PanelApp

Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Intellectual disability syndromic and non-syndromic v2.7 MAGED1 Sarah Milton gene: MAGED1 was added
gene: MAGED1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAGED1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: MAGED1 were set to 42162770
Phenotypes for gene: MAGED1 were set to Neurodevelopmental disorder, MONDO:0700092, MAGED1-related
Review for gene: MAGED1 was set to AMBER
Added comment: MAGED1 encodes Melanoma-Associated Antigen D1. It is expressed in the developing brain and is involved in controlling cell cycle progression and neuronal apoptosis.

PMID 42162770 reports two unrelated male probands with de novo variants in MAGED1 presenting with epileptic spasms and severe intellectual disability.
One frameshift and one missense variant we observed.
It should be noted the missense variant was present in gnomAD v4 with 3 heterozygotes.

Functional studies were performed demonstrating altered protein interactions and changes to cell cycle progression.
Proposed mechanism of disease (GOF vs LOF) remains unclear.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.834 MAGED1 Sarah Milton gene: MAGED1 was added
gene: MAGED1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: MAGED1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: MAGED1 were set to 42162770
Phenotypes for gene: MAGED1 were set to Neurodevelopmental disorder, MONDO:0700092, MAGED1-related
Intellectual disability syndromic and non-syndromic v2.5 DSCAM chirag patel Publications for gene: DSCAM were set to PMID: 27824329; 28191889; 21904980
Intellectual disability syndromic and non-syndromic v2.1 SNORD116-1 Boris Keren gene: SNORD116-1 was added
gene: SNORD116-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNORD116-1 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Publications for gene: SNORD116-1 were set to PMID: 24916642
Phenotypes for gene: SNORD116-1 were set to Intellectual disability, obesity, hypotonia
Penetrance for gene: SNORD116-1 were set to Complete
Mode of pathogenicity for gene: SNORD116-1 was set to Other
Review for gene: SNORD116-1 was set to GREEN
gene: SNORD116-1 was marked as current diagnostic
Added comment: The paternal deletion of the SNORD166 cluster is the critical region of Prader Willi syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.832 HDAC2 Lucy Spencer gene: HDAC2 was added
gene: HDAC2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: HDAC2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: HDAC2 were set to 30806031; 27620904; 38753158
Phenotypes for gene: HDAC2 were set to Neurodevelopmental disorder (MONDO:0700092), HDAC2-related
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37498-Loss Region ISCA-37498-Loss: gene migrated from ENSG00000162105 to ENSG00000162105 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37448-Loss Region ISCA-37448-Loss: gene migrated from ENSG00000170113 to ENSG00000170113 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-46290-Gain Region ISCA-46290-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37500-Loss Region ISCA-37500-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37494-Gain Region ISCA-37494-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37493-Loss Region ISCA-37493-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37486-Loss Region ISCA-37486-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37478-Loss Region ISCA-37478-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37478-Gain Region ISCA-37478-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37468-Loss Region ISCA-37468-Loss: gene migrated from ENSG00000069535 to ENSG00000069535 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37446-Loss Region ISCA-37446-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-46299-Gain Region ISCA-46299-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37446-Gain Region ISCA-37446-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37443-Loss Region ISCA-37443-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37441-Loss Region ISCA-37441-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-46300-Loss Region ISCA-46300-Loss: gene migrated from ENSG00000169375 to ENSG00000169375 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-46304-Gain Region ISCA-46304-Gain: gene migrated from ENSG00000169057 to ENSG00000169057 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-46743-Gain Region ISCA-46743-Gain: gene migrated from ENSG00000101972 to ENSG00000101972 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37432-Gain Region ISCA-37432-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37439-Gain Region ISCA-37439-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37434-Loss Region ISCA-37434-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37431-Loss Region ISCA-37431-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37433-Loss Region ISCA-37433-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37424-Loss Region ISCA-37424-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37429-Loss Region ISCA-37429-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37431-Gain Region ISCA-37431-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37411-Loss Region ISCA-37411-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37415-Gain Region ISCA-37415-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37421-Gain Region ISCA-37421-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37423-Loss Region ISCA-37423-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37425-Loss Region ISCA-37425-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-46296-Loss Region ISCA-46296-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37430-Loss Region ISCA-37430-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37440-Loss Region ISCA-37440-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37430-Gain Region ISCA-37430-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37423-Gain Region ISCA-37423-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37406-Loss Region ISCA-37406-Loss: gene migrated from ENSG00000005339 to ENSG00000005339 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37433-Gain Region ISCA-37433-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37418-Loss Region ISCA-37418-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37405-Loss Region ISCA-37405-Loss: gene migrated from ENSG00000144061 to ENSG00000144061 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37404-Loss Region ISCA-37404-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37404-Gain Region ISCA-37404-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37432-Loss Region ISCA-37432-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37393-Gain Region ISCA-37393-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37394-Loss Region ISCA-37394-Loss: gene migrated from ENSG00000068024 to ENSG00000068024 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37396-Loss Region ISCA-37396-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37397-Gain Region ISCA-37397-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37397-Loss Region ISCA-37397-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37400-Gain Region ISCA-37400-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37400-Loss Region ISCA-37400-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37418-Gain Region ISCA-37418-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-46295-Loss Region ISCA-46295-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37390-Loss Region ISCA-37390-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37392-Gain Region ISCA-37392-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37392-Loss Region ISCA-37392-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37425-Gain Region ISCA-37425-Gain migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA-37421-Loss Region ISCA-37421-Loss migrated (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DIP2B_FRA12A_CGG STR DIP2B_FRA12A_CGG: gene migrated from ENSG00000066084 to ENSG00000066084 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DMPK_DM1_CTG STR DMPK_DM1_CTG: gene migrated from ENSG00000104936 to ENSG00000104936 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLS_GDPAG_GCA STR GLS_GDPAG_GCA: gene migrated from ENSG00000115419 to ENSG00000115419 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FMR1_FXS_CGG STR FMR1_FXS_CGG: gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARX_EIEE1_GCN2 STR ARX_EIEE1_GCN2: gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 XYLT1_DBQD2_GGC STR XYLT1_DBQD2_GGC: gene migrated from ENSG00000103489 to ENSG00000103489 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARX_EIEE1_GCN1 STR ARX_EIEE1_GCN1: gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF4A3_RCPS_complex STR EIF4A3_RCPS_complex: gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AFF2_FRAXE_GCC STR AFF2_FRAXE_GCC: gene migrated from ENSG00000155966 to ENSG00000155966 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZIC2_HPE5_GCN STR ZIC2_HPE5_GCN: gene migrated from ENSG00000043355 to ENSG00000043355 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DMPK Gene migrated from ENSG00000104936 to ENSG00000104936 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PROSER1 Gene migrated from ENSG00000120685 to ENSG00000120685 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RIN2 Gene migrated from ENSG00000132669 to ENSG00000132669 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RIMS1 Gene migrated from ENSG00000079841 to ENSG00000079841 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TP63 Gene migrated from ENSG00000073282 to ENSG00000073282 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAX Gene migrated from ENSG00000134438 to ENSG00000134438 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRKRA Gene migrated from ENSG00000180228 to ENSG00000180228 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRKN Gene migrated from ENSG00000185345 to ENSG00000185345 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRKDC Gene migrated from ENSG00000253729 to ENSG00000253729 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB27A Gene migrated from ENSG00000069974 to ENSG00000069974 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RASA1 Gene migrated from ENSG00000145715 to ENSG00000145715 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIM74 Gene migrated from ENSG00000155428 to ENSG00000155428 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAPPC6A Gene migrated from ENSG00000007255 to ENSG00000007255 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TFAP2A Gene migrated from ENSG00000137203 to ENSG00000137203 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRICKLE1 Gene migrated from ENSG00000139174 to ENSG00000139174 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRF1 Gene migrated from ENSG00000180644 to ENSG00000180644 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PREPL Gene migrated from ENSG00000138078 to ENSG00000138078 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRDM8 Gene migrated from ENSG00000152784 to ENSG00000152784 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SYT14 Gene migrated from ENSG00000143469 to ENSG00000143469 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAPSN Gene migrated from ENSG00000165917 to ENSG00000165917 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRHR Gene migrated from ENSG00000174417 to ENSG00000174417 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TPR Gene migrated from ENSG00000047410 to ENSG00000047410 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 THAP1 Gene migrated from ENSG00000131931 to ENSG00000131931 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP2R5E Gene migrated from ENSG00000154001 to ENSG00000154001 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RFX6 Gene migrated from ENSG00000185002 to ENSG00000185002 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNF135 Gene migrated from ENSG00000181481 to ENSG00000181481 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RANBP2 Gene migrated from ENSG00000153201 to ENSG00000153201 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RALGAPB Gene migrated from ENSG00000170471 to ENSG00000170471 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TFG Gene migrated from ENSG00000114354 to ENSG00000114354 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM260 Gene migrated from ENSG00000070269 to ENSG00000070269 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TGFBR2 Gene migrated from ENSG00000163513 to ENSG00000163513 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP1R2 Gene migrated from ENSG00000184203 to ENSG00000184203 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TGFBR1 Gene migrated from ENSG00000106799 to ENSG00000106799 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STX11 Gene migrated from ENSG00000135604 to ENSG00000135604 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STT3B Gene migrated from ENSG00000163527 to ENSG00000163527 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SYNE2 Gene migrated from ENSG00000054654 to ENSG00000054654 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TG Gene migrated from ENSG00000042832 to ENSG00000042832 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FTL Gene migrated from ENSG00000087086 to ENSG00000087086 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TIMM8A Gene migrated from ENSG00000126953 to ENSG00000126953 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RET Gene migrated from ENSG00000165731 to ENSG00000165731 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FSCN1 Gene migrated from ENSG00000075618 to ENSG00000075618 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRMT1L Gene migrated from ENSG00000121486 to ENSG00000121486 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMPRSS7 Gene migrated from ENSG00000176040 to ENSG00000176040 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 QSER1 Gene migrated from ENSG00000060749 to ENSG00000060749 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMLHE Gene migrated from ENSG00000185973 to ENSG00000185973 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RECQL4 Gene migrated from ENSG00000160957 to ENSG00000160957 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RDH14 Gene migrated from ENSG00000240857 to ENSG00000240857 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TREM2 Gene migrated from ENSG00000095970 to ENSG00000095970 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIM37 Gene migrated from ENSG00000108395 to ENSG00000108395 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBPJ Gene migrated from ENSG00000168214 to ENSG00000168214 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TECR Gene migrated from ENSG00000099797 to ENSG00000099797 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSMC1 Gene migrated from ENSG00000100764 to ENSG00000100764 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PYGL Gene migrated from ENSG00000100504 to ENSG00000100504 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TPK1 Gene migrated from ENSG00000196511 to ENSG00000196511 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBM8A Gene migrated from ENSG00000265241 to ENSG00000265241 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRX Gene migrated from ENSG00000105227 to ENSG00000105227 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TPH2 Gene migrated from ENSG00000139287 to ENSG00000139287 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TFAP2B Gene migrated from ENSG00000008196 to ENSG00000008196 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRRX1 Gene migrated from ENSG00000116132 to ENSG00000116132 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB40AL Gene migrated from ENSG00000102128 to ENSG00000102128 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRIPTO Gene symbol changed from TDGF1 to CRIPTO during gene set migration (ENSG00000241186 -> ENSG00000241186)
