A were set to 32703943
Phenotypes for gene: FAM50A were set to Mental retardation syndrome, X-linked, Armfield type (MIM #300261)
Penetrance for gene: FAM50A were set to unknown
Review for gene: FAM50A was set to GREEN
Added comment: Lee et al (2020 - PMID: 32703943) provide evidence that Armfield X-Linked intellectual disability syndrome is caused by monoallelic FAM50A pathogenic variants. The current review is based only on this reference.

The authors provide clinical details on 6 affected individuals from 5 families.

Features included postnatal growth delay, DD and ID (6/6 - also evident for those without formal IQ assesment), seizures (3/6 from 2 families), prominent forehead with presence of other facial features and variable head circumference (5th to >97th %le), ocular anomalies (5/6 - strabismus/nystagmus/Axenfeld-Rieger), cardiac (3/6 - ASD/Fallot) and genitourinary anomalies (3/6).

In the first of these families (Armfield et al 1999 - PMID: 10398235), linkage analysis followed by additional studies (Sanger, NGS of 718 genes on chrX, X-exome NGS - several refs provided) allowed the identification of a FAM50A variant. Variants in other families were identified by singleton (1 fam) or trio-ES (3 fam).

In affected individuals from 3 families, the variant had occurred de novo. Carrier females in the other families were unaffected (based on pedigrees and/or the original publication). XCI was rather biased in most obligate carrier females from the 1st family (although this ranged from 95:5 to 60:40).

Missense variants were reported in all affected subjects incl. Trp206Gly, Asp255Gly, Asp255Asn (dn), Glu254Gly (dn), Arg273Trp (dn) (NM_004699.3).

Previous studies have demonstrated that FAM50A has ubiquitous expression in human fetal and adult tissues (incl. brain in fetal ones).

Immunostaining suggests a nuclear localization for the protein (NIH/3T3 cells). Comparison of protein levels in LCLs from affected males and controls did not demonstrate significant differences. Protein localization for 3 variants (transfection of COS-7 cells) was shown to be similar to wt.

Complementation studies in zebrafish provided evidence that the identified variants confer partial loss of function (rescue of the morpholino phenotype with co-injection of wt but not mt mRNA). The zebrafish ko model seemed to recapitulate the abnormal development of cephalic structures and was indicative of diminished/defective neurogenesis. Transcriptional dysregulation was demonstrated in zebrafish (altered levels and mis-splicing). Upregulation of spliceosome effectors was demonstrated in ko zebrafish.

Similarly, mRNA expression and splicing defects were demonstrated in LCLs from affected individuals. FAM50A pulldown followed by mass spectrometry in transfected HEK293T cells demonstrated enrichment of binding proteins involved in RNA processing and co-immunoprecipitation assays (transfected U-87 cells) suggested that FAM50A interacts with spliceosome U5 and C-complex proteins.

Overall aberrant spliceosome C-complex function is suggested as the underlying pathogenetic mechanism.

Several other neurodevelopmental syndromes are caused by variants in genes encoding C-complex affiliated proteins (incl. EFTUD2, EIF4A3, THOC2, etc.).

Please consider inclusion in the ID panel with green rating and epilepsy panel with amber (seizures in individuals from 2 families).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2832 ADK Zornitza Stark Publications for gene: ADK were set to
Intellectual disability syndromic and non-syndromic v0.2826 RAC1 Zornitza Stark Publications for gene: RAC1 were set to
Intellectual disability syndromic and non-syndromic v0.2822 BCOR Zornitza Stark Publications for gene: BCOR were set to
Intellectual disability syndromic and non-syndromic v0.2821 BCOR Zornitza Stark Mode of inheritance for gene: BCOR was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.2820 BCOR Zornitza Stark reviewed gene: BCOR: Rating: GREEN; Mode of pathogenicity: None; Publications: 29974297; Phenotypes: Microphthalmia, syndromic 2, MIM# 300166, Oculofaciocardiodental syndrome, Lenz microphthalmia; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.2819 ARSE Zornitza Stark Publications for gene: ARSE were set to
Intellectual disability syndromic and non-syndromic v0.2815 FBXO11 Zornitza Stark Publications for gene: FBXO11 were set to
Intellectual disability syndromic and non-syndromic v0.2813 PIGQ Konstantinos Varvagiannis gene: PIGQ was added
gene: PIGQ was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIGQ was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGQ were set to 32588908; 24463883; 25558065; 31148362
Phenotypes for gene: PIGQ were set to Epileptic encephalopathy, early infantile, 77 (MIM #618548)
Penetrance for gene: PIGQ were set to Complete
Review for gene: PIGQ was set to GREEN
Added comment: Homozygous or compound heterozygous mutations in PIGQ cause Epileptic encephalopathy, early infantile, 77 (MIM #618548).

Johnstone et al (2020 - PMID: 32588908) describe the phenotype of 7 children (from 6 families) with biallelic PIGQ pathogenic variants. The authors also review the phenotype of 3 subjects previously reported in the literature (by Martin et al, Alazami et al, Starr et al - respective PMIDs: 24463883, 25558065, 31148362).

Affected individuals displayed severe to profound global DD/ID and seizures with onset in the first year of life. There were variable other features incl. - among others - genitourinary, cardiac, skeletal, ophthalmological anomalies, gastrointestinal issues. Within the cohort there was significant morbidity/mortality.

PIGQ encodes phosphatidylinositol glycan anchor biosynthesis class Q protein, playing a role (early) in the biosynthesis of the GPI-anchor. Several genes in the GPI biosynthesis pathway cause multi-system disease with DD/ID and seizures. Flow cytometry has been used in individuals with PIGQ-related disorder. Serum ALP was elevated in some (4) although - as the authors comment - elevations are more typical in disorders affecting later steps of GPI biosynthesis.

More than 10 variants have been reported to date (missense / pLoF).

Overall PIGQ can be considered for green rating in both ID and epilepsy gene panels.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2811 HPDL Crystle Lee gene: HPDL was added
gene: HPDL was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: HPDL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HPDL were set to 32707086
Phenotypes for gene: HPDL were set to Progressive neurological disorder
Review for gene: HPDL was set to GREEN
Added comment: Biallelic variants reported in 13 families with a neurodegenerative disease ranging from neonatal encephalopathy to adolescent-onset spastic paraplegia
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2811 PIGP Seb Lunke Publications for gene: PIGP were set to 28334793; 31139695
Intellectual disability syndromic and non-syndromic v0.2807 PJA1 Zornitza Stark gene: PJA1 was added
gene: PJA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PJA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: PJA1 were set to 32530565
Phenotypes for gene: PJA1 were set to Intellectual disability; trigonocephaly
Review for gene: PJA1 was set to AMBER
Added comment: Recurrent variant, p.Arg376Cys, reported in 7 Japanese individuals, supportive mouse model. Individuals shared a common haplotype, suggestive of founder effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2806 SCAF4 Crystle Lee gene: SCAF4 was added
gene: SCAF4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: SCAF4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SCAF4 were set to 32730804
Phenotypes for gene: SCAF4 were set to Mild intellectual disability; seizures; behavioral abnormalities
Review for gene: SCAF4 was set to GREEN
Added comment: > 5 variants reported in individuals with variable neurodevelopmental disorder characterized by mild intellectual disability, seizures, behavioral abnormalities, and various skeletal and structural anomalies.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2805 NARS Konstantinos Varvagiannis gene: NARS was added
gene: NARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NARS was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: NARS were set to 32738225
Phenotypes for gene: NARS were set to Abnormal muscle tone; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Ataxia; Abnormality of the face; Demyelinating peripheral neuropathy
Penetrance for gene: NARS were set to Complete
Review for gene: NARS was set to GREEN
Added comment: [Please note that HGNC Approved Gene Symbol for this gene is NARS1]

Manole et al (2020 - PMID: 32738225) provide evidence that both biallelic and monoallelic (de novo) pathogenic NARS1 variants cause a neurodevelopmental disorder. In total 32 individuals from 21 families are reported, with biallelic variants identified in individuals from 13 families and de novo in 8 families.

Similar features were reported for AR/AD occurrences of the disorder and included of microcephaly (90% - most often primary), epilepsy (23/32 or 74% - variable semiology incl. partial/myoclonic/generalized tonic-clonic seizures), DD and ID (as a universal feature), abnormal tone in several (hypotonia/spasticity), ataxia, demyelinating peripheral neuropathy (in 3 or more for each inheritance mode - or a total of 25%). Some individuals had dysmorphic features.

NARS1 encodes an aminoacyl-tRNA synthetase (ARS) [asparaginyl-tRNA synthetase 1]. Aminoacyl-tRNA synthetases constitute a family of enzymes catalyzing attachment of amino-acids to their cognate tRNAs. As the authors comment, mutations in genes encoding several other ARSs result in neurological disorders ranging from peripheral neuropathy to severe multi-systemic NDD. Dominant, recessive or both modes for inheritance for mutations in the same gene (e.g. AARS1, YARS1, MARS1, etc) have been reported.

Some variants were recurrent, e.g. the c.1600C>T / p.Arg534* which occurred in 6 families as a de novo event or c.1633C>T p.Arg545Cys (homozygous in 6 families). 3 different variants were reported to have occured de novo (c.965G>T - p.Arg322Leu, c.1525G>A - p.Gly509Ser, p.Arg534*) with several other variants identified in hmz/compound htz individuals. A single SNV (c.1067A>C - p.Asp356Ala) was suggested to be acting as modifier and pathogenic only when in trans with a severe variant. [NM_004539.4 used as RefSeq for all].

The authors provide several lines of evidence for a partial loss-of-function effect (e.g. reduction in mRNA expression, enzyme levels and activity in fibroblasts or iNPCs) underlying pathogenicity of the variants identified in individuals with biallelic variants. A gain-of-function (dominant-negative) effect is proposed for de novo variants (such effect also demonstrated for the p.Arg534* in a zebrafish model).

As also Manole et al suggest, NARS1 can be considered for inclusion in gene panels for DD/ID, epilepsy and/or demyelinating neuropathy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2804 ZNF407 Konstantinos Varvagiannis gene: ZNF407 was added
gene: ZNF407 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF407 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ZNF407 were set to 24907849; 32737394; 23195952
Phenotypes for gene: ZNF407 were set to Global developmental delay; Intellectual disability
Penetrance for gene: ZNF407 were set to unknown
Review for gene: ZNF407 was set to AMBER
Added comment: You may consider inclusion of this gene probably with amber rating (or green if the evidence for biallelic variants is considered sufficient).

Biallelic variants:

- Kambouris et al. (2014 - PMID: 24907849) described 2 brothers with severe DD and ID, born to first cousin parents. Homozygosity mapping, following other non-diagnostic investigations (incl. aCGH), revealed 4 major homozygosity intervals. Exome sequencing in one identified 5 variants within these intervals, ZNF407 (c.5054C>G, p.Ser1685Trp) being the best candidate, supported also by segregation studies. The authors commented that zinc finger proteins act as transcriptional regulators, with mutations in genes encoding for other zinc finger proteins interfering with normal brain development.

- Zahra et al. (2020 - PMID: 32737394) report on 7 affected individuals (from 3 families) homozygous or compound heterozygous for ZNF407 variants. Features included hypotonia, DD and ID (in all) and variable occurrence of short stature (6/6), microcephaly (in at least 5), behavioural, visual problems and deafness. Linkage analysis in the first family revealed a 4.4 Mb shared homozygosity region and exome (30x) revealed a 3-bp duplication, confirmed by Sanger sequencing and segregating with the disease (NM_001146189:c.2814_2816dup, p.Val939dup). Affected subjects from the 2 other families were each found to be homozygous (c.2405G>T) or compound heterozygous (c.2884C>G, c.3642G>C) for other variants. Segregation was compatible in all families. Other studies were not performed. The authors comment than only the 3-bp duplication fullfilled ACMG criteria for classification as LP, the other variants being all formally classified as VUS (also due to in silico predictions predicting a LB effect). In addition, while several features such as DD/ID and short stature appeared to be frequent among all patients reported, Zahra et all comment that there was partial clinical overlap with the sibs described by Kambouris et al (additional variants?).


Monoallelic disruption of ZNF407:

- Ren et al (2013 - PMID: 23195952) described an 8 y.o. boy with ID and ASD. The boy was found to harbor a de novo translocation between chromosomes 3 and 18 [46,XY,t(3;18)(p13;q22.3)]. Array CGH did not reveal any P/LP CNV. Delineation of the breakpoints (FISH, long-range PCR) revealed that the chr18 breakpoint disrupted intron 3 of ZNF407 (isoform 1) with the other breakpoint within a gene-free region of exon 3. There was a loss of 4-8 nt in chr18 and 2-6 in chr3. Sequencing of ZNF407 did not reveal additional variants. RNA isolation in blood followed by RT-PCR studied expression of all 3 ZNF407 isoforms (the intronic region being shared by isoforms 1 and 2). Expression of isoform 1 was shown to be significantly reduced compared to controls. Isoform 2 was undetectable (in blood) while isoform 3 expression was similar to controls. Sequencing of 105 additional patients with similar clinical presentation (ID & ASD) revealed 2 further individuals with de novo missense variants.

- Based on the discussion by Kambouris et al (PMID: 24907849 - cited literature not here reviewed) ZNF407 may be deleted in patients with congenital aural atresia due to deletion of a critical region of 18q22.3 (though TSHZ1 is responsible for this phenotype) or 18q- although such deletions span several other genes (cited PMID: 16639285). In one case the breakpoint was shown to be disrupting ZNF407 (cited PMID: 24092497).

- The denovo db and Decipher (research variant tab) list few individuals with de novo ZNF407 SNVs although these do not seem to allow conclusions.

https://denovo-db.gs.washington.edu/denovo-db/QueryVariantServlet?searchBy=Gene&target=ZNF407
https://decipher.sanger.ac.uk/search/ddd-research-variants/results?q=znf407
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2803 MAPK1 Konstantinos Varvagiannis gene: MAPK1 was added
gene: MAPK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAPK1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAPK1 were set to 32721402
Phenotypes for gene: MAPK1 were set to Global developmental delay; Intellectual disability; Behavioral abnormality; Growth delay; Abnormality of the face; Abnormality of the neck; Abnormality of the cardiovascular system; Abnormality of the skin
Penetrance for gene: MAPK1 were set to unknown
Mode of pathogenicity for gene: MAPK1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: MAPK1 was set to GREEN
Added comment: Motta et al (2020 - PMID: 32721402) report on 7 unrelated individuals harboring de novo missense MAPK1 pathogenic variants.

The phenotype corresponded to a neurodevelopmental disorder and - as the authors comment - consistently included DD, ID , behavioral problems. Postnatal growth delay was observed in approximately half. Hypertelorism, ptosis, downslant of palpebral fissures, wide nasal bridge as low-set/posteriorly rotated ears were among the facial features observed (each in 3 or more subjects within this cohort). Together with short/webbed neck and abnormalities of skin (lentigines / CAL spots) and growth delay these led to clinical suspicion of Noonan s. or disorder of the same pathway in some. Congenital heart defects (ASD, mitral valve insufficiency, though not cardiomyopathy) occurred in 4/7. Bleeding diathesis and lymphedema were reported only once.

MAPK1 encodes the mitogen-activated protein kinase 1 (also known as ERK2) a serine/threonine kinase of the RAS-RAF-MEK-(MAPK/)ERK pathway.

MAPK1 de novo variants were identified in all individuals following trio exome sequencing (and extensive previous genetic investigations which were non-diagnostic).

The distribution of variants, as well as in silico/vitro/vivo studies suggest a GoF effect (boosted signal through the MAPK cascade. MAPK signaling also upregulated in Noonan syndrome).

The authors comment that screening of 267 additional individuals with suspected RASopathy (without mutations in previously implicated genes) did not reveal other MAPK1 variants.

Overall this gene can be considered for inclusion in the ID panel with green rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2802 ASPM Zornitza Stark Publications for gene: ASPM were set to
Intellectual disability syndromic and non-syndromic v0.2799 TUBB2A Zornitza Stark Publications for gene: TUBB2A were set to
Intellectual disability syndromic and non-syndromic v0.2796 EEF1A2 Zornitza Stark Publications for gene: EEF1A2 were set to
Intellectual disability syndromic and non-syndromic v0.2790 LARS Konstantinos Varvagiannis gene: LARS was added
gene: LARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LARS were set to 32699352
Phenotypes for gene: LARS were set to Infantile liver failure syndrome 1, MIM# 615438
Penetrance for gene: LARS were set to Complete
Review for gene: LARS was set to GREEN
Added comment: Please consider inclusion with amber/green rating in the current panel.

Biallelic pathogenic LARS1 variants cause Infantile liver failure syndrome 1, MIM# 615438.

Lenz et al (2020 - PMID: 32699352) review the phenotype of 25 affected individuals from 15 families.

Seizures occurred in 19/24 and were commonly associated with infections. Encephalopathic episodes (in 13 patients) accompanied by seizures up to status epilepticus occurred independently of hepatic decompensation.

In addition 22/24 presented with neurodevelopmental delay. The authors comment that cognitive impairment was present in 13/17 individuals (mild-severe) whereas most presented with learning disabilities.

These patients will most likely investigated for their liver disease (although presentation was highly variable and/or very mild in few).

The gene encodes a cytoplasmic amino-acyl tRNA synthetase (ARS) with neurologic manifestations observed in almost all patients (and seizures / DD and ID common to other disorders due to mutations in other genes encoding for ARSs).

Please note that the HGNC approved symbol for this gene is LARS1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2789 SMARCA2 Zornitza Stark Publications for gene: SMARCA2 were set to
Intellectual disability syndromic and non-syndromic v0.2785 MORC2 Zornitza Stark Publications for gene: MORC2 were set to https://doi.org/10.1016/j.ajhg.2020.06.013
Intellectual disability syndromic and non-syndromic v0.2783 MORC2 Konstantinos Varvagiannis gene: MORC2 was added
gene: MORC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MORC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MORC2 were set to https://doi.org/10.1016/j.ajhg.2020.06.013
Phenotypes for gene: MORC2 were set to Charcot-Marie-Tooth disease, axonal, type 2Z, MIM #616688
Penetrance for gene: MORC2 were set to unknown
Mode of pathogenicity for gene: MORC2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: MORC2 was set to GREEN
Added comment: The current review is based on a recent report by Sacoto et al (2020 - https://doi.org/10.1016/j.ajhg.2020.06.013).

While several previous studies focused on the phenotype of axonal motor and senory neuropathy in individuals with heterozygous MORC2 pathogenic variants (Charcot-Marie-Tooth disease, axonal, type 2Z, MIM #616688) some of them presented among others with hypotonia, muscle weakness, intellectual disability, microcephaly or hearing loss [refs provided by Sacoto et al - learning disabilities (in some patients) also listed in OMIM's clinical synopsis].

Sacoto et al present a cohort of 20 individuals having genetic testing for developmental delay or growth failure (with a single one for a diagnosis of sensorimotor neuropathy).

Overlapping features included DD, ID (18/20 - mild to severe), short stature (18/20), microcephaly (15/20) and variable craniofacial dysmorphisms. The authors comment that features suggestive of neuropathy (weakness, hyporeflexia, abnormal EMG/NCS) were frequent but not the predominant complaint. EMG/NCS abnormalities were abnormal in 6 out of 10 subjects investigated in this cohort. Other findings included brain MRI abnormalities (12/18 - in 5/18 Leigh-like lesions), hearing loss (11/19) and pigmentary retinopathy in few (5).

Affected subjects were found to harbor in all cases missense variants in the ATPase module of MORC2 [residues 1 to 494 - NM_001303256.1 - the module consists of an ATPase domain (aa 1-265), a transducer S5-like domain (266-494) and a coiled-coiled domain (CC1 - aa 282-361)].

Variants had occured mostly as de novo events although inheritance from a similarly affected parent was also reported.

Some of them were recurring within this cohort and/or the literature eg. c.79G>A/p.Glu27Lys (x5), c.260C>T/p.Ser87Leu (x2), c.394C>T/p.Arg132Cys (4x), c.1164C>G/p.Ser388Arg (x2), c.1181A>G/p.Tyr394Cys (x3).

MORC2 encodes an ATPase involved in chromatin remodeling, DNA repair and transcriptional regulation. Chromatin remodeling and epigenetic silencing by MORC2 is mediated by the HUSH (Human Silencing Hub) complex. Functional studies (MORC2-knockout HeLa cells harboring a HUSH-sensitive GFP reporter were transduced with wt or mt MORC2 followed by measurement of reporter repression) supported the deleterious effect of most variants known at the time (hyperactivation of HUSH-mediating silencing, in line with previous observations).

Overall this gene can be considered for inclusion in the ID panel with green rating. Also other gene panels (e.g. for short stature, microcephaly, hearing loss, pigmentary retinopathy, etc) if it meets the respective criteria for inclusion.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2782 HDAC8 Zornitza Stark Publications for gene: HDAC8 were set to
Intellectual disability syndromic and non-syndromic v0.2781 HDAC8 Zornitza Stark Mode of inheritance for gene: HDAC8 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.2780 HDAC8 Zornitza Stark reviewed gene: HDAC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 30614194, 24403048; Phenotypes: Cornelia de Lange syndrome 5, MIM# 300882; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.2778 NSDHL Zornitza Stark Publications for gene: NSDHL were set to
Intellectual disability syndromic and non-syndromic v0.2775 ZNF462 Zornitza Stark Publications for gene: ZNF462 were set to PubMed: 31361404; 28513610
Intellectual disability syndromic and non-syndromic v0.2773 DEAF1 Zornitza Stark Publications for gene: DEAF1 were set to
Intellectual disability syndromic and non-syndromic v0.2769 LHX3 Zornitza Stark Publications for gene: LHX3 were set to
Intellectual disability syndromic and non-syndromic v0.2765 ATL1 Zornitza Stark Publications for gene: ATL1 were set to
Intellectual disability syndromic and non-syndromic v0.2752 HERC2 Zornitza Stark Publications for gene: HERC2 were set to 23243086; 23065719
Intellectual disability syndromic and non-syndromic v0.2750 CNPY3 Konstantinos Varvagiannis gene: CNPY3 was added
gene: CNPY3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CNPY3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CNPY3 were set to 29394991; 30237576
Phenotypes for gene: CNPY3 were set to Epileptic encephalopathy, early infantile, 60 (MIM 617929)
Penetrance for gene: CNPY3 were set to Complete
Review for gene: CNPY3 was set to GREEN
Added comment: Biallelic CNPY3 mutations cause Epileptic encephalopathy, early infantile, 60 (MIM 617929).

The phenotype including among others hypotonia, intractable seizures, DD and ID has been first reported by Mutoh et al (2018 - PMID: 29394991) in 3 subjects from 2 families. Evidence was provided for the role of the gene (incl. mouse model) and pathogenicity of the identified variants (resulting in LoF).

Another subject with similar features of hypotonia, DD, intractable epilepsy, feeding problems has been described briefly by Maddirevula et al (2019 - PMID: 30237576).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2750 KIF21B Konstantinos Varvagiannis gene: KIF21B was added
gene: KIF21B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KIF21B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KIF21B were set to 32415109
Phenotypes for gene: KIF21B were set to Global developmental delay; Intellectual disability; Abnormality of brain morphology; Microcephaly
Penetrance for gene: KIF21B were set to unknown
Mode of pathogenicity for gene: KIF21B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: KIF21B was set to GREEN
Added comment: Asselin et al (2020 - PMID: 32415109) report on 4 individuals with KIF21B pathogenic variants. DD/ID (borderline intellectual functioning to severe ID) was a feature in all. Variable other findings included brain malformations (CCA) and microcephaly. 3 missense variants and a 4-bp insertion were identified, in 3 cases as de novo events while in a single subject the variant was inherited from the father who was also affected. The authors provide evidence for a role of KIF21B in the regulation of processes involved in cortical development and deleterious effect of the missense variants impeding neuronal migration and kinesin autoinhibition. Phenotypes specific to variants (e.g. CCA or microcephaly) were recapitulated in animal models. Missense variants are thought to exert a gain-of-function effect. As commented on, the 4-bp duplication (/frameshift) variant might not be pathogenic. In blood sample from the respective individual, RT-qPCR analysis suggested that haploinsufficiency (NMD) applies. Although Kif21b haploinsufficiency in mice was shown to lead to impaired neuronal positioning, the gene might partially tolerate LoF variants as also suggested by 28 such variants in gnomAD. Homozygous Kif21b ko mice display severe morphological abnormalities, partial loss of commissural fibers, cognitive deficits and altered synaptic transmission (several refs to previous studies provided by the authors).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2750 PAX1 Konstantinos Varvagiannis gene: PAX1 was added
gene: PAX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Radboud University Medical Center, Nijmegen
Mode of inheritance for gene: PAX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PAX1 were set to 29681087; 23851939; 28657137
Phenotypes for gene: PAX1 were set to Otofaciocervical syndrome 2, 615560
Penetrance for gene: PAX1 were set to Complete
Review for gene: PAX1 was set to AMBER
Added comment: Biallelic PAX1 pathogenic variants cause Otofaciocervical syndrome 2 (OMIM 615560).

Brief review of the literature suggests 3 relevant publications to date (04-07-2020).

2 individuals with DD and ID have been reported (Patil et al, 2018 - PMID: 29681087 and Pohl et al, 2013 - PMID: 23851939). Other subjects reported were only evaluated as newborns(mostly)/infants [Paganini et al, 2017 - PMID: 28657137, Patil et al, 2018 - PMID: 29681087].

While the first report by Pohl et al identified a homozygous missense variant supported by functional studies [NM_006192.5:c.497G>T - p.(Gly166Val)] subsequent ones identified homozygosity for pLoF mutations [Patil et al: NM_006192.4:c.1173_1174insGCCCG / Paganini et al: NM_006192:c.1104C>A - p.(Cys368*)].

As discussed by Pohl et al:

PAX1 encodes a transcription factor with critical role in pattern formation during embryogenesis. Study of the mouse Gly157Val (equivalent to human Gly166Val) Pax1 variant suggested reduced binding affinity (reduced transactivation of a regulatory sequence of the Nkx3-2 promoter) and hypofunctional nature of this variant.

Mouse models seem to recapitulate features of the disorder (skeletal, immunodeficiency) while the role of Pax1 in hearing process was thought to be supported by early expression (P6) in mouse cochlea.

Overall this gene can be considered for inclusion in the ID panel with amber/green rating.
Sources: Literature, Radboud University Medical Center, Nijmegen
Intellectual disability syndromic and non-syndromic v0.2750 TMEM106B Konstantinos Varvagiannis gene: TMEM106B was added
gene: TMEM106B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM106B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TMEM106B were set to 29186371; 29444210; 32595021
Phenotypes for gene: TMEM106B were set to Leukodystrophy, hypomyelinating, 16 (MIM #617964)
Penetrance for gene: TMEM106B were set to Complete
Mode of pathogenicity for gene: TMEM106B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: TMEM106B was set to GREEN
Added comment: 6 unrelated individuals with Leukodystrophy, hypomyelinating, 16 (MIM #617964) due to a recurrent TMEM106B variant have been reported to date in the literature (Simons et al 2017 - PMID: 29186371, Yan et al 2018 - PMID: 29444210, Ikemoto et al 2020 - PMID: 32595021).

While a 3 y.o. female described by Yan et al had DD (eg sitting at 9m, walking at 25m) with normal cognitive functioning, and a 38 y.o. female had borderline intellectual functioning (IQ 76), 4 affected individuals had ID. Among them, a 19 y.o. male with severe ID was also found to harbor a second de novo possibly damaging USP7 variant. Seizures have been reported in 2 unrelated subjects. [Clinical features are also summarized in table 1 - Ikemoto et al].

All harbored NM_001134232.2(TMEM106B):c.754G>A (p.Asp252Asn) which in almost all cases occurred as a de novo event. In a single case this variant was inherited from a mosaic parent with mild DD in infancy but normal cognition (reported by Simons et al).

As discussed by Ito et al (2018 - PMID: 30643851) the encoded protein is a structural component of the lysosomal membrane, playing a role on lysosome acidification. Acidity of the lysosome mediates multiple aspects of lysosomal function. Ito et al, using patient-derived fibroblasts assessed mRNA and protein levels. These were unaltered compared with controls. While TMEM106B had been previously shown to affect lysosome number, morphology and acidification, Ito et al demonstrated increased number of lysosomes in patient cells as well as impaired acidification compared to controls. As commented lysosomes are required for generation of myelin.

Recurrence of this missense variant, the presence of pLoF TMEM106B variants in gnomAD as well as the phenotypically normal Tmem106b null mice suggest that this variant may have a gain-of-function or dominant negative effect.

Genes for other forms of hypomyelinating lipodystrophy (incl. PLP1) have green rating in the ID panel.

Overall TMEM106B can be considered for the ID panel with green rating and the epilepsy panel with amber rating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2750 TBC1D2B Konstantinos Varvagiannis gene: TBC1D2B was added
gene: TBC1D2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBC1D2B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBC1D2B were set to 32623794
Phenotypes for gene: TBC1D2B were set to Global developmental delay; Intellectual disability; Seizures; Gingival overgrowth; Behavioral abnormality; Abnormality of the mandible; Abnormality of brain morphology; Abnormality of the eye; Hearing abnormality
Penetrance for gene: TBC1D2B were set to Complete
Review for gene: TBC1D2B was set to AMBER
Added comment: Harms et al (2020 - PMID: 32623794) report on 3 unrelated individuals with biallelic pLoF TBC1D2B variants.

Features included cognitive impairment (mild ID in one case, regression at the age of 12y in another, hypotonia and delayed milestones in a third aged 8m), seizures (3/3 - variable age of onset) and/or gingival overgrowth (2/3 - prior to initiation of AEDs). Other findings included behavioral abnormalities, mandibular anomalies, abnormal brain imaging and ophthalmologic or (rarely) audiometric evaluations.

All were born to non-consanguineous couples and additional investigations were performed in some.

Variants were identified by WES or trio WGS, with Sanger confirmation/compatible segregation analyses.

In line with the pLoF variants, mRNA studies in fibroblasts from 2 unrelated affected individuals demonstrated significantly reduced (~80-90%) TBC1C2D mRNA levels compared to controls, restored following cycloheximide treatment. Protein was absent in patient fibroblasts.

TBC-domain containing GTPase activating proteins are known as key regulators of RAB GTPase activity. TBC1D2B was shown to colocalize with RAB5-positive endocytic vesicles. CRISPR/Cas9-mediated ko of TBC1D2B in HeLa cells suggested a role in EGF receptor endocytosis and decreased cell viability of TBC1D2B-deficient HeLa cells upon serum deprivation.

Genes encoding other TBC domain-containg GTPase-activating proteins, e.g. TBC1D7 and TBC1D20, TBC1D24 are associated with recessive neurodevelopmental disorders (with ID and/or seizures) and the pathophysiological defect in TBC1D2B-related disorder (deficit in vesicle trafficking and/or cell survival) is proposed to be similar to that of TBC1D24.

Overall this gene can be considered for inclusion with amber/green rating in the ID panel and green in epilepsy panel.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2750 EXOC2 Konstantinos Varvagiannis gene: EXOC2 was added
gene: EXOC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EXOC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOC2 were set to 32639540
Phenotypes for gene: EXOC2 were set to Global developmental delay; Intellectual disability; Abnormality of the face; Abnormality of brain morphology
Penetrance for gene: EXOC2 were set to Complete
Review for gene: EXOC2 was set to AMBER
Added comment: Van Bergen et al (2020 - PMID: 32639540) report on 3 individuals from 2 families, harboring biallelic EXOC2 mutations.

Clinical presentation included DD, ID (severe in 2 subjects from fam1, borderline intellectual functioning in fam2), dysmorphic features and brain abnormalities. Cerebellar anomalies were common to all with a molar tooth sign observed in one (1/3). Other findings limited to subjects from one family included acquired microcephaly, congenital contractures, spastic quadriplegia (each observed 2/3).

Previous investigations were in all cases non-diagnostic. WES identified biallelic EXOC2 mutations in all affected individuals.

EXOC2 encodes an exocyst subunit. The latter is an octameric complex, component of the membrane transport machinery, required for tethering and fusion of vesicles at the plasma membrane. As discussed ,vesicle transport is important for the development of brain and the function of neurons and glia. Exocyst function is also important for delivery of Arl13b to the primary cilium (biallelic ARL13B mutations cause Joubert syndrome 8) and ciliogenesis.

Affected subjects from a broader consanguineous family (fam1) were homozygous for a truncating variant. Fibroblast studies revealed mRNA levels compatible with NMD (further restored in presence of CHX) as well as reduced protein levels. The female belonging to the second non-consanguineous family was found to harbor 2 missense variants in trans configuration.

An exocytosis defect was demonstrated in fibroblasts from individuals belonging to both families. Ciliogenesis appeared to be normal, however Arl13b localization/recruitment to the cilia was reduced compared with control cells with the defect rescued upon exogenous expression of wt EXOC2.

Mutations in other genes encoding components of the exocyst complex have been previously reported in individuals with relevant phenotypes (e.g. EXOC8 in a boy with features of Joubert s. or EXOC4 in nephrotic syndrome).

The authors discuss on the essential role of EXOC2 based on model organism studies (e.g. impaired neuronal membrane traffic, failure of neuronal polarization and neuromuscular junction expansion seen in Drosophila Sec5 (EXOC2) null mutants).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2750 CEP120 Konstantinos Varvagiannis gene: CEP120 was added
gene: CEP120 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CEP120 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP120 were set to 27208211
Phenotypes for gene: CEP120 were set to Joubert syndrome 31 (MIM 617761); Short-rib thoracic dysplasia 13 with or without polydactyly (MIM 616300)
Penetrance for gene: CEP120 were set to Complete
Review for gene: CEP120 was set to GREEN
Added comment: Pathogenic CEP120 variants have been reported in recessive ciliopathies, namely Short-rib thoracic dysplasia 13 with or without polydactyly (MIM 616300) and Joubert syndrome 31 (MIM 617761).

The former is associated with a severe/lethal outcome (4 unrelated infants described by Shaheen et al 2015 - PMID: 25361962, 2 fetuses reported by Roosing et al 2016 - PMID: 27208211).

Roosing et al however, also provided details on 4 unrelated subjects with Joubert syndrome diagnosis. All presented with a neurologic phenotype of hypotonia, DD, cognitive impairment and exhibited a molar tooth sign.

As a result, this gene can be considered for inclusion in the ID panel with green rating (>3 individuals/variants, consistent ciliopathy phenotype).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2750 CCDC174 Konstantinos Varvagiannis gene: CCDC174 was added
gene: CCDC174 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC174 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC174 were set to 26358778
Phenotypes for gene: CCDC174 were set to Hypotonia, infantile, with psychomotor retardation - IHPMR, 616816
Penetrance for gene: CCDC174 were set to Complete
Mode of pathogenicity for gene: CCDC174 was set to Other
Review for gene: CCDC174 was set to AMBER
Added comment: Biallelic pathogenic CCDC174 variants cause Hypotonia, infantile, with psychomotor retardation - IHPMR (MIM 616816).