Intellectual disability syndromic and non-syndromic v2.0 RNH1 Gene migrated from ENSG00000023191 to ENSG00000023191 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBFOX3 Gene migrated from ENSG00000167281 to ENSG00000167281 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIM32 Gene migrated from ENSG00000119401 to ENSG00000119401 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDKL1 Gene migrated from ENSG00000100490 to ENSG00000100490 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPAST Gene migrated from ENSG00000021574 to ENSG00000021574 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STK3 Gene migrated from ENSG00000104375 to ENSG00000104375 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF507 Gene migrated from ENSG00000168813 to ENSG00000168813 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FGF3 Gene migrated from ENSG00000186895 to ENSG00000186895 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPAG9 Gene migrated from ENSG00000008294 to ENSG00000008294 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INTS8 Gene migrated from ENSG00000164941 to ENSG00000164941 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SP7 Gene migrated from ENSG00000170374 to ENSG00000170374 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FMO4 Gene migrated from ENSG00000076258 to ENSG00000076258 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK5R1 Gene migrated from ENSG00000176749 to ENSG00000176749 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SAMD9L Gene migrated from ENSG00000177409 to ENSG00000177409 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DIP2B Gene migrated from ENSG00000066084 to ENSG00000066084 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX8 Gene migrated from ENSG00000005513 to ENSG00000005513 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SHROOM4 Gene migrated from ENSG00000158352 to ENSG00000158352 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR83 Gene migrated from ENSG00000123154 to ENSG00000123154 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASMT Gene migrated from ENSG00000196433 to ENSG00000196433 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STAT5B Gene migrated from ENSG00000173757 to ENSG00000173757 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF496 Gene migrated from ENSG00000162714 to ENSG00000162714 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EVC2 Gene migrated from ENSG00000173040 to ENSG00000173040 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EVC Gene migrated from ENSG00000072840 to ENSG00000072840 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASAH2 Gene migrated from ENSG00000188611 to ENSG00000188611 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPSM2 Gene migrated from ENSG00000121957 to ENSG00000121957 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ETS1 Gene migrated from ENSG00000134954 to ENSG00000134954 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPS19 Gene migrated from ENSG00000105372 to ENSG00000105372 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDH15 Gene migrated from ENSG00000129910 to ENSG00000129910 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPL11 Gene migrated from ENSG00000142676 to ENSG00000142676 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDC6 Gene migrated from ENSG00000094804 to ENSG00000094804 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SH3TC2 Gene migrated from ENSG00000169247 to ENSG00000169247 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLIP2 Gene migrated from ENSG00000106665 to ENSG00000106665 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UCHL1 Gene migrated from ENSG00000154277 to ENSG00000154277 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF423 Gene migrated from ENSG00000102935 to ENSG00000102935 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOST Gene migrated from ENSG00000167941 to ENSG00000167941 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GOSR2 Gene migrated from ENSG00000108433 to ENSG00000108433 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARID3A Gene migrated from ENSG00000116017 to ENSG00000116017 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLIC2 Gene migrated from ENSG00000155962 to ENSG00000155962 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCTD13 Gene migrated from ENSG00000174943 to ENSG00000174943 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VANGL1 Gene migrated from ENSG00000173218 to ENSG00000173218 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SGCA Gene migrated from ENSG00000108823 to ENSG00000108823 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARHGEF6 Gene migrated from ENSG00000129675 to ENSG00000129675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SALL1 Gene migrated from ENSG00000103449 to ENSG00000103449 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARHGEF2 Gene migrated from ENSG00000116584 to ENSG00000116584 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBA8 Gene migrated from ENSG00000183785 to ENSG00000183785 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC5A2 Gene migrated from ENSG00000140675 to ENSG00000140675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDX39A Gene migrated from ENSG00000123136 to ENSG00000123136 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SF3B4 Gene migrated from ENSG00000143368 to ENSG00000143368 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZDHHC15 Gene migrated from ENSG00000102383 to ENSG00000102383 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTR Gene migrated from ENSG00000118271 to ENSG00000118271 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDR2 Gene migrated from ENSG00000162733 to ENSG00000162733 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOBP Gene migrated from ENSG00000112320 to ENSG00000112320 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AR Gene migrated from ENSG00000169083 to ENSG00000169083 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERMARD Gene migrated from ENSG00000130023 to ENSG00000130023 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 APTX Gene migrated from ENSG00000137074 to ENSG00000137074 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC93 Gene migrated from ENSG00000125633 to ENSG00000125633 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VAMP1 Gene migrated from ENSG00000139190 to ENSG00000139190 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF41 Gene migrated from ENSG00000147124 to ENSG00000147124 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 XIST Gene migrated from ENSG00000229807 to ENSG00000229807 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WWP1 Gene migrated from ENSG00000123124 to ENSG00000123124 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COLEC10 Gene migrated from ENSG00000184374 to ENSG00000184374 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNRPE Gene migrated from ENSG00000182004 to ENSG00000182004 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLCNKA Gene migrated from ENSG00000186510 to ENSG00000186510 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DBX1 Gene migrated from ENSG00000109851 to ENSG00000109851 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNA14 Gene migrated from ENSG00000156049 to ENSG00000156049 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNJ11 Gene migrated from ENSG00000187486 to ENSG00000187486 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC8 Gene migrated from ENSG00000169515 to ENSG00000169515 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DYNC2I2 Gene symbol changed from WDR34 to DYNC2I2 during gene set migration (ENSG00000119333 -> ENSG00000119333)
Intellectual disability syndromic and non-syndromic v2.0 SRPX2 Gene migrated from ENSG00000102359 to ENSG00000102359 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC44A1 Gene migrated from ENSG00000070214 to ENSG00000070214 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CYP2U1 Gene migrated from ENSG00000155016 to ENSG00000155016 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANKRD31 Gene migrated from ENSG00000145700 to ENSG00000145700 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CYP27A1 Gene migrated from ENSG00000135929 to ENSG00000135929 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLYAT Gene migrated from ENSG00000149124 to ENSG00000149124 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANKH Gene migrated from ENSG00000154122 to ENSG00000154122 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNRPA Gene migrated from ENSG00000077312 to ENSG00000077312 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CYC1 Gene migrated from ENSG00000179091 to ENSG00000179091 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HOXD10 Gene migrated from ENSG00000128710 to ENSG00000128710 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLUD1 Gene migrated from ENSG00000148672 to ENSG00000148672 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INSR Gene migrated from ENSG00000171105 to ENSG00000171105 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBR4 Gene migrated from ENSG00000127481 to ENSG00000127481 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLRA1 Gene migrated from ENSG00000145888 to ENSG00000145888 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC39A4 Gene migrated from ENSG00000147804 to ENSG00000147804 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERCC4 Gene migrated from ENSG00000175595 to ENSG00000175595 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INS Gene migrated from ENSG00000254647 to ENSG00000254647 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALS2 Gene migrated from ENSG00000003393 to ENSG00000003393 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LHX3 Gene migrated from ENSG00000107187 to ENSG00000107187 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSEN34 Gene migrated from ENSG00000170892 to ENSG00000170892 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNC3 Gene migrated from ENSG00000131398 to ENSG00000131398 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF81 Gene migrated from ENSG00000197779 to ENSG00000197779 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SELENON Gene migrated from ENSG00000162430 to ENSG00000162430 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CUBN Gene migrated from ENSG00000107611 to ENSG00000107611 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZFP57 Gene migrated from ENSG00000204644 to ENSG00000204644 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTSF Gene migrated from ENSG00000174080 to ENSG00000174080 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTC21B Gene migrated from ENSG00000123607 to ENSG00000123607 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GJB1 Gene migrated from ENSG00000169562 to ENSG00000169562 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GJA1 Gene migrated from ENSG00000152661 to ENSG00000152661 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LGI4 Gene migrated from ENSG00000153902 to ENSG00000153902 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALDOB Gene migrated from ENSG00000136872 to ENSG00000136872 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EPM2A Gene migrated from ENSG00000112425 to ENSG00000112425 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLASP1 Gene migrated from ENSG00000074054 to ENSG00000074054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GHR Gene migrated from ENSG00000112964 to ENSG00000112964 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTC1 Gene migrated from ENSG00000113312 to ENSG00000113312 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SEC24C Gene migrated from ENSG00000176986 to ENSG00000176986 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTBK1 Gene migrated from ENSG00000146216 to ENSG00000146216 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLX4 Gene migrated from ENSG00000188827 to ENSG00000188827 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AKR1C2 Gene migrated from ENSG00000151632 to ENSG00000151632 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZCCHC12 Gene migrated from ENSG00000174460 to ENSG00000174460 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KATNAL2 Gene migrated from ENSG00000167216 to ENSG00000167216 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EPB41L1 Gene migrated from ENSG00000088367 to ENSG00000088367 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSTB Gene migrated from ENSG00000160213 to ENSG00000160213 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AHSG Gene migrated from ENSG00000145192 to ENSG00000145192 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FLNB Gene migrated from ENSG00000136068 to ENSG00000136068 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CISD2 Gene migrated from ENSG00000145354 to ENSG00000145354 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSHR Gene migrated from ENSG00000165409 to ENSG00000165409 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGTR2 Gene migrated from ENSG00000180772 to ENSG00000180772 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CANT1 Gene migrated from ENSG00000171302 to ENSG00000171302 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGT Gene migrated from ENSG00000135744 to ENSG00000135744 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGPS Gene migrated from ENSG00000018510 to ENSG00000018510 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EOMES Gene migrated from ENSG00000163508 to ENSG00000163508 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGO3 Gene migrated from ENSG00000126070 to ENSG00000126070 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSMD2 Gene migrated from ENSG00000121904 to ENSG00000121904 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UROC1 Gene migrated from ENSG00000159650 to ENSG00000159650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EOGT Gene migrated from ENSG00000163378 to ENSG00000163378 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGL Gene migrated from ENSG00000162688 to ENSG00000162688 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGK Gene migrated from ENSG00000006530 to ENSG00000006530 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGGF1 Gene migrated from ENSG00000164252 to ENSG00000164252 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GCK Gene migrated from ENSG00000106633 to ENSG00000106633 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AFG3L2 Gene migrated from ENSG00000141385 to ENSG00000141385 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRTAP Gene migrated from ENSG00000170275 to ENSG00000170275 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCO1 Gene migrated from ENSG00000133028 to ENSG00000133028 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCN9A Gene migrated from ENSG00000169432 to ENSG00000169432 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GBX1 Gene migrated from ENSG00000164900 to ENSG00000164900 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADRA2B Gene migrated from ENSG00000274286 to ENSG00000274286 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRLF1 Gene migrated from ENSG00000006016 to ENSG00000006016 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRKL Gene migrated from ENSG00000099942 to ENSG00000099942 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GBE1 Gene migrated from ENSG00000114480 to ENSG00000114480 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADGRG6 Gene migrated from ENSG00000112414 to ENSG00000112414 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GBA2 Gene migrated from ENSG00000070610 to ENSG00000070610 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADGRB3 Gene migrated from ENSG00000135298 to ENSG00000135298 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LBR Gene migrated from ENSG00000143815 to ENSG00000143815 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COA3 Gene migrated from ENSG00000183978 to ENSG00000183978 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EN2 Gene migrated from ENSG00000164778 to ENSG00000164778 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNTNAP5 Gene migrated from ENSG00000155052 to ENSG00000155052 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KANK1 Gene migrated from ENSG00000107104 to ENSG00000107104 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SBDS Gene migrated from ENSG00000126524 to ENSG00000126524 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADAMTSL2 Gene migrated from ENSG00000197859 to ENSG00000197859 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UQCRQ Gene migrated from ENSG00000164405 to ENSG00000164405 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNHIT6 Gene migrated from ENSG00000117174 to ENSG00000117174 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNG2 Gene migrated from ENSG00000166862 to ENSG00000166862 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADA2 Gene migrated from ENSG00000093072 to ENSG00000093072 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GATA1 Gene migrated from ENSG00000102145 to ENSG00000102145 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CPA6 Gene migrated from ENSG00000165078 to ENSG00000165078 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CP Gene migrated from ENSG00000047457 to ENSG00000047457 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHRNA4 Gene migrated from ENSG00000101204 to ENSG00000101204 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX6B1 Gene migrated from ENSG00000126267 to ENSG00000126267 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACTA1 Gene migrated from ENSG00000143632 to ENSG00000143632 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX4I2 Gene migrated from ENSG00000131055 to ENSG00000131055 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACOX2 Gene migrated from ENSG00000168306 to ENSG00000168306 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GAP43 Gene migrated from ENSG00000172020 to ENSG00000172020 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR19 Gene migrated from ENSG00000157796 to ENSG00000157796 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNTN6 Gene migrated from ENSG00000134115 to ENSG00000134115 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPTLC1 Gene migrated from ENSG00000090054 to ENSG00000090054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPTBN5 Gene migrated from ENSG00000137877 to ENSG00000137877 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ELP1 Gene migrated from ENSG00000070061 to ENSG00000070061 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GAN Gene migrated from ENSG00000261609 to ENSG00000261609 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMG6 Gene migrated from ENSG00000070366 to ENSG00000070366 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IMMP2L Gene migrated from ENSG00000184903 to ENSG00000184903 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CORO1A Gene migrated from ENSG00000102879 to ENSG00000102879 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RUBCN Gene migrated from ENSG00000145016 to ENSG00000145016 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABCG5 Gene migrated from ENSG00000138075 to ENSG00000138075 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMCHD1 Gene migrated from ENSG00000101596 to ENSG00000101596 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ELMOD1 Gene migrated from ENSG00000110675 to ENSG00000110675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 JAG1 Gene migrated from ENSG00000101384 to ENSG00000101384 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABCC6 Gene migrated from ENSG00000091262 to ENSG00000091262 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WRAP53 Gene migrated from ENSG00000141499 to ENSG00000141499 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNTN4 Gene migrated from ENSG00000144619 to ENSG00000144619 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IYD Gene migrated from ENSG00000009765 to ENSG00000009765 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF804A Gene migrated from ENSG00000170396 to ENSG00000170396 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CA5A Gene migrated from ENSG00000174990 to ENSG00000174990 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IGF2 Gene migrated from ENSG00000167244 to ENSG00000167244 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBN1 Gene migrated from ENSG00000166147 to ENSG00000166147 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBLN5 Gene migrated from ENSG00000140092 to ENSG00000140092 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DIPK2A Gene symbol changed from C3orf58 to DIPK2A during gene set migration (ENSG00000181744 -> ENSG00000181744)
Intellectual disability syndromic and non-syndromic v2.0 UGT1A1 Gene migrated from ENSG00000241635 to ENSG00000241635 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC9A9 Gene migrated from ENSG00000181804 to ENSG00000181804 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB5IF Gene symbol changed from C20orf24 to RAB5IF during gene set migration (ENSG00000101084 -> ENSG00000101084)
Intellectual disability syndromic and non-syndromic v2.0 IGBP1 Gene migrated from ENSG00000089289 to ENSG00000089289 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 C19orf12 Gene migrated from ENSG00000131943 to ENSG00000131943 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 C18orf32 Gene migrated from ENSG00000177576 to ENSG00000177576 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNTN3 Gene migrated from ENSG00000113805 to ENSG00000113805 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC2A10 Gene migrated from ENSG00000197496 to ENSG00000197496 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CFHR3 Gene migrated from ENSG00000116785 to ENSG00000116785 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC29A3 Gene migrated from ENSG00000198246 to ENSG00000198246 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2B5 Gene migrated from ENSG00000145191 to ENSG00000145191 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2B4 Gene migrated from ENSG00000115211 to ENSG00000115211 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2B3 Gene migrated from ENSG00000070785 to ENSG00000070785 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2B2 Gene migrated from ENSG00000119718 to ENSG00000119718 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CFHR1 Gene migrated from ENSG00000244414 to ENSG00000244414 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2B1 Gene migrated from ENSG00000111361 to ENSG00000111361 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC27A3 Gene migrated from ENSG00000143554 to ENSG00000143554 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A4 Gene migrated from ENSG00000151729 to ENSG00000151729 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2AK1 Gene migrated from ENSG00000086232 to ENSG00000086232 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CFH Gene migrated from ENSG00000000971 to ENSG00000000971 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A24 Gene migrated from ENSG00000085491 to ENSG00000085491 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF674 Gene migrated from ENSG00000251192 to ENSG00000251192 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EFNB2 Gene migrated from ENSG00000125266 to ENSG00000125266 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR18 Gene migrated from ENSG00000065268 to ENSG00000065268 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EFNB1 Gene migrated from ENSG00000090776 to ENSG00000090776 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A20 Gene migrated from ENSG00000178537 to ENSG00000178537 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KYNU Gene migrated from ENSG00000115919 to ENSG00000115919 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A19 Gene migrated from ENSG00000125454 to ENSG00000125454 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPRTN Gene migrated from ENSG00000010072 to ENSG00000010072 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A13 Gene migrated from ENSG00000004864 to ENSG00000004864 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBE2U Gene migrated from ENSG00000177414 to ENSG00000177414 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EDNRB Gene migrated from ENSG00000136160 to ENSG00000136160 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STAC3 Gene migrated from ENSG00000185482 to ENSG00000185482 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EDC3 Gene migrated from ENSG00000179151 to ENSG00000179151 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BMPER Gene migrated from ENSG00000164619 to ENSG00000164619 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC7A7 Gene migrated from ENSG00000155465 to ENSG00000155465 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IFT140 Gene migrated from ENSG00000187535 to ENSG00000187535 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BLM Gene migrated from ENSG00000197299 to ENSG00000197299 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BIN1 Gene migrated from ENSG00000136717 to ENSG00000136717 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC22A5 Gene migrated from ENSG00000197375 to ENSG00000197375 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BICD2 Gene migrated from ENSG00000185963 to ENSG00000185963 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCN11A Gene migrated from ENSG00000168356 to ENSG00000168356 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BDNF Gene migrated from ENSG00000176697 to ENSG00000176697 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DYNC2H1 Gene migrated from ENSG00000187240 to ENSG00000187240 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UQCRB Gene migrated from ENSG00000156467 to ENSG00000156467 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS45 Gene migrated from ENSG00000136631 to ENSG00000136631 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC1A3 Gene migrated from ENSG00000079215 to ENSG00000079215 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KLLN Gene migrated from ENSG00000227268 to ENSG00000227268 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DUOXA2 Gene migrated from ENSG00000140274 to ENSG00000140274 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR13 Gene migrated from ENSG00000101940 to ENSG00000101940 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DSE Gene migrated from ENSG00000111817 to ENSG00000111817 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCAT1 Gene migrated from ENSG00000060982 to ENSG00000060982 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS26C Gene symbol changed from DSCR3 to VPS26C during gene set migration (ENSG00000157538 -> ENSG00000157538)
Intellectual disability syndromic and non-syndromic v2.0 COMMD9 Gene migrated from ENSG00000110442 to ENSG00000110442 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ST7 Gene migrated from ENSG00000004866 to ENSG00000004866 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF185 Gene migrated from ENSG00000147394 to ENSG00000147394 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HARS2 Gene migrated from ENSG00000112855 to ENSG00000112855 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC6A4 Gene migrated from ENSG00000108576 to ENSG00000108576 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FHIP2A Gene symbol changed from FAM160B1 to FHIP2A during gene set migration (ENSG00000151553 -> ENSG00000151553)
Intellectual disability syndromic and non-syndromic v2.0 COL1A2 Gene migrated from ENSG00000164692 to ENSG00000164692 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WASHC5 Gene migrated from ENSG00000164961 to ENSG00000164961 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPP6 Gene migrated from ENSG00000130226 to ENSG00000130226 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FAM111A Gene migrated from ENSG00000166801 to ENSG00000166801 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPP10 Gene migrated from ENSG00000175497 to ENSG00000175497 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FAAH2 Gene migrated from ENSG00000165591 to ENSG00000165591 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPM3 Gene migrated from ENSG00000179085 to ENSG00000179085 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BANF1 Gene migrated from ENSG00000175334 to ENSG00000175334 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HAL Gene migrated from ENSG00000084110 to ENSG00000084110 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FA2H Gene migrated from ENSG00000103089 to ENSG00000103089 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC19A2 Gene migrated from ENSG00000117479 to ENSG00000117479 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HADH Gene migrated from ENSG00000138796 to ENSG00000138796 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KLF8 Gene migrated from ENSG00000102349 to ENSG00000102349 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UNC13D Gene migrated from ENSG00000092929 to ENSG00000092929 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIRREL3 Gene migrated from ENSG00000149571 to ENSG00000149571 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B3GAT3 Gene migrated from ENSG00000149541 to ENSG00000149541 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COL18A1 Gene migrated from ENSG00000182871 to ENSG00000182871 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 H19 Gene migrated from ENSG00000130600 to ENSG00000130600 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GYS2 Gene migrated from ENSG00000111713 to ENSG00000111713 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AVPR2 Gene migrated from ENSG00000126895 to ENSG00000126895 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AVPR1A Gene migrated from ENSG00000166148 to ENSG00000166148 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AVP Gene migrated from ENSG00000101200 to ENSG00000101200 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOK7 Gene migrated from ENSG00000175920 to ENSG00000175920 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPINK5 Gene migrated from ENSG00000133710 to ENSG00000133710 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOCK8 Gene migrated from ENSG00000107099 to ENSG00000107099 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 XPNPEP3 Gene migrated from ENSG00000196236 to ENSG00000196236 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATXN10 Gene migrated from ENSG00000130638 to ENSG00000130638 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPG7 Gene migrated from ENSG00000197912 to ENSG00000197912 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HYPK Gene migrated from ENSG00000242028 to ENSG00000242028 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TXNL4A Gene migrated from ENSG00000141759 to ENSG00000141759 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TWNK Gene migrated from ENSG00000107815 to ENSG00000107815 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPEG Gene migrated from ENSG00000072195 to ENSG00000072195 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP6V1C1 Gene migrated from ENSG00000155097 to ENSG00000155097 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTF2IRD1 Gene migrated from ENSG00000006704 to ENSG00000006704 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COMMD4 Gene migrated from ENSG00000140365 to ENSG00000140365 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNAJC6 Gene migrated from ENSG00000116675 to ENSG00000116675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNAJC3 Gene migrated from ENSG00000102580 to ENSG00000102580 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTF2H4 Gene migrated from ENSG00000213780 to ENSG00000213780 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDT1 Gene migrated from ENSG00000167513 to ENSG00000167513 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CYFIP1 Gene migrated from ENSG00000273749 to ENSG00000273749 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CMAS Gene migrated from ENSG00000111726 to ENSG00000111726 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLUAP1 Gene migrated from ENSG00000103351 to ENSG00000103351 