Volodarsky et al [2015 - PMID: 26358778] describe 6 children from 2 unrelated families with - among others - severe hypotonia, psychomotor delay and abducens nerve palsy. All affected subjects were homozygous for a stoploss variant. Evidence from functional studies/animal model is provided supporting the role of the gene in this phenotype.

Overall this gene can be considered for inclusion in the ID panel with amber rating (2 families, single founder variant, consistent phenotype, supportive studies) pending further reports.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2750 ACOX2 Konstantinos Varvagiannis gene: ACOX2 was added
gene: ACOX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ACOX2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ACOX2 were set to 27647924; 27884763; 29287774
Phenotypes for gene: ACOX2 were set to Bile acid synthesis defect, congenital, 6 - 617308
Penetrance for gene: ACOX2 were set to unknown
Review for gene: ACOX2 was set to RED
Added comment: Biallelic pathogenic ACOX2 variants cause Bile acid synthesis defect, congenital, 6 (MIM 617308). Overall the phenotype corresponds to an IEM/peroxisomal disorder.

As per 01-07-2020 there are 3 reports, briefly reviewed :

- Vilarinho et al [2016 - PMID: 27647924] provided details on an 8-year-old boy with ID.
- Monte et al [2017 - PMID: 27884763] described a 16 year old male with sustained elevation of transaminases *without* accompanying neurologic symptomatology (as they comment).
- Ferdinandusse et al [2018 - PMID: 29287774] reported on a girl deceased at the age of few months.

Please consider inclusion in the ID panel with amber/red rating pending further reports.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2750 ABCA2 Konstantinos Varvagiannis gene: ABCA2 was added
gene: ABCA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABCA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ABCA2 were set to 30237576; 29302074; 31047799
Phenotypes for gene: ABCA2 were set to Intellectual developmental disorder with poor growth and with or without seizures or ataxia, 618808
Penetrance for gene: ABCA2 were set to Complete
Review for gene: ABCA2 was set to GREEN
Added comment: Biallelic pathogenic ABCA2 variants cause Intellectual developmental disorder with poor growth and with or without seizures or ataxia (MIM 618808).

There are 3 relevant publications (01-07-2020) :
- Maddirevula et al [2019 - PMID: 30237576] described briefly 2 unrelated subjects (16-2987, 16DG0071) both DD and seizures among other manifestations.
- Hu et al [2019 - PMID: 29302074] reported 3 sibs (M8600615 - III:1-3) born to consanguineous parents (M8600615 - III:1-3) with DD/ID (formal confirmation of moderate ID, in those (2) evaluated). One also presented with seizures.
- Aslam and Naz [2019 - PMID: 31047799] provided clinical details on 2 siblings born to consanguineous parents. ID was reported for the older sib but was absent in the younger one. Seizures were not part of the phenotype.

All subjects harbored biallelic pLoF variants.

N.B. : Steinberg et al [2015 - PMID: 25773295], within a cohort of patients with ALS, identified one with biallelic ABCA2 variants. As however Aslam and Naz comment, this person harbored a single pathogenic variant, with a second one rather unlikely to be pathogenic due to high allele frequency.

Overall this gene can be considered for inclusion with green rating in both ID and epilepsy panels (each in >=3 unrelated individuals).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2749 RPL10 Zornitza Stark Publications for gene: RPL10 were set to
Intellectual disability syndromic and non-syndromic v0.2746 GLS Zornitza Stark Publications for gene: GLS were set to 30970188
Intellectual disability syndromic and non-syndromic v0.2743 PLCB1 Zornitza Stark Publications for gene: PLCB1 were set to
Intellectual disability syndromic and non-syndromic v0.2740 PIGY Zornitza Stark Publications for gene: PIGY were set to
Intellectual disability syndromic and non-syndromic v0.2733 RAP1GDS1 Zornitza Stark gene: RAP1GDS1 was added
gene: RAP1GDS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAP1GDS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAP1GDS1 were set to 32431071
Phenotypes for gene: RAP1GDS1 were set to Intellectual disability; dysmorphic features
Review for gene: RAP1GDS1 was set to AMBER
Added comment: Four individuals from two consanguineous families, same homozygous splice site variant detected.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2732 SETD1B Zornitza Stark Publications for gene: SETD1B were set to 32546566
Intellectual disability syndromic and non-syndromic v0.2731 SETD1B Zornitza Stark edited their review of gene: SETD1B: Changed publications: 32546566, 29322246, 31440728, 31685013
Intellectual disability syndromic and non-syndromic v0.2731 SETD1B Zornitza Stark Marked gene: SETD1B as ready
Intellectual disability syndromic and non-syndromic v0.2731 SETD1B Zornitza Stark Gene: setd1b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2731 SETD1B Zornitza Stark Phenotypes for gene: SETD1B were changed from to SETD1B-related neurodevelopmental disorder
Intellectual disability syndromic and non-syndromic v0.2730 SETD1B Zornitza Stark Publications for gene: SETD1B were set to
Intellectual disability syndromic and non-syndromic v0.2729 SETD1B Zornitza Stark Mode of inheritance for gene: SETD1B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2728 SETD1B Zornitza Stark reviewed gene: SETD1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 32546566; Phenotypes: SETD1B-related neurodevelopmental disorder; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2726 CAPZA2 Zornitza Stark gene: CAPZA2 was added
gene: CAPZA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CAPZA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CAPZA2 were set to 32338762
Phenotypes for gene: CAPZA2 were set to Intellectual disability
Review for gene: CAPZA2 was set to AMBER
Added comment: PMID: 32338762 - Huang et al 2020 - report 2 unrelated families (Chinese and European) in which a de novo heterozygous variant has been identified in CAPZA2 in paediatric probands that present with global motor development delay, speech delay, intellectual disability, hypotonia. One proband had seizures at 7 months but these were controlled with medication and did not repeat. The other proband at age one had an atypical febrile seizure that was controlled without medication. Functional studies in Drosophila suggest that these variants are mild loss of function mutations but that they can act as dominant negative variants in actin polymerization in bristles.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2724 MCM3AP Zornitza Stark Publications for gene: MCM3AP were set to 24123876; 28633435; 28969388; 29982295
Intellectual disability syndromic and non-syndromic v0.2722 EXOC7 Chirag Patel gene: EXOC7 was added
gene: EXOC7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EXOC7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOC7 were set to PMID: 32103185
Phenotypes for gene: EXOC7 were set to brain atrophy; seizures; developmental delay; microcephaly
Review for gene: EXOC7 was set to GREEN
Added comment: 4 families with 8 affected individuals with brain atrophy, seizures, and developmental delay, and in more severe cases microcephaly and infantile death. Four novel homozygous or comp.heterozygous variants found in EXOC7, which segregated with disease in the families. They showed that EXOC7, a member of the mammalian exocyst complex, is highly expressed in developing human cortex. In addition, a zebrafish model of Exoc7 deficiency recapitulates the human disorder with increased apoptosis and decreased progenitor cells during telencephalon development, suggesting that the brain atrophy in human cases reflects neuronal degeneration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2720 HNRNPH1 Chirag Patel gene: HNRNPH1 was added
gene: HNRNPH1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HNRNPH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HNRNPH1 were set to PMID: 32335897; 29938792
Phenotypes for gene: HNRNPH1 were set to HNRNPH1 ‐related syndromic intellectual disability
Review for gene: HNRNPH1 was set to GREEN
Added comment: 1st patient reported in 2018 with intellectual disability and dysmorphic features and HNRNPH1 heterozygous missense variant.

2020 paper reports additional 7 cases with ID, short stature, microcephaly, distinctive dysmorphic facial features, and congenital anomalies (cranial, brain, genitourinary, palate, ophthalmologic). They all had HNRNPH1 heterozygous pathogenic variants (missense, frameshift, in‐frame deletion, entire gene duplication) and were identified using clinical networks and GeneMatcher. No comments in paper if all de novo.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2719 PDCD6IP Chirag Patel gene: PDCD6IP was added
gene: PDCD6IP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PDCD6IP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDCD6IP were set to PMID: 32286682
Phenotypes for gene: PDCD6IP were set to Primary microcephaly
Review for gene: PDCD6IP was set to RED
Added comment: One consanguineous family with 2 affected sibs with primary microcephaly (-4SD), intellectual disability and short stature (-5/6SD), and homozygous frameshift variant in PDCD6IP. The homozygous variant was confirmed in both affected sibs, while the four healthy siblings and parents were heterozygous. The clinical features observed in the patients were similar to the phenotypes observed in mouse and zebrafish models of PDCD6IP mutations in previous studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2715 SETD2 Zornitza Stark Marked gene: SETD2 as ready
Intellectual disability syndromic and non-syndromic v0.2715 SETD2 Zornitza Stark Gene: setd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2715 SETD2 Zornitza Stark Phenotypes for gene: SETD2 were changed from to Luscan-Lumish syndrome, MIM#616831
Intellectual disability syndromic and non-syndromic v0.2714 SETD2 Zornitza Stark Publications for gene: SETD2 were set to
Intellectual disability syndromic and non-syndromic v0.2713 SETD2 Zornitza Stark Mode of inheritance for gene: SETD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2712 SETD2 Zornitza Stark reviewed gene: SETD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29681085; Phenotypes: Luscan-Lumish syndrome, MIM#616831; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2711 UBE2A Zornitza Stark Publications for gene: UBE2A were set to
Intellectual disability syndromic and non-syndromic v0.2708 HARS Bryony Thompson gene: HARS was added
gene: HARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HARS were set to 32296180
Phenotypes for gene: HARS were set to multisystem ataxic syndrome; mild-severe intellectual disability
Review for gene: HARS was set to AMBER
Added comment: 3 cases from 2 unrelated families with biallelic variants and mild to severe intellectual disability as a feature of the condition.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2705 SIL1 Zornitza Stark Publications for gene: SIL1 were set to
Intellectual disability syndromic and non-syndromic v0.2703 GOLGA2 Elena Savva gene: GOLGA2 was added
gene: GOLGA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GOLGA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GOLGA2 were set to PMID: 30237576; 26742501
Phenotypes for gene: GOLGA2 were set to Neuromuscular disorder
Review for gene: GOLGA2 was set to AMBER
Added comment: PMID: 30237576 - One 11 year old patient with a homozygous PTC.
Patient had global dev delay, microcephaly, distal muscle weakness with joint contractures and elevated CK levels. Muscle biopsy showed dystrophin changes. MRI at 2 years old showed brain atrophy with thin corpus callosum and hypomyelination. No seizures or regression.

PMID: 26742501 - One infant with a homozygous PTC.
Patient had dev delay, seizures, microcephaly and muscular dystrophy. Zebrafish null model recapitulates the human phenotype with microcephaly and skeletal muscle disorganization.

Summary: 2 patients
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2701 NEXMIF Zornitza Stark Publications for gene: NEXMIF were set to
Intellectual disability syndromic and non-syndromic v0.2700 NEXMIF Zornitza Stark Mode of inheritance for gene: NEXMIF was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.2699 NEXMIF Zornitza Stark reviewed gene: NEXMIF: Rating: GREEN; Mode of pathogenicity: None; Publications: 27358180; Phenotypes: Mental retardation, X-linked 98 300912; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.2697 SCN3A Zornitza Stark Publications for gene: SCN3A were set to
Intellectual disability syndromic and non-syndromic v0.2693 SLC6A1 Zornitza Stark Publications for gene: SLC6A1 were set to
Intellectual disability syndromic and non-syndromic v0.2690 GATM Zornitza Stark Publications for gene: GATM were set to
Intellectual disability syndromic and non-syndromic v0.2687 PSMB1 Zornitza Stark gene: PSMB1 was added
gene: PSMB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PSMB1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PSMB1 were set to 32129449
Phenotypes for gene: PSMB1 were set to Intellectual disability; microcephaly
Review for gene: PSMB1 was set to AMBER
Added comment: Two siblings reported with a homozygous missense variant in this gene; supportive experimental evidence including zebrafish model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2686 C16orf62 Zornitza Stark Publications for gene: C16orf62 were set to 25434475; 31712251
Intellectual disability syndromic and non-syndromic v0.2685 C16orf62 Zornitza Stark Publications for gene: C16orf62 were set to 25434475
Intellectual disability syndromic and non-syndromic v0.2683 C16orf62 Zornitza Stark gene: C16orf62 was added
gene: C16orf62 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: C16orf62 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C16orf62 were set to 25434475
Phenotypes for gene: C16orf62 were set to 3C/Ritscher-Schinzel-like syndrome
Review for gene: C16orf62 was set to AMBER
Added comment: HGNC approved name: VPS35L. Two variants have been reported as compound heterozygotes in two sibs with features of 3C/Ritscher-Schinzel syndrome. Functional studies show that loss of VPS35L function results in impared autophagy and VPS35L knockout mouse resulted in early embrionic lethality (PMID 25434475).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2681 PPP1CB Zornitza Stark Publications for gene: PPP1CB were set to
Intellectual disability syndromic and non-syndromic v0.2679 RBL2 Zornitza Stark gene: RBL2 was added
gene: RBL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RBL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RBL2 were set to 32105419; 9806916
Phenotypes for gene: RBL2 were set to Intellectual disability
Review for gene: RBL2 was set to RED
Added comment: Single family reported with pair of affected siblings. Supportive mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2677 GRM7 Zornitza Stark gene: GRM7 was added
gene: GRM7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GRM7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GRM7 were set to 32286009; 32248644
Phenotypes for gene: GRM7 were set to Epilepsy, microcephaly, developmental delay
Review for gene: GRM7 was set to GREEN
Added comment: Eleven individuals from six families reported, three different homozygous variants (two missense, one LoF). Developmental delay, neonatal‐ or infantile‐onset epilepsy, and microcephaly were universal. Supportive mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2675 OTUD7A Zornitza Stark Publications for gene: OTUD7A were set to PMID: 31997314
Intellectual disability syndromic and non-syndromic v0.2673 GATAD2B Zornitza Stark Publications for gene: GATAD2B were set to
Intellectual disability syndromic and non-syndromic v0.2669 KMT2D Zornitza Stark Publications for gene: KMT2D were set to
Intellectual disability syndromic and non-syndromic v0.2667 COG4 Zornitza Stark Publications for gene: COG4 were set to
Intellectual disability syndromic and non-syndromic v0.2665 DSCR3 Chirag Patel gene: DSCR3 was added
gene: DSCR3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DSCR3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DSCR3 were set to PMID: 31845315
Phenotypes for gene: DSCR3 were set to Intellectual disability, no OMIM # yet
Review for gene: DSCR3 was set to RED
Added comment: 1 family/2 cousins with cognitive impairment, growth failure, skeletal abnormalities, and distinctive facial features. Both shared the homozygous nonsense variant c.178G>T (p.Glu60*) in the VPS26C gene. This gene encodes VPS26C, a member of the retriever integral membrane protein recycling pathway. The nature of the variant which is predicted to result in loss‐of‐function, expression studies revealing significant reduction in the mutant transcript, and the co‐segregation of the homozygous variant with the phenotype in two affected individuals.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2664 OTUD7A Chirag Patel gene: OTUD7A was added
gene: OTUD7A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: OTUD7A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OTUD7A were set to PMID: 31997314
Phenotypes for gene: OTUD7A were set to Epileptic encephalopathy, no OMIM# yet
Review for gene: OTUD7A was set to RED
Added comment: One patient with severe global developmental delay, language impairment and epileptic encephalopathy. Homozygous OTUD7A missense variant (c.697C>T, p.Leu233Phe), predicted to alter an ultraconserved amino acid, lying within the OTU catalytic domain. Its subsequent segregation analysis revealed that the parents, presenting with learning disability, and brother were heterozygous carriers. Biochemical assays demonstrated that proteasome complex formation and function were significantly reduced in patient‐derived fibroblasts and in OTUD7A knockout HAP1 cell line. We provide evidence that biallelic pathogenic OTUD7A variation is linked to early‐onset epileptic encephalopathy and proteasome dysfunction. Gene lies in the chromosome 15q13.3 region. Heterozygous microdeletions of chromosome 15q13.3 show incomplete penetrance and are associated with a highly variable phenotype that may include intellectual disability, epilepsy, facial dysmorphism and digit anomalies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2662 ARL13B Zornitza Stark Publications for gene: ARL13B were set to
Intellectual disability syndromic and non-syndromic v0.2659 TTC5 Konstantinos Varvagiannis gene: TTC5 was added
gene: TTC5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TTC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTC5 were set to 29302074; 32439809
Phenotypes for gene: TTC5 were set to Central hypotonia; Global developmental delay; Intellectual disability; Abnormality of nervous system morphology; Microcephaly; Abnormality of the face; Behavioral abnormality; Abnormality of the genitourinary system
Penetrance for gene: TTC5 were set to Complete
Review for gene: TTC5 was set to GREEN
Added comment: Hu et al (2019 - PMID: 29302074) reported briefly on 3 individuals from 2 consanguineous families (from Turkey and Iran) with biallelic TTC5 variants. Features included DD (3/3), ID (severe in 2/2 with relevant age), microcephaly (3/3), brain abnormalities, etc. A nonsense and a variant affecting splice site were identified by WES/WGS.

---

In a recent report, Rasheed et al (2020 - PMID: 32439809) report on the phenotype of 8 individuals - belonging to 5 consanguineous families - all 8 harboring homozygous TTC5 mutations.

Frequent features included hypotonia (6/8), motor and speech delay, moderate to severe ID (10/10 of relevant age - inclusion of less severely affected subjects was not considered by study design), brain MRI abnormalities (8/8). Other findings included microcephaly in some (6/11), behavioral abnormalities in few (autistic behavior in 2/8, aggression in 2/8), genitourinary anomalies (2/8), seizures (1/11). Facial phenotype incl. thin V-shaped upper lip, low-set ears (in most) and/or additional features.

TTC5 encodes a 440 aa protein, functioning as a scaffold to stabilise p300-JMY interactions. Apart from this role in nucleus, it has functions in the cytoplasm (inhibiting actin nucleataion, autophagosome formation, etc).

The gene has ubiquitous expression, highest in brain.

All variants were identified following WES - as the best candidates - in affected individuals with compatible Sanger studies in all affected family members and carrier parents.

2 missense and 2 nonsense variants were identified with the 2 missense SNVs localizing within TPR domains. qRT-PCR studies for a nonsense variant localizing 19 nt before the last exon, revealed fourfold decreased expression in affected individuals compared to carriers.

Families from Egypt shared a homozygous ~6.3 Mb haplotype block spanning TTC5, suggesting that p.(Arg263Ter) is likely a founder mutation.

The authors underscore some phenotypic (though not facial) similarities with Rubinstein-Taybi syndrome 2 due to EP300 mutations (in line with the role of TTC5).

Biallelic variants in genes encoding other members of the TTC family (containing a TPR motif), e.g. TTC8 or TTC15 cause disorders with neurologic manifestations (and DD/ID).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2658 SOX6 Paul De Fazio gene: SOX6 was added
gene: SOX6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SOX6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SOX6 were set to 32442410
Phenotypes for gene: SOX6 were set to ADHD; Craniosynostosis; Osteochondromas
Review for gene: SOX6 was set to GREEN
Added comment: 6 LoF, 4 missense, and 6 intragenic deletion variants identified in individuals with a neurodevelopmental syndrome, however the number of families is unclear to me.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2657 HIST1H4J Sue White gene: HIST1H4J was added
gene: HIST1H4J was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HIST1H4J was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HIST1H4J were set to 31804630
Phenotypes for gene: HIST1H4J were set to microcephaly; intellectual disability; dysmorphic features
Penetrance for gene: HIST1H4J were set to Complete
Review for gene: HIST1H4J was set to AMBER
Added comment: single case report but with functional evidence in zebrafish and phenotypic similarity to other HIST1H4C phenotype
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2654 RBM10 Zornitza Stark Publications for gene: RBM10 were set to
Intellectual disability syndromic and non-syndromic v0.2651 MADD Zornitza Stark Publications for gene: MADD were set to
Intellectual disability syndromic and non-syndromic v0.2648 DHX30 Zornitza Stark Publications for gene: DHX30 were set to
Intellectual disability syndromic and non-syndromic v0.2645 JARID2 Zornitza Stark gene: JARID2 was added
gene: JARID2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: JARID2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: JARID2 were set to 23294540
Phenotypes for gene: JARID2 were set to Intellectual disability
Review for gene: JARID2 was set to AMBER
Added comment: Emerging evidence, mostly based on CNV data to date.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2643 TRIP12 Zornitza Stark Publications for gene: TRIP12 were set to 27848077; 28251352
Intellectual disability syndromic and non-syndromic v0.2643 TRIP12 Zornitza Stark Publications for gene: TRIP12 were set to
Intellectual disability syndromic and non-syndromic v0.2639 PACS1 Zornitza Stark Publications for gene: PACS1 were set to
Intellectual disability syndromic and non-syndromic v0.2636 IQSEC3 Zornitza Stark Publications for gene: IQSEC3 were set to 31130284
Intellectual disability syndromic and non-syndromic v0.2634 PRKD1 Zornitza Stark Publications for gene: PRKD1 were set to
Intellectual disability syndromic and non-syndromic v0.2629 CUL3 Konstantinos Varvagiannis gene: CUL3 was added
gene: CUL3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CUL3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CUL3 were set to 32341456
Phenotypes for gene: CUL3 were set to Global developmental delay; Intellectual disability; Seizures; Abnormality of cardiovascular system morphology; Abnormality of the palate; Pseudohypoaldosteronism, type IIE - MIM #614496
Penetrance for gene: CUL3 were set to unknown
Review for gene: CUL3 was set to GREEN
Added comment: Please consider inclusion with amber / green rating.
--
Nakashima et al (2020 - PMID:32341456) provide clinical details on 3 unrelated individuals with de novo CUL3 variants.

Features included DD, variable degrees of ID (P1: severe, P3: mild, P2: NA although he displayed motor and severe speech and language delay and had severe learning difficulties). Two out of three had intractable seizures (onset 2 - 6 months). One presented with congenital heart defects (ASD, PV stenosis) and another submucosal palatoschisis/bifid uvula. There were no facial dysmorphisms reported.

CUL3 encodes Cullin-3, a core piece of the E3 ubiquitin ligase complex, thus playing a role in the ubiquitin-proteasome system. [ https://ghr.nlm.nih.gov/gene/CUL3 ]. Germline variants in some other Cullin family genes (eg. CUL4B, CUL7) cause disorders with ID as a feature.

The 3 individuals reported by Nakashima had variable previous investigations (karyotype, CMA, metabolic testing) which were non-diagnostic. Singleton or trio exome sequencing identified 2 frameshift and 1 missense variant (NM_003590.4:c.854T>C / p.Val285Ala), further confirmed with Sanger sequencing. De novo occurrence was confirmed by analysis of microsatellite markers in an individual with singleton ES.

While the frameshift variants were presumed to lead to NMD (not studied), studies in HEK293T cells suggested that the Val285Ala reduced binding ability with KEAP1, possibly leading to instability of the Cullin-RING ligase (CRL) complex and impairment of the ubiquitin-proteasome system.

In OMIM, the phenotype associated with heterozygous CUL3 mutations is Pseudohypoaldosteronism type IIE (PHA2E - # 614496). As OMIM and Nakashima et al comment, PHA2E-associated variants are clustered around exon 9, most lead to skipping of exon 9 and produce an in-frame deletion of 57 aa in the cullin homology domain. Few (probably 3) missense variants in exon 9 have also been reported. Individuals with PHA2E do not display DD/ID and conversely individuals with NDD did not display features of PHA2E.

Nakashima et al summarize the phenotypes associated with 12 further de novo CUL3 variants in the literature with most pLOF ones detected in individuals with autism and/or developmental disorders and in few cases with congenital heart disease. Few additional missense variants and a stoploss one have been reported in individuals with NDD and one in SCZ.

Heterozygous Cul3 (/tissue-specific) deletion in mice resulted in autism-like behavior. Cul3 deficient mice also demonstrated NMDAR hypofunction and decreased spine density. [PMIDs cited : 31455858, 31780330]

Overall haploinsufficiency is favored as the underlying mechanism of variants associated with NDD. Nakashima et al comment that the pathogenesis of missense variants remains unknown and/or that a dominant-negative effect on CRL may be possible.

Studies on larger cohorts reporting on individuals with relevant phenotypes due to de novo CUL3 variants (eg. DDD study - PMID: 28135719, Lelieveld et al - PMID: 27479843), are summarized in denovo-db (after filtering for coding variants):

http://denovo-db.gs.washington.edu/denovo-db/QueryVariantServlet?searchBy=Gene&target=cul3

Overall, this gene can be considered for inclusion in the ID (amber/green), epilepsy (amber) and/or ASD panels.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2629 ADAM22 Zornitza Stark gene: ADAM22 was added
gene: ADAM22 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: ADAM22 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAM22 were set to 27066583; 30237576
Phenotypes for gene: ADAM22 were set to Epileptic encephalopathy, early infantile, 61, MIM# 617933
Review for gene: ADAM22 was set to AMBER
Added comment: Two families reported; the second one as part of a large consanguineous cohort.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2627 UGDH Konstantinos Varvagiannis gene: UGDH was added
gene: UGDH was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UGDH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGDH were set to 32001716
Phenotypes for gene: UGDH were set to Epileptic encephalopathy, early infantile, 84 - MIM #618792
Penetrance for gene: UGDH were set to Complete
Review for gene: UGDH was set to GREEN
Added comment: Hengel et al (2020 - PMID: 32001716) report on 36 individuals with biallelic UGDH pathogenic variants.

The phenotype corresponded overall to a developmental epileptic encephalopathy with hypotonia, feeding difficulties, severe global DD, moderate or commonly severe ID in all. Hypotonia and motor disorder (incl. spasticity, dystonia, ataxia, chorea, etc) often occurred prior to the onset of seizures. A single individual did not present seizures and 2 sibs had only seizures in the setting of fever.

Affected subjects were tested by exome sequencing and UGDH variants were the only/best candidates for the phenotype following also segregation studies. Many were compound heterozygous or homozygous (~6 families were consanguineous) for missense variants and few were compound heterozygous for missense and pLoF variants. There were no individuals with biallelic pLoF variants identified. Parental/sib studies were all compatible with AR inheritance mode.

UGDH encodes the enzyme UDP-glucose dehydrogenase which converts UDP-glucose to UDP-glucuronate, the latter being a critical component of the glycosaminoglycans, hyaluronan, chondroitin sulfate, and heparan sulfate [OMIM].

Patient fibroblast and biochemical assays suggested a LoF effect of variants leading to impairment of UGDH stability, oligomerization or enzymatic activity (decreased UGDH-catalyzed reduction of NAD+ to NADH / hyaluronic acid production which requires UDP-glucuronate).

Attempts to model the disorder using an already developped zebrafish model (for a hypomorphic LoF allele) were unsuccessful as fish did not exhibit seizures spontaneously or upon induction with PTZ.

Modelling of the disorder in vitro using patient-derived cerebral organoids demonstrated smaller organoids due to reduced number of proliferating neural progenitors.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2625 YIF1B Konstantinos Varvagiannis gene: YIF1B was added
gene: YIF1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: YIF1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YIF1B were set to 32006098
Phenotypes for gene: YIF1B were set to Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement
Penetrance for gene: YIF1B were set to Complete
Review for gene: YIF1B was set to GREEN
Added comment: AlMuhaizea et al (2020 - PMID: 32006098) report on the phenotype of 6 individuals (from 5 families) with biallelic YIF1B truncating variants.

Affected subjects presented hypotonia, failure to thrive, microcephaly (5/6), severe global DD and ID (as evident from best motor/language milestones achieved - Table S1) as well as features suggestive of a motor disorder (dystonia/spasticity/dyskinesia). Seizures were reported in 2 unrelated individuals (2/6). MRI abnormalities were observed in some with thin CC being a feature in 3.

Variable initial investigations were performed including SNP CMA, MECP2, microcephaly / neurotransmitter disorders gene panel testing did not reveal P/LP variants.

YIF1B variants were identified in 3 families within ROH. Following exome sequencing, affected individuals were found to be homozygous for truncating variants (4/5 families being consanguineous). The following 3 variants were identified (NM_001039672.2) : c.186dupT or p.Ala64fs / c.360_361insACAT or p.Gly121fs / c.598G>T or p.Glu200*.

YIF1B encodes an intracellular transmembrane protein.

It has been previously demonstrated that - similarly to other proteins of the Yip family being implicated in intracellular traffic between the Golgi - Yif1B is involved in the anterograde traffic pathway. Yif1B KO mice demonstrate a disorganized Golgi architecture in pyramidal hippocampal neurons (Alterio et al 2015 - PMID: 26077767). The rat ortholog interacts with serotonin receptor 1 (5-HT1AR) with colocalization of Yif1BB and 5-HT1AR in intermediate compartment vesicles and involvement of the former in intracellular trafficing/modulation of 5-HT1AR transport to dendrites (PMID cited: 18685031).

Available mRNA and protein expression data (Protein Atlas) suggest that the gene is widely expressed in all tissues incl. neuronal cells. Immunochemistry data from the Human Brain Atlas also suggest that YIF1B is found in vesicles and localized to the Golgi apparatus. Immunohistochemistry in normal human brain tissue (cerebral cortex) demonstrated labeling of neuronal cells (Human Protein Atlas).

Functional/network analysis of genes co-regulated with YIF1B based on available RNAseq data, suggest enrichement in in genes important for nervous system development and function.

Please consider inclusion in other panels that may be relevant (e.g. microcephaly, etc).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2624 TNRC6B Zornitza Stark Publications for gene: TNRC6B were set to
Intellectual disability syndromic and non-syndromic v0.2619 CDC42BPB Konstantinos Varvagiannis gene: CDC42BPB was added
gene: CDC42BPB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDC42BPB was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CDC42BPB were set to 32031333
Phenotypes for gene: CDC42BPB were set to Central hypotonia; Global developmental delay; Intellectual disability; Seizures; Autistic behavior; Behavioral abnormality
Penetrance for gene: CDC42BPB were set to unknown
Review for gene: CDC42BPB was set to GREEN
Added comment: Chilton et al (2020 - PMID: 32031333) report on 14 individuals with missense and loss-of-function CDC42BPB variants.

Features included hypotonia (8/11), DD (12/13 - the 14th was a fetus), ID (7/13), ASD (8/12), clinical seizures (in 3 - a 4th had abnormal EEG without seizures), behavioral abnormalities. Variable non-specific dysmorphic features were reported in some (sparse hair being the most frequent - 4/8). Additional features were observed in few (=<4) incl. cryptorchidism, ophthalmological issues, constipation, kidney abnormalities, micropenis, etc.

All individuals had non-diagnostic prior genetic testing (incl. CMA, FMR1, MECP2, Angelman/Prader-Willi methylation studies, autism gene panel - suggesting relevance to the current panel) or metabolic testing.

Variants were identified following clinical exome sequencing with Sanger confirmation. Most occurred as de novo events (11/14) while inheritance was not available for few (3/14). Missense variants did not display (particular) clustering.

Almost all variants were absent from gnomAD and were predicted to be deleterious in silico (among others almost all had CADD scores >25).

As the authors comment, CDC42BPB encodes myotonic dystrophy-related Cdc42-binding kinase β (MRCKβ) a serine/threonine protein kinase playing a role in regulation of cytoskeletal reorganization and cell migration in nonmuscle cells (through phosporylation of MLC2).

Previous studies have demonstrated that it is ubiquitously expressed with prenatal brain expression.

The gene appears to be intolerant to pLoF (pLI of 1) as well as to missense variants (Z-score of 3.66).

CDC42BPB is a downstream effector of CDC42. Mutations of the latter cause Takenouchi-Kosaki syndrome with DD/ID and some further overlapping features (with CDC42BPB-associated phenotypes).

Homozygous Cdc42bpb KO in mouse appears to be nonviable (MGI:2136459). Loss of gek in the eyes of Drosophila results in disrupted growth cone targeting to the lamina (gek is the fly CDC42BPB ortholog).