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNAJA1 Gene migrated from ENSG00000086061 to ENSG00000086061 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP2C2 Gene migrated from ENSG00000064270 to ENSG00000064270 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNAH14 Gene migrated from ENSG00000185842 to ENSG00000185842 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF1B Gene migrated from ENSG00000054523 to ENSG00000054523 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATL1 Gene migrated from ENSG00000198513 to ENSG00000198513 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP2A2 Gene migrated from ENSG00000174437 to ENSG00000174437 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC12A1 Gene migrated from ENSG00000074803 to ENSG00000074803 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRPR Gene migrated from ENSG00000126010 to ENSG00000126010 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF16B Gene migrated from ENSG00000089177 to ENSG00000089177 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UQCRC2 Gene migrated from ENSG00000140740 to ENSG00000140740 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPS28 Gene migrated from ENSG00000233927 to ENSG00000233927 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP10A Gene migrated from ENSG00000206190 to ENSG00000206190 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DLK1 Gene migrated from ENSG00000185559 to ENSG00000185559 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLPP Gene migrated from ENSG00000125656 to ENSG00000125656 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DLGAP2 Gene migrated from ENSG00000198010 to ENSG00000198010 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPOX Gene migrated from ENSG00000143224 to ENSG00000143224 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PANK2 Gene migrated from ENSG00000125779 to ENSG00000125779 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED14 Gene migrated from ENSG00000180182 to ENSG00000180182 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NRXN2 Gene migrated from ENSG00000110076 to ENSG00000110076 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDSS2 Gene migrated from ENSG00000164494 to ENSG00000164494 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAT8L Gene migrated from ENSG00000185818 to ENSG00000185818 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLD2 Gene migrated from ENSG00000106628 to ENSG00000106628 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MCM4 Gene migrated from ENSG00000104738 to ENSG00000104738 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLD1 Gene migrated from ENSG00000062822 to ENSG00000062822 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLR3D Gene migrated from ENSG00000168495 to ENSG00000168495 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAGS Gene migrated from ENSG00000161653 to ENSG00000161653 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDGFB Gene migrated from ENSG00000100311 to ENSG00000100311 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAA30 Gene migrated from ENSG00000139977 to ENSG00000139977 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POU1F1 Gene migrated from ENSG00000064835 to ENSG00000064835 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDE11A Gene migrated from ENSG00000128655 to ENSG00000128655 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MARS2 Gene migrated from ENSG00000247626 to ENSG00000247626 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MARK4 Gene migrated from ENSG00000007047 to ENSG00000007047 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPID Gene migrated from ENSG00000171497 to ENSG00000171497 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYT1 Gene migrated from ENSG00000196132 to ENSG00000196132 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYO7A Gene migrated from ENSG00000137474 to ENSG00000137474 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NOP58 Gene migrated from ENSG00000055044 to ENSG00000055044 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYMK Gene migrated from ENSG00000187616 to ENSG00000187616 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYH3 Gene migrated from ENSG00000109063 to ENSG00000109063 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NOP10 Gene migrated from ENSG00000182117 to ENSG00000182117 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYCBP2 Gene migrated from ENSG00000005810 to ENSG00000005810 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGF Gene migrated from ENSG00000151665 to ENSG00000151665 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ORC6 Gene migrated from ENSG00000091651 to ENSG00000091651 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ORC4 Gene migrated from ENSG00000115947 to ENSG00000115947 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ORC1 Gene migrated from ENSG00000085840 to ENSG00000085840 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAGT1 Gene migrated from ENSG00000102158 to ENSG00000102158 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NIN Gene migrated from ENSG00000100503 to ENSG00000100503 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MACROD2 Gene migrated from ENSG00000172264 to ENSG00000172264 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NHLRC1 Gene migrated from ENSG00000187566 to ENSG00000187566 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTPAP Gene migrated from ENSG00000107951 to ENSG00000107951 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NHEJ1 Gene migrated from ENSG00000187736 to ENSG00000187736 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIP5K1B Gene migrated from ENSG00000107242 to ENSG00000107242 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NGF Gene migrated from ENSG00000134259 to ENSG00000134259 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTMR2 Gene migrated from ENSG00000087053 to ENSG00000087053 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTM1 Gene migrated from ENSG00000171100 to ENSG00000171100 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LSM11 Gene migrated from ENSG00000155858 to ENSG00000155858 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PINK1 Gene migrated from ENSG00000158828 to ENSG00000158828 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POP1 Gene migrated from ENSG00000104356 to ENSG00000104356 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCDH9 Gene migrated from ENSG00000184226 to ENSG00000184226 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LRP5 Gene migrated from ENSG00000162337 to ENSG00000162337 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WASHC3 Gene migrated from ENSG00000120860 to ENSG00000120860 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NFE2L1 Gene migrated from ENSG00000082641 to ENSG00000082641 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCDH15 Gene migrated from ENSG00000150275 to ENSG00000150275 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LMNA Gene migrated from ENSG00000160789 to ENSG00000160789 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIK3R1 Gene migrated from ENSG00000145675 to ENSG00000145675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCDH10 Gene migrated from ENSG00000138650 to ENSG00000138650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MSH6 Gene migrated from ENSG00000116062 to ENSG00000116062 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MRPS16 Gene migrated from ENSG00000182180 to ENSG00000182180 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NUP62 Gene migrated from ENSG00000213024 to ENSG00000213024 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIK3C3 Gene migrated from ENSG00000078142 to ENSG00000078142 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MRAP Gene migrated from ENSG00000170262 to ENSG00000170262 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRG1 Gene migrated from ENSG00000163285 to ENSG00000163285 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MPZ Gene migrated from ENSG00000158887 to ENSG00000158887 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NEGR1 Gene migrated from ENSG00000172260 to ENSG00000172260 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PON3 Gene migrated from ENSG00000105852 to ENSG00000105852 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MPI Gene migrated from ENSG00000178802 to ENSG00000178802 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHKG2 Gene migrated from ENSG00000156873 to ENSG00000156873 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCBD1 Gene migrated from ENSG00000166228 to ENSG00000166228 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 G6PC3 Gene migrated from ENSG00000141349 to ENSG00000141349 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHKA2 Gene migrated from ENSG00000044446 to ENSG00000044446 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MNX1 Gene migrated from ENSG00000130675 to ENSG00000130675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FZD3 Gene migrated from ENSG00000104290 to ENSG00000104290 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PNP Gene migrated from ENSG00000198805 to ENSG00000198805 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MLH1 Gene migrated from ENSG00000076242 to ENSG00000076242 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MIS18BP1 Gene migrated from ENSG00000129534 to ENSG00000129534 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MID2 Gene migrated from ENSG00000080561 to ENSG00000080561 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MGP Gene migrated from ENSG00000111341 to ENSG00000111341 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MGME1 Gene migrated from ENSG00000125871 to ENSG00000125871 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NTNG1 Gene migrated from ENSG00000162631 to ENSG00000162631 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MFN2 Gene migrated from ENSG00000116688 to ENSG00000116688 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAX7 Gene migrated from ENSG00000009709 to ENSG00000009709 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 METAP1 Gene migrated from ENSG00000164024 to ENSG00000164024 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MET Gene migrated from ENSG00000105976 to ENSG00000105976 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MEPCE Gene migrated from ENSG00000146834 to ENSG00000146834 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MELK Gene migrated from ENSG00000165304 to ENSG00000165304 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAX3 Gene migrated from ENSG00000135903 to ENSG00000135903 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAX2 Gene migrated from ENSG00000075891 to ENSG00000075891 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDN Gene migrated from ENSG00000182636 to ENSG00000182636 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLXNA2 Gene migrated from ENSG00000076356 to ENSG00000076356 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFS3 Gene migrated from ENSG00000213619 to ENSG00000213619 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MMGT1 Gene migrated from ENSG00000169446 to ENSG00000169446 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFS2 Gene migrated from ENSG00000158864 to ENSG00000158864 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGY Gene migrated from ENSG00000255072 to ENSG00000255072 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFB9 Gene migrated from ENSG00000147684 to ENSG00000147684 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NHP2 Gene migrated from ENSG00000145912 to ENSG00000145912 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFB3 Gene migrated from ENSG00000119013 to ENSG00000119013 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDE2A Gene migrated from ENSG00000186642 to ENSG00000186642 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFAF6 Gene migrated from ENSG00000156170 to ENSG00000156170 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFAF5 Gene migrated from ENSG00000101247 to ENSG00000101247 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MRTFB Gene symbol changed from MKL2 to MRTFB during gene set migration (ENSG00000186260 -> ENSG00000186260)
Intellectual disability syndromic and non-syndromic v2.0 NDUFAF4 Gene migrated from ENSG00000123545 to ENSG00000123545 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTERF3 Gene migrated from ENSG00000156469 to ENSG00000156469 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MIR17HG Gene migrated from ENSG00000215417 to ENSG00000215417 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIEZO2 Gene migrated from ENSG00000154864 to ENSG00000154864 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFAF3 Gene migrated from ENSG00000178057 to ENSG00000178057 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFAF2 Gene migrated from ENSG00000164182 to ENSG00000164182 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LINGO1 Gene migrated from ENSG00000169783 to ENSG00000169783 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFV2 Gene migrated from ENSG00000178127 to ENSG00000178127 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MOCS3 Gene migrated from ENSG00000124217 to ENSG00000124217 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MGA Gene migrated from ENSG00000174197 to ENSG00000174197 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFA9 Gene migrated from ENSG00000139180 to ENSG00000139180 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFA8 Gene migrated from ENSG00000119421 to ENSG00000119421 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MRPL3 Gene migrated from ENSG00000114686 to ENSG00000114686 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LYST Gene migrated from ENSG00000143669 to ENSG00000143669 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLEKHG2 Gene migrated from ENSG00000090924 to ENSG00000090924 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGU Gene migrated from ENSG00000101464 to ENSG00000101464 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NFXL1 Gene migrated from ENSG00000170448 to ENSG00000170448 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFS6 Gene migrated from ENSG00000145494 to ENSG00000145494 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NECAP1 Gene migrated from ENSG00000089818 to ENSG00000089818 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NUBP2 Gene migrated from ENSG00000095906 to ENSG00000095906 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFA11 Gene migrated from ENSG00000174886 to ENSG00000174886 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFA10 Gene migrated from ENSG00000130414 to ENSG00000130414 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PFAS Gene migrated from ENSG00000178921 to ENSG00000178921 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LIPT2 Gene migrated from ENSG00000175536 to ENSG00000175536 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED29 Gene migrated from ENSG00000063322 to ENSG00000063322 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAX1 Gene migrated from ENSG00000125813 to ENSG00000125813 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NMNAT1 Gene migrated from ENSG00000173614 to ENSG00000173614 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLCH1 Gene migrated from ENSG00000114805 to ENSG00000114805 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED22 Gene migrated from ENSG00000148297 to ENSG00000148297 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LRRC8C Gene migrated from ENSG00000171488 to ENSG00000171488 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MANF Gene migrated from ENSG00000145050 to ENSG00000145050 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KGD4 Gene symbol changed from MRPS36 to KGD4 during gene set migration (ENSG00000134056 -> ENSG00000134056)