Please consider inclusion with amber / green rating in the ID panel (>=4 relevant individuals / variants) and other panels (e.g. for epilepsy, ASD).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2617 ARMC9 Zornitza Stark Publications for gene: ARMC9 were set to
Intellectual disability syndromic and non-syndromic v0.2614 DARS Zornitza Stark Publications for gene: DARS were set to
Intellectual disability syndromic and non-syndromic v0.2611 ARID1B Zornitza Stark Publications for gene: ARID1B were set to
Intellectual disability syndromic and non-syndromic v0.2608 EMX2 Zornitza Stark Publications for gene: EMX2 were set to
Intellectual disability syndromic and non-syndromic v0.2604 ATAD3A Zornitza Stark Publications for gene: ATAD3A were set to 27640307; 32004445
Intellectual disability syndromic and non-syndromic v0.2599 VPS51 Zornitza Stark gene: VPS51 was added
gene: VPS51 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: VPS51 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS51 were set to 30624672; 31207318
Phenotypes for gene: VPS51 were set to Pontocerebellar hypoplasia, type 13, MIM# 618606
Review for gene: VPS51 was set to AMBER
Added comment: Two families reported with bi-allelic variants in this gene and global developmental delay, impaired intellectual development with absent speech, microcephaly, and progressive atrophy of the cerebellar vermis and brainstem. Additional features, including seizures and visual impairment, are variable.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2597 CDK19 Zornitza Stark gene: CDK19 was added
gene: CDK19 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDK19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDK19 were set to 32330417
Phenotypes for gene: CDK19 were set to Intellectual disability; epileptic encephalopathy
Review for gene: CDK19 was set to GREEN
Added comment: Three unrelated individuals with de novo missense variants reported, and intellectual disability/epileptic encephalopathy. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2595 PTPN23 Zornitza Stark Publications for gene: PTPN23 were set to
Intellectual disability syndromic and non-syndromic v0.2591 CYFIP2 Zornitza Stark Publications for gene: CYFIP2 were set to 29534297
Intellectual disability syndromic and non-syndromic v0.2589 CEP55 Zornitza Stark gene: CEP55 was added
gene: CEP55 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CEP55 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP55 were set to 32100459
Phenotypes for gene: CEP55 were set to Multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly, MIM# 236500; Microcephaly; Intellectual disability
Review for gene: CEP55 was set to GREEN
Added comment: Homozygous nonsense variants in CEP55 are associated with a lethal condition characterized by multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly (MARCH syndrome) also known as Meckel-like syndrome. New report of seven living individuals from five families with biallelic CEP55 variants. Four unrelated individuals with microcephaly, speech delays, and bilateral toe syndactyly all had a common CEP55 variant c.70G>A p.(Glu24Lys) in trans with nonsense variants. Three siblings were homozygous for a consensus splice site variant near the end of the gene. These affected girls all had severely delayed development, microcephaly, and varying degrees of lissencephaly/pachygyria. This series suggests that individuals with compound heterozygosity for nonsense and missense variants in CEP55 have a different viable phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2587 LRRC32 Zornitza Stark gene: LRRC32 was added
gene: LRRC32 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LRRC32 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LRRC32 were set to 30976112
Phenotypes for gene: LRRC32 were set to Intellectual disability; cleft palate; proliferative retinopathy
Review for gene: LRRC32 was set to AMBER
Added comment: Three individuals from two consanguineous families segregated the same homozygous bi-allelic variant, c.1630C>T; p.(Arg544Ter), shared haplotype indicative of founder effect. Mouse model has cleft palate and neonatal death.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2586 NTNG2 Zornitza Stark Publications for gene: NTNG2 were set to 31668703
Intellectual disability syndromic and non-syndromic v0.2584 TAF1 Zornitza Stark Publications for gene: TAF1 were set to
Intellectual disability syndromic and non-syndromic v0.2581 KCNB1 Zornitza Stark Publications for gene: KCNB1 were set to
Intellectual disability syndromic and non-syndromic v0.2578 GAD1 Zornitza Stark Publications for gene: GAD1 were set to 15571623
Intellectual disability syndromic and non-syndromic v0.2575 GAD1 Zornitza Stark edited their review of gene: GAD1: Added comment: 2020: 11 individuals from 6 consanguineous families reported with bi-allelic LOF variant and a developmental/epileptic encephalopathy. Seizure onset occurred in the first 2 months of life in all. All 10 individuals, from whom early disease history was available, presented with seizure onset in the first month of life, mainly consisting of epileptic spasms or myoclonic seizures. Early EEG showed suppression-burst or pattern of burst attenuation or hypsarrhythmia if only recorded in the post-neonatal period. Eight individuals had joint contractures and/or pes equinovarus. Seven presented a cleft palate and two also had an omphalocele, reproducing the phenotype of the knockout Gad1−/− mouse model. Four individuals died before 4 years of age.; Changed publications: 15571623, 32282878; Changed phenotypes: Cerebral palsy, spastic quadriplegic, 1, MIM#603513, Developmental and epileptic encephalopathy
Intellectual disability syndromic and non-syndromic v0.2574 GALNT2 Zornitza Stark gene: GALNT2 was added
gene: GALNT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GALNT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GALNT2 were set to 32293671
Phenotypes for gene: GALNT2 were set to Congenital disorder of glycosylation
Review for gene: GALNT2 was set to GREEN
Added comment: Seven individuals from four families reported with bi-allelic LOF variants and global developmental delay, intellectual disability with language deficit, autistic features, behavioural abnormalities, epilepsy, chronic insomnia, white matter changes on brain MRI, dysmorphic features, decreased stature, and decreased high density lipoprotein cholesterol levels. Rodent (mouse and rat) models of GALNT2-CDG recapitulated much of the human phenotype, including poor growth and neurodevelopmental abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2573 PLPBP Zornitza Stark Phenotypes for gene: PLPBP were changed from to Epilepsy, early-onset, vitamin B6-dependent, MIM# 617290
Intellectual disability syndromic and non-syndromic v0.2572 PLPBP Zornitza Stark Publications for gene: PLPBP were set to
Intellectual disability syndromic and non-syndromic v0.2570 PLPBP Zornitza Stark reviewed gene: PLPBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 27912044, 31741821, 30668673; Phenotypes: Epilepsy, early-onset, vitamin B6-dependent, MIM# 617290; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2569 GRIN2A Zornitza Stark Publications for gene: GRIN2A were set to
Intellectual disability syndromic and non-syndromic v0.2565 TSEN34 Zornitza Stark Publications for gene: TSEN34 were set to
Intellectual disability syndromic and non-syndromic v0.2561 CHD4 Zornitza Stark Publications for gene: CHD4 were set to 31388190
Intellectual disability syndromic and non-syndromic v0.2560 CHD4 Zornitza Stark Publications for gene: CHD4 were set to
Intellectual disability syndromic and non-syndromic v0.2557 TLK2 Zornitza Stark Publications for gene: TLK2 were set to
Intellectual disability syndromic and non-syndromic v0.2554 DYRK1A Zornitza Stark Publications for gene: DYRK1A were set to
Intellectual disability syndromic and non-syndromic v0.2551 GABRA1 Zornitza Stark Publications for gene: GABRA1 were set to
Intellectual disability syndromic and non-syndromic v0.2548 GNAI2 Zornitza Stark gene: GNAI2 was added
gene: GNAI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GNAI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GNAI2 were set to 31036916
Phenotypes for gene: GNAI2 were set to Syndromic intellectual disability
Review for gene: GNAI2 was set to RED
Added comment: Single individual with de novo variant reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2546 FEM1B Zornitza Stark gene: FEM1B was added
gene: FEM1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FEM1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FEM1B were set to 31036916
Phenotypes for gene: FEM1B were set to Syndromic intellectual disability
Review for gene: FEM1B was set to AMBER
Added comment: No OMIM phenotype PMID: 31036916 - a single de novo patient reported in a neurodevelopmental disorder cohort. Authors note another de novo case with the exact same variant (p.Arg126Gln) from the DDD study, and a 3rd patient from GeneMatcher with the same de novo missense again. Decipher shows this variant to be in a highly constrained region of the protein. Cannot be certain the DDD and GeneMatcher individuals are unrelated, therefore treat as two reports for now.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2545 WIPI2 Zornitza Stark gene: WIPI2 was added
gene: WIPI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WIPI2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WIPI2 were set to 30968111
Phenotypes for gene: WIPI2 were set to Intellectual developmental disorder with short stature and variable skeletal anomalies 618453
Review for gene: WIPI2 was set to RED
Added comment: Four homozygous individuals from one consanguineous family with intellectual disability, short stature and variable skeletal anomalies. Functional studies in patient cells showed impaired protein function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2543 GSX2 Zornitza Stark gene: GSX2 was added
gene: GSX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GSX2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GSX2 were set to 31412107
Phenotypes for gene: GSX2 were set to Diencephalic-mesencephalic junction dysplasia syndrome 2 618646; Intellectual disability; Dystonia; Spastic tetra paresis
Review for gene: GSX2 was set to AMBER
Added comment: Two unrelated families, some functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2541 IGF1R Zornitza Stark Publications for gene: IGF1R were set to 31586944
Intellectual disability syndromic and non-syndromic v0.2541 IGF1R Zornitza Stark Publications for gene: IGF1R were set to
Intellectual disability syndromic and non-syndromic v0.2539 YARS Zornitza Stark gene: YARS was added
gene: YARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: YARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YARS were set to 30304524; 29232904; 27633801
Phenotypes for gene: YARS were set to Intellectual disability; deafness; nystagmus; liver dysfunction
Review for gene: YARS was set to GREEN
Added comment: Mono-allelic variants are associated with CMT. However, 10 individuals from three unrelated families reported with bi-allelic variants and a severe phenotype, comprising ID, nystagmus, deafness, liver dysfunction and a range of other features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2536 SLC44A1 Sebastian Lunke gene: SLC44A1 was added
gene: SLC44A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC44A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC44A1 were set to 31855247
Phenotypes for gene: SLC44A1 were set to progressive ataxia; tremor; cognitive decline; dysphagia; optic atrophy; dysarthria
Review for gene: SLC44A1 was set to GREEN
gene: SLC44A1 was marked as current diagnostic
Added comment: Four affected individuals from three families with homozygous frameshift variants. Functional evidence points to impaired choline transporter function yet unchanged membrane phosphatidylcholine content. Choline treatments may be beneficial.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2534 CTCF Zornitza Stark Publications for gene: CTCF were set to
Intellectual disability syndromic and non-syndromic v0.2532 MAB21L1 Zornitza Stark Publications for gene: MAB21L1 were set to 30487245
Intellectual disability syndromic and non-syndromic v0.2530 ZMYND11 Zornitza Stark Publications for gene: ZMYND11 were set to
Intellectual disability syndromic and non-syndromic v0.2527 BAZ2B Zornitza Stark gene: BAZ2B was added
gene: BAZ2B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BAZ2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BAZ2B were set to 31999386
Phenotypes for gene: BAZ2B were set to Intellectual disability; autism
Review for gene: BAZ2B was set to GREEN
Added comment: Postulated as a candidate gene for ID/ASD by large-scale studies. Case series reports two individuals with small CNVs and and six with SNVs, mostly LoF type variants. Although the gene is generally intolerant of LoF, some LoF variants present in gnomad ?incomplete penetrance. Additional reported features were inconsistent
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2525 CACNB4 Bryony Thompson gene: CACNB4 was added
gene: CACNB4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACNB4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CACNB4 were set to 32176688
Phenotypes for gene: CACNB4 were set to intellectual disability; psychomotor retardation; blindness; epilepsy; movement disorder; cerebellar atrophy
Review for gene: CACNB4 was set to AMBER
Added comment: A homozygous missense variant (Leu126Pro) was identified in two siblings with intellectual disability, psychomotor retardation, blindness, epilepsy, movement disorder and cerebellar atrophy. In vitro functional assays of the variant identify three potential pathomechanisms: impairs the formation of synaptic P/Q-type calcium channel complexes; prevents activity-dependent nuclear targeting and thus β4-dependent nuclear functions; disturbs complex formation between β4b and the TRAF2 and NCK interacting kinase TNIK.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2523 SLC18A2 Zornitza Stark gene: SLC18A2 was added
gene: SLC18A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: SLC18A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC18A2 were set to 23363473; 31240161; 26497564
Phenotypes for gene: SLC18A2 were set to Parkinsonism-dystonia, infantile, 2, MIM# 618049
Review for gene: SLC18A2 was set to GREEN
Added comment: At least three unrelated families reported, potential treatment implications.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2520 NUP188 Zornitza Stark Publications for gene: NUP188 were set to https://doi.org/10.1159/000504818; 28726809
Intellectual disability syndromic and non-syndromic v0.2518 AP3B2 Zornitza Stark Phenotypes for gene: AP3B2 were changed from to Early-onset epileptic encephalopathy with optic atrophy, MIM#617276
Intellectual disability syndromic and non-syndromic v0.2517 AP3B2 Zornitza Stark Publications for gene: AP3B2 were set to
Intellectual disability syndromic and non-syndromic v0.2515 AP3B2 Zornitza Stark reviewed gene: AP3B2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27889060; Phenotypes: Early-onset epileptic encephalopathy with optic atrophy, MIM#617276; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2514 TCF20 Zornitza Stark Publications for gene: TCF20 were set to
Intellectual disability syndromic and non-syndromic v0.2511 TFE3 Zornitza Stark gene: TFE3 was added
gene: TFE3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TFE3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TFE3 were set to 30595499; 31833172
Phenotypes for gene: TFE3 were set to TFE3-associated neurodevelopmental disorder; Intellectual disability; Epilepsy; Coarse facial features
Review for gene: TFE3 was set to GREEN
Added comment: Seven individuals reported; so far, all have been found to harbour de novo variants affecting exons 3 or 4.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2509 TOP2B Zornitza Stark gene: TOP2B was added
gene: TOP2B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TOP2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TOP2B were set to 31953910; 28343847; 12773624
Phenotypes for gene: TOP2B were set to Intellectual disability
Review for gene: TOP2B was set to AMBER
Added comment: Two unrelated individuals reported with the same de novo variant, c.187C > T, p.(His63Tyr) and also mouse model data supports role in brain development. Gene has also been associated independently with deafness and with immunodeficiency and the variant-disease relationship remains to be fully elucidated.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2507 CNKSR1 Zornitza Stark gene: CNKSR1 was added
gene: CNKSR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: CNKSR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CNKSR1 were set to 30450701; 30237576; 21937992
Phenotypes for gene: CNKSR1 were set to Intellectual disability
Review for gene: CNKSR1 was set to AMBER
Added comment: Three families reported, two as part of large cohorts reporting multiple novel genes. Note the family reported in PMID 30450701 appears to be the same family as reported in PMID 21937992. Some functional data in PMID 30450701, including Drosophila model.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2504 FRMD4A Zornitza Stark gene: FRMD4A was added
gene: FRMD4A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: FRMD4A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FRMD4A were set to 25388005; 30214071
Phenotypes for gene: FRMD4A were set to Intellectual disability; microcephaly
Review for gene: FRMD4A was set to AMBER
Added comment: Single Bedouin Israeli family reported with homozygous variant initially. Good segregation data. No functional data. Another family reported as part of a large consanguineous microcephaly cohort, different variant.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2502 PIGK Zornitza Stark gene: PIGK was added
gene: PIGK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIGK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGK were set to 32220290
Phenotypes for gene: PIGK were set to Intellectual disability; seizures; cerebellar atrophy
Review for gene: PIGK was set to GREEN
Added comment: 12 individuals from 9 unrelated families reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2499 ADARB1 Zornitza Stark gene: ADARB1 was added
gene: ADARB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADARB1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADARB1 were set to 32220291
Phenotypes for gene: ADARB1 were set to Intellectual disability; microcephaly; seizures
Review for gene: ADARB1 was set to GREEN
Added comment: Four unrelated individuals with bi-allelic variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2497 PQBP1 Zornitza Stark Publications for gene: PQBP1 were set to
Intellectual disability syndromic and non-syndromic v0.2494 DLG3 Zornitza Stark Publications for gene: DLG3 were set to
Intellectual disability syndromic and non-syndromic v0.2491 AGTPBP1 Zornitza Stark gene: AGTPBP1 was added
gene: AGTPBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: NHS GMS
Mode of inheritance for gene: AGTPBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AGTPBP1 were set to 30420557
Phenotypes for gene: AGTPBP1 were set to Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy; Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276
Review for gene: AGTPBP1 was set to GREEN
Added comment: Thirteen individuals reported, clinical presentation was with developmental delay, though six went on to have a progressive neurological course. Other features include cerebellar atrophy and neuropathy.
Sources: NHS GMS
Intellectual disability syndromic and non-syndromic v0.2489 NR2F2 Sue White gene: NR2F2 was added
gene: NR2F2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NR2F2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NR2F2 were set to 29478779; 29663647
Phenotypes for gene: NR2F2 were set to mild intellectual disability; congenital heart disease; disorder of sexual differentiation; dysmorphic features
Penetrance for gene: NR2F2 were set to Complete
Review for gene: NR2F2 was set to AMBER
Added comment: Established gene for congenital heart disease and DSD and emerging gene for ID. 2 unrelated individuals published with mild or borderline ID, dysmorphism and de novo truncating/missense variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2487 EIF2AK2 Zornitza Stark gene: EIF2AK2 was added
gene: EIF2AK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF2AK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF2AK2 were set to 32197074
Phenotypes for gene: EIF2AK2 were set to Intellectual disability; white matter abnormalities; ataxia; regression with febrile illness
Review for gene: EIF2AK2 was set to GREEN
Added comment: Eight individuals with de novo variants and complex neurodevelopmental phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2486 EIF2AK1 Zornitza Stark gene: EIF2AK1 was added
gene: EIF2AK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF2AK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF2AK1 were set to 32197074
Phenotypes for gene: EIF2AK1 were set to Intellectual disability; white matter abnormalities
Review for gene: EIF2AK1 was set to RED
Added comment: Single individual reported with de novo variant in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2484 NOVA2 Zornitza Stark gene: NOVA2 was added
gene: NOVA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NOVA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NOVA2 were set to 32197073
Phenotypes for gene: NOVA2 were set to Intellectual disability; autism; hypotonia; spasticity; ataxia
Mode of pathogenicity for gene: NOVA2 was set to Other
Review for gene: NOVA2 was set to GREEN
Added comment: Six individuals with de novo frameshift variants resulting in C-terminal extension suggesting partial LoF as mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2482 GNB2 Sue White gene: GNB2 was added
gene: GNB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GNB2 were set to 31698099
Phenotypes for gene: GNB2 were set to intellectual disability; dysmorphic features
Review for gene: GNB2 was set to AMBER
Added comment: emerging evidence of de novo missense variants in patients with intellectual disability
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2480 NRROS Sue White gene: NRROS was added
gene: NRROS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NRROS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NRROS were set to 32197075; 32100099
Phenotypes for gene: NRROS were set to neurodegeneration; intracranial calcification; epilepsy
Penetrance for gene: NRROS were set to Complete
Review for gene: NRROS was set to GREEN
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2478 CNOT3 Zornitza Stark Publications for gene: CNOT3 were set to
Intellectual disability syndromic and non-syndromic v0.2475 QARS Zornitza Stark Publications for gene: QARS were set to
Intellectual disability syndromic and non-syndromic v0.2472 SPATA5 Zornitza Stark Publications for gene: SPATA5 were set to
Intellectual disability syndromic and non-syndromic v0.2469 ISCA1 Zornitza Stark gene: ISCA1 was added
gene: ISCA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ISCA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ISCA1 were set to 28356563; 32092383; 31016283; 30113620; 30105122
Phenotypes for gene: ISCA1 were set to Multiple mitochondrial dysfunctions syndrome 5, MIM# 617613
Review for gene: ISCA1 was set to GREEN
gene: ISCA1 was marked as current diagnostic
Added comment: Multiple unrelated families reported. Severe disorder characterised by progressive neurologic deterioration beginning in early infancy. Affected individuals have essentially no psychomotor development and have early-onset seizures with neurologic decline and spasticity. Brain imaging shows severe leukodystrophy with evidence of dys- or delayed myelination. Rat model results in early lethality. Founder variant c.259G > A, p.(Glu87Lys) reported in Indian families.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2468 CAMTA1 Zornitza Stark Publications for gene: CAMTA1 were set to
Intellectual disability syndromic and non-syndromic v0.2466 GPT2 Zornitza Stark Publications for gene: GPT2 were set to
Intellectual disability syndromic and non-syndromic v0.2462 SUPT16H Zornitza Stark gene: SUPT16H was added
gene: SUPT16H was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SUPT16H was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SUPT16H were set to 31924697
Phenotypes for gene: SUPT16H were set to Intellectual disability; Abnormality of the corpus callosum
Review for gene: SUPT16H was set to GREEN
Added comment: Four unrelated individuals with de novo missense variants in this gene. Publication also reports on a deletion, but note this includes other genes and the individual also had another CNV.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2461 SLC5A6 Zornitza Stark Publications for gene: SLC5A6 were set to 31754459; 27904971
Intellectual disability syndromic and non-syndromic v0.2459 RARS Zornitza Stark gene: RARS was added
gene: RARS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: RARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RARS were set to 31814314
Phenotypes for gene: RARS were set to Leukodystrophy, hypomyelinating, 9 MIM# 616140
Review for gene: RARS was set to GREEN
gene: RARS was marked as current diagnostic
Added comment: 15 families reported, DD/ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2456 TNR Zornitza Stark gene: TNR was added
gene: TNR was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TNR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TNR were set to 32099069
Phenotypes for gene: TNR were set to Spastic para- or tetraparesis; Axial muscular hypotonia; Intellectual disability; Transient opisthotonus
Review for gene: TNR was set to GREEN
Added comment: 13 individuals from 8 unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2454 RSPRY1 Zornitza Stark gene: RSPRY1 was added
gene: RSPRY1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: RSPRY1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RSPRY1 were set to 26365341
Phenotypes for gene: RSPRY1 were set to Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type, 616585
Review for gene: RSPRY1 was set to AMBER
Added comment: Two unrelated individuals reported, some functional evidence.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2452 RPS23 Zornitza Stark Publications for gene: RPS23 were set to 28257692
Intellectual disability syndromic and non-syndromic v0.2452 RPS23 Zornitza Stark Publications for gene: RPS23 were set to
Intellectual disability syndromic and non-syndromic v0.2448 RNF13 Zornitza Stark gene: RNF13 was added
gene: RNF13 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: RNF13 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNF13 were set to 30595371
Phenotypes for gene: RNF13 were set to Epileptic encephalopathy, early infantile, 73 618379
Mode of pathogenicity for gene: RNF13 was set to Other
Review for gene: RNF13 was set to GREEN
Added comment: Three unrelated individuals with de novo variants in this gene and severe neurological phenotype, including microcephaly, seizures, visual impairment, profound developmental delay.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2446 RIMS1 Zornitza Stark Publications for gene: RIMS1 were set to
Intellectual disability syndromic and non-syndromic v0.2442 RHEB Zornitza Stark Publications for gene: RHEB were set to
Intellectual disability syndromic and non-syndromic v0.2439 MRPS34 Zornitza Stark gene: MRPS34 was added
gene: MRPS34 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MRPS34 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MRPS34 were set to 28777931
Phenotypes for gene: MRPS34 were set to Combined oxidative phosphorylation deficiency 32, MIM# 617664
Review for gene: MRPS34 was set to GREEN
gene: MRPS34 was marked as current diagnostic
Added comment: Six individuals from 4 unrelated families; clinical presentation is with developmental delay/regression. More variable features include movement disorders, microcephaly, strabismus, nystagmus, optic atrophy.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2437 MFSD2A Zornitza Stark gene: MFSD2A was added
gene: MFSD2A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MFSD2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MFSD2A were set to 26005865; 26005868; 24828044
Phenotypes for gene: MFSD2A were set to Microcephaly 15, primary, autosomal recessive, MIM# 616486
Review for gene: MFSD2A was set to GREEN
Added comment: Three unrelated families and two animal models.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2435 MED13 Zornitza Stark Publications for gene: MED13 were set to
Intellectual disability syndromic and non-syndromic v0.2432 MED12L Zornitza Stark gene: MED12L was added
gene: MED12L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MED12L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MED12L were set to 31155615
Phenotypes for gene: MED12L were set to Intellectual disability; Seizures; Autism
Review for gene: MED12L was set to GREEN
Added comment: 7 individuals reported, 3 with CNVs (encompassing other genes) and 4 with SNVs (frameshift, nonsense and splice site).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2430 MCM3AP Zornitza Stark gene: MCM3AP was added
gene: MCM3AP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MCM3AP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MCM3AP were set to 24123876; 28633435; 28969388; 29982295
Phenotypes for gene: MCM3AP were set to Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, MIM#618124
Review for gene: MCM3AP was set to GREEN
gene: MCM3AP was marked as current diagnostic
Added comment: ID is a feature in many of the reported individuals.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2427 MAPRE2 Zornitza Stark gene: MAPRE2 was added
gene: MAPRE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MAPRE2 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: MAPRE2 were set to 26637975
Phenotypes for gene: MAPRE2 were set to Symmetric circumferential skin creases, congenital, 2, MIM# 616734
Review for gene: MAPRE2 was set to GREEN
Added comment: ID is part of the phenotype, more severe in those with bi-allelic variants.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2425 PURA Zornitza Stark Publications for gene: PURA were set to
Intellectual disability syndromic and non-syndromic v0.2422 BPTF Zornitza Stark Publications for gene: BPTF were set to
Intellectual disability syndromic and non-syndromic v0.2419 TRIO Zornitza Stark Publications for gene: TRIO were set to
Intellectual disability syndromic and non-syndromic v0.2412 NUDT2 Zornitza Stark gene: NUDT2 was added
gene: NUDT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: NUDT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NUDT2 were set to 27431290; 30059600
Phenotypes for gene: NUDT2 were set to Muscular hypotonia; Global developmental delay; Intellectual disability
Review for gene: NUDT2 was set to AMBER
Added comment: 7 affected individuals from 4 Saudi families, with same homozygous truncating variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2410 NKAP Zornitza Stark gene: NKAP was added
gene: NKAP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: NKAP was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: NKAP were set to 26358559; 26350204; 31587868
Phenotypes for gene: NKAP were set to Intellectual disability
Review for gene: NKAP was set to GREEN
gene: NKAP was marked as current diagnostic
Added comment: 10 males from 8 unrelated families with missense variants in NKAP. Main features: intellectual disability, hypotonia, tall stature with Marfanoid habitus. Recurrent variant (NM_024528:c.988G>A / p.Arg333Gln) seen in several families from different ethnic backgrounds.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2408 NHP2 Zornitza Stark Publications for gene: NHP2 were set to
Intellectual disability syndromic and non-syndromic v0.2404 NHEJ1 Zornitza Stark Publications for gene: NHEJ1 were set to
Intellectual disability syndromic and non-syndromic v0.2393 TBR1 Zornitza Stark Publications for gene: TBR1 were set to
Intellectual disability syndromic and non-syndromic v0.2390 NDUFS1 Zornitza Stark Publications for gene: NDUFS1 were set to 20382551
Intellectual disability syndromic and non-syndromic v0.2390 NDUFS1 Zornitza Stark Publications for gene: NDUFS1 were set to
Intellectual disability syndromic and non-syndromic v0.2385 NDUFAF5 Zornitza Stark Publications for gene: NDUFAF5 were set to
Intellectual disability syndromic and non-syndromic v0.2376 SYNGAP1 Zornitza Stark Publications for gene: SYNGAP1 were set to
Intellectual disability syndromic and non-syndromic v0.2370 ZBTB24 Zornitza Stark Publications for gene: ZBTB24 were set to
Intellectual disability syndromic and non-syndromic v0.2367 ZBTB16 Zornitza Stark Publications for gene: ZBTB16 were set to
Intellectual disability syndromic and non-syndromic v0.2364 ZBTB11 Zornitza Stark Publications for gene: ZBTB11 were set to
Intellectual disability syndromic and non-syndromic v0.2362 XPA Zornitza Stark Publications for gene: XPA were set to
Intellectual disability syndromic and non-syndromic v0.2357 WDR81 Zornitza Stark Publications for gene: WDR81 were set to
Intellectual disability syndromic and non-syndromic v0.2355 WDR4 Zornitza Stark Publications for gene: WDR4 were set to PubMed: 26416026, 30079490, 29597095, 28617965
Intellectual disability syndromic and non-syndromic v0.2354 VARS Zornitza Stark Publications for gene: VARS were set to PubMed: 30755616, 30755602, 26539891, 29691655, 30275004
Intellectual disability syndromic and non-syndromic v0.2349 TUBGCP4 Zornitza Stark gene: TUBGCP4 was added
gene: TUBGCP4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TUBGCP4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TUBGCP4 were set to 25817018
Phenotypes for gene: TUBGCP4 were set to Microcephaly and chorioretinopathy, autosomal recessive, 3, 616335
Review for gene: TUBGCP4 was set to AMBER
Added comment: Three unrelated families reported; ID described as mild.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2347 TUBA8 Zornitza Stark Publications for gene: TUBA8 were set to
Intellectual disability syndromic and non-syndromic v0.2339 TSEN15 Zornitza Stark gene: TSEN15 was added
gene: TSEN15 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TSEN15 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TSEN15 were set to 27392077; 30914295; 25558065
Phenotypes for gene: TSEN15 were set to Pontocerebellar hypoplasia, type 2F, 617026
Review for gene: TSEN15 was set to GREEN
Added comment: Three unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2337 TRIP13 Zornitza Stark Publications for gene: TRIP13 were set to
Intellectual disability syndromic and non-syndromic v0.2333 TRIM8 Zornitza Stark gene: TRIM8 was added
gene: TRIM8 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TRIM8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRIM8 were set to 30244534; 27346735; 23934111
Phenotypes for gene: TRIM8 were set to Intellectual disability; Seizures
Review for gene: TRIM8 was set to GREEN
gene: TRIM8 was marked as current diagnostic
Added comment: Six unrelated individuals reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2331 TRAK1 Zornitza Stark Publications for gene: TRAK1 were set to
Intellectual disability syndromic and non-syndromic v0.2328 TRAIP Zornitza Stark gene: TRAIP was added
gene: TRAIP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TRAIP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRAIP were set to Seckel syndrome 9, MIM#616777
Review for gene: TRAIP was set to GREEN
gene: TRAIP was marked as current diagnostic
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2323 TPH2 Zornitza Stark Publications for gene: TPH2 were set to
Intellectual disability syndromic and non-syndromic v0.2319 SPOP Zornitza Stark gene: SPOP was added
gene: SPOP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPOP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SPOP were set to 32109420
Phenotypes for gene: SPOP were set to Intellectual disability; dysmorphism; microcephaly; macrocephaly
Mode of pathogenicity for gene: SPOP was set to Other
Review for gene: SPOP was set to GREEN
Added comment: Seven individuals reported with de novo missense variants in this gene. Gain-of-function variants associated with microcephaly whereas dominant-negative variants associated with macrocephaly.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2317 TNIK Zornitza Stark Publications for gene: TNIK were set to
Intellectual disability syndromic and non-syndromic v0.2313 TMLHE Zornitza Stark Publications for gene: TMLHE were set to 21865298
Intellectual disability syndromic and non-syndromic v0.2313 TMLHE Zornitza Stark Publications for gene: TMLHE were set to
Intellectual disability syndromic and non-syndromic v0.2309 TMEM94 Zornitza Stark gene: TMEM94 was added
gene: TMEM94 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TMEM94 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM94 were set to 30526868
Phenotypes for gene: TMEM94 were set to Intellectual developmental disorder with cardiac defects and dysmorphic facies, MIM#618316
Review for gene: TMEM94 was set to GREEN
Added comment: 10 individuals from 6 unrelated families.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2307 TMEM260 Zornitza Stark Publications for gene: TMEM260 were set to
Intellectual disability syndromic and non-syndromic v0.2302 TINF2 Zornitza Stark Publications for gene: TINF2 were set to
Intellectual disability syndromic and non-syndromic v0.2299 TIMM50 Zornitza Stark gene: TIMM50 was added
gene: TIMM50 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TIMM50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TIMM50 were set to 27573165; 30190335; 31058414
Phenotypes for gene: TIMM50 were set to 3-methylglutaconic aciduria, type IX, MIM#617698
Review for gene: TIMM50 was set to GREEN
Added comment: Four unrelated families reported, ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2297 THRB Zornitza Stark Publications for gene: THRB were set to
Intellectual disability syndromic and non-syndromic v0.2292 TGFB1 Zornitza Stark gene: TGFB1 was added
gene: TGFB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TGFB1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TGFB1 were set to 29483653
Phenotypes for gene: TGFB1 were set to Inflammatory bowel disease, immunodeficiency, and encephalopathy, MIM# 618213
Review for gene: TGFB1 was set to AMBER
Added comment: Three individuals from two unrelated families reported. DD/ID and seizures in addition to IBD/immunodeficiency.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2290 TELO2 Zornitza Stark gene: TELO2 was added
gene: TELO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: TELO2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TELO2 were set to 27132593; 28944240
Phenotypes for gene: TELO2 were set to You-Hoover-Fong syndrome, MIM#616954; Syndromic intellectual disability
Review for gene: TELO2 was set to GREEN
Added comment: Five unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2288 TECR Zornitza Stark Publications for gene: TECR were set to
Intellectual disability syndromic and non-syndromic v0.2284 TBC1D7 Zornitza Stark Publications for gene: TBC1D7 were set to
Intellectual disability syndromic and non-syndromic v0.2280 TAF2 Zornitza Stark Publications for gene: TAF2 were set to
Intellectual disability syndromic and non-syndromic v0.2277 TAF13 Zornitza Stark Publications for gene: TAF13 were set to
Intellectual disability syndromic and non-syndromic v0.2271 SYT14 Zornitza Stark Publications for gene: SYT14 were set to
Intellectual disability syndromic and non-syndromic v0.2266 SUFU Zornitza Stark gene: SUFU was added
gene: SUFU was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SUFU was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUFU were set to 28965847
Phenotypes for gene: SUFU were set to Joubert syndrome 32, MIM#617757
Review for gene: SUFU was set to AMBER
Added comment: Two unrelated families described with what are postulated to be hypomorphic bi-allelic variants in this gene and Joubert syndrome. Note gene also causes dominant Basal Cell Nevus Syndrome.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2261 STRADA Zornitza Stark gene: STRADA was added
gene: STRADA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: STRADA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: STRADA were set to 17522105; 27170158; 28688840
Phenotypes for gene: STRADA were set to Polyhydramnios, megalencephaly, and symptomatic epilepsy, MIM# 611087
Review for gene: STRADA was set to GREEN
Added comment: Seven distantly related Menonite children plus four other unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2259 SRPX2 Zornitza Stark Publications for gene: SRPX2 were set to
Intellectual disability syndromic and non-syndromic v0.2255 SPRTN Zornitza Stark Publications for gene: SPRTN were set to
Intellectual disability syndromic and non-syndromic v0.2249 CEP135 Zornitza Stark Publications for gene: CEP135 were set to
Intellectual disability syndromic and non-syndromic v0.2246 CDK13 Zornitza Stark Publications for gene: CDK13 were set to
Intellectual disability syndromic and non-syndromic v0.2239 SOS2 Zornitza Stark gene: SOS2 was added
gene: SOS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SOS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOS2 were set to Noonan syndrome 9, MIM# 616559
Review for gene: SOS2 was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2238 RASA1 Sebastian Lunke gene: RASA1 was added
gene: RASA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: RASA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Review for gene: RASA1 was set to RED
Added comment: GEL review red in 2018, no evidence for link with ID since
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2237 RAX Sebastian Lunke gene: RAX was added
gene: RAX was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: RAX was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAX were set to 30762128; 24033328
Phenotypes for gene: RAX were set to MICROPHTHALMIA, ISOLATED 3; MCOP3
Review for gene: RAX was set to RED
Added comment: Only three cases described with intellectual disability in addition to microphthalmia, no new descriptions of ID association since 2014. Not clear if the cases are from the same or different families. Link with ID seems tenuous at best.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2234 SOBP Zornitza Stark Publications for gene: SOBP were set to 21035105
Intellectual disability syndromic and non-syndromic v0.2233 SOBP Zornitza Stark Publications for gene: SOBP were set to
Intellectual disability syndromic and non-syndromic v0.2229 SNIP1 Zornitza Stark Publications for gene: SNIP1 were set to 22279524
Intellectual disability syndromic and non-syndromic v0.2228 SNIP1 Zornitza Stark Publications for gene: SNIP1 were set to
Intellectual disability syndromic and non-syndromic v0.2225 SMG9 Zornitza Stark gene: SMG9 was added
gene: SMG9 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SMG9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SMG9 were set to 27018474; 31390136
Phenotypes for gene: SMG9 were set to Heart and brain malformation syndrome, MIM# 616920
Review for gene: SMG9 was set to GREEN
Added comment: Three unrelated families reported, severe congenital malformation syndrome, ID is part of the phenotype in survivors.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2223 SMARCD2 Zornitza Stark gene: SMARCD2 was added
gene: SMARCD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SMARCD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SMARCD2 were set to 26350204; 28369036
Phenotypes for gene: SMARCD2 were set to Specific granule deficiency 2, 617475 (includes global developmental delay in some patients)
Review for gene: SMARCD2 was set to AMBER
Added comment: Candidate ID gene in PMID:26350204 and developmental delay seen in 2 patients with SGD2 PMID:28369036.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2221 PIGA Zornitza Stark Publications for gene: PIGA were set to
Intellectual disability syndromic and non-syndromic v0.2218 SLC9A9 Zornitza Stark Publications for gene: SLC9A9 were set to
Intellectual disability syndromic and non-syndromic v0.2211 SLC6A4 Zornitza Stark Publications for gene: SLC6A4 were set to
Intellectual disability syndromic and non-syndromic v0.2208 PNKP Zornitza Stark Publications for gene: PNKP were set to
Intellectual disability syndromic and non-syndromic v0.2201 SLC1A2 Zornitza Stark gene: SLC1A2 was added
gene: SLC1A2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SLC1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC1A2 were set to 27476654; 28777935
Phenotypes for gene: SLC1A2 were set to Epileptic encephalopathy, early infantile, 41, MIM#617105; Intellectual disability
Review for gene: SLC1A2 was set to GREEN
gene: SLC1A2 was marked as current diagnostic
Added comment: Four unrelated individuals reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2199 SHROOM4 Zornitza Stark Publications for gene: SHROOM4 were set to
Intellectual disability syndromic and non-syndromic v0.2196 CHD2 Zornitza Stark Phenotypes for gene: CHD2 were changed from to Epileptic encephalopathy, childhood-onset (MIM # 615369)
Intellectual disability syndromic and non-syndromic v0.2193 INTS1 Zornitza Stark Publications for gene: INTS1 were set to
Intellectual disability syndromic and non-syndromic v0.2189 SACS Zornitza Stark Publications for gene: SACS were set to
Intellectual disability syndromic and non-syndromic v0.2185 SOX3 Zornitza Stark Publications for gene: SOX3 were set to
Intellectual disability syndromic and non-syndromic v0.2180 PUF60 Zornitza Stark Publications for gene: PUF60 were set to
Intellectual disability syndromic and non-syndromic v0.2177 PTRHD1 Zornitza Stark gene: PTRHD1 was added
gene: PTRHD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PTRHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTRHD1 were set to 30398675; 27134041; 27753167; 29143421
Phenotypes for gene: PTRHD1 were set to Parkinsonism; Intellectual disability
Review for gene: PTRHD1 was set to GREEN
Added comment: Three unrelated families reported: two with homozygous missense variants; and one with truncating variant. Affected individuals have juvenile-onset parkinsonism and ID.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2175 PTRH2 Zornitza Stark gene: PTRH2 was added
gene: PTRH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PTRH2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTRH2 were set to 25574476; 28175314; 28328138; 25558065; 27129381
Phenotypes for gene: PTRH2 were set to Infantile-onset multisystem neurologic, endocrine, and pancreatic disease, MIM# 616263
Review for gene: PTRH2 was set to AMBER
Added comment: A spectrum of features associated with bi-allelic variants in this gene; however, ID only reported as a feature in two families.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2173 PSAT1 Zornitza Stark Publications for gene: PSAT1 were set to
Intellectual disability syndromic and non-syndromic v0.2169 PRRT2 Zornitza Stark Publications for gene: PRRT2 were set to
Intellectual disability syndromic and non-syndromic v0.2159 POLR1C Zornitza Stark gene: POLR1C was added
gene: POLR1C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: POLR1C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR1C were set to 26151409
Phenotypes for gene: POLR1C were set to Leukodystrophy, hypomyelinating, 11, MIM# 616494
Review for gene: POLR1C was set to GREEN
Added comment: 8 unrelated individuals reported, ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2156 PMPCA Zornitza Stark gene: PMPCA was added
gene: PMPCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PMPCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PMPCA were set to 25808372; 26657514; 27148589; 30617178
Phenotypes for gene: PMPCA were set to Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200
Review for gene: PMPCA was set to GREEN
Added comment: Seven families reported. Three had the same founder variant. ID observed in five of the affected families (includes the three with the same founder variant).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2154 GFER Zornitza Stark Publications for gene: GFER were set to
Intellectual disability syndromic and non-syndromic v0.2151 RPIA Sebastian Lunke gene: RPIA was added
gene: RPIA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: RPIA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RPIA were set to 14988808; 10589548; 20499043; 28801340; 30088433
Phenotypes for gene: RPIA were set to Ribose 5-phosphate isomerase deficiency, MIM 608611
Review for gene: RPIA was set to GREEN
gene: RPIA was marked as current diagnostic
Added comment: From GEL: Three patients described in total, one of these with functional data:

Patient 1 with comp het missense and frameshift as well as functional data, early developmental delay, leukoencephalopathy, seizures with onset at 4 years, with subsequent neurologic regression and peripheral neuropathy

Patient 2 with missense, delayed early development, seizures and regression at the age of 7 with MRI white matter abnormalities

Patient 3 with comp het missense and canonical splice, clinical biochem corroboration ribitol and arabitol in urine demonstrated significant elevations (>20x), neonatal onset leukoencephalopathy and developmental delay
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2149 PLEKHG2 Zornitza Stark gene: PLEKHG2 was added
gene: PLEKHG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PLEKHG2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLEKHG2 were set to 26539891; 24001768; 26573021
Phenotypes for gene: PLEKHG2 were set to Leukodystrophy and acquired microcephaly with or without dystonia, 616763
Review for gene: PLEKHG2 was set to AMBER
Added comment: Three families reported; however, two had the same homozygous variant (founder effect).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2147 PITRM1 Zornitza Stark gene: PITRM1 was added
gene: PITRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PITRM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PITRM1 were set to 26697887; 29764912; 29383861
Phenotypes for gene: PITRM1 were set to Ataxia; Intellectual disability
Review for gene: PITRM1 was set to GREEN
gene: PITRM1 was marked as current diagnostic
Added comment: Three unrelated families reported with bi-allelic variants in this gene.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2145 PIK3C2A Zornitza Stark gene: PIK3C2A was added
gene: PIK3C2A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PIK3C2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIK3C2A were set to 31034465
Phenotypes for gene: PIK3C2A were set to Oculoskeletodental syndrome, 618440
Review for gene: PIK3C2A was set to GREEN
Added comment: Three unrelated families, ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2143 MECP2 Zornitza Stark Publications for gene: MECP2 were set to
Intellectual disability syndromic and non-syndromic v0.2139 VARS Chirag Patel gene: VARS was added
gene: VARS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: VARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VARS were set to PubMed: 30755616, 30755602, 26539891, 29691655, 30275004
Phenotypes for gene: VARS were set to Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy; OMIM #617802
Review for gene: VARS was set to GREEN
Added comment: 14 families with 20 affected individuals
- homozygous missense or compound heterozygous mutations in VARS
- mutations segregated with the disorder in the families
- functional studies in some cases
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2137 WDR4 Chirag Patel gene: WDR4 was added
gene: WDR4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: WDR4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR4 were set to PubMed: 26416026, 30079490, 29597095, 28617965
Phenotypes for gene: WDR4 were set to Galloway-Mowat syndrome 6, OMIM #618347; Microcephaly, growth deficiency, seizures, and brain malformations, OMIM #618346
Review for gene: WDR4 was set to GREEN
Added comment: Galloway-Mowat syndrome 6, OMIM #618347:

1 family with 2 sibs with GMS and compound heterozygous mutations in the WDR4 gene, segregated with the disorder in the family. Functional studies of the variants and studies of patient cells were not performed.

1 family with 1 child with GMS and compound heterozygous mutations in the WDR4 gene, segregated with the disorder in the family. Functional studies of the variants and studies of patient cells were not performed.

1 family with 4 sibs with GMS and homozygous splice site mutation in the WDR4 gene. Functional studies of the variant and studies of patient cells were not performed.



Microcephaly, growth deficiency, seizures, and brain malformations; OMIM #618346:

2 unrelated patients with intrauterine growth retardation, postnatal growth deficiency with severe microcephaly, and poor or absent psychomotor development. Testing found the same homozygous missense mutation in the WDR4 gene, which segregated with the disorder in both families. Studies of patient cells and modeling of the corresponding mutation in yeast showed that the mutation caused a significant reduction in m(7)G46 methylation of specific tRNAs species, particularly at higher temperatures. This was associated with a growth defect in yeast, thus offering a potential mechanism for the growth defects observed in patients with the mutation. The findings suggested that abnormal tRNA modification is a major contributor to disease pathogenesis.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2134 UNC13A Zornitza Stark Publications for gene: UNC13A were set to
Intellectual disability syndromic and non-syndromic v0.2130 UFC1 Chirag Patel gene: UFC1 was added
gene: UFC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: UFC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFC1 were set to PubMed: 29868776
Phenotypes for gene: UFC1 were set to Neurodevelopmental disorder with spasticity and poor growth; OMIM #618076
Review for gene: UFC1 was set to GREEN
Added comment: 3 consanguineous Saudi families with neurodevelopmental disorder with spasticity and poor growth with a homozygous missense mutation in the UFC1 gene. An unrelated Swiss boy with same phenotype found to have a different homozygous mutation in the UFC1 gene. Total 8 patients from 4 families.

The mutations segregated with the disorder in the families. In vitro functional expression studies showed that both mutations caused impaired thioester binding with UFM1 (610553). Patient cells also showed decreased UFC1 intermediate formation with UFM1. The decrease in function was consistent with a hypomorphic allele, and Nahorski et al. (2018) suggested that complete loss of function would be embryonic lethal.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2125 PIGP Zornitza Stark gene: PIGP was added
gene: PIGP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PIGP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGP were set to 28334793; 31139695
Phenotypes for gene: PIGP were set to Epileptic encephalopathy, early infantile, 55, 617599
Review for gene: PIGP was set to AMBER
Added comment: Two unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2121 SPTBN4 Bryony Thompson gene: SPTBN4 was added
gene: SPTBN4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SPTBN4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPTBN4 were set to 28540413; 29861105
Phenotypes for gene: SPTBN4 were set to Neurodevelopmental disorder with hypotonia, neuropathy, and deafness MIM#617519
Review for gene: SPTBN4 was set to GREEN
Added comment: 6 families with a severe neurological syndrome that includes congenital hypotonia, intellectual disability, and motor axonal and auditory neuropathy
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2118 ZNF81 Chirag Patel reviewed gene: ZNF81: Rating: AMBER; Mode of pathogenicity: None; Publications: PubMed: 15121780; Phenotypes: mental retardation; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.2117 ZIC1 Chirag Patel gene: ZIC1 was added
gene: ZIC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ZIC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZIC1 were set to PMID: 26340333, 30391508
Phenotypes for gene: ZIC1 were set to Structural brain anomalies with impaired intellectual development and craniosynostosis; OMIM #618736 
Review for gene: ZIC1 was set to GREEN
Added comment: 5 families with heterozygous mutations located in the final (third) exon of ZIC1 who have a distinct phenotype in which severe craniosynostosis, specifically involving the coronal sutures, and variable learning disability are the most characteristic features. The location of the nonsense mutations predicts escape of mutant ZIC1 transcripts from nonsense-mediated decay, which was confirmed in a cell line from an affected individual. Both nonsense and missense mutations are associated with altered and/or enhanced expression of a target gene, engrailed-2, in a Xenopus embryo assay. Analysis of mouse embryos revealed a localized domain of Zic1 expression at embryonic days 11.5-12.5 in a region overlapping the supraorbital regulatory center, which patterns the coronal suture.

2 sibs with BAIDCS, Vandervore et al. (2018) identified heterozygosity for a frameshift mutation in the ZIC1 gene. Neither parent had evidence of the mutation by whole-exome sequencing, suggesting that gonadal mosaicism for the mutation was present in one of the parents. Expression of the mutated allele was detected in patient fibroblasts by RT-PCR, evidence that the mutant mRNA did not undergo nonsense-mediated decay and probably generates an abnormal protein.


Also heterozygous deletions of ZIC1 on chromosome 3q25.1 are associated with Dandy-Walker malformation of the cerebellum. Loss of the orthologous Zic1 gene in the mouse causes cerebellar hypoplasia and vertebral defects.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2115 ZNF148 Chirag Patel gene: ZNF148 was added
gene: ZNF148 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ZNF148 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF148 were set to PMID: 27964749
Phenotypes for gene: ZNF148 were set to Global developmental delay, absent or hypoplastic corpus callosum, and dysmorphic facies; OMIM #617260
Review for gene: ZNF148 was set to GREEN
Added comment: 4 patients with de novo heterozygous nonsense or frameshift mutations in the ZNF148 gene. Patients characterized by underdevelopment of the corpus callosum, mild to moderate developmental delay and ID, variable microcephaly or mild macrocephaly, short stature, feeding problems, facial dysmorphisms, and cardiac and renal malformations. No functional evidence.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2113 EML1 Zornitza Stark Publications for gene: EML1 were set to
Intellectual disability syndromic and non-syndromic v0.2110 WAC Zornitza Stark Publications for gene: WAC were set to
Intellectual disability syndromic and non-syndromic v0.2108 PIGH Zornitza Stark Publications for gene: PIGH were set to 29573052; 29603510
Intellectual disability syndromic and non-syndromic v0.2106 PIGH Zornitza Stark gene: PIGH was added
gene: PIGH was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PIGH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGH were set to 29573052; 29603510
Phenotypes for gene: PIGH were set to Glycosylphosphatidylinositol biosynthesis defect 17, MIM#618010
Review for gene: PIGH was set to AMBER
Added comment: Two unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2104 PIEZO2 Zornitza Stark Publications for gene: PIEZO2 were set to 24726473
Intellectual disability syndromic and non-syndromic v0.2103 PIEZO2 Zornitza Stark Publications for gene: PIEZO2 were set to
Intellectual disability syndromic and non-syndromic v0.2099 PHACTR1 Zornitza Stark gene: PHACTR1 was added
gene: PHACTR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PHACTR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PHACTR1 were set to 30256902; 28135719; 23033978; 27457812
Phenotypes for gene: PHACTR1 were set to Seizures:Epileptic encephalopathy, early infantile, 70, MIM# 618298; PHACTR1-associated neurodevelopment disorder
Penetrance for gene: PHACTR1 were set to Incomplete
Mode of pathogenicity for gene: PHACTR1 was set to Other
Review for gene: PHACTR1 was set to GREEN
gene: PHACTR1 was marked as current diagnostic
Added comment: 6 unrelated individuals reported altogether with variants in this gene. Several as part of large cohorts, so limited variant and patient characterisation. One variant reported by de Ligt et al is present in the population (4 individuals) suggesting reduced penetrance. However, functional data (including mouse model) for this and other variants exerting a dominant negative effect.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2096 PET100 Zornitza Stark Publications for gene: PET100 were set to
Intellectual disability syndromic and non-syndromic v0.2090 PCDH10 Zornitza Stark Publications for gene: PCDH10 were set to
Intellectual disability syndromic and non-syndromic v0.2083 OSGEP Zornitza Stark gene: OSGEP was added
gene: OSGEP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: OSGEP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OSGEP were set to 28805828; 28272532
Phenotypes for gene: OSGEP were set to Galloway-Mowat syndrome 3, MIM# 617729
Review for gene: OSGEP was set to GREEN
gene: OSGEP was marked as current diagnostic
Added comment: 25 families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2075 LNPK Zornitza Stark Publications for gene: LNPK were set to
Intellectual disability syndromic and non-syndromic v0.2070 LIPT2 Zornitza Stark gene: LIPT2 was added
gene: LIPT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: LIPT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LIPT2 were set to 28757203
Phenotypes for gene: LIPT2 were set to Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM#617668
Review for gene: LIPT2 was set to AMBER
Added comment: Three individuals from two unrelated families; profound ID.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2068 LAS1L Zornitza Stark Publications for gene: LAS1L were set to
Intellectual disability syndromic and non-syndromic v0.2066 KIF4A Zornitza Stark Publications for gene: KIF4A were set to
Intellectual disability syndromic and non-syndromic v0.2063 KIF2A Zornitza Stark gene: KIF2A was added
gene: KIF2A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: KIF2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIF2A were set to 23603762; 21594994; 27747449; 27896282
Phenotypes for gene: KIF2A were set to Cortical dysplasia, complex, with other brain malformations 3, 615411
Review for gene: KIF2A was set to GREEN
gene: KIF2A was marked as current diagnostic
Added comment: Five unrelated individuals reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2061 KCNT2 Zornitza Stark gene: KCNT2 was added
gene: KCNT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: KCNT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNT2 were set to 29069600; 29740868
Phenotypes for gene: KCNT2 were set to Epileptic encephalopathy, early infantile 57, 617771
Mode of pathogenicity for gene: KCNT2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: KCNT2 was set to GREEN
gene: KCNT2 was marked as current diagnostic
Added comment: Three unrelated individuals reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2059 KCNK4 Zornitza Stark gene: KCNK4 was added
gene: KCNK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: KCNK4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNK4 were set to 30290154
Phenotypes for gene: KCNK4 were set to Facial dysmorphism, hypertrichosis, epilepsy, intellectual/developmental delay, and gingival overgrowth syndrome 618381
Mode of pathogenicity for gene: KCNK4 was set to Other
Review for gene: KCNK4 was set to GREEN
Added comment: Three unrelated individuals reported with a distinctive syndromic ID condition and de novo variants (two of the individuals had the same variant). Likely GoF as KO mice do not share the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2057 KATNAL2 Zornitza Stark Publications for gene: KATNAL2 were set to 22495311; 21572417; 22495309; 22495306
Intellectual disability syndromic and non-syndromic v0.2056 KATNAL2 Zornitza Stark Publications for gene: KATNAL2 were set to
Intellectual disability syndromic and non-syndromic v0.2054 ITGA7 Zornitza Stark Publications for gene: ITGA7 were set to
Intellectual disability syndromic and non-syndromic v0.2049 ISCA2 Zornitza Stark Publications for gene: ISCA2 were set to
Intellectual disability syndromic and non-syndromic v0.2046 INTS8 Zornitza Stark Publications for gene: INTS8 were set to
Intellectual disability syndromic and non-syndromic v0.2039 TRAPPC9 Zornitza Stark Publications for gene: TRAPPC9 were set to
Intellectual disability syndromic and non-syndromic v0.2037 IGBP1 Zornitza Stark Publications for gene: IGBP1 were set to 14556245
Intellectual disability syndromic and non-syndromic v0.2037 IGBP1 Zornitza Stark Publications for gene: IGBP1 were set to
Intellectual disability syndromic and non-syndromic v0.2035 IQSEC2 Zornitza Stark reviewed gene: IQSEC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31415821, 20473311, 30842726; Phenotypes: Mental retardation, X-linked 1/78, MIM#309530; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.2034 HTT Zornitza Stark gene: HTT was added
gene: HTT was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: HTT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HTT were set to 26740508; 27329733
Phenotypes for gene: HTT were set to Lopes-Maciel-Rodan syndrome, 617435; LOMARS; Intellectual disability
Review for gene: HTT was set to AMBER
Added comment: Two unrelated families reported with bi-allelic variants in this gene and a neurodevelopmental phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2032 HIST1H4C Zornitza Stark Publications for gene: HIST1H4C were set to 28920961
Intellectual disability syndromic and non-syndromic v0.2031 HIST1H4C Zornitza Stark Publications for gene: HIST1H4C were set to
Intellectual disability syndromic and non-syndromic v0.2027 HERC2 Zornitza Stark Publications for gene: HERC2 were set to
Intellectual disability syndromic and non-syndromic v0.2020 HARS2 Zornitza Stark Publications for gene: HARS2 were set to
Intellectual disability syndromic and non-syndromic v0.2015 GTF3C3 Zornitza Stark Publications for gene: GTF3C3 were set to
Intellectual disability syndromic and non-syndromic v0.2012 KIF11 Zornitza Stark Publications for gene: KIF11 were set to
Intellectual disability syndromic and non-syndromic v0.2007 GRIN2D Zornitza Stark gene: GRIN2D was added
gene: GRIN2D was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GRIN2D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GRIN2D were set to 27616483; 30280376
Phenotypes for gene: GRIN2D were set to Epileptic encephalopathy, early infantile, 46, MIM# 617162; intellectual disability
Mode of pathogenicity for gene: GRIN2D was set to Other
Review for gene: GRIN2D was set to GREEN
gene: GRIN2D was marked as current diagnostic
Added comment: Five unrelated individuals reported, two with recurrent variant (NM_000836.2:c.1999G>A or p.Val667Ile). GoF postulated as mechanism.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2005 GRIA1 Zornitza Stark gene: GRIA1 was added
gene: GRIA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GRIA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GRIA1 were set to 28628100; 23033978; 26350204; 24896178
Phenotypes for gene: GRIA1 were set to Intellectual disability; autism
Review for gene: GRIA1 was set to GREEN
Added comment: Multiple affected individuals reported but in large ID cohorts reporting multiple candidate genes. Recurrent (p.A636T) variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2004 GPHN Zornitza Stark Publications for gene: GPHN were set to
Intellectual disability syndromic and non-syndromic v0.1999 HDAC4 Zornitza Stark Publications for gene: HDAC4 were set to
Intellectual disability syndromic and non-syndromic v0.1995 UBR4 Zornitza Stark Publications for gene: UBR4 were set to
Intellectual disability syndromic and non-syndromic v0.1991 GMNN Zornitza Stark gene: GMNN was added
gene: GMNN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GMNN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GMNN were set to 26637980
Phenotypes for gene: GMNN were set to Meier-Gorlin syndrome 6, MIM# 616835
Review for gene: GMNN was set to AMBER
Added comment: Two of the three reported individuals had ID.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1989 TRAPPC4 Zornitza Stark gene: TRAPPC4 was added
gene: TRAPPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: TRAPPC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC4 were set to 31794024
Phenotypes for gene: TRAPPC4 were set to intellectual disability; epilepsy; spasticity; microcephaly
Review for gene: TRAPPC4 was set to GREEN
Added comment: Seven individuals from three unrelated families reported; recurrent splice site variant (hg19:chr11:g.118890966A>G; TRAPPC4: NM_016146.5; c.454+3A>G), not a founder variant.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.1987 SNX27 Zornitza Stark gene: SNX27 was added
gene: SNX27 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: SNX27 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNX27 were set to 25894286; 31721175; 21300787; 23524343
Phenotypes for gene: SNX27 were set to intellectual disability; seizures
Review for gene: SNX27 was set to GREEN
Added comment: Three unrelated families and animal model.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.1985 PMPCB Zornitza Stark gene: PMPCB was added
gene: PMPCB was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: PMPCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PMPCB were set to 29576218
Phenotypes for gene: PMPCB were set to Multiple mitochondrial dysfunctions syndrome 6, MIM# 617954
Review for gene: PMPCB was set to GREEN
Added comment: Five individuals from four families; seizures in 4/5 individuals reported, onset in infancy.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.1983 NSF Zornitza Stark gene: NSF was added
gene: NSF was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NSF were set to 31675180
Phenotypes for gene: NSF were set to Seizures; EEG with burst suppression; Global developmental delay; Intellectual disability
Review for gene: NSF was set to AMBER
Added comment: Two individuals reported with de novo missense variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1981 KAT8 Zornitza Stark gene: KAT8 was added
gene: KAT8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KAT8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KAT8 were set to 31794431
Phenotypes for gene: KAT8 were set to Intellectual disability; seizures; autism; dysmorphic features
Review for gene: KAT8 was set to GREEN
Added comment: Eight unrelated individuals reported with de novo variants in this gene and a mouse model. All variants missense, in the chromobarrel domain or the acetyltransferase domain; three individuals had the same variant p.Tyr90Cys . One more individual reported with bi-allelic variants: one missense and one frameshift; carrier parents were normal suggesting that may be haploinsuffiency is not the mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1977 GEMIN4 Zornitza Stark Publications for gene: GEMIN4 were set to
Intellectual disability syndromic and non-syndromic v0.1968 GABRA2 Zornitza Stark gene: GABRA2 was added
gene: GABRA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GABRA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABRA2 were set to 29422393; 29961870; 31032849; 31032848
Phenotypes for gene: GABRA2 were set to Epileptic encephalopathy, early infantile, 78, 618557
Review for gene: GABRA2 was set to GREEN
gene: GABRA2 was marked as current diagnostic
Added comment: Six unrelated families reported, ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1966 GABBR2 Zornitza Stark gene: GABBR2 was added
gene: GABBR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GABBR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABBR2 were set to 29100083; 28061363; 28135719; 28856709; 29369404; 29377213
Phenotypes for gene: GABBR2 were set to Neurodevelopmental disorder with poor language and loss of hand skills, 617903
Review for gene: GABBR2 was set to GREEN
gene: GABBR2 was marked as current diagnostic
Added comment: At least 7 unrelated individuals reported, missense variants only, A707T and A567T (recurrent).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1964 HNRNPU Zornitza Stark Publications for gene: HNRNPU were set to
Intellectual disability syndromic and non-syndromic v0.1961 G6PC3 Zornitza Stark Publications for gene: G6PC3 were set to
Intellectual disability syndromic and non-syndromic v0.1952 FTO Zornitza Stark Publications for gene: FTO were set to
Intellectual disability syndromic and non-syndromic v0.1949 FRRS1L Zornitza Stark gene: FRRS1L was added
gene: FRRS1L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: FRRS1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FRRS1L were set to 27236917; 27239025
Phenotypes for gene: FRRS1L were set to Epileptic encephalopathy, early infantile, 37, MIM#616981
Review for gene: FRRS1L was set to GREEN
Added comment: Five unrelated individuals reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1947 FIBP Zornitza Stark Publications for gene: FIBP were set to 26660953; 27183861
Intellectual disability syndromic and non-syndromic v0.1947 FIBP Zornitza Stark Publications for gene: FIBP were set to
Intellectual disability syndromic and non-syndromic v0.1944 FGFR1 Zornitza Stark Publications for gene: FGFR1 were set to
Intellectual disability syndromic and non-syndromic v0.1939 TKFC Zornitza Stark gene: TKFC was added
gene: TKFC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TKFC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TKFC were set to 32004446
Phenotypes for gene: TKFC were set to Developmental delay; cataracts; liver dysfunction
Review for gene: TKFC was set to AMBER
Added comment: Two unrelated individuals reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1937 RALGAPA1 Zornitza Stark gene: RALGAPA1 was added
gene: RALGAPA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RALGAPA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RALGAPA1 were set to 32004447
Phenotypes for gene: RALGAPA1 were set to Intellectual disability; hypotonia; infantile spasms.
Review for gene: RALGAPA1 was set to GREEN
Added comment: Four unrelated individuals reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1926 EPB41L1 Zornitza Stark Publications for gene: EPB41L1 were set to
Intellectual disability syndromic and non-syndromic v0.1922 EMG1 Zornitza Stark gene: EMG1 was added
gene: EMG1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: EMG1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EMG1 were set to 19463982
Phenotypes for gene: EMG1 were set to Bowen-Conradi syndrome, MIM#211180
Review for gene: EMG1 was set to AMBER
Added comment: Founder mutation in Hutterite, D86G.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1920 EMC1 Zornitza Stark gene: EMC1 was added
gene: EMC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: EMC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EMC1 were set to 26942288; 29271071
Phenotypes for gene: EMC1 were set to Cerebellar atrophy, visual impairment, and psychomotor retardation, MIM# 616875
Review for gene: EMC1 was set to GREEN
gene: EMC1 was marked as current diagnostic
Added comment: Four unrelated families with bi-allelic variants in this gene reported. Single individual with heterozygous variant: insufficient evidence at present for mono allelic variants causing disease.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1915 ATAD3A Zornitza Stark Publications for gene: ATAD3A were set to
Intellectual disability syndromic and non-syndromic v0.1911 DPM3 Zornitza Stark Publications for gene: DPM3 were set to
Intellectual disability syndromic and non-syndromic v0.1907 DPM2 Zornitza Stark Publications for gene: DPM2 were set to
Intellectual disability syndromic and non-syndromic v0.1903 DNAJC3 Zornitza Stark Publications for gene: DNAJC3 were set to
Intellectual disability syndromic and non-syndromic v0.1899 DLG4 Zornitza Stark Publications for gene: DLG4 were set to
Intellectual disability syndromic and non-syndromic v0.1896 DLG4 Zornitza Stark edited their review of gene: DLG4: Added comment: Four unrelated individuals reported.; Changed rating: GREEN; Changed publications: 27479843, 25123844, 19617690, 29460436, 23020937, 28135719; Changed phenotypes: Intellectual disability, Marfanoid habitus; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Set current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.1894 DIP2B Zornitza Stark Publications for gene: DIP2B were set to
Intellectual disability syndromic and non-syndromic v0.1888 DENND5A Zornitza Stark gene: DENND5A was added
gene: DENND5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: DENND5A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DENND5A were set to 27431290; 27866705
Phenotypes for gene: DENND5A were set to Epileptic encephalopathy, early infantile, 49, MIM# 617281
Review for gene: DENND5A was set to GREEN
Added comment: Four unrelated families, ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1886 DCPS Zornitza Stark gene: DCPS was added
gene: DCPS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: DCPS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DCPS were set to 25701870; 30289615; 25712129
Phenotypes for gene: DCPS were set to Al-Raqad syndrome, MIM#616459
Review for gene: DCPS was set to GREEN
gene: DCPS was marked as current diagnostic
Added comment: 7 individuals from 3 families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1884 CWF19L1 Zornitza Stark gene: CWF19L1 was added
gene: CWF19L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CWF19L1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CWF19L1 were set to 25361784; 15981765; 26197978; 27016154; 30167849
Phenotypes for gene: CWF19L1 were set to Spinocerebellar ataxia, autosomal recessive 17, MIM#616127; intellectual disability, developmental delay
Review for gene: CWF19L1 was set to GREEN
gene: CWF19L1 was marked as current diagnostic
Added comment: Three unrelated families reported, ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1882 CUX1 Zornitza Stark gene: CUX1 was added
gene: CUX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CUX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CUX1 were set to 25059644; 20510857; 30014507
Phenotypes for gene: CUX1 were set to Global developmental delay with or without impaired intellectual development, MIM#618330
Review for gene: CUX1 was set to GREEN
gene: CUX1 was marked as current diagnostic
Added comment: Nine individuals from 7 families reported. Three individuals had normal intelligence at school age despite significant early developmental delay.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1880 CRBN Zornitza Stark Publications for gene: CRBN were set to
Intellectual disability syndromic and non-syndromic v0.1874 COLEC10 Zornitza Stark Publications for gene: COLEC10 were set to
Intellectual disability syndromic and non-syndromic v0.1869 COA3 Zornitza Stark Publications for gene: COA3 were set to 25604084
Intellectual disability syndromic and non-syndromic v0.1868 COA3 Zornitza Stark Publications for gene: COA3 were set to
Intellectual disability syndromic and non-syndromic v0.1867 CNTN3 Zornitza Stark Publications for gene: CNTN3 were set to
Intellectual disability syndromic and non-syndromic v0.1863 CLPP Zornitza Stark Publications for gene: CLPP were set to
Intellectual disability syndromic and non-syndromic v0.1860 CHRNA4 Zornitza Stark Publications for gene: CHRNA4 were set to
Intellectual disability syndromic and non-syndromic v0.1855 CEP104 Zornitza Stark gene: CEP104 was added
gene: CEP104 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CEP104 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP104 were set to 26477546
Phenotypes for gene: CEP104 were set to Joubert syndrome 25, MIM# 616781
Review for gene: CEP104 was set to GREEN
Added comment: Three unrelated individuals reported, ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1850 CDK5R1 Zornitza Stark Publications for gene: CDK5R1 were set to
Intellectual disability syndromic and non-syndromic v0.1846 CCDC88A Zornitza Stark Publications for gene: CCDC88A were set to
Intellectual disability syndromic and non-syndromic v0.1843 CARS2 Zornitza Stark gene: CARS2 was added
gene: CARS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CARS2 were set to 30139652; 25787132
Phenotypes for gene: CARS2 were set to Combined oxidative phosphorylation deficiency 27, MIM#616672
Review for gene: CARS2 was set to GREEN
Added comment: Three unrelated individuals described with this mitochondrial disorder, ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1838 CA5A Zornitza Stark Publications for gene: CA5A were set to
Intellectual disability syndromic and non-syndromic v0.1836 KIF1A Zornitza Stark Publications for gene: KIF1A were set to
Intellectual disability syndromic and non-syndromic v0.1832 ACSL4 Zornitza Stark Publications for gene: ACSL4 were set to
Intellectual disability syndromic and non-syndromic v0.1831 ACSL4 Zornitza Stark Mode of inheritance for gene: ACSL4 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.1827 HUWE1 Zornitza Stark Mode of inheritance for gene: HUWE1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.1826 HUWE1 Zornitza Stark reviewed gene: HUWE1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, X-linked syndromic, Turner type; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.1825 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Intellectual disability syndromic and non-syndromic v0.1822 EBP Zornitza Stark Mode of inheritance for gene: EBP was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.1821 EBP Zornitza Stark reviewed gene: EBP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Chondrodysplasia punctata, X-linked dominant MIM#302960, Conradi-Hunermann syndrome, MEND syndrome, MIM#300960; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.1820 ALDH3A2 Zornitza Stark Publications for gene: ALDH3A2 were set to
Intellectual disability syndromic and non-syndromic v0.1817 ABHD5 Zornitza Stark Publications for gene: ABHD5 were set to
Intellectual disability syndromic and non-syndromic v0.1814 TUBGCP6 Zornitza Stark Publications for gene: TUBGCP6 were set to
Intellectual disability syndromic and non-syndromic v0.1810 MYT1L Zornitza Stark Publications for gene: MYT1L were set to
Intellectual disability syndromic and non-syndromic v0.1806 IRF2BPL Zornitza Stark Publications for gene: IRF2BPL were set to
Intellectual disability syndromic and non-syndromic v0.1805 ACSL4 Michelle Torres reviewed gene: ACSL4: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:12525535; Phenotypes: 1. Mental retardation, X-linked 63 300387 XLD; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.1804 PHF8 Zornitza Stark Publications for gene: PHF8 were set to
Intellectual disability syndromic and non-syndromic v0.1800 IARS Zornitza Stark Publications for gene: IARS were set to
Intellectual disability syndromic and non-syndromic v0.1797 SOX5 Zornitza Stark Publications for gene: SOX5 were set to
Intellectual disability syndromic and non-syndromic v0.1793 GNAO1 Zornitza Stark Publications for gene: GNAO1 were set to
Intellectual disability syndromic and non-syndromic v0.1789 CAD Zornitza Stark gene: CAD was added
gene: CAD was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CAD was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CAD were set to 25678555; 28007989; 30914295
Phenotypes for gene: CAD were set to Epileptic encephalopathy, early infantile, 50, MIM# MIM 616457
Review for gene: CAD was set to GREEN
gene: CAD was marked as current diagnostic
Added comment: Four unrelated families (two with same variant and Roma background, likely founder).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1786 CACNG2 Zornitza Stark Publications for gene: CACNG2 were set to
Intellectual disability syndromic and non-syndromic v0.1783 PPM1D Zornitza Stark Publications for gene: PPM1D were set to
Intellectual disability syndromic and non-syndromic v0.1779 CACNA2D2 Zornitza Stark gene: CACNA2D2 was added
gene: CACNA2D2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CACNA2D2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CACNA2D2 were set to 23339110; 24358150; 30410802; 29997391; 31402629; 11487633; 11756448; 4177347; 14660671; 15331424
Phenotypes for gene: CACNA2D2 were set to Cerebellar atrophy with seizures and variable developmental delay, MIM#618501
Review for gene: CACNA2D2 was set to GREEN
Added comment: Multiple affected individuals reported; DD/ID is variable but present in most.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1775 C8orf37 Zornitza Stark gene: C8orf37 was added
gene: C8orf37 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: C8orf37 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C8orf37 were set to 26854863; 27008867
Phenotypes for gene: C8orf37 were set to Bardet-Biedl syndrome 21, MIM#617406
Review for gene: C8orf37 was set to AMBER
Added comment: Two unrelated individuals reported with BBS; note gene has an association with retinal ciliopathies.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1773 C2CD3 Zornitza Stark Publications for gene: C2CD3 were set to
Intellectual disability syndromic and non-syndromic v0.1764 ATP6V1A Zornitza Stark gene: ATP6V1A was added
gene: ATP6V1A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ATP6V1A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ATP6V1A were set to 29668857; 28065471
Phenotypes for gene: ATP6V1A were set to Epileptic encephalopathy, infantile or early childhood, 3 618012; Cutis laxa, autosomal recessive, type IID 617403
Mode of pathogenicity for gene: ATP6V1A was set to Other
Review for gene: ATP6V1A was set to GREEN
gene: ATP6V1A was marked as current diagnostic
Added comment: Both mono-allelic and bi-allelic variants associated with ID, evidence for both LoF and GoF for the mono-allelic variants.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1759 FBXW11 Alison Yeung gene: FBXW11 was added
gene: FBXW11 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXW11 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FBXW11 were set to PMID: 31402090
Phenotypes for gene: FBXW11 were set to Intellectual disability; developmental eye anomalies; digital anomalies
Review for gene: FBXW11 was set to GREEN
gene: FBXW11 was marked as current diagnostic
Added comment: Reported in >3 unrelated individuals
Functional studies in Zebrafish
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1755 ASMT Zornitza Stark Publications for gene: ASMT were set to 21251267
Intellectual disability syndromic and non-syndromic v0.1754 ASMT Zornitza Stark Publications for gene: ASMT were set to
Intellectual disability syndromic and non-syndromic v0.1752 MAB21L1 Sue White gene: MAB21L1 was added
gene: MAB21L1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAB21L1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAB21L1 were set to 30487245
Phenotypes for gene: MAB21L1 were set to Cerebellar, ocular, craniofacial, and genital syndrome MIM#618479
Penetrance for gene: MAB21L1 were set to Complete
Review for gene: MAB21L1 was set to GREEN
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1750 ARHGEF6 Zornitza Stark Publications for gene: ARHGEF6 were set to 11017088
Intellectual disability syndromic and non-syndromic v0.1750 ARHGEF6 Zornitza Stark Publications for gene: ARHGEF6 were set to
Intellectual disability syndromic and non-syndromic v0.1745 ANK3 Zornitza Stark Publications for gene: ANK3 were set to 23390136; 28687526
Intellectual disability syndromic and non-syndromic v0.1745 ANK3 Zornitza Stark Publications for gene: ANK3 were set to 23390136; 28687526
Intellectual disability syndromic and non-syndromic v0.1744 ANK3 Zornitza Stark Publications for gene: ANK3 were set to
Intellectual disability syndromic and non-syndromic v0.1742 ALX4 Zornitza Stark Publications for gene: ALX4 were set to
Intellectual disability syndromic and non-syndromic v0.1732 CACNA1D Zornitza Stark Publications for gene: CACNA1D were set to
Intellectual disability syndromic and non-syndromic v0.1727 CTBP1 Sebastian Lunke gene: CTBP1 was added
gene: CTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CTBP1 were set to 27094857; 28955726; 31041561
Phenotypes for gene: CTBP1 were set to Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, 617915
gene: CTBP1 was marked as current diagnostic
Added comment: From GEL: There are 12 individuals reported from 3 papers (2 papers from the same group). All 12 individuals have the same heterozygous missense variant (R331W in NM_001012614.1; R342W in NM_001328.2). It is a de novo variant in all cases except one where it's inherited from a somatic parent. The phenotype of all 12 is summarised in Table 1 of PMID:31041561. Global DD is a consistent feature (varying severity). ID is recorded in several patients. Developmental motor regression recorded in 4 patients (2 of which also had cognitive regression). Authors note that healthy individuals with heterozygous LOF alleles have been reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1727 CTBP1 Sebastian Lunke gene: CTBP1 was added
gene: CTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CTBP1 were set to 27094857; 28955726; 31041561
Phenotypes for gene: CTBP1 were set to Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, 617915
gene: CTBP1 was marked as current diagnostic
Added comment: From GEL: There are 12 individuals reported from 3 papers (2 papers from the same group). All 12 individuals have the same heterozygous missense variant (R331W in NM_001012614.1; R342W in NM_001328.2). It is a de novo variant in all cases except one where it's inherited from a somatic parent. The phenotype of all 12 is summarised in Table 1 of PMID:31041561. Global DD is a consistent feature (varying severity). ID is recorded in several patients. Developmental motor regression recorded in 4 patients (2 of which also had cognitive regression). Authors note that healthy individuals with heterozygous LOF alleles have been reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1726 AHCY Zornitza Stark Publications for gene: AHCY were set to
Intellectual disability syndromic and non-syndromic v0.1724 AGO1 Zornitza Stark gene: AGO1 was added
gene: AGO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: AGO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AGO1 were set to 30213762; 22495306; 23020937; 25363768; 25356899; 27620904; 29346770; 28135719
Phenotypes for gene: AGO1 were set to Intellectual disability; autism
Review for gene: AGO1 was set to GREEN
Added comment: Multiple individuals reported with de novo variants in this gene, most as part of large ID cohorts so phenotypic information is scarce; however, given large number I have rated as Green.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1722 CNOT2 Sebastian Lunke gene: CNOT2 was added
gene: CNOT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CNOT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CNOT2 were set to 31512373; 31145527; 28135719
Phenotypes for gene: CNOT2 were set to Intellectual developmental disorder with nasal speech, dysmorphic facies, and variable skeletal anomalies 618608
Review for gene: CNOT2 was set to GREEN
gene: CNOT2 was marked as current diagnostic
Added comment: From GEL: Three independent patients with non-sense or intra-genic deletions
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1718 CNOT1 Sebastian Lunke gene: CNOT1 was added
gene: CNOT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CNOT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CNOT1 were set to 31006510; 21679367; 31006513
Phenotypes for gene: CNOT1 were set to Holoprosencephaly 12, with or without pancreatic agenesis 618500
Review for gene: CNOT1 was set to GREEN
gene: CNOT1 was marked as current diagnostic
Added comment: From GEL: More than three independent families previously described
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1712 CCDC47 Sebastian Lunke gene: CCDC47 was added
gene: CCDC47 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CCDC47 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC47 were set to 30401460
Phenotypes for gene: CCDC47 were set to Trichohepatoneurodevelopmental syndrome, 618268
Review for gene: CCDC47 was set to GREEN
gene: CCDC47 was marked as current diagnostic
Added comment: From GEL: Morimoto el al. (PMID: 30401460) report on 4 individuals from 4 unrelated families with biallelic LoF variants in CCDC47. The phenotype consisted of abnormal (woolly) hair, liver dysfunction, common facial features as well as DD/ID.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1704 CLIC2 Zornitza Stark Publications for gene: CLIC2 were set to
Intellectual disability syndromic and non-syndromic v0.1701 SLC6A9 Zornitza Stark Publications for gene: SLC6A9 were set to
Intellectual disability syndromic and non-syndromic v0.1698 DHFR Zornitza Stark Publications for gene: DHFR were set to
Intellectual disability syndromic and non-syndromic v0.1694 SLC39A8 Zornitza Stark Publications for gene: SLC39A8 were set to
Intellectual disability syndromic and non-syndromic v0.1692 PIGS Zornitza Stark gene: PIGS was added
gene: PIGS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: PIGS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGS were set to 30269814
Phenotypes for gene: PIGS were set to Glycosylphosphatidylinositol biosynthesis defect 18, MIM# 618143
Review for gene: PIGS was set to GREEN
Added comment: Three unrelated families reported. Severe neurological phenotype ranging from fetal akinesia to ID/EE.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.1690 FUK Zornitza Stark gene: FUK was added
gene: FUK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FUK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FUK were set to 30503518
Phenotypes for gene: FUK were set to Congenital disorder of glycosylation with defective fucosylation 2, MIM# 618324
Review for gene: FUK was set to AMBER
Added comment: Two unrelated individuals reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1688 ZNF142 Zornitza Stark gene: ZNF142 was added
gene: ZNF142 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: ZNF142 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF142 were set to 31036918
Phenotypes for gene: ZNF142 were set to Neurodevelopmental disorder with impaired speech and hyperkinetic movements, MIM#618425
Review for gene: ZNF142 was set to GREEN
gene: ZNF142 was marked as current diagnostic
Added comment: 7 individuals from 4 unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1686 WARS2 Zornitza Stark gene: WARS2 was added
gene: WARS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: WARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WARS2 were set to 29783990; 28236339; 29120065; 28650581; 28905505
Phenotypes for gene: WARS2 were set to Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM#617710
Review for gene: WARS2 was set to GREEN
gene: WARS2 was marked as current diagnostic
Added comment: 7 unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1684 VPS11 Zornitza Stark gene: VPS11 was added
gene: VPS11 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: VPS11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS11 were set to 27120463; 26307567; 27473128
Phenotypes for gene: VPS11 were set to Leukodystrophy, hypomyelinating, 12, MIM#616683
Review for gene: VPS11 was set to GREEN
Added comment: ID, (variable) acquired microcephaly with hypomyelination; seizures in several reported individuals. 13 individuals from 7 Ashkenazi Jewish families, homozygous for a founder mutation (NM_021729.5:c.2536T>G or p.Cys846Gly); a different variant (p.Leu387_Gly395del) reported in a consanguineous family.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1682 TRAPPC12 Zornitza Stark Publications for gene: TRAPPC12 were set to 28777934
Intellectual disability syndromic and non-syndromic v0.1682 TRAPPC12 Zornitza Stark Publications for gene: TRAPPC12 were set to 28777934
Intellectual disability syndromic and non-syndromic v0.1681 TRAPPC12 Zornitza Stark Phenotypes for gene: TRAPPC12 were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM#617669
Intellectual disability syndromic and non-syndromic v0.1681 TRAPPC12 Zornitza Stark Publications for gene: TRAPPC12 were set to
Intellectual disability syndromic and non-syndromic v0.1679 TRAPPC12 Zornitza Stark reviewed gene: TRAPPC12: Rating: AMBER; Mode of pathogenicity: None; Publications: 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM#617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.1677 SLC1A4 Zornitza Stark gene: SLC1A4 was added
gene: SLC1A4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: SLC1A4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC1A4 were set to 29989513; 27193218; 26138499; 26041762; 25930971
Phenotypes for gene: SLC1A4 were set to Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657
Review for gene: SLC1A4 was set to GREEN
gene: SLC1A4 was marked as current diagnostic
Added comment: Multiple affected individuals reported in the literature, seizures/EE are part of the phenotype. While initial reports identified a recurrent missense variant in individuals of Ashkenazi Jewish ancestry, there have been more recent reports of individuals from other ethnic backgrounds with different variants
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1675 NBEA Zornitza Stark gene: NBEA was added
gene: NBEA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: NBEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NBEA were set to 30269351; 28554332; 12746398; 12826745; 11450821; 3377648; 23277425; 22109531; 23153818
Phenotypes for gene: NBEA were set to Intellectual disability; Seizures
Review for gene: NBEA was set to GREEN
gene: NBEA was marked as current diagnostic
Added comment: 24 de novo variants reported in individuals with a neurodevelopmental disorder.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1673 MACF1 Zornitza Stark gene: MACF1 was added
gene: MACF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: MACF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MACF1 were set to 30471716
Phenotypes for gene: MACF1 were set to Lissencephaly 9 with complex brainstem malformation, MIM# 618325
Mode of pathogenicity for gene: MACF1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: MACF1 was set to GREEN
Added comment: Nine individuals (including a pair of twins) reported with de novo, likely GoF variants in this gene.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1670 NLGN4X Zornitza Stark Publications for gene: NLGN4X were set to
Intellectual disability syndromic and non-syndromic v0.1666 KATNB1 Zornitza Stark gene: KATNB1 was added
gene: KATNB1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: KATNB1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KATNB1 were set to 25521378; 25521379; 26640080
Phenotypes for gene: KATNB1 were set to Lissencephaly 6, with microcephaly, MIM# 616212
Review for gene: KATNB1 was set to GREEN
Added comment: At least 9 families reported with bi-allelic variants in this gene.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1664 GNB5 Zornitza Stark gene: GNB5 was added
gene: GNB5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: GNB5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GNB5 were set to 27523599; 27677260; 28697420; 29368331
Phenotypes for gene: GNB5 were set to Intellectual developmental disorder with cardiac arrhythmia, 617173; Language delay and ADHD/cognitive impairment with or without cardiac arrhythmia, 617182; Early infantile epileptic encephalopathy (EIEE)
Review for gene: GNB5 was set to GREEN
gene: GNB5 was marked as current diagnostic
Added comment: Multiple affected individuals reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1663 FAR1 Zornitza Stark Publications for gene: FAR1 were set to
Intellectual disability syndromic and non-syndromic v0.1658 GOT2 Zornitza Stark gene: GOT2 was added
gene: GOT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GOT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GOT2 were set to 31422819
Phenotypes for gene: GOT2 were set to Epileptic encephalopathy, early infantile, 82, MIM# 618721
Review for gene: GOT2 was set to GREEN
Added comment: Four individuals from three unrelated families reported, EE/DD. Treatment with pyridoxine and serine ameliorated the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1656 RAB11A Zornitza Stark gene: RAB11A was added
gene: RAB11A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB11A were set to 29100083
Phenotypes for gene: RAB11A were set to Intellectual disability; seizures
Review for gene: RAB11A was set to AMBER
Added comment: Five individuals reported with DNMs and neurodevelopmental phenotypes as part of this paper; however, clinical details are sparse. Emerging gene, phenotype not yet clearly delineated.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1654 DHPS Zornitza Stark gene: DHPS was added
gene: DHPS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: DHPS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DHPS were set to 30661771
Phenotypes for gene: DHPS were set to Neurodevelopmental disorder with seizures and speech and walking impairment, MIM#618480
Review for gene: DHPS was set to GREEN
gene: DHPS was marked as current diagnostic
Added comment: 5 individuals from 4 unrelated families with biallelic pathogenic variants in DHPS, note one variant is recurrent (c.518A>G or p.Asn173Ser). The phenotype consisted of DD/ID (5/5), tone abnormalities (hypotonia/hypertonia/spasticity - 5/5), seizures (5/5 - in one case though unclear staring spells) with EEG abnormalities (5/5). Additionally most individuals displayed behavioral issues, or some common facial features
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1652 DHDDS Zornitza Stark gene: DHDDS was added
gene: DHDDS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: DHDDS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DHDDS were set to 29100083
Phenotypes for gene: DHDDS were set to Developmental delay and seizures with or without movement abnormalities, MIM#617836
Review for gene: DHDDS was set to GREEN
gene: DHDDS was marked as current diagnostic
Added comment: Five unrelated individuals reported with mono-allelic variants and a neurodevelopmental phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1650 DEGS1 Zornitza Stark gene: DEGS1 was added
gene: DEGS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: DEGS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DEGS1 were set to 31186544; 30620337; 30620338
Phenotypes for gene: DEGS1 were set to Leukodystrophy hypomyelinating 18, MIM#618404
Review for gene: DEGS1 was set to GREEN
Added comment: Multiple affected families, DD/ID is part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1649 RBFOX1 Zornitza Stark Publications for gene: RBFOX1 were set to 24664471
Intellectual disability syndromic and non-syndromic v0.1648 RBFOX1 Zornitza Stark Publications for gene: RBFOX1 were set to
Intellectual disability syndromic and non-syndromic v0.1646 DDOST Zornitza Stark Publications for gene: DDOST were set to
Intellectual disability syndromic and non-syndromic v0.1641 MTHFS Zornitza Stark gene: MTHFS was added
gene: MTHFS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTHFS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MTHFS were set to 30031689; 31844630; 22303332
Phenotypes for gene: MTHFS were set to Neurodevelopmental disorder with microcephaly, epilepsy, and hypomyelination, 618367
Review for gene: MTHFS was set to GREEN
Added comment: Three unrelated individuals reported with supporting biochemical evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1639 CACNA1B Zornitza Stark gene: CACNA1B was added
gene: CACNA1B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: CACNA1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CACNA1B were set to 30982612
Phenotypes for gene: CACNA1B were set to Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements, MIM# 618497
Review for gene: CACNA1B was set to GREEN
Added comment: Three unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1637 CDH2 Zornitza Stark gene: CDH2 was added
gene: CDH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDH2 were set to 31585109
Phenotypes for gene: CDH2 were set to Intellectual disability; corpus callosum abnormalities; congenital abnormalities
Review for gene: CDH2 was set to GREEN
Added comment: Nine unrelated individuals reported with de novo variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1634 NTNG2 Zornitza Stark gene: NTNG2 was added
gene: NTNG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NTNG2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NTNG2 were set to 31668703
Phenotypes for gene: NTNG2 were set to Intellectual disability; autism; dysmorphic features
Review for gene: NTNG2 was set to GREEN
Added comment: 16 individuals from 7 unrelated families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1632 TUBGCP2 Zornitza Stark gene: TUBGCP2 was added
gene: TUBGCP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TUBGCP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TUBGCP2 were set to 31630790
Phenotypes for gene: TUBGCP2 were set to Lissencephaly; pachygyria; subcortical band heterotopia; microcephaly; intellectual disability
Review for gene: TUBGCP2 was set to GREEN
Added comment: Four unrelated families reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1630 TP73 Zornitza Stark gene: TP73 was added
gene: TP73 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TP73 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TP73 were set to 31130284
Phenotypes for gene: TP73 were set to Intellectual disability; lissencephaly
Review for gene: TP73 was set to AMBER
Added comment: Two unrelated families, no functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1628 SMG8 Zornitza Stark gene: SMG8 was added
gene: SMG8 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMG8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SMG8 were set to 31130284
Phenotypes for gene: SMG8 were set to Intellectual disability
Review for gene: SMG8 was set to AMBER
Added comment: Two unrelated families, no functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1626 IQSEC3 Zornitza Stark gene: IQSEC3 was added
gene: IQSEC3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IQSEC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IQSEC3 were set to 31130284
Phenotypes for gene: IQSEC3 were set to Intellectual disability
Review for gene: IQSEC3 was set to AMBER
Added comment: Two unrelated families, no functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1624 ICE1 Zornitza Stark gene: ICE1 was added
gene: ICE1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ICE1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ICE1 were set to 31130284
Phenotypes for gene: ICE1 were set to Intellectual disability, cerebral atrophy
Review for gene: ICE1 was set to AMBER
Added comment: Two unrelated families reported, no functional data; part of large consanguineous cohort, mixed phenotypes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1621 EIF2A Alison Yeung gene: EIF2A was added
gene: EIF2A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF2A were set to PMID: 31130284
Phenotypes for gene: EIF2A were set to Intellectual disability, epilepsy
Review for gene: EIF2A was set to AMBER
Added comment: two unrelated families reported, no functional data
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1619 KCNN3 Alison Yeung gene: KCNN3 was added
gene: KCNN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNN3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: KCNN3 were set to PMID: 31155282
Phenotypes for gene: KCNN3 were set to Zimmermann-Laband syndrome 3; OMIM# 618658
Review for gene: KCNN3 was set to GREEN
gene: KCNN3 was marked as current diagnostic
Added comment: Reported in three unrelated individuals
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1617 CTNND2 Zornitza Stark Publications for gene: CTNND2 were set to
Intellectual disability syndromic and non-syndromic v0.1614 IQSEC1 Zornitza Stark gene: IQSEC1 was added
gene: IQSEC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IQSEC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IQSEC1 were set to 31607425
Phenotypes for gene: IQSEC1 were set to Intellectual developmental disorder with short stature and behavioral abnormalities, MIM# 618687
Review for gene: IQSEC1 was set to GREEN
Added comment: Five individuals from two unrelated families reported, animal model data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1612 POLA1 Alison Yeung gene: POLA1 was added
gene: POLA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLA1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: POLA1 were set to PMID: 31006512
Phenotypes for gene: POLA1 were set to Van Esch-O'Driscoll syndrome OMIM# 301030
Review for gene: POLA1 was set to GREEN
gene: POLA1 was marked as current diagnostic
Added comment: Five unrelated families reported
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1609 GPC4 Alison Yeung gene: GPC4 was added
gene: GPC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GPC4 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: GPC4 were set to PMID: 30982611
Phenotypes for gene: GPC4 were set to Keipert syndrome OMIM# 301026
Review for gene: GPC4 was set to GREEN
gene: GPC4 was marked as current diagnostic
Added comment: >3 unrelated individuals reported, functional studies in mice
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1607 CARS Alison Yeung gene: CARS was added
gene: CARS was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CARS were set to PMID: 30824121
Phenotypes for gene: CARS were set to Intellectual disability; microcephaly; brittle hair and nails
Review for gene: CARS was set to GREEN
gene: CARS was marked as current diagnostic
Added comment: Three reported unrelated families
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1605 MAPK8IP3 Alison Yeung gene: MAPK8IP3 was added
gene: MAPK8IP3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAPK8IP3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAPK8IP3 were set to 30612693
Phenotypes for gene: MAPK8IP3 were set to Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431
Review for gene: MAPK8IP3 was set to GREEN
gene: MAPK8IP3 was marked as current diagnostic
Added comment: >3 reported individuals and functional evidence in Caenorhabditis elegans
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1602 NCAPG2 Alison Yeung gene: NCAPG2 was added
gene: NCAPG2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NCAPG2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NCAPG2 were set to 30609410
Phenotypes for gene: NCAPG2 were set to Khan-Khan-Katsanis syndrome, MIM# 618460
Review for gene: NCAPG2 was set to GREEN
Added comment: Two families and functional evidence (zebrafish model).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1600 RIC1 Zornitza Stark gene: RIC1 was added
gene: RIC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RIC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RIC1 were set to 31932796
Phenotypes for gene: RIC1 were set to Cleft lip; cataract; tooth abnormality; intellectual disability; facial dysmorphism; ADHD
Review for gene: RIC1 was set to AMBER
Added comment: Zebrafish model and consanguineous families but homozygous-by-descent.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1598 TET3 Zornitza Stark gene: TET3 was added
gene: TET3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TET3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: TET3 were set to 31928709
Phenotypes for gene: TET3 were set to Intellectual disability; dysmorphic features; abnormal growth; movement disorders
Review for gene: TET3 was set to GREEN
Added comment: Eleven individuals from 8 families described. Mono-allelic frameshift and nonsense variants occur throughout the coding region. Mono-allelic and bi-allelic missense variants localize to conserved residues; all but one such variant occur within the catalytic domain, and most display hypomorphic function in an assay of catalytic activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1592 HK1 Natasha Brown gene: HK1 was added
gene: HK1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: HK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HK1 were set to PMID: 30778173
Mode of pathogenicity for gene: HK1 was set to Other
Review for gene: HK1 was set to GREEN
Added comment: 7 patients from 6 unrelated families with denovo missense variants in the N-terminal half of HK1
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1590 SNORD118 Zornitza Stark Publications for gene: SNORD118 were set to
Intellectual disability syndromic and non-syndromic v0.1587 FARSB Zornitza Stark gene: FARSB was added
gene: FARSB was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: FARSB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FARSB were set to 29573043; 19161147; 29979980; 30014610
Phenotypes for gene: FARSB were set to Rajab syndrome, MIM#613658; interstitial lung disease; brain calcifications; microcephaly; intellectual disability
Review for gene: FARSB was set to GREEN
Added comment: 7 unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1584 CLCNKB Zornitza Stark Publications for gene: CLCNKB were set to
Intellectual disability syndromic and non-syndromic v0.1582 CLCNKA Zornitza Stark Publications for gene: CLCNKA were set to
Intellectual disability syndromic and non-syndromic v0.1579 COASY Zornitza Stark Publications for gene: COASY were set to 24360804; 30089828
Intellectual disability syndromic and non-syndromic v0.1578 COASY Zornitza Stark Publications for gene: COASY were set to
Intellectual disability syndromic and non-syndromic v0.1573 MAP1B Zornitza Stark Publications for gene: MAP1B were set to
Intellectual disability syndromic and non-syndromic v0.1570 MED17 Zornitza Stark Publications for gene: MED17 were set to
Intellectual disability syndromic and non-syndromic v0.1567 NDUFA2 Zornitza Stark Publications for gene: NDUFA2 were set to 18513682; 28857146
Intellectual disability syndromic and non-syndromic v0.1567 NDUFA2 Zornitza Stark Publications for gene: NDUFA2 were set to
Intellectual disability syndromic and non-syndromic v0.1565 NDUFAF1 Zornitza Stark Publications for gene: NDUFAF1 were set to
Intellectual disability syndromic and non-syndromic v0.1561 PIGG Zornitza Stark Publications for gene: PIGG were set to 26996948
Intellectual disability syndromic and non-syndromic v0.1559 PIGG Zornitza Stark Publications for gene: PIGG were set to
Intellectual disability syndromic and non-syndromic v0.1554 SEMA3E Zornitza Stark Publications for gene: SEMA3E were set to 15235037; 31691538; 31464029
Intellectual disability syndromic and non-syndromic v0.1553 SEMA3E Zornitza Stark Publications for gene: SEMA3E were set to
Intellectual disability syndromic and non-syndromic v0.1550 SMPD4 Zornitza Stark Publications for gene: SMPD4 were set to
Intellectual disability syndromic and non-syndromic v0.1548 TBCD Zornitza Stark Phenotypes for gene: TBCD were changed from Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193 to Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193
Intellectual disability syndromic and non-syndromic v0.1548 TBCD Zornitza Stark Phenotypes for gene: TBCD were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193
Intellectual disability syndromic and non-syndromic v0.1547 TBCD Zornitza Stark Publications for gene: TBCD were set to
Intellectual disability syndromic and non-syndromic v0.1544 ZSWIM6 Zornitza Stark Publications for gene: ZSWIM6 were set to
Intellectual disability syndromic and non-syndromic v0.1538 AGMO Zornitza Stark Publications for gene: AGMO were set to 31555905
Intellectual disability syndromic and non-syndromic v0.1536 AGMO Sue White gene: AGMO was added
gene: AGMO was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: AGMO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AGMO were set to 31555905
Phenotypes for gene: AGMO were set to microcephaly; intellectual disability; epilepsy
Penetrance for gene: AGMO were set to Complete
Review for gene: AGMO was set to GREEN
Added comment: biallelic missense and LOF variants reported
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1533 STAG2 Dean Phelan gene: STAG2 was added
gene: STAG2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: STAG2 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: STAG2 were set to 30765867; 28296084; 30447054; 29263825; 30158690
Added comment: 12 unrelated families reported both males and females affected (OMIM).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1532 FOXP1 Zornitza Stark Publications for gene: FOXP1 were set to
Intellectual disability syndromic and non-syndromic v0.1530 NUP214 Zornitza Stark Publications for gene: NUP214 were set to 31178128
Intellectual disability syndromic and non-syndromic v0.1528 EXTL3 Zornitza Stark Publications for gene: EXTL3 were set to
Intellectual disability syndromic and non-syndromic v0.1524 NUP214 Sue White gene: NUP214 was added
gene: NUP214 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: NUP214 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NUP214 were set to 31178128
Phenotypes for gene: NUP214 were set to epileptic encephalopathy; developmental regression; microcephaly
Penetrance for gene: NUP214 were set to Complete
Review for gene: NUP214 was set to GREEN
gene: NUP214 was marked as current diagnostic
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1522 AP2M1 Zornitza Stark gene: AP2M1 was added
gene: AP2M1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: AP2M1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AP2M1 were set to 31104773
Phenotypes for gene: AP2M1 were set to Intellectual developmental disorder 60 with seizures, MIM# 618587
Review for gene: AP2M1 was set to GREEN
Added comment: Four unrelated individuals reported, recurrent variant, NM_004068.3:c.508C>T or p.Arg170Trp.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1519 ASXL3 Zornitza Stark Publications for gene: ASXL3 were set to
Intellectual disability syndromic and non-syndromic v0.1516 WDFY3 Zornitza Stark Publications for gene: WDFY3 were set to
Intellectual disability syndromic and non-syndromic v0.1512 DNMT3A Zornitza Stark Publications for gene: DNMT3A were set to
Intellectual disability syndromic and non-syndromic v0.1510 SETD5 Zornitza Stark Marked gene: SETD5 as ready
Intellectual disability syndromic and non-syndromic v0.1510 SETD5 Zornitza Stark Gene: setd5 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.1510 SETD5 Zornitza Stark Phenotypes for gene: SETD5 were changed from to Intellectual disability, autosomal dominant 23 (MIM # 615761)
Intellectual disability syndromic and non-syndromic v0.1509 SETD5 Zornitza Stark Publications for gene: SETD5 were set to
Intellectual disability syndromic and non-syndromic v0.1508 SETD5 Zornitza Stark Mode of inheritance for gene: SETD5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.1507 SETD5 Ain Roesley reviewed gene: SETD5: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29484850; Phenotypes: Intellectual disability, autosomal dominant 23 (MIM # 615761); Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.1503 EDC3 Zornitza Stark gene: EDC3 was added
gene: EDC3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: EDC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EDC3 were set to 29685133; 25701870
Phenotypes for gene: EDC3 were set to Mental retardation, autosomal recessive 50, MIM# 616460
Review for gene: EDC3 was set to RED
Added comment: Single family reported; some functional data.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1501 PUS3 Zornitza Stark gene: PUS3 was added
gene: PUS3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: PUS3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PUS3 were set to 30308082; 28454995; 27055666; 30697592; 31444731
Phenotypes for gene: PUS3 were set to Mental retardation, autosomal recessive 55, MIM# 617051
Review for gene: PUS3 was set to GREEN
Added comment: Seven individuals from five families reported; two of the families had the same homozygous truncating variant. Variable features reported in addition to ID, including leukoencephalopathy, EE, and nephropathy.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1499 EIF3F Zornitza Stark gene: EIF3F was added
gene: EIF3F was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: EIF3F was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF3F were set to 30409806
Phenotypes for gene: EIF3F were set to Mental retardation, autosomal recessive 67, MIM# 618295
Review for gene: EIF3F was set to GREEN
Added comment: Nine individuals from 7 families reported, all homozygous for the same missense variant, p.(Phe232Val). This variant is present at 0.12% frequency in non-Finnish Europeans in gnomad (no homozygotes).
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1497 RUSC2 Zornitza Stark gene: RUSC2 was added
gene: RUSC2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: RUSC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RUSC2 were set to 27612186
Phenotypes for gene: RUSC2 were set to Mental retardation, autosomal recessive 61, MIM# 617773
Review for gene: RUSC2 was set to AMBER
Added comment: Two unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1495 RSRC1 Zornitza Stark gene: RSRC1 was added
gene: RSRC1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: RSRC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RSRC1 were set to 28640246; 29522154
Phenotypes for gene: RSRC1 were set to Intellectual developmental disorder, autosomal recessive 70, MIM# 618402
Review for gene: RSRC1 was set to AMBER
Added comment: Two unrelated families reported, 8 affected individuals.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1493 METTL5 Zornitza Stark gene: METTL5 was added
gene: METTL5 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: METTL5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: METTL5 were set to 29302074; 31564433
Phenotypes for gene: METTL5 were set to Intellectual developmental disorder, autosomal recessive 72, MIM# 618665
Review for gene: METTL5 was set to GREEN
Added comment: Three unrelated families and animal model.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1492 CXorf56 Zornitza Stark gene: CXorf56 was added
gene: CXorf56 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: CXorf56 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: CXorf56 were set to 29374277
Phenotypes for gene: CXorf56 were set to Mental retardation, X-linked 107, MIM# 301013
Review for gene: CXorf56 was set to RED
Added comment: Single multigenerational family reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1490 USP27X Zornitza Stark gene: USP27X was added
gene: USP27X was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: USP27X was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: USP27X were set to 25644381
Phenotypes for gene: USP27X were set to Mental retardation, X-linked 105, MIM#300984
Review for gene: USP27X was set to AMBER
Added comment: Four individuals from two unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1488 KLHL15 Zornitza Stark gene: KLHL15 was added
gene: KLHL15 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: KLHL15 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: KLHL15 were set to 25644381; 24817631
Phenotypes for gene: KLHL15 were set to Mental retardation, X-linked 103, MIM#300982
Review for gene: KLHL15 was set to AMBER
Added comment: Two families described: variants maternally inherited in both, one deletion, the other truncating.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1486 ODC1 Zornitza Stark gene: ODC1 was added
gene: ODC1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ODC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ODC1 were set to 30475435
Phenotypes for gene: ODC1 were set to Intellectual disability; macrocephaly; dysmorphism
Mode of pathogenicity for gene: ODC1 was set to Other
Review for gene: ODC1 was set to GREEN
Added comment: Four individuals with de novo GoF variants in this gene reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1484 RALA Zornitza Stark gene: RALA was added
gene: RALA was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: RALA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RALA were set to 30500825
Phenotypes for gene: RALA were set to Intellectual disability; short stature; dysmorphism
Review for gene: RALA was set to GREEN
Added comment: Ten individuals with de novo variants in this gene, six of these at two codons only: Val25 and Lys128.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1481 TRPM3 Zornitza Stark gene: TRPM3 was added
gene: TRPM3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: TRPM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRPM3 were set to 31278393
Phenotypes for gene: TRPM3 were set to Intellectual disability; epilepsy
Review for gene: TRPM3 was set to GREEN
Added comment: 8 unrelated individuals with de novo variants in this gene. Recurrent variant p.(Val837Met) identified in 7/8.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1478 NUS1 Zornitza Stark gene: NUS1 was added
gene: NUS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: NUS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NUS1 were set to 31656175; 29100083
Phenotypes for gene: NUS1 were set to Epilepsy; intellectual disability
Review for gene: NUS1 was set to GREEN
Added comment: Five individuals reported with de novo variants in this gene and epilepsy/ID phenotype (4 truncating variants and a small deletion).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1476 UGP2 Zornitza Stark gene: UGP2 was added
gene: UGP2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: UGP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGP2 were set to 31820119
Phenotypes for gene: UGP2 were set to Epileptic encephalopathy; intellectual disability; microcephaly
Review for gene: UGP2 was set to GREEN
Added comment: 22 individuals from 15 families reported with the same homozygous missense variant in this gene, chr2:64083454A > G, which causes a disruption of the start codon in the shorter isoform, which is expressed in brain.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1473 TRIM32 Zornitza Stark Publications for gene: TRIM32 were set to
Intellectual disability syndromic and non-syndromic v0.1469 XPNPEP3 Zornitza Stark Publications for gene: XPNPEP3 were set to
Intellectual disability syndromic and non-syndromic v0.1465 NTRK2 Zornitza Stark gene: NTRK2 was added
gene: NTRK2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: NTRK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NTRK2 were set to 15494731; 27884935; 29100083
Phenotypes for gene: NTRK2 were set to Obesity, hyperphagia, and developmental delay, MIM# 613886
Review for gene: NTRK2 was set to GREEN
Added comment: Three unrelated individuals reported with this phenotype.
Note recurrent missense in this gene also causes EE.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1463 GLS Zornitza Stark gene: GLS was added
gene: GLS was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: GLS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLS were set to 30970188
Phenotypes for gene: GLS were set to Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412
Review for gene: GLS was set to AMBER
Added comment: Three unrelated individuals described with compound het variants, however, note one of these is a triplet expansion in the 5' UTR, this may not be tractable depending on sequencing modality.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1462 PPP1R12A Zornitza Stark Publications for gene: PPP1R12A were set to
Intellectual disability syndromic and non-syndromic v0.1459 PUM1 Zornitza Stark Publications for gene: PUM1 were set to 29474920; 25768905
Intellectual disability syndromic and non-syndromic v0.1456 SHANK1 Zornitza Stark Publications for gene: SHANK1 were set to
Intellectual disability syndromic and non-syndromic v0.1453 AP1B1 Zornitza Stark gene: AP1B1 was added
gene: AP1B1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: AP1B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AP1B1 were set to 31630788; 31630791
Phenotypes for gene: AP1B1 were set to Intellectual disability; enteropathy; deafness; ichthyosis; keratoderma
Review for gene: AP1B1 was set to GREEN
Added comment: Four unrelated families with bi-allelic LoF variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1451 DMXL2 Zornitza Stark gene: DMXL2 was added
gene: DMXL2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: DMXL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DMXL2 were set to 31688942; 30237576
Phenotypes for gene: DMXL2 were set to Epileptic encephalopathy, early infantile, 81, MIM# 618663
Review for gene: DMXL2 was set to GREEN
Added comment: Four unrelated families reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1448 SLC5A6 Zornitza Stark gene: SLC5A6 was added
gene: SLC5A6 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SLC5A6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC5A6 were set to 31754459; 27904971
Phenotypes for gene: SLC5A6 were set to Developmental delay; epilepsy; neurodegeneration
Review for gene: SLC5A6 was set to GREEN
Added comment: Two unrelated families reported, functional data and some evidence of response to treatment.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1446 NUP188 Zornitza Stark Publications for gene: NUP188 were set to
Intellectual disability syndromic and non-syndromic v0.1442 CCDC88C Zornitza Stark Publications for gene: CCDC88C were set to
Intellectual disability syndromic and non-syndromic v0.1439 COQ5 Zornitza Stark Publications for gene: COQ5 were set to
Intellectual disability syndromic and non-syndromic v0.1435 MN1 Zornitza Stark gene: MN1 was added
gene: MN1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: MN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MN1 were set to 31834374; 31839203
Phenotypes for gene: MN1 were set to Intellectual disability; dysmophic features; rhombencephalosynapsis
Mode of pathogenicity for gene: MN1 was set to Other
Review for gene: MN1 was set to GREEN
Added comment: Over 20 individuals described with de novo truncating variants in this gene; these cluster in the C-terminal and the authors postulate that that syndrome is not due to MN1 haploinsufficiency but rather is the result of dominantly acting C-terminally truncated MN1 protein.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1433 EEF1B2 Zornitza Stark gene: EEF1B2 was added
gene: EEF1B2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: EEF1B2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EEF1B2 were set to 31845318; 21937992
Phenotypes for gene: EEF1B2 were set to Intellectual disability
Review for gene: EEF1B2 was set to AMBER
Added comment: 5 individuals from two unrelated families described in the literature so far, no functional data but gene belongs to a family implicated in neurodevelopmental disorders.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1431 CLCN4 Zornitza Stark Mode of inheritance for gene: CLCN4 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.1430 CLCN4 Zornitza Stark Publications for gene: CLCN4 were set to
Intellectual disability syndromic and non-syndromic v0.1429 CLCN4 Elizabeth Palmer reviewed gene: CLCN4: Rating: GREEN; Mode of pathogenicity: None; Publications: (PMID: 27550844); Phenotypes: intellectual disability, epilepsy, autistic features, mood disorders, cerebral white matter changes, progressive appendicular spasticity; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.1428 ATP1A1 Zornitza Stark gene: ATP1A1 was added
gene: ATP1A1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ATP1A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP1A1 were set to 30388404
Phenotypes for gene: ATP1A1 were set to Intellectual disability; seizures; hypomagnesaemia
Review for gene: ATP1A1 was set to GREEN
Added comment: Three infants with de novo missense variants in this gene; seizures persisted despite correction of magnesium, intellectual disability is part of the phenotype. Note gene is also linked to CMT and possibly HSP.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1426 TASP1 Zornitza Stark gene: TASP1 was added
gene: TASP1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: TASP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TASP1 were set to 31209944; 31350873
Phenotypes for gene: TASP1 were set to Developmental delay; microcephaly; dysmorphic features; congenital abnormalities
Review for gene: TASP1 was set to GREEN
Added comment: Four unrelated families reported; two with founder mutation. Protein interacts with KMT2A and KMT2D. Another infant with a de novo missense variant reported in a single infant with multiple congenital abnormalities, insufficient evidence for mono allelic disease at present.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1425 CACNA1G Chris Richmond reviewed gene: CACNA1G: Rating: ; Mode of pathogenicity: Other; Publications: 29878067, 31836334; Phenotypes: Spinocerebellar ataxia 42 [616795], Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits [618087], Infantile-Onset Syndromic Cerebellar Ataxia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Intellectual disability syndromic and non-syndromic v0.1423 HNRNPR Zornitza Stark gene: HNRNPR was added
gene: HNRNPR was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: HNRNPR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HNRNPR were set to 31079900
Phenotypes for gene: HNRNPR were set to Intellectual disability; seizures; dysmorphic features
Review for gene: HNRNPR was set to GREEN
Added comment: Four unrelated families with heterozygous variants in this gene and a neurodevelopmental phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1421 DSCAM Natasha Brown Publications for gene: DSCAM were set to
Intellectual disability syndromic and non-syndromic v0.1417 PPP1R12A Zornitza Stark gene: PPP1R12A was added
gene: PPP1R12A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Research
Mode of inheritance for gene: PPP1R12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PPP1R12A were set to Intellectual disability; holoprosencephaly; disorder of sex development
Added comment: Emerging evidence.
Sources: Research
Intellectual disability syndromic and non-syndromic v0.1415 ANKRD17 Zornitza Stark gene: ANKRD17 was added
gene: ANKRD17 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Research
Mode of inheritance for gene: ANKRD17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANKRD17 were set to Intellectual disability; dysmorphic features
Review for gene: ANKRD17 was set to AMBER
Added comment: Emerging evidence.
Sources: Research
Intellectual disability syndromic and non-syndromic v0.1412 ZFHX3 Zornitza Stark gene: ZFHX3 was added
gene: ZFHX3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Research
Mode of inheritance for gene: ZFHX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZFHX3 were set to Intellectual disability
Review for gene: ZFHX3 was set to GREEN
Added comment: Personal communication: Over 20 individuals with mostly de novo variants in this gene and mild ID/DD
Sources: Research
Intellectual disability syndromic and non-syndromic v0.1410 USP7 Natasha Brown gene: USP7 was added
gene: USP7 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: USP7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: USP7 were set to 30679821
Phenotypes for gene: USP7 were set to ID; Autism
Review for gene: USP7 was set to GREEN
Added comment: at least 16 individuals identified and 7 previous cases
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1408 SEC31A Tiong Tan gene: SEC31A was added
gene: SEC31A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SEC31A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SEC31A were set to 30464055
Phenotypes for gene: SEC31A were set to ?Neurodevelopmental disorder with spastic quadriplegia, optic atrophy, seizures, and structural brain anomalies, OMIM #618651
Review for gene: SEC31A was set to AMBER
Added comment: Single family with two affected sibs with functional data (drosophila)
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1406 SLC12A2 Zornitza Stark gene: SLC12A2 was added
gene: SLC12A2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SLC12A2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC12A2 were set to 30740830
Phenotypes for gene: SLC12A2 were set to Kilquist syndrome; deafness; intellectual disability; dysmorphic features; absent salivation
Review for gene: SLC12A2 was set to AMBER
Added comment: Single individual with bi-alllelic deletion described; mouse model recapitulated the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1405 POLD2 Zornitza Stark gene: POLD2 was added
gene: POLD2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: POLD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLD2 were set to 31449058
Phenotypes for gene: POLD2 were set to Intellectual disability; immunodeficiency
Review for gene: POLD2 was set to RED
Added comment: Single family, functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1404 POLD1 Zornitza Stark gene: POLD1 was added
gene: POLD1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: POLD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLD1 were set to 31449058
Phenotypes for gene: POLD1 were set to Intellectual disability; immunodeficiency
Review for gene: POLD1 was set to RED
Added comment: Single family reported with biallelic variants in this gene. Note heterozygous variants cause a different condition: Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, MIM#615381
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1400 TUBB Zornitza Stark Publications for gene: TUBB were set to
Intellectual disability syndromic and non-syndromic v0.1397 TENM3 Zornitza Stark gene: TENM3 was added
gene: TENM3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: TENM3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TENM3 were set to 30513139; 22766609; 27103084; 29753094
Phenotypes for gene: TENM3 were set to Microphthalmia, syndromic 15, MIM#615145; coloboma
Review for gene: TENM3 was set to GREEN
Added comment: At least four unrelated families described with syndromic microphthalmia and bi-allelic variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1396 SNRPE Zornitza Stark Publications for gene: SNRPE were set to
Intellectual disability syndromic and non-syndromic v0.1392 POLR2A Sue White gene: POLR2A was added
gene: POLR2A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: POLR2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: POLR2A were set to 31353023
Phenotypes for gene: POLR2A were set to Neurodevelopmental disorder with hypotonia and variable intellectual and behavioral abnormalities, MIM# 618603
Mode of pathogenicity for gene: POLR2A was set to Other
Review for gene: POLR2A was set to GREEN
Added comment: 11 unrelated individuals reported with de novo variants in this gene. Missense variants postulated to exert a dominant-negative effect; LoF variants by contrast resulted in milder phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1391 GNAI1 Zornitza Stark Publications for gene: GNAI1 were set to
Intellectual disability syndromic and non-syndromic v0.1379 ETS1 Zornitza Stark gene: ETS1 was added
gene: ETS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ETS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ETS1 were set to 31160359
Phenotypes for gene: ETS1 were set to Intellectual disability
Review for gene: ETS1 was set to RED
Added comment: Single individual with de novo truncating variant in this gene; gene is Jacobsen syndrome critical region.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1378 ELMOD1 Zornitza Stark gene: ELMOD1 was added
gene: ELMOD1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ELMOD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ELMOD1 were set to 31327155
Phenotypes for gene: ELMOD1 were set to Intellectual disability
Review for gene: ELMOD1 was set to RED
Added comment: Single family reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1376 EEF1D Zornitza Stark gene: EEF1D was added
gene: EEF1D was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: EEF1D was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EEF1D were set to 30787422; 28097321
Phenotypes for gene: EEF1D were set to Intellectual disability
Review for gene: EEF1D was set to AMBER
Added comment: Two unrelated families reported; one as part of a very large cohort of consanguineous families reporting multiple new candidate genes. No functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1374 DYNC1I2 Zornitza Stark gene: DYNC1I2 was added
gene: DYNC1I2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: DYNC1I2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DYNC1I2 were set to 31079899
Phenotypes for gene: DYNC1I2 were set to Neurodevelopmental disorder with microcephaly and structural brain anomalies , MIM#618492
Review for gene: DYNC1I2 was set to GREEN
Added comment: Five individuals from three unrelated families reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1373 DTYMK Zornitza Stark gene: DTYMK was added
gene: DTYMK was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: DTYMK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DTYMK were set to 31271740
Phenotypes for gene: DTYMK were set to Intellectual disability; microcephaly
Review for gene: DTYMK was set to RED
Added comment: Single family, two affected sibs with compound het variants reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1372 DNAJA1 Zornitza Stark gene: DNAJA1 was added
gene: DNAJA1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: DNAJA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAJA1 were set to 30972502
Phenotypes for gene: DNAJA1 were set to Intellectual disability; seizures
Review for gene: DNAJA1 was set to RED
Added comment: Single family with multiple affected individuals reported with bi-allelic truncating variant in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1370 DLL1 Zornitza Stark gene: DLL1 was added
gene: DLL1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: DLL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DLL1 were set to 31353024
Phenotypes for gene: DLL1 were set to Intellectual disability; autism; seizures; variable brain abnormalities; scoliosis
Review for gene: DLL1 was set to GREEN
Added comment: Fifteen individuals from 12 unrelated families reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1368 DDX6 Zornitza Stark gene: DDX6 was added
gene: DDX6 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: DDX6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DDX6 were set to 31422817,
Phenotypes for gene: DDX6 were set to Intellectual developmental disorder with impaired language and dysmorphic facies, MIM#618653
Review for gene: DDX6 was set to GREEN
Added comment: Five unrelated individuals reported with 5 different de novo heterozygous missense mutations in exon 11 of the DDX6 gene. All variants occurred at conserved residues in either the QxxR or V motifs within the second RecA-2 domain of the helicase core; this region is involved in RNA and/or ATP binding, suggesting functional consequences.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1366 CYFIP2 Zornitza Stark gene: CYFIP2 was added
gene: CYFIP2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: CYFIP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CYFIP2 were set to 29534297
Phenotypes for gene: CYFIP2 were set to Epileptic encephalopathy, early infantile, 65, MIM#618008
Review for gene: CYFIP2 was set to GREEN
Added comment: Four unrelated individuals with de novo variants in this gene. All variants affected the same highly conserved residue (arg87) in the DUF1394 domain.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1364 CSDE1 Zornitza Stark gene: CSDE1 was added
gene: CSDE1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: CSDE1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CSDE1 were set to 31579823
Phenotypes for gene: CSDE1 were set to Autism; intellectual disability; seizures; macrocephaly
Review for gene: CSDE1 was set to GREEN
Added comment: 18 families reported with high impact (stoppage/frameshift) variants in this gene. Eight de novo, eight inherited, two with undetermined inheritance. Functional data. Parents who had the variants were also affected, though generally more mildly.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1363 FAM160B1 Chirag Patel gene: FAM160B1 was added
gene: FAM160B1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: FAM160B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM160B1 were set to PMID: 31353455; 27431290
Phenotypes for gene: FAM160B1 were set to no OMIM number yet
Review for gene: FAM160B1 was set to RED
Added comment: 1 patient with severe ID, microcephaly, behavioral abnormalities, speech problems, mild ataxia and mild facial dysmorphism, and homozygous truncating variant in FAM160B1. No functional studies.