Intellectual disability syndromic and non-syndromic v2.0 NLGN1 Gene migrated from ENSG00000169760 to ENSG00000169760 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LRRC45 Gene migrated from ENSG00000169683 to ENSG00000169683 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NCAPG2 Gene migrated from ENSG00000146918 to ENSG00000146918 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHC1 Gene migrated from ENSG00000111752 to ENSG00000111752 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NBN Gene migrated from ENSG00000104320 to ENSG00000104320 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDS5B Gene migrated from ENSG00000083642 to ENSG00000083642 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDS5A Gene migrated from ENSG00000121892 to ENSG00000121892 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAV2 Gene migrated from ENSG00000166833 to ENSG00000166833 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MDGA1 Gene migrated from ENSG00000112139 to ENSG00000112139 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAN2A2 Gene migrated from ENSG00000196547 to ENSG00000196547 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHACTR4 Gene migrated from ENSG00000204138 to ENSG00000204138 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LRRC32 Gene migrated from ENSG00000137507 to ENSG00000137507 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAL Gene migrated from ENSG00000172005 to ENSG00000172005 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLOD3 Gene migrated from ENSG00000106397 to ENSG00000106397 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MCCC2 Gene migrated from ENSG00000131844 to ENSG00000131844 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MCCC1 Gene migrated from ENSG00000078070 to ENSG00000078070 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCNT Gene migrated from ENSG00000160299 to ENSG00000160299 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NUP85 Gene migrated from ENSG00000125450 to ENSG00000125450 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPM1K Gene migrated from ENSG00000163644 to ENSG00000163644 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCNA Gene migrated from ENSG00000132646 to ENSG00000132646 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PJA1 Gene migrated from ENSG00000181191 to ENSG00000181191 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AASS Gene migrated from ENSG00000008311 to ENSG00000008311 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UQCC2 Gene migrated from ENSG00000137288 to ENSG00000137288 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ITGA7 Gene migrated from ENSG00000135424 to ENSG00000135424 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCD2 Gene migrated from ENSG00000108604 to ENSG00000108604 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ITCH Gene migrated from ENSG00000078747 to ENSG00000078747 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COG3 Gene migrated from ENSG00000136152 to ENSG00000136152 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FKBP4 Gene migrated from ENSG00000004478 to ENSG00000004478 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IRF2BP1 Gene migrated from ENSG00000170604 to ENSG00000170604 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FICD Gene migrated from ENSG00000198855 to ENSG00000198855 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IQSEC3 Gene migrated from ENSG00000120645 to ENSG00000120645 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STN1 Gene migrated from ENSG00000107960 to ENSG00000107960 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNKSR1 Gene migrated from ENSG00000142675 to ENSG00000142675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FGFR2 Gene migrated from ENSG00000066468 to ENSG00000066468 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UNC13C Gene migrated from ENSG00000137766 to ENSG00000137766 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FEM1C Gene migrated from ENSG00000145780 to ENSG00000145780 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLCN7 Gene migrated from ENSG00000103249 to ENSG00000103249 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SACS Gene migrated from ENSG00000151835 to ENSG00000151835 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLCN2 Gene migrated from ENSG00000114859 to ENSG00000114859 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RUSC2 Gene migrated from ENSG00000198853 to ENSG00000198853 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 YAP1 Gene migrated from ENSG00000137693 to ENSG00000137693 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IMPA1 Gene migrated from ENSG00000133731 to ENSG00000133731 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHST14 Gene migrated from ENSG00000169105 to ENSG00000169105 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHRM1 Gene migrated from ENSG00000168539 to ENSG00000168539 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHMP3 Gene migrated from ENSG00000115561 to ENSG00000115561 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IKZF2 Gene migrated from ENSG00000030419 to ENSG00000030419 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC9A7 Gene migrated from ENSG00000065923 to ENSG00000065923 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP89 Gene migrated from ENSG00000121289 to ENSG00000121289 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP63 Gene migrated from ENSG00000182923 to ENSG00000182923 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FANCG Gene migrated from ENSG00000221829 to ENSG00000221829 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FANCD2 Gene migrated from ENSG00000144554 to ENSG00000144554 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FANCB Gene migrated from ENSG00000181544 to ENSG00000181544 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACACA Gene migrated from ENSG00000278540 to ENSG00000278540 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ICE1 Gene migrated from ENSG00000164151 to ENSG00000164151 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZDHHC16 Gene migrated from ENSG00000171307 to ENSG00000171307 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HYLS1 Gene migrated from ENSG00000198331 to ENSG00000198331 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXOSC4 Gene migrated from ENSG00000178896 to ENSG00000178896 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDO1 Gene migrated from ENSG00000129596 to ENSG00000129596 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDKN1C Gene migrated from ENSG00000129757 to ENSG00000129757 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDKL2 Gene migrated from ENSG00000138769 to ENSG00000138769 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK9 Gene migrated from ENSG00000136807 to ENSG00000136807 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXOSC2 Gene migrated from ENSG00000130713 to ENSG00000130713 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXOSC10 Gene migrated from ENSG00000171824 to ENSG00000171824 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HTT Gene migrated from ENSG00000197386 to ENSG00000197386 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPS23 Gene migrated from ENSG00000186468 to ENSG00000186468 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXOC2 Gene migrated from ENSG00000112685 to ENSG00000112685 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HSPA9 Gene migrated from ENSG00000113013 to ENSG00000113013 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CD96 Gene migrated from ENSG00000153283 to ENSG00000153283 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC5A5 Gene migrated from ENSG00000105641 to ENSG00000105641 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CENATAC Gene symbol changed from CCDC84 to CENATAC during gene set migration (ENSG00000186166 -> ENSG00000186166)
Intellectual disability syndromic and non-syndromic v2.0 ERGIC3 Gene migrated from ENSG00000125991 to ENSG00000125991 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC78 Gene migrated from ENSG00000162004 to ENSG00000162004 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC174 Gene migrated from ENSG00000154781 to ENSG00000154781 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SREK1 Gene migrated from ENSG00000153914 to ENSG00000153914 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SREBF2 Gene migrated from ENSG00000198911 to ENSG00000198911 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERBB4 Gene migrated from ENSG00000178568 to ENSG00000178568 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EPHA7 Gene migrated from ENSG00000135333 to ENSG00000135333 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC35F1 Gene migrated from ENSG00000196376 to ENSG00000196376 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC35B2 Gene migrated from ENSG00000157593 to ENSG00000157593 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC35A3 Gene migrated from ENSG00000117620 to ENSG00000117620 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAMK2G Gene migrated from ENSG00000148660 to ENSG00000148660 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EMX2 Gene migrated from ENSG00000170370 to ENSG00000170370 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EMG1 Gene migrated from ENSG00000126749 to ENSG00000126749 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNB4 Gene migrated from ENSG00000182389 to ENSG00000182389 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC35A1 Gene migrated from ENSG00000164414 to ENSG00000164414 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA2D1 Gene migrated from ENSG00000153956 to ENSG00000153956 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 H4C11 Gene symbol changed from HIST1H4J to H4C11 during gene set migration (ENSG00000197238 -> ENSG00000197238)
Intellectual disability syndromic and non-syndromic v2.0 MIDEAS Gene symbol changed from ELMSAN1 to MIDEAS during gene set migration (ENSG00000156030 -> ENSG00000156030)
Intellectual disability syndromic and non-syndromic v2.0 H4C6 Gene symbol changed from HIST1H4F to H4C6 during gene set migration (ENSG00000274618 -> ENSG00000274618)
Intellectual disability syndromic and non-syndromic v2.0 ZC3H14 Gene migrated from ENSG00000100722 to ENSG00000100722 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 H4C4 Gene symbol changed from HIST1H4D to H4C4 during gene set migration (ENSG00000277157 -> ENSG00000277157)
Intellectual disability syndromic and non-syndromic v2.0 CFAP418 Gene symbol changed from C8orf37 to CFAP418 during gene set migration (ENSG00000156172 -> ENSG00000156172)
Intellectual disability syndromic and non-syndromic v2.0 TRPC5 Gene migrated from ENSG00000072315 to ENSG00000072315 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF3K Gene migrated from ENSG00000178982 to ENSG00000178982 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF3I Gene migrated from ENSG00000084623 to ENSG00000084623 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC2A2 Gene migrated from ENSG00000163581 to ENSG00000163581 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTNAP1 Gene symbol changed from C17orf80 to MTNAP1 during gene set migration (ENSG00000141219 -> ENSG00000141219)
Intellectual disability syndromic and non-syndromic v2.0 ZBTB7B Gene migrated from ENSG00000160685 to ENSG00000160685 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BUB1 Gene migrated from ENSG00000169679 to ENSG00000169679 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2A Gene migrated from ENSG00000144895 to ENSG00000144895 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRIP1 Gene migrated from ENSG00000136492 to ENSG00000136492 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF668 Gene migrated from ENSG00000167394 to ENSG00000167394 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HEATR5B Gene migrated from ENSG00000008869 to ENSG00000008869 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HEATR3 Gene migrated from ENSG00000155393 to ENSG00000155393 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC20A2 Gene migrated from ENSG00000168575 to ENSG00000168575 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCORL1 Gene migrated from ENSG00000085185 to ENSG00000085185 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBA7 Gene migrated from ENSG00000182179 to ENSG00000182179 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DSCAM Gene migrated from ENSG00000171587 to ENSG00000171587 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DROSHA Gene migrated from ENSG00000113360 to ENSG00000113360 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HAX1 Gene migrated from ENSG00000143575 to ENSG00000143575 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HARS1 Gene symbol changed from HARS to HARS1 during gene set migration (ENSG00000170445 -> ENSG00000170445)
Intellectual disability syndromic and non-syndromic v2.0 DPYSL2 Gene migrated from ENSG00000092964 to ENSG00000092964 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC1A1 Gene migrated from ENSG00000106688 to ENSG00000106688 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPYD Gene migrated from ENSG00000188641 to ENSG00000188641 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBOX1 Gene migrated from ENSG00000129151 to ENSG00000129151 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BAZ2B Gene migrated from ENSG00000123636 to ENSG00000123636 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WFS1 Gene migrated from ENSG00000109501 to ENSG00000109501 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS37A Gene migrated from ENSG00000155975 to ENSG00000155975 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B3GALT6 Gene migrated from ENSG00000176022 to ENSG00000176022 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATXN2L Gene migrated from ENSG00000168488 to ENSG00000168488 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF5A Gene migrated from ENSG00000155980 to ENSG00000155980 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDTC1 Gene migrated from ENSG00000142784 to ENSG00000142784 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF21A Gene migrated from ENSG00000139116 to ENSG00000139116 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNAJA3 Gene migrated from ENSG00000103423 to ENSG00000103423 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP5F1E Gene symbol changed from ATP5E to ATP5F1E during gene set migration (ENSG00000124172 -> ENSG00000124172)
Intellectual disability syndromic and non-syndromic v2.0 ATP13A2 Gene migrated from ENSG00000159363 to ENSG00000159363 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP11A Gene migrated from ENSG00000068650 to ENSG00000068650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATM Gene migrated from ENSG00000149311 to ENSG00000149311 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUFM Gene migrated from ENSG00000178952 to ENSG00000178952 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DLG2 Gene migrated from ENSG00000150672 to ENSG00000150672 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATAD2B Gene migrated from ENSG00000119778 to ENSG00000119778 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBGCP4 Gene migrated from ENSG00000137822 to ENSG00000137822 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRORP Gene symbol changed from KIAA0391 to PRORP during gene set migration (ENSG00000100890 -> ENSG00000100890)