1 family with 2 sibs with DD, ID, speech issues, and with homozygous missense variant in FAM160B1. No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1363 FAM160B1 Chirag Patel gene: FAM160B1 was added
gene: FAM160B1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: FAM160B1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FAM160B1 were set to PMID: 31353455; 27431290
Phenotypes for gene: FAM160B1 were set to no OMIM number yet
Review for gene: FAM160B1 was set to RED
Added comment: 1 patient with severe ID, microcephaly, behavioral abnormalities, speech problems, mild ataxia and mild facial dysmorphism, and homozygous truncating variant in FAM160B1. No functional studies.

1 family with 2 sibs with DD, ID, speech issues, and with homozygous missense variant in FAM160B1. No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1361 FBXL3 Chirag Patel gene: FBXL3 was added
gene: FBXL3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: FBXL3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXL3 were set to PubMed: 30481285
Phenotypes for gene: FBXL3 were set to Intellectual developmental disorder with short stature, facial anomalies, and speech defects; OMIM #606220
Review for gene: FBXL3 was set to AMBER
Added comment: 3 unrelated families with 8 affected individuals with ID, DD, short stature and mild facial dysmorphism, and with homozygous mutations in FBXL3. Segregated with the disorder in all 3 families. Functional studies of the variants and studies of patient cells were not performed.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1360 CNTN6 Zornitza Stark gene: CNTN6 was added
gene: CNTN6 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: CNTN6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CNTN6 were set to 30836150; 28641109; 29983269
Phenotypes for gene: CNTN6 were set to Intellectual disability; autism; Tourette syndrome; schizophrenia
Review for gene: CNTN6 was set to RED
Added comment: Conflicting evidence based on CNV data, no SNVs identified.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1358 FRY Chirag Patel gene: FRY was added
gene: FRY was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: FRY was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FRY were set to PMID: 31487712; 27457812; 21937992
Phenotypes for gene: FRY were set to no OMIM number yet
Review for gene: FRY was set to AMBER
Added comment: 1 patient with ID/DD and a novel homozygous deletion involving FRY gene identified by genomic SNP microarray. No functional evidence.

2 consanguineous families with 6 affected individuals with ID, and homozygous mutations of FRY. No functional evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1357 CMAS Zornitza Stark gene: CMAS was added
gene: CMAS was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: CMAS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CMAS were set to 31495922
Phenotypes for gene: CMAS were set to Intellectual disability
Review for gene: CMAS was set to RED
Added comment: Single family, no functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1355 GABRA5 Chirag Patel gene: GABRA5 was added
gene: GABRA5 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: GABRA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABRA5 were set to PMID: 31056671; 29961870
Phenotypes for gene: GABRA5 were set to Epileptic encephalopathy, early infantile, 79; OMIM #618559
Review for gene: GABRA5 was set to GREEN
Added comment: 3 unrelated patients with de novo heterozygous missense mutations in GABRA5 gene. In vitro functional expression studies in HEK293 cells showed that the mutant subunit was expressed at the surface and incorporated into the channel, but the mutant channel was 10 times more sensitive to GABA compared to wildtype. This increased sensitization resulted in increased receptor desensitization to GABA, with a reduced maximal GABA-evoked current and impaired capacity to pass GABAergic chloride current.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1354 ADGRG6 Chirag Patel gene: ADGRG6 was added
gene: ADGRG6 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ADGRG6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADGRG6 were set to PMID: 30549416
Phenotypes for gene: ADGRG6 were set to Lethal congenital contracture syndrome 9; OMIM #616503
Review for gene: ADGRG6 was set to RED
Added comment: 1 family with 2 patients with profound ID, severe speech impairment, microcephaly, seizures, spasticity, and cerebellar hypoplasia, with homozygous missense variation in ADGRG6 (GPR126). No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1352 CDK8 Zornitza Stark gene: CDK8 was added
gene: CDK8 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: CDK8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDK8 were set to 30905399
Phenotypes for gene: CDK8 were set to Intellectual disability; dysmorphism; congenital abnormalities; seizures
Review for gene: CDK8 was set to GREEN
Added comment: 12 unrelated individuals, missense variants demonstrated as de novo in 10. All variants localize to the ATP-binding pocket of the kinase domain.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1350 GRIA2 Chirag Patel gene: GRIA2 was added
gene: GRIA2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: GRIA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GRIA2 were set to PMID: 31300657
Phenotypes for gene: GRIA2 were set to no OMIM number yet
Review for gene: GRIA2 was set to GREEN
Added comment: 28 unrelated patients with ID, ASD, Rett-like features, seizures/EE, and de novo heterozygous GRIA2 mutations. In functional expression studies, mutations led to a decrease in agonist-evoked current mediated by mutant subunits compared to wild-type channels. When GluA2 subunits are co-expressed with GluA1, most GRIA2 mutations cause a decreased current amplitude and some also affect voltage rectification.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1348 GTF2E2 Chirag Patel gene: GTF2E2 was added
gene: GTF2E2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: GTF2E2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF2E2 were set to PMID: 28973399
Phenotypes for gene: GTF2E2 were set to Trichothiodystrophy 6, nonphotosensitive; OMIM #616943
Review for gene: GTF2E2 was set to AMBER
Added comment: 2 unrelated non-photosensitive TTD families with homozygous missense mutation in GTF2E2. Functional evidence showing mutant TFIIEβ strongly reduces the total amount of the entire TFIIE complex, with a remarkable temperature-sensitive transcription defect, which strikingly correlates with the phenotypic aggravation of key clinical symptoms after episodes of high fever. Induced pluripotent stem cell reprogramming of patient fibroblasts followed by in vitro erythroid differentiation, showed a clear hematopoietic defect during late-stage differentiation associated with hemoglobin subunit imbalance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1346 KDM3B Chirag Patel gene: KDM3B was added
gene: KDM3B was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: KDM3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KDM3B were set to PMID: 30929739
Phenotypes for gene: KDM3B were set to no OMIM number yet
Review for gene: KDM3B was set to GREEN
Added comment: 14 unrelated individuals and 3 affected parents with varying degrees of ID, DD, short stature, dysmorphism, and de novo or inherited pathogenic variants in KDM3B. No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1344 LMAN2L Chirag Patel gene: LMAN2L was added
gene: LMAN2L was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: LMAN2L was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: LMAN2L were set to PMID: 31020005; 26566883
Phenotypes for gene: LMAN2L were set to ?Mental retardation, autosomal recessive, 52; OMIM #616887
Review for gene: LMAN2L was set to AMBER
Added comment: 1 consanguineous family with 7 individuals with ID and epilepsy, with homozygous LMAN2L missense mutation. Segregated with disease in family, and unaffected family members were heterozygous variant carriers. No functional studies.

1 non-consanguineous family with 4 affected with heterozygous frameshift LMAN2L mutation. Segregates in family. Mutation eliminates LMAN2L's endoplasmic reticulum retention signal and mislocalizes the protein from that compartment to the plasma membrane.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1343 LSM1 Chirag Patel gene: LSM1 was added
gene: LSM1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: LSM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LSM1 were set to PMID: 31010896
Phenotypes for gene: LSM1 were set to no OMIM number yet
Review for gene: LSM1 was set to RED
Added comment: 1 family with 2 siblings with global DD, multiple congenital anomalies, and abnormal eye movements, with homozygous splice variant in LSM1. Segregated with the phenotype in the family. Expression studies revealed absence of expression of the canonical isoform in the affected individuals. The Lsm1 knockout mice have a partially overlapping phenotype that affects the brain, heart, and eye.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1341 LSS Chirag Patel gene: LSS was added
gene: LSS was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: LSS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LSS were set to PMID: 30723320
Phenotypes for gene: LSS were set to Cataract 44, OMIM #616509; Hypotrichosis 14, OMIM #618275
Review for gene: LSS was set to GREEN
Added comment: Expanded the phenotypic spectrum of LSS to a recessive neuroectodermal syndrome formerly named alopecia with mental retardation (APMR) syndrome. Ten APMR individuals from 6 unrelated families with biallelic variants in LSS. Quantification of cholesterol and its precursors did not reveal noticeable imbalance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1340 MACROD2 Chirag Patel gene: MACROD2 was added
gene: MACROD2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: MACROD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MACROD2 were set to PMID: 31055587
Phenotypes for gene: MACROD2 were set to no OMIM number yet
Review for gene: MACROD2 was set to RED
Added comment: 1 family with a few affected with microcephaly, ID, dysmorphic features, and polydactyly. Deletion of chromosome 20p12.1 involving the MACROD2 gene was found in several members of the family. qRT-PCR showed higher levels of a MACROD2 mRNA isoform in the individuals carrying the deletion.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1338 MAST1 Chirag Patel gene: MAST1 was added
gene: MAST1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: MAST1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAST1 were set to PMID: 31721002; 30449657
Phenotypes for gene: MAST1 were set to Mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations; OMIM #618273
Review for gene: MAST1 was set to GREEN
Added comment: 6 unrelated patients with mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations (MCCCHCM) with de novo heterozygous mutations in MAST1 gene. In vitro functional studies showed that 1 of the variants (lys276del) increased MAST1 binding to microtubules compared to controls. Mutant mice heterozygous for a Mast1 leu278del allele showed a thicker corpus callosum compared to wildtype, and an overall reduction in cortical volume and thickness and decreased cerebellar volume and number of granule and Purkinje cells due to increased apoptosis compared to controls.

1 Emirati patient with ID, microcephaly, and dysmorphic features, with missense variant in MAST1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1337 MEPCE Chirag Patel gene: MEPCE was added
gene: MEPCE was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: MEPCE was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MEPCE were set to PMID: 31467394
Phenotypes for gene: MEPCE were set to no OMIM number yet
Review for gene: MEPCE was set to RED
Added comment: 1 patient with global DD and seizures with de novo MEPCE nonsense variant. mRNA and protein analyses identified nonsense-mediated mRNA decay to underlie the decreased amount of MEPCE in patient fibroblasts followed by LARP7 and 7SK snRNA downregulation and HEXIM1 upregulation. Flavopiridol treatment and ectopic MEPCE protein expression in patient fibroblasts rescued increased expression of six RNAP II-sensitive genes and suggested a possible repressive effect of MEPCE on P-TEFb-dependent transcription of specific genes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1335 NCAPD2 Chirag Patel gene: NCAPD2 was added
gene: NCAPD2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: NCAPD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NCAPD2 were set to PMID: 31056748; 27737959; 28097321
Phenotypes for gene: NCAPD2 were set to ?Microcephaly 21, primary, autosomal recessive; OMIM #617983
Review for gene: NCAPD2 was set to AMBER
Added comment: 1 family with 2 sibs with microcephaly and ID, and homozygous NCAPD2 mutation, which segregated with disease. No functional evidence.

1 family with 1 affected and homozygous NCAPD2 mutation, which segregated with disease. Patient fibroblasts showed impaired chromosome segregation and abnormal recovery from mitotic condensation compared to controls.

1 family with 2 sibs with microcephaly, growth retardation, and ID, and homozygous NCAPD2 mutation, which segregated with disease. Functional studies of the variants and studies of patient cells were not performed.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1333 NFASC Chirag Patel gene: NFASC was added
gene: NFASC was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: NFASC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NFASC were set to PMID: 31501903; 28940097; 30124836; 30850329; 31608123
Phenotypes for gene: NFASC were set to Neurodevelopmental disorder with central and peripheral motor dysfunction; OMIM #618356
Review for gene: NFASC was set to GREEN
Added comment: > 10 unrelated families reported, exhibiting a neurodevelopmental disorder (intellectual disability, developmental delay, motor impairment, speech difficulties, early onset demyelinating neuropathy), with homozygous variants in NFASC. Segregated with the disorder in the family. Some studies with functional evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1332 NLGN1 Chirag Patel gene: NLGN1 was added
gene: NLGN1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: NLGN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NLGN1 were set to PMID: 30460678
Phenotypes for gene: NLGN1 were set to no OMIM number yet
Review for gene: NLGN1 was set to RED
Added comment: homozygous variant in the NLGN1 gene found in a pair of monozygotic twin brothers with intellectual disability and autism. Segregated with disease. No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1330 P4HTM Chirag Patel gene: P4HTM was added
gene: P4HTM was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: P4HTM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: P4HTM were set to PMID: 25078763; 30940925
Phenotypes for gene: P4HTM were set to Hypotonia, hypoventilation, impaired intellectual development, dysautonomia, epilepsy, and eye abnormalities; OMIM #618493
Review for gene: P4HTM was set to GREEN
Added comment: 12 patients from 5 families with hypotonia, intellectual disability, and eye abnormalities, and homozygous or compound heterozygous pathogenic P4HTM gene variants. Segregated with the disorder in the families. In vitro functional expression studies of 3 of the P4HTM variants showed that they caused a significant decrease in the amount of soluble protein compared to wildtype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1328 PAK1 Chirag Patel gene: PAK1 was added
gene: PAK1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PAK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PAK1 were set to PMID: 31504246; 30290153
Phenotypes for gene: PAK1 were set to Intellectual developmental disorder with macrocephaly, seizures, and speech delay; OMIM #618158
Review for gene: PAK1 was set to GREEN
Added comment: 2 unrelated individuals with de novo PAK1 mutations, with developmental delay, secondary macrocephaly, seizures, and ataxic gait. Enhanced phosphorylation of the PAK1 targets JNK and AKT shown in fibroblasts of one subject and of c-JUN in those of both subjects compared with control subjects. In fibroblasts of the 2 affected individuals, they observed a trend toward enhanced PAK1 kinase activity. By using co-immunoprecipitation and size-exclusion chromatography, they observed a significantly reduced dimerization for both PAK1 mutants compared with wild-type PAK1.

4 unrelated individuals with intellectual disability, macrocephaly and seizures, with de novo heterozygous missense variants in PAK1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1326 PHF21A Chirag Patel gene: PHF21A was added
gene: PHF21A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PHF21A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PHF21A were set to PMID: 31649809; 30487643; 22770980
Phenotypes for gene: PHF21A were set to no OMIM number yet.
Review for gene: PHF21A was set to GREEN
Added comment: 9 cases with intellectual disability and craniofacial anomalies (Potocki-Shaffer syndrome), with de novo truncating variants in PHF21A. No functional evidence of variants, but PHF21A is highly expressed in the human fetal brain, which is consistent with the neurodevelopmental phenotype.

2 other unrelated individuals with translocations disrupting PHF21A. Lymphoblastoid cell lines from translocation subjects showed derepression of the neuronal gene SCN3A and reduced LSD1 occupancy at the SCN3A promoter, supporting a direct functional consequence of PHF21A haploinsufficiency on transcriptional regulation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1324 PIBF1 Chirag Patel gene: PIBF1 was added
gene: PIBF1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PIBF1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIBF1 were set to PubMed: 26167768; 30858804; 29695797
Phenotypes for gene: PIBF1 were set to Joubert syndrome 33; OMIM #617767
Review for gene: PIBF1 was set to GREEN
Added comment: 1 family of Schmiedeleut Hutterite descent with 2 affected brothers with Joubert syndrome had homozygous missense mutation in PIBF1 gene. Parents were heterozygous.

2 other Hutterite families with 3 affected children and same homozygous missense mutation in PIBF1 gene, suggesting a founder effect.

2 other unrelated individuals with compound heterozygous mutations in PIBF1 gene.

1 unrelated individual with compound heterozygous variants in PIBF1 gene, and functional evidence in the frog Xenopus.

1 unrelated individual with another homozygous missense mutation in PIBF1 gene, but no and functional evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1322 PIGB Chirag Patel gene: PIGB was added
gene: PIGB was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PIGB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGB were set to PubMed: 31256876
Phenotypes for gene: PIGB were set to Epileptic encephalopathy, early infantile, 80; OMIM #618580
Review for gene: PIGB was set to GREEN
Added comment: 10 unrelated families with biallelic mutations in PIGB, with global DD and/or ID, and seizures. Two had polymicrogyria, 4 had a peripheral neuropathy, and 2 had a clinical diagnosis of DOORS syndrome. Patient lymphocytes and fibroblasts showed variably decreased levels of cell surface GPI-anchored proteins, including CD16 and CD59. In vitro functional expression studies performed with some of the mutations in PIGB-null CHO cells showed that the mutant proteins were unable to fully restore expression of GPI-anchored surface proteins, consistent with a loss of function, although the mutations had variable effects.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1320 PIGU Chirag Patel gene: PIGU was added
gene: PIGU was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PIGU was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIGU were set to PMID: 31353022
Phenotypes for gene: PIGU were set to Glycosylphosphatidylinositol biosynthesis defect 21; OMIM #618590
Review for gene: PIGU was set to GREEN
Added comment: 5 patients from 3 unrelated families, with homozygous missense mutations in the PIGU gene. All individuals presented with global DD, severe-to-profound ID, muscular hypotonia, seizures, brain anomalies, scoliosis, and mild facial dysmorphism. Flow cytometric analysis of patient granulocytes showed a characteristic pattern, with reduced cell surface expression of CD16 and CD24. In addition, patient B cells showed increased expression of free GPI anchors determined by a specific antibody, T5. The findings suggested that PIGU mutations reduce the function of the GPI transamidase complex, leading to accumulation of free GPI anchors on the cell surface.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1317 PISD Chirag Patel changed review comment from: 4 individuals in 2 unrelated but consanguineous families from Portugal and Brazil affected by early-onset retinal degeneration, sensorineural hearing loss, microcephaly, intellectual disability, and skeletal dysplasia with scoliosis and short stature (Liberfarb syndrome). Affected individuals shared a homozygous 10-bp deletion immediately upstream of the last exon of the PISD gene. In HEK293T cells, this variant led to aberrant splicing of PISD transcripts.
Sources: Literature; to: 4 individuals in 2 unrelated but consanguineous families from Portugal and Brazil affected by early-onset retinal degeneration, sensorineural hearing loss, microcephaly, intellectual disability, and skeletal dysplasia with scoliosis and short stature (Liberfarb syndrome). Affected individuals shared a homozygous 10-bp deletion immediately upstream of the last exon of the PISD gene. In HEK293T cells, this variant led to aberrant splicing of PISD transcripts.

1 family with 2 sisters with congenital cataracts, short stature, and white matter changes identified compound heterozygous variants in the PISD gene. Decreased conversion of phosphatidylserine to PE in patient fibroblasts is consistent with impaired phosphatidylserine decarboxylase (PISD) enzyme activity.
Intellectual disability syndromic and non-syndromic v0.1317 PISD Chirag Patel gene: PISD was added
gene: PISD was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PISD was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PISD were set to PMID: 31263216
Phenotypes for gene: PISD were set to no OMIM number yet.
Review for gene: PISD was set to AMBER
Added comment: 4 individuals in 2 unrelated but consanguineous families from Portugal and Brazil affected by early-onset retinal degeneration, sensorineural hearing loss, microcephaly, intellectual disability, and skeletal dysplasia with scoliosis and short stature (Liberfarb syndrome). Affected individuals shared a homozygous 10-bp deletion immediately upstream of the last exon of the PISD gene. In HEK293T cells, this variant led to aberrant splicing of PISD transcripts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1315 POU3F3 Chirag Patel gene: POU3F3 was added
gene: POU3F3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: POU3F3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: POU3F3 were set to PMID: 24550763; 31303265
Phenotypes for gene: POU3F3 were set to no OMIM number yet.
Review for gene: POU3F3 was set to GREEN
Added comment: 19 individuals with DD/ID/speech issues and heterozygous POU3F3 disruptions, most of which were de novo variants. Positive functional cell-based analyses of pathogenic variants.

1 patient reported with whole gene deletion and ID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1313 PPP2CA Chirag Patel gene: PPP2CA was added
gene: PPP2CA was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PPP2CA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2CA were set to PMID: 30595372
Phenotypes for gene: PPP2CA were set to Neurodevelopmental disorder and language delay with or without structural brain abnormalities; OMIM #618354
Review for gene: PPP2CA was set to GREEN
Added comment: 15 unrelated patients with a neurodevelopmental disorder with de novo heterozygous PPP2CA mutations, and 1 with partial deletion of PPP2CA. Functional studies showed complete PP2A dysfunction in 4 individuals with seemingly milder ID, hinting at haploinsufficiency. Ten other individuals showed mutation-specific biochemical distortions, including poor expression, altered binding to the A subunit and specific B-type subunits, and impaired phosphatase activity and C-terminal methylation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1311 PUS7 Chirag Patel gene: PUS7 was added
gene: PUS7 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PUS7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PUS7 were set to PMID: 30526862; 30778726; 31583274
Phenotypes for gene: PUS7 were set to Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature; OMIM #618342
Review for gene: PUS7 was set to GREEN
Added comment: 11 patients from 6 families with ID, speech delay, short stature, microcephaly, and aggressive behavior, with homozygous PUS7 mutations, which segregated with disease.

One study showed disease-related variants lead to abolishment of PUS7 activity on both tRNA and mRNA substrates. pus7 knockout in Drosophila melanogaster results in a number of behavioral defects, including increased activity, disorientation, and aggressiveness supporting that neurological defects are caused by PUS7 variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1309 RNF113A Chirag Patel gene: RNF113A was added
gene: RNF113A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: RNF113A was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: RNF113A were set to PMID: 25612912; 31793730
Phenotypes for gene: RNF113A were set to ?Trichothiodystrophy 5, nonphotosensitive; OMIM #300953
Review for gene: RNF113A was set to AMBER
Added comment: 1 family of 2 male cousins with IUGR, progressive microcephaly, profound ID, genital anomalies, and severe linear growth failure, and nonsense Q301X mutation in RNF113A gene. Segregated with disease in the family. The mutation markedly reduced RNF113A protein expression in extracts from lymphoblastoid cell lines derived from the affected individuals.

2 fetuses affected with abnormalities similar to previous report, with the same nonsense Q301X mutation in RNF113A gene (can not access paper to see if from same family or functional evidence).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1307 SCAMP5 Chirag Patel gene: SCAMP5 was added
gene: SCAMP5 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SCAMP5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SCAMP5 were set to PMID: 31439720
Phenotypes for gene: SCAMP5 were set to no OMIM number yet
Review for gene: SCAMP5 was set to AMBER
Added comment: 2 unrelated individuals with ASD, ID and seizures, with the same heterozygous de novo variant in SCAMP5 (p.Gly302Trp). Western blot analysis of proteins overexpressed in the Drosophila fat body showed strongly reduced levels of the SCAMP p.Gly302Trp protein compared with the wild-type protein, indicating that the mutant either reduced expression or increased turnover of the protein. The expression of the fly homologue of the human SCAMP5 p.Gly180Trp mutation caused similar eye and neuronal phenotypes as the expression of SCAMP RNAi, suggesting a dominant-negative effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1305 SCAPER Chirag Patel gene: SCAPER was added
gene: SCAPER was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SCAPER was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCAPER were set to PMID: 28794130; 31069901; 31192531; 30723319
Phenotypes for gene: SCAPER were set to Intellectual developmental disorder and retinitis pigmentosa; OMIM #618195
Review for gene: SCAPER was set to GREEN
Added comment: 28 patients from 14 unrelated families with ID and retinitis pigmentosa (some with BBS phenotype), and homozygous or compound heterozygous mutations in SCAPER gene. No functional evidence of specific variants.

Analyses of SCAPER expression in human and mouse brain revealed an upregulation of SCAPER expression during cortical development and a higher expression of SCAPER in neurons compared to neural progenitors.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1303 BRSK2 Zornitza Stark gene: BRSK2 was added
gene: BRSK2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: BRSK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BRSK2 were set to 30879638
Phenotypes for gene: BRSK2 were set to Intellectual disability; autism
Review for gene: BRSK2 was set to GREEN
Added comment: Nine unrelated individuals with heterozygous variants in this gene; six confirmed de novo (parents available).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1301 SEMA5A Chirag Patel gene: SEMA5A was added
gene: SEMA5A was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SEMA5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SEMA5A were set to PMID: 26395558
Phenotypes for gene: SEMA5A were set to no OMIM number yet
Review for gene: SEMA5A was set to AMBER
Added comment: 1 patient with de novo translocation t(5;22)(p15.3;q11.21) and ASD and ID. At the translocation breakpoint on chromosome 5, they observed a 861-kb deletion encompassing the end of the SEMA5A gene. No functional studies.

2 patients with ASD and predicted deleterious heterozygous variants (maternally inherited). No functional studies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1299 BCORL1 Zornitza Stark gene: BCORL1 was added
gene: BCORL1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: BCORL1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: BCORL1 were set to 24123876; 30941876
Phenotypes for gene: BCORL1 were set to Shukla-Vernon syndrome, MIM#301029
Review for gene: BCORL1 was set to GREEN
Added comment: Four unrelated families reported altogether; some mothers mildly affected.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1298 SMARCC2 Chirag Patel gene: SMARCC2 was added
gene: SMARCC2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SMARCC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCC2 were set to PMID: 30580808
Phenotypes for gene: SMARCC2 were set to Coffin-Siris syndrome 8; OMIM #618362
Review for gene: SMARCC2 was set to GREEN
Added comment: 15 individuals with variable degrees of neurodevelopmental delay, growth retardation, prominent speech impairment, hypotonia, feeding difficulties, behavioral abnormalities, and dysmorphic features. They found heterozygous de novo SMARCC2 variants, but no functional evidence of specific variants. Transcriptomic analysis of fibroblasts from affected individuals highlighted a group of differentially expressed genes with possible roles in regulation of neuronal development and function, namely H19, SCRG1, RELN, and CACNB4.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1296 SMARCD1 Chirag Patel gene: SMARCD1 was added
gene: SMARCD1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SMARCD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCD1 were set to PMID: 30879640
Phenotypes for gene: SMARCD1 were set to no OMIM number yet
Review for gene: SMARCD1 was set to GREEN
Added comment: 5 individuals with heterozygous SMARCD1 variants (4 de novo, 1 unk), and developmental delay, intellectual disability, hypotonia, feeding difficulties, dysmorphisms, and small hands and feet. No functional evidence of some variants was not conclusive with immunoblot or co-immunoprecipitation studies. Targeted knockdown of Drosophila ortholog Bap60 in the mushroom body of adult flies causes defects in long-term memory. Mushroom-body-specific transcriptome analysis revealed that Bap60 is required for context-dependent expression of genes involved in neuron function and development in juvenile flies when synaptic connections are actively being formed in response to experience. T
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1294 BCL11B Zornitza Stark gene: BCL11B was added
gene: BCL11B was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: BCL11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BCL11B were set to 29985992
Phenotypes for gene: BCL11B were set to Intellectual developmental disorder with dysmorphic facies, speech delay, and T-cell abnormalities, MIM# 618092
Review for gene: BCL11B was set to GREEN
Added comment: Nine unrelated individuals, all but one with de novo variants in this gene and syndromic ID/immunodeficiency. Most variants located in the last exon (exon 4) and are predicted to escape nonsense-mediated mRNA decay.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1293 SNRPE Chirag Patel gene: SNRPE was added
gene: SNRPE was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SNRPE was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SNRPE were set to Hypotrichosis 11; OMIM #615059
Review for gene: SNRPE was set to AMBER
Added comment: 1 patient with de novo heterozygous missense SNRPE mutation, with non-syndromic primary microcephaly and intellectual disability. SNRPE encodes SmE and they showed that the microcephaly-linked SmE variant is unable to interact with the SMN complex and as a consequence fails to assemble into U snRNPs. This results in widespread mRNA splicing alterations in fibroblast cells derived from this patient. Similar alterations were observed in HEK293 cells upon SmE depletion that could be rescued by the expression of wild type but not mutant SmE. Depletion of SmE in zebrafish causes aberrant mRNA splicing alterations and reduced brain size, reminiscent of the patient microcephaly phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1291 SOX4 Chirag Patel gene: SOX4 was added
gene: SOX4 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SOX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SOX4 were set to PMID: 30661772
Phenotypes for gene: SOX4 were set to Coffin-Siris syndrome 10; OMIM #618506
Review for gene: SOX4 was set to GREEN
Added comment: 4 patients with syndromic DD/ID and de novo mutations in SOX4 gene. Functional assays demonstrated that the SOX4 proteins carrying these variants were unable to bind DNA in vitro and transactivate SOX reporter genes in cultured cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1289 SVBP Chirag Patel gene: SVBP was added
gene: SVBP was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: SVBP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SVBP were set to PMID: 31363758; 30607023
Phenotypes for gene: SVBP were set to Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly; OMIM #618569
Review for gene: SVBP was set to GREEN
Added comment: 5 unrelated families with homozygous mutations in SVBP. The mutations segregated with the disorder in all families. In vitro functional cellular expression studies showed that protein levels of the SVBP mutants were barely detectable, suggesting instability, and that the mutant proteins had lost VASH/SVBP catalytic detyrosination activity toward tubulin. Knockdown of about 50% Svbp expression using shRNA in rat hippocampal neurons impaired the formation of excitatory synapses compared to controls.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1287 TANC2 Chirag Patel gene: TANC2 was added
gene: TANC2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: TANC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TANC2 were set to PMID: 31616000
Phenotypes for gene: TANC2 were set to no OMIM number yet
Review for gene: TANC2 was set to GREEN
Added comment: 19 families with potentially disruptive heterozygous TANC2 variants, including 16 likely gene-disrupting mutations and three intragenic microdeletions. Patients presented with autism, intellectual disability, delayed language and motor development, epilepsy, facial dysmorphism, with complex psychiatric dysfunction or behavioral problems in adult probands or carrier parents. No functional evidence of specific variants, but they show TANC2 is expressed broadly in the human developing brain, especially in excitatory neurons and glial cells, and shows a more restricted pattern in Drosophila glial cells where its disruption affects behavioral outcomes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1285 ATN1 Zornitza Stark gene: ATN1 was added
gene: ATN1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ATN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATN1 were set to 30827498
Phenotypes for gene: ATN1 were set to Congenital hypotonia, epilepsy, developmental delay, and digital anomalies, MIM#618494
Review for gene: ATN1 was set to GREEN
Added comment: Eight unrelated individuals with de novo heterozygous variants in this gene and syndromic ID; all variants result in substitutions within the highly conserved 16-amino acid histidine-rich 'HX repeat' motif near the C terminus.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1283 TARS Chirag Patel gene: TARS was added
gene: TARS was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: TARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TARS were set to PMID: 31374204
Phenotypes for gene: TARS were set to Trichothiodystrophy 7, nonphotosensitive; OMIM #618546
Review for gene: TARS was set to AMBER
Added comment: Clinical features of trichothiodystrophy (TTD) include ichthyosis, intellectual disability, decreased fertility, short stature.

2 unrelated patients with non-photosensitive-TTD, in whom limited clinical information was available (one with DD): one compound heterozygous TARS variants, second homozygous for TARS variant. They showed that the variants had a profound effect on TARS protein stability and enzymatic function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1281 TEMN3-AS1 Chirag Patel gene: TEMN3-AS1 was added
gene: TEMN3-AS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: TEMN3-AS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TEMN3-AS1 were set to PubMed: 27103084; 30513139; 30513139
Phenotypes for gene: TEMN3-AS1 were set to ?Microphthalmia, isolated, with coloboma 9, OMIM #615145; Microphthalmia, syndromic 15, OMIM #615145
Review for gene: TEMN3-AS1 was set to AMBER
Added comment: 3 unrelated families, but no functional evidence.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1279 APC2 Zornitza Stark gene: APC2 was added
gene: APC2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: APC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: APC2 were set to 31585108
Phenotypes for gene: APC2 were set to Cortical dysplasia, complex, with other brain malformations 10, MIM#618677
Review for gene: APC2 was set to GREEN
Added comment: 12 individuals from 8 unrelated families; intellectual disability, seizures, cortical dysplasia including posterior to anterior predominant pattern of lissencephaly, heterotopias, paucity of white matter, thin corpus callosum.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1277 VAMP2 Chirag Patel gene: VAMP2 was added
gene: VAMP2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: VAMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: VAMP2 were set to PMID: 30929742
Phenotypes for gene: VAMP2 were set to no OMIM number yet
Review for gene: VAMP2 was set to GREEN
Added comment: 5 unrelated patients with heterozygous de novo mutations in VAMP2, presenting with a neurodevelopmental disorder characterized by axial hypotonia, intellectual disability, and autistic features. Affected individuals carrying de novo non-synonymous variants involving the C-terminal region presented a more severe phenotype with additional neurological features, including central visual impairment, hyperkinetic movement disorder, and epilepsy or electroencephalography abnormalities. Reconstituted fusion involving a lipid-mixing assay indicated impairment in vesicle fusion as one of the possible associated disease mechanisms.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1275 ZMIZ1 Chirag Patel gene: ZMIZ1 was added
gene: ZMIZ1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ZMIZ1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZMIZ1 were set to PubMed: 30639322
Phenotypes for gene: ZMIZ1 were set to Neurodevelopmental disorder with dysmorphic facies and distal skeletal anomalies; OMIM #618659
Review for gene: ZMIZ1 was set to GREEN
Added comment: 28 families with spectrum of neurodevelopmental features (including ID, ASD, and ADHD) due to de novo ZNF292 variants (1 family inherited). No functional evidence of specific variants, but ZNF292 is highly expressed in the developing human brain.


14 unrelated patients with neurodevelopmental disorder with dysmorphic facies and distal skeletal anomalies, and de novo heterozygous mutations in the ZMIZ1 gene. Transfection of 3 variants (T300M, c.3112dupA, and K91R) into HEK293T cells resulted in decreased induction of luciferase activity compared to wildtype (although the change for K91R was not statistically significant), suggesting impaired coactivation activity of the mutant proteins. Electroporation of these 3 mutants into progenitor cells in the ventricular zone of embryonic mice cortices resulted in defective neuronal migration to the cortex, as well as morphologic abnormalities of the neurons manifest as rounded cells with aberrantly oriented processes. These findings suggested that the ZMIZ1 mutations disrupted proper neuronal polarization and neuronal migration in the developing cortex. Functional studies of the other variants and additional studies of patient cells were not performed.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1273 ZNF292 Chirag Patel gene: ZNF292 was added
gene: ZNF292 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ZNF292 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF292 were set to PMID: 31723249
Phenotypes for gene: ZNF292 were set to no OMIM number yet
Review for gene: ZNF292 was set to GREEN
Added comment: 28 families with spectrum of neurodevelopmental features (including ID, ASD, and ADHD) due to de novo ZNF292 variants (1 family inherited). No functional evidence of specific variants, but ZNF292 is highly expressed in the developing human brain.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1271 ALKBH8 Zornitza Stark gene: ALKBH8 was added
gene: ALKBH8 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ALKBH8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALKBH8 were set to 31079898
Phenotypes for gene: ALKBH8 were set to Intellectual developmental disorder, autosomal recessive 71, MIM#618504
Review for gene: ALKBH8 was set to GREEN
Added comment: Two families and functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1270 ADGRB3 Zornitza Stark gene: ADGRB3 was added
gene: ADGRB3 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ADGRB3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADGRB3 were set to 30659260; 18628273
Phenotypes for gene: ADGRB3 were set to Intellectual disability
Review for gene: ADGRB3 was set to RED
Added comment: Single family with intragenic bi-allelic duplications and ID reported; association studies with schizophrenia.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1268 ACTL6B Zornitza Stark gene: ACTL6B was added
gene: ACTL6B was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: ACTL6B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ACTL6B were set to 31134736; 31031012; 30656450; 30237576
Phenotypes for gene: ACTL6B were set to Epileptic encephalopathy, early infantile, 76, MIM# 618468; Intellectual developmental disorder with severe speech and ambulation defects, MIM# 618470
Review for gene: ACTL6B was set to GREEN
Added comment: Multiple affected individuals reported, main phenotype is ID/EE.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1263 STT3A Zornitza Stark Publications for gene: STT3A were set to PMID: 23842455
Intellectual disability syndromic and non-syndromic v0.1259 ZMYM3 Zornitza Stark Publications for gene: ZMYM3 were set to
Intellectual disability syndromic and non-syndromic v0.1258 ZNF41 Zornitza Stark Publications for gene: ZNF41 were set to
Intellectual disability syndromic and non-syndromic v0.1257 ZNF674 Zornitza Stark Publications for gene: ZNF674 were set to
Intellectual disability syndromic and non-syndromic v0.1256 MEGF8 Zornitza Stark Publications for gene: MEGF8 were set to
Intellectual disability syndromic and non-syndromic v0.1253 TTI1 Zornitza Stark gene: TTI1 was added
gene: TTI1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: TTI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTI1 were set to 26539891; 30315573
Phenotypes for gene: TTI1 were set to intellectual disability; seizures; cerebellar atrophy
Review for gene: TTI1 was set to AMBER
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1232 SLC25A19 Zornitza Stark Publications for gene: SLC25A19 were set to
Intellectual disability syndromic and non-syndromic v0.1227 SNAP25 Chirag Patel gene: SNAP25 was added
gene: SNAP25 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: SNAP25 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SNAP25 were set to PMID: 25003006; 29100083; 28135719
Phenotypes for gene: SNAP25 were set to ?Myasthenic syndrome, congenital, 18; OMIM #616330
Review for gene: SNAP25 was set to GREEN
Added comment: ID neurodevelopmental disorder rather than muscle disorder, so OMIM entry needs to be edited.
> 5 patients reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1226 SLC25A13 Zornitza Stark Phenotypes for gene: SLC25A13 were changed from to Citrullinemia, type II, neonatal-onset, MIM#605814
Intellectual disability syndromic and non-syndromic v0.1223 SLC25A13 Zornitza Stark reviewed gene: SLC25A13: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Citrullinemia, type II, neonatal-onset, MIM#605814; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.1175 SUZ12 Chirag Patel gene: SUZ12 was added
gene: SUZ12 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: SUZ12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SUZ12 were set to PMID: 31736240; 30019515; 28229514
Phenotypes for gene: SUZ12 were set to no OMIM number yet.
Review for gene: SUZ12 was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1173 SYT1 Chirag Patel gene: SYT1 was added
gene: SYT1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: SYT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SYT1 were set to PubMed: 30107533
Phenotypes for gene: SYT1 were set to Baker-Gordon syndrome; OMIM #618218
Review for gene: SYT1 was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1169 SFXN4 Zornitza Stark Publications for gene: SFXN4 were set to
Intellectual disability syndromic and non-syndromic v0.1163 SEPSECS Zornitza Stark Publications for gene: SEPSECS were set to
Intellectual disability syndromic and non-syndromic v0.1158 SELENOI Zornitza Stark gene: SELENOI was added
gene: SELENOI was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: SELENOI was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SELENOI were set to 28052917
Phenotypes for gene: SELENOI were set to developmental delay; spasticity; periventricular white mater abnormalities; peripheral neuropathy; seizures; bifid uvula in some affected individuals; microcephaly
Review for gene: SELENOI was set to RED
Added comment: Single family only, four sibs, supportive biochemical evidence. Borderline amber/red gene, only mild ID described, seems to be more of a progressive neurometabolic condition based on limited evidence.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1121 SBF1 Zornitza Stark Publications for gene: SBF1 were set to
Intellectual disability syndromic and non-syndromic v0.1118 SBDS Zornitza Stark Publications for gene: SBDS were set to
Intellectual disability syndromic and non-syndromic v0.1114 SARS2 Zornitza Stark Publications for gene: SARS2 were set to
Intellectual disability syndromic and non-syndromic v0.1108 RUBCN Zornitza Stark Publications for gene: RUBCN were set to
Intellectual disability syndromic and non-syndromic v0.1105 RTN4IP1 Zornitza Stark Publications for gene: RTN4IP1 were set to
Intellectual disability syndromic and non-syndromic v0.1093 RORA Zornitza Stark gene: RORA was added
gene: RORA was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: RORA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RORA were set to 29656859
Phenotypes for gene: RORA were set to Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, MIM#618060
Mode of pathogenicity for gene: RORA was set to Other
Review for gene: RORA was set to GREEN
Added comment: Eleven unrelated individuals with de novo variants in this gene; postulated that some variants exert dominant-negative effect resulting in a more severe phenotype than the LoF variants.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1083 RHOBTB2 Zornitza Stark gene: RHOBTB2 was added
gene: RHOBTB2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: RHOBTB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RHOBTB2 were set to 29768694; 29276004
Phenotypes for gene: RHOBTB2 were set to Epileptic encephalopathy, early infantile, 64, MIM#618004
Review for gene: RHOBTB2 was set to GREEN
Added comment: 13 individuals from unrelated families reported in the literature in 2018 with de novo variants in this gene and ID/EE.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1072 RBPJ Zornitza Stark Publications for gene: RBPJ were set to
Intellectual disability syndromic and non-syndromic v0.1061 TRAF7 Chirag Patel gene: TRAF7 was added
gene: TRAF7 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: TRAF7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRAF7 were set to PMID: 29961569
Phenotypes for gene: TRAF7 were set to Cardiac, facial, and digital anomalies with developmental delay; OMIM #618164
Intellectual disability syndromic and non-syndromic v0.1057 RBM28 Zornitza Stark Publications for gene: RBM28 were set to
Intellectual disability syndromic and non-syndromic v0.1047 RAC3 Zornitza Stark Publications for gene: RAC3 were set to
Intellectual disability syndromic and non-syndromic v0.1044 RAB40AL Zornitza Stark Publications for gene: RAB40AL were set to
Intellectual disability syndromic and non-syndromic v0.1034 PUM1 Zornitza Stark Publications for gene: PUM1 were set to
Intellectual disability syndromic and non-syndromic v0.1022 PRR12 Zornitza Stark gene: PRR12 was added
gene: PRR12 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PRR12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRR12 were set to 29556724
Review for gene: PRR12 was set to GREEN
Added comment: Three unrelated individuals reported with de novo LoF variants; in addition, another individual with translocation disrupting gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.1014 PRKDC Zornitza Stark Publications for gene: PRKDC were set to
Intellectual disability syndromic and non-syndromic v0.1003 PREPL Zornitza Stark Publications for gene: PREPL were set to
Intellectual disability syndromic and non-syndromic v0.999 PRDM8 Zornitza Stark Publications for gene: PRDM8 were set to
Intellectual disability syndromic and non-syndromic v0.995 PPP1R21 Zornitza Stark gene: PPP1R21 was added
gene: PPP1R21 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: PPP1R21 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPP1R21 were set to 30520571
Phenotypes for gene: PPP1R21 were set to Hypotonia; intellectual disability; white matter abnormalities
Review for gene: PPP1R21 was set to GREEN
Added comment: At least four unrelated families reported with bi-allelic variants in this gene.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.990 PPM1K Zornitza Stark Publications for gene: PPM1K were set to
Intellectual disability syndromic and non-syndromic v0.974 PLOD3 Zornitza Stark Publications for gene: PLOD3 were set to 18834968; 31129566
Intellectual disability syndromic and non-syndromic v0.972 PLOD3 Zornitza Stark Publications for gene: PLOD3 were set to
Intellectual disability syndromic and non-syndromic v0.968 PINK1 Zornitza Stark Phenotypes for gene: PINK1 were changed from to Parkinson disease 6, early onset, MIM#605909
Intellectual disability syndromic and non-syndromic v0.965 PINK1 Zornitza Stark reviewed gene: PINK1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 6, early onset, MIM#605909; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.956 PHKA2 Zornitza Stark Mode of inheritance for gene: PHKA2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.954 PHKA2 Zornitza Stark reviewed gene: PHKA2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Glycogen storage disease, type IXa1, MIM#306000; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.953 PHIP Zornitza Stark gene: PHIP was added
gene: PHIP was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert list
Mode of inheritance for gene: PHIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PHIP were set to 29209020; 27900362; 23033978
Phenotypes for gene: PHIP were set to Chung-Jansen syndrome, MIM#617991
Review for gene: PHIP was set to GREEN
Added comment: Recent large case series describing 20 individuals; variable expressivity, some inherited from mildly affected parents, most de novo.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.951 PHC1 Zornitza Stark Publications for gene: PHC1 were set to
Intellectual disability syndromic and non-syndromic v0.947 PDP1 Zornitza Stark Publications for gene: PDP1 were set to
Intellectual disability syndromic and non-syndromic v0.944 PDHB Zornitza Stark Publications for gene: PDHB were set to
Intellectual disability syndromic and non-syndromic v0.939 PDE6D Zornitza Stark Publications for gene: PDE6D were set to
Intellectual disability syndromic and non-syndromic v0.933 OXR1 Zornitza Stark gene: OXR1 was added
gene: OXR1 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: OXR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OXR1 were set to 31785787
Phenotypes for gene: OXR1 were set to Intellectual disability; seizures; cerebellar atrophy
Review for gene: OXR1 was set to GREEN
Added comment: Five individuals from three families.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.931 TMX2 Zornitza Stark gene: TMX2 was added
gene: TMX2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Literature
Mode of inheritance for gene: TMX2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMX2 were set to 31735293; 31586943
Phenotypes for gene: TMX2 were set to Microcephaly; ID; brain malformations
Review for gene: TMX2 was set to GREEN
Added comment: 14 individuals from 10 unrelated families with bi-allelic variants in this gene (31735293) and another four families with recurrent variant (31586943).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.930 PDE10A Zornitza Stark Phenotypes for gene: PDE10A were changed from to Dyskinesia, limb and orofacial, infantile-onset, MIM#616921
Intellectual disability syndromic and non-syndromic v0.929 PDE10A Zornitza Stark Publications for gene: PDE10A were set to
Intellectual disability syndromic and non-syndromic v0.927 PDE10A Zornitza Stark reviewed gene: PDE10A: Rating: GREEN; Mode of pathogenicity: None; Publications: 27058446; Phenotypes: Dyskinesia, limb and orofacial, infantile-onset, MIM#616921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.926 PCYT2 Zornitza Stark gene: PCYT2 was added
gene: PCYT2 was added to Intellectual disability, syndromic and non-syndromic_GHQ_VCGS. Sources: Expert Review
Mode of inheritance for gene: PCYT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCYT2 were set to 31637422
Phenotypes for gene: PCYT2 were set to Global developmental delay with regression; spastic para- or tetra paresis; epilepsy; progressive cerebral and cerebellar atrophy
Review for gene: PCYT2 was set to GREEN
Added comment: Five unrelated individuals. Variants are hypomorphic.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.923 PCLO Zornitza Stark Publications for gene: PCLO were set to
Intellectual disability syndromic and non-syndromic v0.915 PCDH12 Zornitza Stark Publications for gene: PCDH12 were set to
Intellectual disability syndromic and non-syndromic v0.900 PAM16 Zornitza Stark Publications for gene: PAM16 were set to
Intellectual disability syndromic and non-syndromic v0.897 PACS2 Zornitza Stark Publications for gene: PACS2 were set to
Intellectual disability syndromic and non-syndromic v0.893 NUP62 Zornitza Stark Added comment: Comment when marking as ready: Multiple affected individuals, age of onset variable, may be after viral trigger.
Intellectual disability syndromic and non-syndromic v0.893 NUP62 Zornitza Stark Publications for gene: NUP62 were set to
Intellectual disability syndromic and non-syndromic v0.888 NRXN2 Zornitza Stark Publications for gene: NRXN2 were set to
Intellectual disability syndromic and non-syndromic v0.884 NR4A2 Zornitza Stark Publications for gene: NR4A2 were set to
Intellectual disability syndromic and non-syndromic v0.880 NIN Zornitza Stark Publications for gene: NIN were set to
Intellectual disability syndromic and non-syndromic v0.873 NOP10 Zornitza Stark Publications for gene: NOP10 were set to
Intellectual disability syndromic and non-syndromic v0.866 NFIB Zornitza Stark gene: NFIB was added
gene: NFIB was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: NFIB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NFIB were set to 30388402
Phenotypes for gene: NFIB were set to Macrocephaly, acquired, with impaired intellectual development, MIM#618286
Review for gene: NFIB was set to GREEN
Added comment: 18 individuals reported, of whom 11 had deletions of this gene and the rest had SNVs.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.861 NECAP1 Zornitza Stark Publications for gene: NECAP1 were set to
Intellectual disability syndromic and non-syndromic v0.857 NDUFV2 Zornitza Stark Publications for gene: NDUFV2 were set to
Intellectual disability syndromic and non-syndromic v0.854 NDUFS6 Zornitza Stark Publications for gene: NDUFS6 were set to
Intellectual disability syndromic and non-syndromic v0.851 NDUFS3 Zornitza Stark Publications for gene: NDUFS3 were set to
Intellectual disability syndromic and non-syndromic v0.848 NDUFS2 Zornitza Stark Publications for gene: NDUFS2 were set to
Intellectual disability syndromic and non-syndromic v0.845 NDUFB9 Zornitza Stark Publications for gene: NDUFB9 were set to
Intellectual disability syndromic and non-syndromic v0.842 NDUFB3 Zornitza Stark Publications for gene: NDUFB3 were set to
Intellectual disability syndromic and non-syndromic v0.839 NDUFAF6 Zornitza Stark Publications for gene: NDUFAF6 were set to
Intellectual disability syndromic and non-syndromic v0.836 NDUFAF4 Zornitza Stark Publications for gene: NDUFAF4 were set to
Intellectual disability syndromic and non-syndromic v0.833 NDUFAF3 Zornitza Stark Publications for gene: NDUFAF3 were set to
Intellectual disability syndromic and non-syndromic v0.830 NDUFAF2 Zornitza Stark Publications for gene: NDUFAF2 were set to
Intellectual disability syndromic and non-syndromic v0.827 NDUFA9 Zornitza Stark Publications for gene: NDUFA9 were set to
Intellectual disability syndromic and non-syndromic v0.824 NDUFA11 Zornitza Stark Publications for gene: NDUFA11 were set to
Intellectual disability syndromic and non-syndromic v0.820 NDUFA10 Zornitza Stark Publications for gene: NDUFA10 were set to
Intellectual disability syndromic and non-syndromic v0.813 CLCN2 Zornitza Stark Publications for gene: CLCN2 were set to
Intellectual disability syndromic and non-syndromic v0.806 CHST14 Zornitza Stark Publications for gene: CHST14 were set to
Intellectual disability syndromic and non-syndromic v0.799 AGO3 Zornitza Stark gene: AGO3 was added
gene: AGO3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: AGO3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: AGO3 were set to 25271087
Phenotypes for gene: AGO3 were set to Intellectual disability
Review for gene: AGO3 was set to RED
Added comment: Five children with heterozygous deletions of AGO3 reported; however deletions also encompass AGO1 and therefore gene-disease association cannot be firmly established until SNVs reported/functional data becomes available.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.798 ADRA2B Zornitza Stark gene: ADRA2B was added
gene: ADRA2B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: ADRA2B was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ADRA2B were set to 24114805; 21937992
Phenotypes for gene: ADRA2B were set to Cortical myoclonus and epilepsy; Intellectual disability
Review for gene: ADRA2B was set to RED
Added comment: Two families reported but same mutation, ?founder effect. Most affected individuals had normal intellect.
Another paper linking to AR intellectual disability but as part of manuscript reporting multiple novel candidates.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.787 CEP89 Zornitza Stark Publications for gene: CEP89 were set to
Intellectual disability syndromic and non-syndromic v0.783 CEP63 Zornitza Stark Publications for gene: CEP63 were set to
Intellectual disability syndromic and non-syndromic v0.776 CDK6 Zornitza Stark Publications for gene: CDK6 were set to
Intellectual disability syndromic and non-syndromic v0.772 CDK16 Zornitza Stark Publications for gene: CDK16 were set to
Intellectual disability syndromic and non-syndromic v0.768 CD96 Zornitza Stark Publications for gene: CD96 were set to
Intellectual disability syndromic and non-syndromic v0.764 CCDC8 Zornitza Stark Publications for gene: CCDC8 were set to
Intellectual disability syndromic and non-syndromic v0.760 CCDC78 Zornitza Stark Publications for gene: CCDC78 were set to
Intellectual disability syndromic and non-syndromic v0.757 CACNA1G Zornitza Stark Phenotypes for gene: CACNA1G were changed from to Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#618087
Intellectual disability syndromic and non-syndromic v0.756 CACNA1G Zornitza Stark Publications for gene: CACNA1G were set to
Intellectual disability syndromic and non-syndromic v0.753 CA8 Zornitza Stark Publications for gene: CA8 were set to
Intellectual disability syndromic and non-syndromic v0.742 BRAT1 Zornitza Stark Publications for gene: BRAT1 were set to
Intellectual disability syndromic and non-syndromic v0.731 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to
Intellectual disability syndromic and non-syndromic v0.727 B9D2 Zornitza Stark Publications for gene: B9D2 were set to
Intellectual disability syndromic and non-syndromic v0.724 B9D1 Zornitza Stark Publications for gene: B9D1 were set to
Intellectual disability syndromic and non-syndromic v0.721 B4GALT1 Zornitza Stark Publications for gene: B4GALT1 were set to
Intellectual disability syndromic and non-syndromic v0.707 ALX3 Zornitza Stark Publications for gene: ALX3 were set to
Intellectual disability syndromic and non-syndromic v0.704 ALX1 Zornitza Stark Publications for gene: ALX1 were set to
Intellectual disability syndromic and non-syndromic v0.700 ALG14 Zornitza Stark Publications for gene: ALG14 were set to
Intellectual disability syndromic and non-syndromic v0.693 ADD3 Zornitza Stark Publications for gene: ADD3 were set to
Intellectual disability syndromic and non-syndromic v0.690 ADAT3 Zornitza Stark Publications for gene: ADAT3 were set to
Intellectual disability syndromic and non-syndromic v0.685 ACTL6A Zornitza Stark Publications for gene: ACTL6A were set to
Intellectual disability syndromic and non-syndromic v0.672 ATP8A2 Zornitza Stark Publications for gene: ATP8A2 were set to
Intellectual disability syndromic and non-syndromic v0.669 ATP2B3 Zornitza Stark Publications for gene: ATP2B3 were set to
Intellectual disability syndromic and non-syndromic v0.661 ATP10A Zornitza Stark Publications for gene: ATP10A were set to
Intellectual disability syndromic and non-syndromic v0.657 ARNT2 Zornitza Stark Publications for gene: ARNT2 were set to
Intellectual disability syndromic and non-syndromic v0.651 APTX Zornitza Stark Phenotypes for gene: APTX were changed from to Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia, MIM#208920
Intellectual disability syndromic and non-syndromic v0.645 ALS2 Zornitza Stark Phenotypes for gene: ALS2 were changed from to Spastic paralysis, infantile onset ascending, MIM#607225
Intellectual disability syndromic and non-syndromic v0.635 AKAP6 Zornitza Stark Publications for gene: AKAP6 were set to
Intellectual disability syndromic and non-syndromic v0.608 MAP4K4 Zornitza Stark gene: MAP4K4 was added
gene: MAP4K4 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: MAP4K4 was set to Unknown
Review for gene: MAP4K4 was set to RED
Added comment: Cannot find evidence for gene-disease association.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.606 LZTR1 Zornitza Stark gene: LZTR1 was added
gene: LZTR1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: LZTR1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: LZTR1 were set to Noonan syndrome 10, MIM#616564; Noonan syndrome 2, MIM#605275
Review for gene: LZTR1 was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.598 LMNB1 Zornitza Stark Phenotypes for gene: LMNB1 were changed from to Leukodystrophy, adult-onset, autosomal dominant, MIM#169500
Intellectual disability syndromic and non-syndromic v0.595 LMNB1 Zornitza Stark reviewed gene: LMNB1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy, adult-onset, autosomal dominant, MIM#169500; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.593 LIPT1 Zornitza Stark Publications for gene: LIPT1 were set to
Intellectual disability syndromic and non-syndromic v0.589 LINGO1 Zornitza Stark gene: LINGO1 was added
gene: LINGO1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: LINGO1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LINGO1 were set to 28837161
Phenotypes for gene: LINGO1 were set to Mental retardation, autosomal recessive 64, MIM#618103
Review for gene: LINGO1 was set to GREEN
Added comment: Five individuals from two unrelated families, no functional evidence.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.587 LIAS Zornitza Stark Publications for gene: LIAS were set to
Intellectual disability syndromic and non-syndromic v0.578 KYNU Zornitza Stark Publications for gene: KYNU were set to
Intellectual disability syndromic and non-syndromic v0.575 KMT5B Zornitza Stark gene: KMT5B was added
gene: KMT5B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: KMT5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KMT5B were set to 25363768; 28191889; 29276005
Phenotypes for gene: KMT5B were set to Mental retardation, autosomal dominant 51, MIM#617788
Review for gene: KMT5B was set to GREEN
Added comment: Multiple affected individuals from unrelated families.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.574 KMT2B Zornitza Stark Phenotypes for gene: KMT2B were changed from to Dystonia 28, childhood-onset, MIM#617284
Intellectual disability syndromic and non-syndromic v0.572 KMT2B Zornitza Stark reviewed gene: KMT2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Dystonia 28, childhood-onset, MIM#617284; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.572 KLLN Zornitza Stark Publications for gene: KLLN were set to
Intellectual disability syndromic and non-syndromic v0.570 KLF8 Zornitza Stark Publications for gene: KLF8 were set to
Intellectual disability syndromic and non-syndromic v0.567 KLF7 Zornitza Stark Publications for gene: KLF7 were set to
Intellectual disability syndromic and non-syndromic v0.564 KIRREL3 Zornitza Stark Publications for gene: KIRREL3 were set to
Intellectual disability syndromic and non-syndromic v0.557 KIF16B Zornitza Stark Publications for gene: KIF16B were set to
Intellectual disability syndromic and non-syndromic v0.553 KDM6B Zornitza Stark gene: KDM6B was added
gene: KDM6B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: KDM6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KDM6B were set to 31124279
Phenotypes for gene: KDM6B were set to Intellectual disability
Review for gene: KDM6B was set to GREEN
Added comment: 12 unrelated individuals with de novo variants in this gene, no functional evidence reported but KDM6B involved in histone methylation.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.551 KCTD13 Zornitza Stark Publications for gene: KCTD13 were set to
Intellectual disability syndromic and non-syndromic v0.547 KCNMA1 Zornitza Stark Publications for gene: KCNMA1 were set to
Intellectual disability syndromic and non-syndromic v0.535 KARS Zornitza Stark gene: KARS was added
gene: KARS was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: KARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KARS were set to 26741492; 31618474; 28887846; 25330800; 29615062; 30252186; 28496994
Phenotypes for gene: KARS were set to Combined mitochondrial oxidative phosphorylation deficiency; epilepsy; intellectual disability; microcephaly
Review for gene: KARS was set to GREEN
gene: KARS was marked as current diagnostic
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.526 TRRAP Chirag Patel gene: TRRAP was added
gene: TRRAP was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: TRRAP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRRAP were set to PubMed: 30827496
Phenotypes for gene: TRRAP were set to Developmental delay with or without dysmorphic facies and autism; OMIM #618454
Review for gene: TRRAP was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.512 KANK1 Zornitza Stark Publications for gene: KANK1 were set to
Intellectual disability syndromic and non-syndromic v0.508 ACTA1 Zornitza Stark Publications for gene: ACTA1 were set to
Intellectual disability syndromic and non-syndromic v0.495 ITCH Zornitza Stark Publications for gene: ITCH were set to
Intellectual disability syndromic and non-syndromic v0.491 IREB2 Zornitza Stark gene: IREB2 was added
gene: IREB2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Literature
Mode of inheritance for gene: IREB2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IREB2 were set to 30915432; 31243445; 11175792
Phenotypes for gene: IREB2 were set to Neurodegeneration, early-onset, with choreoathetoid movements and microcytic anemia, MIM#618451
Review for gene: IREB2 was set to GREEN
Added comment: Two affected individuals from unrelated families with functional evidence including concordant phenotype in mice.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.486 IMPA1 Zornitza Stark Publications for gene: IMPA1 were set to
Intellectual disability syndromic and non-syndromic v0.482 IMMP2L Zornitza Stark Publications for gene: IMMP2L were set to
Intellectual disability syndromic and non-syndromic v0.478 IGF2 Zornitza Stark Publications for gene: IGF2 were set to
Intellectual disability syndromic and non-syndromic v0.475 IFT27 Zornitza Stark Publications for gene: IFT27 were set to
Intellectual disability syndromic and non-syndromic v0.396 HNMT Zornitza Stark Publications for gene: HNMT were set to
Intellectual disability syndromic and non-syndromic v0.394 VPS37A Chirag Patel changed review comment from: ID reported in this type of HSP in 2 families.