Intellectual disability syndromic and non-syndromic v2.0 ASTN2 Gene migrated from ENSG00000148219 to ENSG00000148219 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX9 Gene migrated from ENSG00000125398 to ENSG00000125398 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHX32 Gene migrated from ENSG00000089876 to ENSG00000089876 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHTKD1 Gene migrated from ENSG00000181192 to ENSG00000181192 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASAP2 Gene migrated from ENSG00000151693 to ENSG00000151693 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZBTB16 Gene migrated from ENSG00000109906 to ENSG00000109906 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPN2 Gene migrated from ENSG00000142751 to ENSG00000142751 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX3 Gene migrated from ENSG00000134595 to ENSG00000134595 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF865 Gene migrated from ENSG00000261221 to ENSG00000261221 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR59 Gene migrated from ENSG00000103091 to ENSG00000103091 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DENR Gene migrated from ENSG00000139726 to ENSG00000139726 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARNT2 Gene migrated from ENSG00000172379 to ENSG00000172379 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GORAB Gene migrated from ENSG00000120370 to ENSG00000120370 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARHGEF40 Gene migrated from ENSG00000165801 to ENSG00000165801 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARHGAP31 Gene migrated from ENSG00000031081 to ENSG00000031081 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 YWHAZ Gene migrated from ENSG00000164924 to ENSG00000164924 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AQP4 Gene migrated from ENSG00000171885 to ENSG00000171885 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTL Gene migrated from ENSG00000114999 to ENSG00000114999 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNAQ Gene migrated from ENSG00000156052 to ENSG00000156052 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNK3 Gene migrated from ENSG00000171303 to ENSG00000171303 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNRPN Gene migrated from ENSG00000128739 to ENSG00000128739 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DCAF15 Gene migrated from ENSG00000132017 to ENSG00000132017 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF407 Gene migrated from ENSG00000215421 to ENSG00000215421 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GMNN Gene migrated from ENSG00000112312 to ENSG00000112312 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNJ1 Gene migrated from ENSG00000151704 to ENSG00000151704 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLYCTK Gene migrated from ENSG00000168237 to ENSG00000168237 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANAPC7 Gene migrated from ENSG00000196510 to ENSG00000196510 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNORD118 Gene migrated from ENSG00000200463 to ENSG00000200463 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNIP1 Gene migrated from ENSG00000163877 to ENSG00000163877 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALX4 Gene migrated from ENSG00000052850 to ENSG00000052850 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALX3 Gene migrated from ENSG00000156150 to ENSG00000156150 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALX1 Gene migrated from ENSG00000180318 to ENSG00000180318 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 YKT6 Gene migrated from ENSG00000106636 to ENSG00000106636 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SEMA5A Gene migrated from ENSG00000112902 to ENSG00000112902 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SEMA3E Gene migrated from ENSG00000170381 to ENSG00000170381 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 USP14 Gene migrated from ENSG00000101557 to ENSG00000101557 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALDOA Gene migrated from ENSG00000149925 to ENSG00000149925 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTNND1 Gene migrated from ENSG00000198561 to ENSG00000198561 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTC1 Gene migrated from ENSG00000178971 to ENSG00000178971 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AKAP6 Gene migrated from ENSG00000151320 to ENSG00000151320 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSTF2 Gene migrated from ENSG00000101811 to ENSG00000101811 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP5MK Gene symbol changed from USMG5 to ATP5MK during gene set migration (ENSG00000173915 -> ENSG00000173915)
Intellectual disability syndromic and non-syndromic v2.0 TSHZ3 Gene migrated from ENSG00000121297 to ENSG00000121297 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSNK1G1 Gene migrated from ENSG00000169118 to ENSG00000169118 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGPAT3 Gene migrated from ENSG00000160216 to ENSG00000160216 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSF1R Gene migrated from ENSG00000182578 to ENSG00000182578 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GBA1 Gene symbol changed from GBA to GBA1 during gene set migration (ENSG00000177628 -> ENSG00000177628)
Intellectual disability syndromic and non-syndromic v2.0 ADD1 Gene migrated from ENSG00000087274 to ENSG00000087274 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADCY5 Gene migrated from ENSG00000173175 to ENSG00000173175 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRBN Gene migrated from ENSG00000113851 to ENSG00000113851 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 JPH3 Gene migrated from ENSG00000154118 to ENSG00000154118 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADAM23 Gene migrated from ENSG00000114948 to ENSG00000114948 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCN3B Gene migrated from ENSG00000166257 to ENSG00000166257 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX7B Gene migrated from ENSG00000131174 to ENSG00000131174 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX20 Gene migrated from ENSG00000203667 to ENSG00000203667 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX14 Gene migrated from ENSG00000178449 to ENSG00000178449 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACAT1 Gene migrated from ENSG00000075239 to ENSG00000075239 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACADSB Gene migrated from ENSG00000196177 to ENSG00000196177 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACADS Gene migrated from ENSG00000122971 to ENSG00000122971 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABI2 Gene migrated from ENSG00000138443 to ENSG00000138443 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COQ9 Gene migrated from ENSG00000088682 to ENSG00000088682 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 JAKMIP1 Gene migrated from ENSG00000152969 to ENSG00000152969 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABCB7 Gene migrated from ENSG00000131269 to ENSG00000131269 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COQ2 Gene migrated from ENSG00000173085 to ENSG00000173085 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FOXR1 Gene migrated from ENSG00000176302 to ENSG00000176302 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TNIK Gene migrated from ENSG00000154310 to ENSG00000154310 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TARS1 Gene symbol changed from TARS to TARS1 during gene set migration (ENSG00000113407 -> ENSG00000113407)
Intellectual disability syndromic and non-syndromic v2.0 RAB14 Gene migrated from ENSG00000119396 to ENSG00000119396 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RMRP Gene migrated from ENSG00000269900 to ENSG00000277027 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAF13 Gene migrated from ENSG00000197780 to ENSG00000197780 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TACO1 Gene migrated from ENSG00000136463 to ENSG00000136463 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RIC1 Gene migrated from ENSG00000107036 to ENSG00000107036 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTPRD Gene migrated from ENSG00000153707 to ENSG00000153707 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TKT Gene migrated from ENSG00000163931 to ENSG00000163931 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TKFC Gene migrated from ENSG00000149476 to ENSG00000149476 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTPA Gene migrated from ENSG00000119383 to ENSG00000119383 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FRMD4A Gene migrated from ENSG00000151474 to ENSG00000151474 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 REPS2 Gene migrated from ENSG00000169891 to ENSG00000169891 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTBP2 Gene migrated from ENSG00000117569 to ENSG00000117569 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSPAN7 Gene migrated from ENSG00000156298 to ENSG00000156298 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SV2A Gene migrated from ENSG00000159164 to ENSG00000159164 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBMX Gene migrated from ENSG00000147274 to ENSG00000147274 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSMB1 Gene migrated from ENSG00000008018 to ENSG00000008018 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSAT1 Gene migrated from ENSG00000135069 to ENSG00000135069 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBM28 Gene migrated from ENSG00000106344 to ENSG00000106344 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRSS12 Gene migrated from ENSG00000164099 to ENSG00000164099 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRRT2 Gene migrated from ENSG00000167371 to ENSG00000167371 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBX2 Gene migrated from ENSG00000121068 to ENSG00000121068 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIP13 Gene migrated from ENSG00000071539 to ENSG00000071539 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUPT6H Gene migrated from ENSG00000109111 to ENSG00000109111 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRODH Gene migrated from ENSG00000100033 to ENSG00000100033 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 THRB Gene migrated from ENSG00000151090 to ENSG00000151090 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM231 Gene migrated from ENSG00000205084 to ENSG00000205084 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRKD1 Gene migrated from ENSG00000184304 to ENSG00000184304 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRICKLE2 Gene migrated from ENSG00000163637 to ENSG00000163637 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 THG1L Gene migrated from ENSG00000113272 to ENSG00000113272 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBCB Gene migrated from ENSG00000105254 to ENSG00000105254 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP5C Gene migrated from ENSG00000011485 to ENSG00000011485 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TNK2 Gene migrated from ENSG00000061938 to ENSG00000061938 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP2R2B Gene migrated from ENSG00000156475 to ENSG00000156475 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEDS1 Gene symbol changed from TMEM189 to PEDS1 during gene set migration (ENSG00000240849 -> ENSG00000240849)
Intellectual disability syndromic and non-syndromic v2.0 PPP1R3F Gene migrated from ENSG00000049769 to ENSG00000049769 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TGFB1 Gene migrated from ENSG00000105329 to ENSG00000105329 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FTCD Gene migrated from ENSG00000160282 to ENSG00000160282 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNU5A-1 Gene migrated from ENSG00000199568 to ENSG00000199568 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FRYL Gene migrated from ENSG00000075539 to ENSG00000075539 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FRY Gene migrated from ENSG00000073910 to ENSG00000073910 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAB2 Gene migrated from ENSG00000055208 to ENSG00000055208 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SZT2 Gene migrated from ENSG00000198198 to ENSG00000198198 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SYT1 Gene migrated from ENSG00000067715 to ENSG00000067715 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SYP Gene migrated from ENSG00000102003 to ENSG00000102003 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SYNJ1 Gene migrated from ENSG00000159082 to ENSG00000159082 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SYNGAP1 Gene migrated from ENSG00000197283 to ENSG00000197283 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SYNCRIP Gene migrated from ENSG00000135316 to ENSG00000135316 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SYN1 Gene migrated from ENSG00000008056 to ENSG00000008056 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SVBP Gene migrated from ENSG00000177868 to ENSG00000177868 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUZ12 Gene migrated from ENSG00000178691 to ENSG00000178691 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SURF1 Gene migrated from ENSG00000148290 to ENSG00000148290 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUPT4H1 Gene migrated from ENSG00000213246 to ENSG00000213246 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUPT16H Gene migrated from ENSG00000092201 to ENSG00000092201 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUOX Gene migrated from ENSG00000139531 to ENSG00000139531 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUMF1 Gene migrated from ENSG00000144455 to ENSG00000144455 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUFU Gene migrated from ENSG00000107882 to ENSG00000107882 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUCO Gene migrated from ENSG00000094975 to ENSG00000094975 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUCLG1 Gene migrated from ENSG00000163541 to ENSG00000163541 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SUCLA2 Gene migrated from ENSG00000136143 to ENSG00000136143 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STXBP1 Gene migrated from ENSG00000136854 to ENSG00000136854 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STX1B Gene migrated from ENSG00000099365 to ENSG00000099365 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STX1A Gene migrated from ENSG00000106089 to ENSG00000106089 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNU6ATAC Gene migrated from ENSG00000221676 to ENSG00000221676 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNU5B-1 Gene migrated from ENSG00000200156 to ENSG00000200156 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNU4ATAC Gene migrated from ENSG00000264229 to ENSG00000264229 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNU4-2 Gene migrated from ENSG00000202538 to ENSG00000202538 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNU2-2 Gene symbol changed from RNU2-2P to RNU2-2 during gene set migration (ENSG00000222328 -> ENSG00000222328)