Zivony-Elboum et al. (2012) reported 9 patients from 2 Arab Moslem families with early-onset spastic paraplegia. Affected individuals showed developmental and motor delay during the first 2 years of life. They had unsteadiness in standing and difficulty walking. All affected children presented with spasticity in the lower limbs that progressed to the upper extremities. All had mild to moderate cognitive and speech delay.; to: ID reported in this type of HSP in 2 families.

Zivony-Elboum et al. (2012) reported 9 patients from 2 Arab Moslem families with early-onset spastic paraplegia. Affected individuals showed developmental and motor delay during the first 2 years of life. They had unsteadiness in standing and difficulty walking. All affected children presented with spasticity in the lower limbs that progressed to the upper extremities. All had mild to moderate cognitive and speech delay. Functional studied performed.
Intellectual disability syndromic and non-syndromic v0.393 HAL Zornitza Stark Publications for gene: HAL were set to
Intellectual disability syndromic and non-syndromic v0.387 UFM1 Chirag Patel gene: UFM1 was added
gene: UFM1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: UFM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFM1 were set to PubMed: 27545674; 27545681; 28931644
Phenotypes for gene: UFM1 were set to Leukodystrophy, hypomyelinating, 14; OMIM #617899
Review for gene: UFM1 was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.362 WASF1 Chirag Patel gene: WASF1 was added
gene: WASF1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: WASF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WASF1 were set to PMID: 29961568
Review for gene: WASF1 was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.349 WDR37 Chirag Patel gene: WDR37 was added
gene: WDR37 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: WDR37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDR37 were set to PubMed: 31327508; 31327510
Phenotypes for gene: WDR37 were set to Neurooculocardiogenitourinary syndrome; OMIM #618652
Review for gene: WDR37 was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.332 GTF2IRD1 Zornitza Stark Publications for gene: GTF2IRD1 were set to
Intellectual disability syndromic and non-syndromic v0.329 GSPT2 Zornitza Stark Publications for gene: GSPT2 were set to
Intellectual disability syndromic and non-syndromic v0.314 ZNF462 Chirag Patel gene: ZNF462 was added
gene: ZNF462 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: ZNF462 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF462 were set to PubMed: 31361404; 28513610
Phenotypes for gene: ZNF462 were set to Weiss-Kruszka syndrome; OMIM# 618619
Review for gene: ZNF462 was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.286 GLIS3 Zornitza Stark Publications for gene: GLIS3 were set to
Intellectual disability syndromic and non-syndromic v0.274 GCSH Zornitza Stark Publications for gene: GCSH were set to
Intellectual disability syndromic and non-syndromic v0.262 GATA6 Zornitza Stark Publications for gene: GATA6 were set to
Intellectual disability syndromic and non-syndromic v0.255 GAD1 Zornitza Stark Publications for gene: GAD1 were set to
Intellectual disability syndromic and non-syndromic v0.250 FUT8 Zornitza Stark gene: FUT8 was added
gene: FUT8 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: FUT8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FUT8 were set to 29304374
Phenotypes for gene: FUT8 were set to Congenital disorder of glycosylation with defective fucosylation 1, MIM#618005
Review for gene: FUT8 was set to GREEN
Added comment: Three unrelated individuals reported with bi-allelic variants in this gene.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.245 FRMPD4 Zornitza Stark Publications for gene: FRMPD4 were set to
Intellectual disability syndromic and non-syndromic v0.231 FDFT1 Zornitza Stark gene: FDFT1 was added
gene: FDFT1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: FDFT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FDFT1 were set to 29909962
Phenotypes for gene: FDFT1 were set to Squalene synthase deficiency, MIM#618156
Review for gene: FDFT1 was set to GREEN
Added comment: Three individuals from two unrelated families reported; metabolic disorder with good level of biochemical evidence to support gene-disease association..
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.229 FBXO31 Zornitza Stark Publications for gene: FBXO31 were set to
Intellectual disability syndromic and non-syndromic v0.219 FASTKD2 Zornitza Stark Publications for gene: FASTKD2 were set to
Intellectual disability syndromic and non-syndromic v0.215 FARS2 Zornitza Stark Publications for gene: FARS2 were set to
Intellectual disability syndromic and non-syndromic v0.207 FAAH2 Zornitza Stark Publications for gene: FAAH2 were set to
Intellectual disability syndromic and non-syndromic v0.198 EXOSC8 Zornitza Stark Publications for gene: EXOSC8 were set to
Intellectual disability syndromic and non-syndromic v0.195 EXOSC2 Zornitza Stark gene: EXOSC2 was added
gene: EXOSC2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: EXOSC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOSC2 were set to 26843489; 31628467
Phenotypes for gene: EXOSC2 were set to Short stature, hearing loss, retinitis pigmentosa, and distinctive facies, MIM# 617763
Review for gene: EXOSC2 was set to GREEN
Added comment: Three individuals from two families, but founder mutation, some functional data.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.181 ERMARD Zornitza Stark Publications for gene: ERMARD were set to
Intellectual disability syndromic and non-syndromic v0.166 EOMES Zornitza Stark Publications for gene: EOMES were set to
Intellectual disability syndromic and non-syndromic v0.162 EOGT Zornitza Stark Publications for gene: EOGT were set to
Intellectual disability syndromic and non-syndromic v0.143 EFNB2 Zornitza Stark Publications for gene: EFNB2 were set to
Intellectual disability syndromic and non-syndromic v0.139 EARS2 Zornitza Stark Publications for gene: EARS2 were set to
Intellectual disability syndromic and non-syndromic v0.135 CLIP2 Zornitza Stark Publications for gene: CLIP2 were set to
Intellectual disability syndromic and non-syndromic v0.119 DPP10 Zornitza Stark Publications for gene: DPP10 were set to
Intellectual disability syndromic and non-syndromic v0.116 DPH1 Zornitza Stark Publications for gene: DPH1 were set to
Intellectual disability syndromic and non-syndromic v0.106 DNAJC6 Zornitza Stark Phenotypes for gene: DNAJC6 were changed from to Parkinson disease 19a, juvenile-onset, MIM#615528
Intellectual disability syndromic and non-syndromic v0.103 DNAJC6 Zornitza Stark reviewed gene: DNAJC6: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 19a, juvenile-onset, MIM#615528; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.102 DNAJC12 Zornitza Stark gene: DNAJC12 was added
gene: DNAJC12 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: DNAJC12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAJC12 were set to Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384
Review for gene: DNAJC12 was set to GREEN
Added comment: Highly variable neurological phenotype, including ID, dystonia, parkinsonism. Treatable.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.93 DISP1 Zornitza Stark Publications for gene: DISP1 were set to
Intellectual disability syndromic and non-syndromic v0.90 DDX59 Zornitza Stark Publications for gene: DDX59 were set to
Intellectual disability syndromic and non-syndromic v0.85 DDB1 Zornitza Stark gene: DDB1 was added
gene: DDB1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Research
Mode of inheritance for gene: DDB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DDB1 were set to Syndromic intellectual disability
Review for gene: DDB1 was set to GREEN
Added comment: High quality unpublished evidence.
Sources: Research
Intellectual disability syndromic and non-syndromic v0.83 CNTN4 Zornitza Stark Publications for gene: CNTN4 were set to
Intellectual disability syndromic and non-syndromic v0.75 CUX2 Zornitza Stark Publications for gene: CUX2 were set to
Intellectual disability syndromic and non-syndromic v0.69 CTU2 Zornitza Stark gene: CTU2 was added
gene: CTU2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: CTU2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CTU2 were set to 27480277; 26633546
Phenotypes for gene: CTU2 were set to Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome, MIM#618142
Review for gene: CTU2 was set to GREEN
Added comment: Multiple Saudi families reported with same homozygous variant; founder effect. Severe disorder of infancy.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.64 CTNNA2 Zornitza Stark gene: CTNNA2 was added
gene: CTNNA2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: CTNNA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CTNNA2 were set to 30013181
Phenotypes for gene: CTNNA2 were set to Cortical dysplasia, complex, with other brain malformations 9, MIM#618174
Review for gene: CTNNA2 was set to GREEN
Added comment: 13 children from three unrelated families reported, severe ID as part of the phenotype.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.57 CRKL Zornitza Stark Publications for gene: CRKL were set to
Intellectual disability syndromic and non-syndromic v0.53 CPA6 Zornitza Stark Publications for gene: CPA6 were set to
Intellectual disability syndromic and non-syndromic v0.46 COX7B Zornitza Stark Publications for gene: COX7B were set to
Intellectual disability syndromic and non-syndromic v0.43 COX4I2 Zornitza Stark Publications for gene: COX4I2 were set to
Intellectual disability syndromic and non-syndromic v0.40 COX20 Zornitza Stark Publications for gene: COX20 were set to
Intellectual disability syndromic and non-syndromic v0.36 COX14 Zornitza Stark Publications for gene: COX14 were set to
Intellectual disability syndromic and non-syndromic v0.24 CNTNAP5 Zornitza Stark Publications for gene: CNTNAP5 were set to
Intellectual disability syndromic and non-syndromic v0.20 CNTNAP1 Zornitza Stark Publications for gene: CNTNAP1 were set to
Intellectual disability syndromic and non-syndromic v0.14 ABAT Zornitza Stark Publications for gene: ABAT were set to
Intellectual disability syndromic and non-syndromic v0.10 CHD3 Zornitza Stark gene: CHD3 was added
gene: CHD3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: CHD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHD3 were set to 30397230
Phenotypes for gene: CHD3 were set to Snijders Blok-Campeau syndrome, MIM#618205
Review for gene: CHD3 was set to GREEN
gene: CHD3 was marked as current diagnostic
Added comment: 35 individuals from 33 unrelated families reported with heterozygous variants in this gene.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.9 CHD1 Zornitza Stark gene: CHD1 was added
gene: CHD1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Literature
Mode of inheritance for gene: CHD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHD1 were set to 28866611
Phenotypes for gene: CHD1 were set to Pilarowski-Bjornsson syndrome, MIM#617682
Review for gene: CHD1 was set to GREEN
Added comment: Six unrelated individuals with heterozygous variants reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.7 KIF1BP Zornitza Stark gene: KIF1BP was added
gene: KIF1BP was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KIF1BP were set to Goldberg-Shprintzen megacolon syndrome 609460
Review for gene: KIF1BP was set to GREEN
Added comment: Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.6 CACNA1G Zornitza Stark reviewed gene: CACNA1G: Rating: GREEN; Mode of pathogenicity: None; Publications: 29878067; Phenotypes: Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#618087; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.6 CACNA1E Zornitza Stark gene: CACNA1E was added
gene: CACNA1E was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: CACNA1E was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1E were set to 30343943
Phenotypes for gene: CACNA1E were set to Epileptic encephalopathy, early infantile, 69, MIM#618285
Review for gene: CACNA1E was set to GREEN
gene: CACNA1E was marked as current diagnostic
Added comment: At least 30 unrelated patients reported with heterozygous variants in this gene; primarily a seizure disorder, often with profound intellectual disability.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.5 ATP6AP1 Zornitza Stark gene: ATP6AP1 was added
gene: ATP6AP1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: ATP6AP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ATP6AP1 were set to 27231034
Phenotypes for gene: ATP6AP1 were set to Immunodeficiency 47, MIM#300972
Review for gene: ATP6AP1 was set to GREEN
gene: ATP6AP1 was marked as current diagnostic
Added comment: 11 males from 6 unrelated families with primarily an immunodeficiency disorder; six patients from 3 families who carried the same variant (E346K) had neurologic features, including seizures, mild intellectual disability, and behavioral abnormalities
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4 ATAD1 Zornitza Stark gene: ATAD1 was added
gene: ATAD1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: ATAD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATAD1 were set to 28180185
Phenotypes for gene: ATAD1 were set to Hyperekplexia 4, MIM#618011
Review for gene: ATAD1 was set to GREEN
gene: ATAD1 was marked as current diagnostic
Added comment: Severe progressive neurological disorder, severe/profound intellectual disability is a feature
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.3 ASTN1 Zornitza Stark gene: ASTN1 was added
gene: ASTN1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: ASTN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ASTN1 were set to 29706646; 27431290; 26539891
Review for gene: ASTN1 was set to GREEN
gene: ASTN1 was marked as current diagnostic
Added comment: Three families reported as part of large cohorts albeit proposing multiple novel candidate genes with minimal detail and no functional validation.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2 ASH1L Zornitza Stark gene: ASH1L was added
gene: ASH1L was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert list
Mode of inheritance for gene: ASH1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ASH1L were set to 23033978; 25961944; 28394464; 28191889; 27824329
Phenotypes for gene: ASH1L were set to Mental retardation, autosomal dominant 52, MIM#617796
Review for gene: ASH1L was set to GREEN
gene: ASH1L was marked as current diagnostic
Added comment: Multiple cases with de novo variants and intellectual disability reported as part of large cohorts identifying multiple candidate genes.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.1 APTX Zornitza Stark reviewed gene: APTX: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia, MIM#208920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.1 ALS2 Zornitza Stark reviewed gene: ALS2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paralysis, infantile onset ascending, MIM#607225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.0 ZBTB11 Zornitza Stark gene: ZBTB11 was added
gene: ZBTB11 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: ZBTB11 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 YY1 Zornitza Stark gene: YY1 was added
gene: YY1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: YY1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 YWHAG Zornitza Stark gene: YWHAG was added
gene: YWHAG was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: YWHAG was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 XRCC4 Zornitza Stark gene: XRCC4 was added
gene: XRCC4 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: XRCC4 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 XIST Zornitza Stark gene: XIST was added
gene: XIST was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: XIST was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 WDR73 Zornitza Stark gene: WDR73 was added
gene: WDR73 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: WDR73 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 WDR45B Zornitza Stark gene: WDR45B was added
gene: WDR45B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: WDR45B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 WDFY3 Zornitza Stark gene: WDFY3 was added
gene: WDFY3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: WDFY3 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 WAC Zornitza Stark gene: WAC was added
gene: WAC was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: WAC was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 VARS2 Zornitza Stark gene: VARS2 was added
gene: VARS2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: VARS2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 VAMP1 Zornitza Stark gene: VAMP1 was added
gene: VAMP1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: VAMP1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 USP18 Zornitza Stark gene: USP18 was added
gene: USP18 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: USP18 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 UNC13A Zornitza Stark gene: UNC13A was added
gene: UNC13A was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: UNC13A was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 UBTF Zornitza Stark gene: UBTF was added
gene: UBTF was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: UBTF was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 UBR4 Zornitza Stark gene: UBR4 was added
gene: UBR4 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: UBR4 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 UBA5 Zornitza Stark gene: UBA5 was added
gene: UBA5 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: UBA5 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TXNL4A Zornitza Stark gene: TXNL4A was added
gene: TXNL4A was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TXNL4A was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TUBG1 Zornitza Stark gene: TUBG1 was added
gene: TUBG1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TUBG1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TUBB2A Zornitza Stark gene: TUBB2A was added
gene: TUBB2A was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TUBB2A was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TUBB Zornitza Stark gene: TUBB was added
gene: TUBB was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TUBB was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TRMT1 Zornitza Stark gene: TRMT1 was added
gene: TRMT1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TRMT1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TRIT1 Zornitza Stark gene: TRIT1 was added
gene: TRIT1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TRIT1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TRIP13 Zornitza Stark gene: TRIP13 was added
gene: TRIP13 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TRIP13 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TRIM37 Zornitza Stark gene: TRIM37 was added
gene: TRIM37 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TRIM37 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TRAPPC6B Zornitza Stark gene: TRAPPC6B was added
gene: TRAPPC6B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TRAPPC6B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TRAPPC6A Zornitza Stark gene: TRAPPC6A was added
gene: TRAPPC6A was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TRAPPC6A was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TRAPPC12 Zornitza Stark gene: TRAPPC12 was added
gene: TRAPPC12 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TRAPPC12 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TRAK1 Zornitza Stark gene: TRAK1 was added
gene: TRAK1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TRAK1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TOE1 Zornitza Stark gene: TOE1 was added
gene: TOE1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TOE1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TNRC6B Zornitza Stark gene: TNRC6B was added
gene: TNRC6B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TNRC6B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TMTC3 Zornitza Stark gene: TMTC3 was added
gene: TMTC3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TMTC3 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TMLHE Zornitza Stark gene: TMLHE was added
gene: TMLHE was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TMLHE was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TMEM260 Zornitza Stark gene: TMEM260 was added
gene: TMEM260 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TMEM260 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TLK2 Zornitza Stark gene: TLK2 was added
gene: TLK2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TLK2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 THRA Zornitza Stark gene: THRA was added
gene: THRA was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: THRA was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 THAP1 Zornitza Stark gene: THAP1 was added
gene: THAP1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: THAP1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TCF20 Zornitza Stark gene: TCF20 was added
gene: TCF20 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TCF20 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TBR1 Zornitza Stark gene: TBR1 was added
gene: TBR1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TBR1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TBCK Zornitza Stark gene: TBCK was added
gene: TBCK was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TBCK was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TBCD Zornitza Stark gene: TBCD was added
gene: TBCD was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TBCD was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TBC1D23 Zornitza Stark gene: TBC1D23 was added
gene: TBC1D23 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TBC1D23 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TAZ Zornitza Stark gene: TAZ was added
gene: TAZ was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TAZ was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TAOK1 Zornitza Stark gene: TAOK1 was added
gene: TAOK1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TAOK1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TANGO2 Zornitza Stark gene: TANGO2 was added
gene: TANGO2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TANGO2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TAF8 Zornitza Stark gene: TAF8 was added
gene: TAF8 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TAF8 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TAF6 Zornitza Stark gene: TAF6 was added
gene: TAF6 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TAF6 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 TAF13 Zornitza Stark gene: TAF13 was added
gene: TAF13 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: TAF13 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SURF1 Zornitza Stark gene: SURF1 was added
gene: SURF1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SURF1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 STX1B Zornitza Stark gene: STX1B was added
gene: STX1B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: STX1B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 STAG1 Zornitza Stark gene: STAG1 was added
gene: STAG1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: STAG1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SPRTN Zornitza Stark gene: SPRTN was added
gene: SPRTN was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SPRTN was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SPG11 Zornitza Stark gene: SPG11 was added
gene: SPG11 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SPG11 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SPECC1L Zornitza Stark gene: SPECC1L was added
gene: SPECC1L was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SPECC1L was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SPART Zornitza Stark gene: SPART was added
gene: SPART was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SPART was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SOX9 Zornitza Stark gene: SOX9 was added
gene: SOX9 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SOX9 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SON Zornitza Stark gene: SON was added
gene: SON was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SON was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SNX14 Zornitza Stark gene: SNX14 was added
gene: SNX14 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SNX14 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SNRPA Zornitza Stark gene: SNRPA was added
gene: SNRPA was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SNRPA was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SNORD118 Zornitza Stark gene: SNORD118 was added
gene: SNORD118 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SNORD118 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SMPD4 Zornitza Stark gene: SMPD4 was added
gene: SMPD4 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SMPD4 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC9A7 Zornitza Stark gene: SLC9A7 was added
gene: SLC9A7 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC9A7 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC6A9 Zornitza Stark gene: SLC6A9 was added
gene: SLC6A9 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC6A9 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC6A1 Zornitza Stark gene: SLC6A1 was added
gene: SLC6A1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC6A1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC46A1 Zornitza Stark gene: SLC46A1 was added
gene: SLC46A1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC46A1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC45A1 Zornitza Stark gene: SLC45A1 was added
gene: SLC45A1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC45A1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC39A8 Zornitza Stark gene: SLC39A8 was added
gene: SLC39A8 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC39A8 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC39A14 Zornitza Stark gene: SLC39A14 was added
gene: SLC39A14 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC39A14 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC25A24 Zornitza Stark gene: SLC25A24 was added
gene: SLC25A24 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC25A24 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC25A20 Zornitza Stark gene: SLC25A20 was added
gene: SLC25A20 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC25A20 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SLC12A5 Zornitza Stark gene: SLC12A5 was added
gene: SLC12A5 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SLC12A5 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SIN3A Zornitza Stark gene: SIN3A was added
gene: SIN3A was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SIN3A was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SIK1 Zornitza Stark gene: SIK1 was added
gene: SIK1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SIK1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SHANK1 Zornitza Stark gene: SHANK1 was added
gene: SHANK1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SHANK1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SGPL1 Zornitza Stark gene: SGPL1 was added
gene: SGPL1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SGPL1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SETD1B Zornitza Stark gene: SETD1B was added
gene: SETD1B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SETD1B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SET Zornitza Stark gene: SET was added
gene: SET was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SET was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SCN3A Zornitza Stark gene: SCN3A was added
gene: SCN3A was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SCN3A was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 SAMD9 Zornitza Stark gene: SAMD9 was added
gene: SAMD9 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: SAMD9 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RTEL1 Zornitza Stark gene: RTEL1 was added
gene: RTEL1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RTEL1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RPS23 Zornitza Stark gene: RPS23 was added
gene: RPS23 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RPS23 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RNF135 Zornitza Stark gene: RNF135 was added
gene: RNF135 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RNF135 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RNF125 Zornitza Stark gene: RNF125 was added
gene: RNF125 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RNF125 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RIMS1 Zornitza Stark gene: RIMS1 was added
gene: RIMS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RIMS1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RHEB Zornitza Stark gene: RHEB was added
gene: RHEB was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RHEB was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RERE Zornitza Stark gene: RERE was added
gene: RERE was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RERE was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RAC3 Zornitza Stark gene: RAC3 was added
gene: RAC3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RAC3 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RAC1 Zornitza Stark gene: RAC1 was added
gene: RAC1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RAC1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 RAB11B Zornitza Stark gene: RAB11B was added
gene: RAB11B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: RAB11B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 QRICH1 Zornitza Stark gene: QRICH1 was added
gene: QRICH1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: QRICH1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PYCR2 Zornitza Stark gene: PYCR2 was added
gene: PYCR2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PYCR2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PUM1 Zornitza Stark gene: PUM1 was added
gene: PUM1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PUM1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PUF60 Zornitza Stark gene: PUF60 was added
gene: PUF60 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PUF60 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PTPN23 Zornitza Stark gene: PTPN23 was added
gene: PTPN23 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PTPN23 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PTF1A Zornitza Stark gene: PTF1A was added
gene: PTF1A was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PTF1A was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PSMD12 Zornitza Stark gene: PSMD12 was added
gene: PSMD12 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PSMD12 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PRUNE1 Zornitza Stark gene: PRUNE1 was added
gene: PRUNE1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PRUNE1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PRRT2 Zornitza Stark gene: PRRT2 was added
gene: PRRT2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PRRT2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PRMT7 Zornitza Stark gene: PRMT7 was added
gene: PRMT7 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PRMT7 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PRKD1 Zornitza Stark gene: PRKD1 was added
gene: PRKD1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PRKD1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PPP3CA Zornitza Stark gene: PPP3CA was added
gene: PPP3CA was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PPP3CA was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PPP1R15B Zornitza Stark gene: PPP1R15B was added
gene: PPP1R15B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PPP1R15B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PPP1CB Zornitza Stark gene: PPP1CB was added
gene: PPP1CB was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PPP1CB was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 POLG Zornitza Stark gene: POLG was added
gene: POLG was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: POLG was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 POGZ Zornitza Stark gene: POGZ was added
gene: POGZ was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: POGZ was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PLPBP Zornitza Stark gene: PLPBP was added
gene: PLPBP was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PLPBP was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PLK4 Zornitza Stark gene: PLK4 was added
gene: PLK4 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PLK4 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PLAA Zornitza Stark gene: PLAA was added
gene: PLAA was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PLAA was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PIGC Zornitza Stark gene: PIGC was added
gene: PIGC was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PIGC was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PGM3 Zornitza Stark gene: PGM3 was added
gene: PGM3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PGM3 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PEX26 Zornitza Stark gene: PEX26 was added
gene: PEX26 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PEX26 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PEX14 Zornitza Stark gene: PEX14 was added
gene: PEX14 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PEX14 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PEX1 Zornitza Stark gene: PEX1 was added
gene: PEX1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PEX1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PCLO Zornitza Stark gene: PCLO was added
gene: PCLO was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PCLO was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PCGF2 Zornitza Stark gene: PCGF2 was added
gene: PCGF2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PCGF2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PCDH12 Zornitza Stark gene: PCDH12 was added
gene: PCDH12 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PCDH12 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PCDH10 Zornitza Stark gene: PCDH10 was added
gene: PCDH10 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PCDH10 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PBX1 Zornitza Stark gene: PBX1 was added
gene: PBX1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PBX1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PAX8 Zornitza Stark gene: PAX8 was added
gene: PAX8 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PAX8 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PAX7 Zornitza Stark gene: PAX7 was added
gene: PAX7 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PAX7 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PARN Zornitza Stark gene: PARN was added
gene: PARN was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PARN was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 PACS2 Zornitza Stark gene: PACS2 was added
gene: PACS2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: PACS2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 OTUD6B Zornitza Stark gene: OTUD6B was added
gene: OTUD6B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: OTUD6B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 ORC4 Zornitza Stark gene: ORC4 was added
gene: ORC4 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: ORC4 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NUP188 Zornitza Stark gene: NUP188 was added
gene: NUP188 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NUP188 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NSD2 Zornitza Stark gene: NSD2 was added
gene: NSD2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NSD2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NRXN2 Zornitza Stark gene: NRXN2 was added
gene: NRXN2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NRXN2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NR4A2 Zornitza Stark gene: NR4A2 was added
gene: NR4A2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NR4A2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NEXMIF Zornitza Stark gene: NEXMIF was added
gene: NEXMIF was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NEXMIF was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NCKAP1 Zornitza Stark gene: NCKAP1 was added
gene: NCKAP1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NCKAP1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NANS Zornitza Stark gene: NANS was added
gene: NANS was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NANS was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NACC1 Zornitza Stark gene: NACC1 was added
gene: NACC1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NACC1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 NAA15 Zornitza Stark gene: NAA15 was added
gene: NAA15 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: NAA15 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MYMK Zornitza Stark gene: MYMK was added
gene: MYMK was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MYMK was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MTOR Zornitza Stark gene: MTOR was added
gene: MTOR was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MTOR was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MSMO1 Zornitza Stark gene: MSMO1 was added
gene: MSMO1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MSMO1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MSL3 Zornitza Stark gene: MSL3 was added
gene: MSL3 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MSL3 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MICU1 Zornitza Stark gene: MICU1 was added
gene: MICU1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MICU1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MFF Zornitza Stark gene: MFF was added
gene: MFF was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MFF was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MED25 Zornitza Stark gene: MED25 was added
gene: MED25 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MED25 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MED13 Zornitza Stark gene: MED13 was added
gene: MED13 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MED13 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MDH2 Zornitza Stark gene: MDH2 was added
gene: MDH2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MDH2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MBOAT7 Zornitza Stark gene: MBOAT7 was added
gene: MBOAT7 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MBOAT7 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MAP1B Zornitza Stark gene: MAP1B was added
gene: MAP1B was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MAP1B was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MAF Zornitza Stark gene: MAF was added
gene: MAF was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MAF was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MADD Zornitza Stark gene: MADD was added
gene: MADD was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MADD was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 MAB21L2 Zornitza Stark gene: MAB21L2 was added
gene: MAB21L2 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: MAB21L2 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 LONP1 Zornitza Stark gene: LONP1 was added
gene: LONP1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: LONP1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 LNPK Zornitza Stark gene: LNPK was added
gene: LNPK was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: LNPK was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 LNP1 Zornitza Stark gene: LNP1 was added
gene: LNP1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: LNP1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 LINS1 Zornitza Stark gene: LINS1 was added
gene: LINS1 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: LINS1 was set to Unknown
Intellectual disability syndromic and non-syndromic v0.0 LGI4 Zornitza Stark gene: LGI4 was added
gene: LGI4 was added to Intellectual disability, syndromic and non-syndromic_GHQ. Sources: Expert Review Green,Genetic Health Queensland
Mode of inheritance for gene: LGI4 was set to Unknown