Intellectual disability syndromic and non-syndromic v2.0 RNPC3 Gene migrated from ENSG00000185946 to ENSG00000185946 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNF220 Gene migrated from ENSG00000187147 to ENSG00000187147 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNF2 Gene migrated from ENSG00000121481 to ENSG00000121481 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNF13 Gene migrated from ENSG00000082996 to ENSG00000082996 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNF125 Gene migrated from ENSG00000101695 to ENSG00000101695 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNF113A Gene migrated from ENSG00000125352 to ENSG00000125352 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNASET2 Gene migrated from ENSG00000026297 to ENSG00000026297 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNASEH2C Gene migrated from ENSG00000172922 to ENSG00000172922 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNASEH2B Gene migrated from ENSG00000136104 to ENSG00000136104 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNASEH2A Gene migrated from ENSG00000104889 to ENSG00000104889 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RMND1 Gene migrated from ENSG00000155906 to ENSG00000155906 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RLIM Gene migrated from ENSG00000131263 to ENSG00000131263 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RIT1 Gene migrated from ENSG00000143622 to ENSG00000143622 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RING1 Gene migrated from ENSG00000204227 to ENSG00000204227 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RICTOR Gene migrated from ENSG00000164327 to ENSG00000164327 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RHOBTB2 Gene migrated from ENSG00000008853 to ENSG00000008853 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RHEB Gene migrated from ENSG00000106615 to ENSG00000106615 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RFX7 Gene migrated from ENSG00000181827 to ENSG00000181827 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RFX4 Gene migrated from ENSG00000111783 to ENSG00000111783 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RFX3 Gene migrated from ENSG00000080298 to ENSG00000080298 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RFT1 Gene migrated from ENSG00000163933 to ENSG00000163933 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RFC4 Gene migrated from ENSG00000163918 to ENSG00000163918 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RERE Gene migrated from ENSG00000142599 to ENSG00000142599 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RELN Gene migrated from ENSG00000189056 to ENSG00000189056 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RDH11 Gene migrated from ENSG00000072042 to ENSG00000072042 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBSN Gene migrated from ENSG00000131381 to ENSG00000131381 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBM10 Gene migrated from ENSG00000182872 to ENSG00000182872 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBL2 Gene migrated from ENSG00000103479 to ENSG00000103479 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBFOX1 Gene migrated from ENSG00000078328 to ENSG00000078328 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBBP8 Gene migrated from ENSG00000101773 to ENSG00000101773 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RBBP5 Gene migrated from ENSG00000117222 to ENSG00000117222 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RARS2 Gene migrated from ENSG00000146282 to ENSG00000146282 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RARS1 Gene symbol changed from RARS to RARS1 during gene set migration (ENSG00000113643 -> ENSG00000113643)
Intellectual disability syndromic and non-syndromic v2.0 RARB Gene migrated from ENSG00000077092 to ENSG00000077092 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAPGEF2 Gene migrated from ENSG00000109756 to ENSG00000109756 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAP1GDS1 Gene migrated from ENSG00000138698 to ENSG00000138698 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAP1B Gene migrated from ENSG00000127314 to ENSG00000127314 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RALGAPA1 Gene migrated from ENSG00000174373 to ENSG00000174373 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RALA Gene migrated from ENSG00000006451 to ENSG00000006451 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAI1 Gene migrated from ENSG00000108557 to ENSG00000108557 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAF1 Gene migrated from ENSG00000132155 to ENSG00000132155 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAD21 Gene migrated from ENSG00000164754 to ENSG00000164754 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAC3 Gene migrated from ENSG00000169750 to ENSG00000169750 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAC1 Gene migrated from ENSG00000136238 to ENSG00000136238 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RABGAP1 Gene migrated from ENSG00000011454 to ENSG00000011454 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB5C Gene migrated from ENSG00000108774 to ENSG00000108774 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB3GAP2 Gene migrated from ENSG00000118873 to ENSG00000118873 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB3GAP1 Gene migrated from ENSG00000115839 to ENSG00000115839 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB3A Gene migrated from ENSG00000105649 to ENSG00000105649 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB39B Gene migrated from ENSG00000155961 to ENSG00000155961 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB23 Gene migrated from ENSG00000112210 to ENSG00000112210 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB1A Gene migrated from ENSG00000138069 to ENSG00000138069 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB18 Gene migrated from ENSG00000099246 to ENSG00000099246 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB11B Gene migrated from ENSG00000185236 to ENSG00000185236 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RAB11A Gene migrated from ENSG00000103769 to ENSG00000103769 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 QRICH1 Gene migrated from ENSG00000198218 to ENSG00000198218 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 QDPR Gene migrated from ENSG00000151552 to ENSG00000151552 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 QARS1 Gene symbol changed from QARS to QARS1 during gene set migration (ENSG00000172053 -> ENSG00000172053)
Intellectual disability syndromic and non-syndromic v2.0 PYCR2 Gene migrated from ENSG00000143811 to ENSG00000143811 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PYCR1 Gene migrated from ENSG00000183010 to ENSG00000183010 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PUS7 Gene migrated from ENSG00000091127 to ENSG00000091127 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PUS3 Gene migrated from ENSG00000110060 to ENSG00000110060 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PUS1 Gene migrated from ENSG00000177192 to ENSG00000177192 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PURA Gene migrated from ENSG00000185129 to ENSG00000185129 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PUM1 Gene migrated from ENSG00000134644 to ENSG00000134644 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PUF60 Gene migrated from ENSG00000179950 to ENSG00000179950 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTS Gene migrated from ENSG00000150787 to ENSG00000150787 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTRHD1 Gene migrated from ENSG00000184924 to ENSG00000184924 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTRH2 Gene migrated from ENSG00000141378 to ENSG00000141378 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTPN4 Gene migrated from ENSG00000088179 to ENSG00000088179 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTPN23 Gene migrated from ENSG00000076201 to ENSG00000076201 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTPN11 Gene migrated from ENSG00000179295 to ENSG00000179295 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTPN1 Gene migrated from ENSG00000196396 to ENSG00000196396 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTPMT1 Gene migrated from ENSG00000110536 to ENSG00000110536 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTF1A Gene migrated from ENSG00000168267 to ENSG00000168267 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTEN Gene migrated from ENSG00000171862 to ENSG00000171862 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTDSS1 Gene migrated from ENSG00000156471 to ENSG00000156471 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTCHD1 Gene migrated from ENSG00000165186 to ENSG00000165186 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTCH1 Gene migrated from ENSG00000185920 to ENSG00000185920 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTCD3 Gene migrated from ENSG00000132300 to ENSG00000132300 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PTBP1 Gene migrated from ENSG00000011304 to ENSG00000011304 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSPH Gene migrated from ENSG00000146733 to ENSG00000146733 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSMF1 Gene migrated from ENSG00000125818 to ENSG00000125818 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSMD12 Gene migrated from ENSG00000197170 to ENSG00000197170 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSMD11 Gene migrated from ENSG00000108671 to ENSG00000108671 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSMC5 Gene migrated from ENSG00000087191 to ENSG00000087191 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSMC3 Gene migrated from ENSG00000165916 to ENSG00000165916 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PSAP Gene migrated from ENSG00000197746 to ENSG00000197746 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRUNE1 Gene migrated from ENSG00000143363 to ENSG00000143363 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRR12 Gene migrated from ENSG00000126464 to ENSG00000126464 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRPS1 Gene migrated from ENSG00000147224 to ENSG00000147224 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRPF8 Gene migrated from ENSG00000174231 to ENSG00000174231 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRPF19 Gene migrated from ENSG00000110107 to ENSG00000110107 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRMT9 Gene migrated from ENSG00000164169 to ENSG00000164169 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRMT7 Gene migrated from ENSG00000132600 to ENSG00000132600 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRMT1 Gene migrated from ENSG00000126457 to ENSG00000126457 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRKAR1B Gene migrated from ENSG00000188191 to ENSG00000188191 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRKAR1A Gene migrated from ENSG00000108946 to ENSG00000108946 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRKACB Gene migrated from ENSG00000142875 to ENSG00000142875 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PRDM13 Gene migrated from ENSG00000112238 to ENSG00000112238 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PQBP1 Gene migrated from ENSG00000102103 to ENSG00000102103 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPT1 Gene migrated from ENSG00000131238 to ENSG00000131238 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP3CA Gene migrated from ENSG00000138814 to ENSG00000138814 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP2R5C Gene migrated from ENSG00000078304 to ENSG00000078304 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP2R1A Gene migrated from ENSG00000105568 to ENSG00000105568 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP2R5D Gene migrated from ENSG00000112640 to ENSG00000112640 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP2CA Gene migrated from ENSG00000113575 to ENSG00000113575 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP1R21 Gene migrated from ENSG00000162869 to ENSG00000162869 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP1R15B Gene migrated from ENSG00000158615 to ENSG00000158615 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FCSK Gene symbol changed from FUK to FCSK during gene set migration (ENSG00000157353 -> ENSG00000157353)
Intellectual disability syndromic and non-syndromic v2.0 FUCA1 Gene migrated from ENSG00000179163 to ENSG00000179163 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FTSJ1 Gene migrated from ENSG00000068438 to ENSG00000068438 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FTO Gene migrated from ENSG00000140718 to ENSG00000140718 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FSD1L Gene migrated from ENSG00000106701 to ENSG00000106701 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRMT10A Gene migrated from ENSG00000145331 to ENSG00000145331 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRMT1 Gene migrated from ENSG00000104907 to ENSG00000104907 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIT1 Gene migrated from ENSG00000043514 to ENSG00000043514 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIP12 Gene migrated from ENSG00000153827 to ENSG00000153827 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIO Gene migrated from ENSG00000038382 to ENSG00000038382 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIM8 Gene migrated from ENSG00000171206 to ENSG00000171206 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRIM71 Gene migrated from ENSG00000206557 to ENSG00000206557 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TREX1 Gene migrated from ENSG00000213689 to ENSG00000213689 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAPPC9 Gene migrated from ENSG00000167632 to ENSG00000167632 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAPPC6B Gene migrated from ENSG00000182400 to ENSG00000182400 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAPPC4 Gene migrated from ENSG00000196655 to ENSG00000196655 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAPPC2L Gene migrated from ENSG00000167515 to ENSG00000167515 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAPPC12 Gene migrated from ENSG00000171853 to ENSG00000171853 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAPPC11 Gene migrated from ENSG00000168538 to ENSG00000168538 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAPPC10 Gene migrated from ENSG00000160218 to ENSG00000160218 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAK1 Gene migrated from ENSG00000182606 to ENSG00000182606 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAIP Gene migrated from ENSG00000183763 to ENSG00000183763 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRAF7 Gene migrated from ENSG00000131653 to ENSG00000131653 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRA2B Gene migrated from ENSG00000136527 to ENSG00000136527 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TPP2 Gene migrated from ENSG00000134900 to ENSG00000134900 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TPP1 Gene migrated from ENSG00000166340 to ENSG00000166340 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TP73 Gene migrated from ENSG00000078900 to ENSG00000078900 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TOP2B Gene migrated from ENSG00000077097 to ENSG00000077097 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TOGARAM1 Gene migrated from ENSG00000198718 to ENSG00000198718 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TOE1 Gene migrated from ENSG00000132773 to ENSG00000132773 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TNRC6B Gene migrated from ENSG00000100354 to ENSG00000100354 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TNR Gene migrated from ENSG00000116147 to ENSG00000116147 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TNPO2 Gene migrated from ENSG00000105576 to ENSG00000105576 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMX2 Gene migrated from ENSG00000213593 to ENSG00000213593 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMTC3 Gene migrated from ENSG00000139324 to ENSG00000139324 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM94 Gene migrated from ENSG00000177728 to ENSG00000177728 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM70 Gene migrated from ENSG00000175606 to ENSG00000175606 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM67 Gene migrated from ENSG00000164953 to ENSG00000164953 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM63C Gene migrated from ENSG00000165548 to ENSG00000165548 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM63B Gene migrated from ENSG00000137216 to ENSG00000137216 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RXYLT1 Gene symbol changed from TMEM5 to RXYLT1 during gene set migration (ENSG00000118600 -> ENSG00000118600)
Intellectual disability syndromic and non-syndromic v2.0 LYSET Gene symbol changed from TMEM251 to LYSET during gene set migration (ENSG00000153485 -> ENSG00000153485)
Intellectual disability syndromic and non-syndromic v2.0 TMEM240 Gene migrated from ENSG00000205090 to ENSG00000205090 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM237 Gene migrated from ENSG00000155755 to ENSG00000155755 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM222 Gene migrated from ENSG00000186501 to ENSG00000186501 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM218 Gene migrated from ENSG00000150433 to ENSG00000150433 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM216 Gene migrated from ENSG00000187049 to ENSG00000187049 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM184B Gene migrated from ENSG00000198792 to ENSG00000198792 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM167A Gene migrated from ENSG00000174695 to ENSG00000174695 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM165 Gene migrated from ENSG00000134851 to ENSG00000134851 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM163 Gene migrated from ENSG00000152128 to ENSG00000152128 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM161B Gene migrated from ENSG00000164180 to ENSG00000164180 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM147 Gene migrated from ENSG00000105677 to ENSG00000105677 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMEM106B Gene migrated from ENSG00000106460 to ENSG00000106460 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRPM7 Gene migrated from ENSG00000092439 to ENSG00000092439 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TMCO1 Gene migrated from ENSG00000143183 to ENSG00000143183 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TM2D3 Gene migrated from ENSG00000184277 to ENSG00000184277 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TLK2 Gene migrated from ENSG00000146872 to ENSG00000146872 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TINF2 Gene migrated from ENSG00000092330 to ENSG00000092330 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TIMM50 Gene migrated from ENSG00000105197 to ENSG00000105197 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TIAM1 Gene migrated from ENSG00000156299 to ENSG00000156299 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 THUMPD1 Gene migrated from ENSG00000066654 to ENSG00000066654 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 THRA Gene migrated from ENSG00000126351 to ENSG00000126351 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 THOC6 Gene migrated from ENSG00000131652 to ENSG00000131652 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 THOC2 Gene migrated from ENSG00000125676 to ENSG00000125676 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TH Gene migrated from ENSG00000180176 to ENSG00000180176 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TGIF1 Gene migrated from ENSG00000177426 to ENSG00000177426 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TFE3 Gene migrated from ENSG00000068323 to ENSG00000068323 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TET3 Gene migrated from ENSG00000187605 to ENSG00000187605 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TERT Gene migrated from ENSG00000164362 to ENSG00000164362 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TENM3 Gene migrated from ENSG00000218336 to ENSG00000218336 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TELO2 Gene migrated from ENSG00000100726 to ENSG00000100726 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TEFM Gene migrated from ENSG00000172171 to ENSG00000172171 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TECPR2 Gene migrated from ENSG00000196663 to ENSG00000196663 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TDP2 Gene migrated from ENSG00000111802 to ENSG00000111802 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCTN3 Gene migrated from ENSG00000119977 to ENSG00000119977 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCTN2 Gene migrated from ENSG00000168778 to ENSG00000168778 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCTN1 Gene migrated from ENSG00000204852 to ENSG00000204852 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCP1 Gene migrated from ENSG00000120438 to ENSG00000120438 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCN2 Gene migrated from ENSG00000185339 to ENSG00000185339 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCF7L2 Gene migrated from ENSG00000148737 to ENSG00000148737 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCF4 Gene migrated from ENSG00000196628 to ENSG00000196628 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCF20 Gene migrated from ENSG00000100207 to ENSG00000100207 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TCEAL1 Gene migrated from ENSG00000172465 to ENSG00000172465 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBX1 Gene migrated from ENSG00000184058 to ENSG00000184058 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBR1 Gene migrated from ENSG00000136535 to ENSG00000136535 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBL1XR1 Gene migrated from ENSG00000177565 to ENSG00000177565 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBCK Gene migrated from ENSG00000145348 to ENSG00000145348 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBCE Gene migrated from ENSG00000116957 to ENSG00000284770 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBCD Gene migrated from ENSG00000141556 to ENSG00000141556 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBC1D7 Gene migrated from ENSG00000145979 to ENSG00000145979 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBC1D32 Gene migrated from ENSG00000146350 to ENSG00000146350 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBC1D2B Gene migrated from ENSG00000167202 to ENSG00000167202 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBC1D24 Gene migrated from ENSG00000162065 to ENSG00000162065 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBC1D23 Gene migrated from ENSG00000036054 to ENSG00000036054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TBC1D20 Gene migrated from ENSG00000125875 to ENSG00000125875 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAFAZZIN Gene symbol changed from TAZ to TAFAZZIN during gene set migration (ENSG00000102125 -> ENSG00000102125)
Intellectual disability syndromic and non-syndromic v2.0 TAT Gene migrated from ENSG00000198650 to ENSG00000198650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TASP1 Gene migrated from ENSG00000089123 to ENSG00000089123 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TARS2 Gene migrated from ENSG00000143374 to ENSG00000143374 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAOK2 Gene migrated from ENSG00000149930 to ENSG00000149930 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAOK1 Gene migrated from ENSG00000160551 to ENSG00000160551 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TANGO2 Gene migrated from ENSG00000183597 to ENSG00000183597 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TANC2 Gene migrated from ENSG00000170921 to ENSG00000170921 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAF8 Gene migrated from ENSG00000137413 to ENSG00000137413 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAF6 Gene migrated from ENSG00000106290 to ENSG00000106290 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAF4 Gene migrated from ENSG00000130699 to ENSG00000130699 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAF2 Gene migrated from ENSG00000064313 to ENSG00000064313 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAF1C Gene migrated from ENSG00000103168 to ENSG00000103168 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TAF1 Gene migrated from ENSG00000147133 to ENSG00000147133 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FRRS1L Gene migrated from ENSG00000260230 to ENSG00000260230 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FRMPD4 Gene migrated from ENSG00000169933 to ENSG00000169933 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FRMD5 Gene migrated from ENSG00000171877 to ENSG00000171877 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRNT1 Gene migrated from ENSG00000072756 to ENSG00000072756 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OPA3 Gene migrated from ENSG00000125741 to ENSG00000125741 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OLA1 Gene migrated from ENSG00000138430 to ENSG00000138430 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OGT Gene migrated from ENSG00000147162 to ENSG00000147162 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OGDHL Gene migrated from ENSG00000197444 to ENSG00000197444 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OGDH Gene migrated from ENSG00000105953 to ENSG00000105953 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OFD1 Gene migrated from ENSG00000046651 to ENSG00000046651 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ODC1 Gene migrated from ENSG00000115758 to ENSG00000115758 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OCRL Gene migrated from ENSG00000122126 to ENSG00000122126 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OCLN Gene migrated from ENSG00000197822 to ENSG00000197822 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NUS1 Gene migrated from ENSG00000153989 to ENSG00000153989 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NUP214 Gene migrated from ENSG00000126883 to ENSG00000126883 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NUP188 Gene migrated from ENSG00000095319 to ENSG00000095319 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NUDT2 Gene migrated from ENSG00000164978 to ENSG00000164978 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NUBPL Gene migrated from ENSG00000151413 to ENSG00000151413 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NTRK2 Gene migrated from ENSG00000148053 to ENSG00000148053 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NTRK1 Gene migrated from ENSG00000198400 to ENSG00000198400 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NTNG2 Gene migrated from ENSG00000196358 to ENSG00000196358 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NT5C2 Gene migrated from ENSG00000076685 to ENSG00000076685 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NSUN6 Gene migrated from ENSG00000241058 to ENSG00000241058 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NSUN3 Gene migrated from ENSG00000178694 to ENSG00000178694 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NSUN2 Gene migrated from ENSG00000037474 to ENSG00000037474 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NSRP1 Gene migrated from ENSG00000126653 to ENSG00000126653 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NSF Gene migrated from ENSG00000073969 to ENSG00000073969 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NSDHL Gene migrated from ENSG00000147383 to ENSG00000147383 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NSD2 Gene migrated from ENSG00000109685 to ENSG00000109685 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NSD1 Gene migrated from ENSG00000165671 to ENSG00000165671 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NRXN1 Gene migrated from ENSG00000179915 to ENSG00000179915 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NRROS Gene migrated from ENSG00000174004 to ENSG00000174004 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NRDC Gene migrated from ENSG00000078618 to ENSG00000078618 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NRCAM Gene migrated from ENSG00000091129 to ENSG00000091129 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NRAS Gene migrated from ENSG00000213281 to ENSG00000213281 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NR4A2 Gene migrated from ENSG00000153234 to ENSG00000153234 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NR2F2 Gene migrated from ENSG00000185551 to ENSG00000185551 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NR2F1 Gene migrated from ENSG00000175745 to ENSG00000175745 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NPRL2 Gene migrated from ENSG00000114388 to ENSG00000114388 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NPHP3 Gene migrated from ENSG00000113971 to ENSG00000113971 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NPHP1 Gene migrated from ENSG00000144061 to ENSG00000144061 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NPC2 Gene migrated from ENSG00000119655 to ENSG00000119655 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NPC1 Gene migrated from ENSG00000141458 to ENSG00000141458 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NOVA2 Gene migrated from ENSG00000104967 to ENSG00000104967 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NOTCH3 Gene migrated from ENSG00000074181 to ENSG00000074181 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NOTCH1 Gene migrated from ENSG00000148400 to ENSG00000148400 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NONO Gene migrated from ENSG00000147140 to ENSG00000147140 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NLGN4X Gene migrated from ENSG00000146938 to ENSG00000146938 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NLGN3 Gene migrated from ENSG00000196338 to ENSG00000196338 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NKX2-1 Gene migrated from ENSG00000136352 to ENSG00000136352 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NKAP Gene migrated from ENSG00000101882 to ENSG00000101882 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NIPBL Gene migrated from ENSG00000164190 to ENSG00000164190 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NHS Gene migrated from ENSG00000188158 to ENSG00000188158 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NGLY1 Gene migrated from ENSG00000151092 to ENSG00000151092 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NFU1 Gene migrated from ENSG00000169599 to ENSG00000169599 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NFIX Gene migrated from ENSG00000008441 to ENSG00000008441 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NFIB Gene migrated from ENSG00000147862 to ENSG00000147862 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NFIA Gene migrated from ENSG00000162599 to ENSG00000162599 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NFASC Gene migrated from ENSG00000163531 to ENSG00000163531 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NF1 Gene migrated from ENSG00000196712 to ENSG00000196712 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NEXMIF Gene migrated from ENSG00000050030 to ENSG00000050030 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NEUROG1 Gene migrated from ENSG00000181965 to ENSG00000181965 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NEUROD2 Gene migrated from ENSG00000171532 to ENSG00000171532 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NEU1 Gene migrated from ENSG00000204386 to ENSG00000204386 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NEMF Gene migrated from ENSG00000165525 to ENSG00000165525 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NEDD4L Gene migrated from ENSG00000049759 to ENSG00000049759 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFV1 Gene migrated from ENSG00000167792 to ENSG00000167792 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFS8 Gene migrated from ENSG00000110717 to ENSG00000110717 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFS7 Gene migrated from ENSG00000115286 to ENSG00000115286 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFS4 Gene migrated from ENSG00000164258 to ENSG00000164258 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFS1 Gene migrated from ENSG00000023228 to ENSG00000023228 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFB7 Gene migrated from ENSG00000099795 to ENSG00000099795 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFAF1 Gene migrated from ENSG00000137806 to ENSG00000137806 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COXFA4 Gene symbol changed from NDUFA4 to COXFA4 during gene set migration (ENSG00000189043 -> ENSG00000189043)
Intellectual disability syndromic and non-syndromic v2.0 NDUFA3 Gene migrated from ENSG00000170906 to ENSG00000170906 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFA2 Gene migrated from ENSG00000131495 to ENSG00000131495 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDUFA1 Gene migrated from ENSG00000125356 to ENSG00000125356 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDST1 Gene migrated from ENSG00000070614 to ENSG00000070614 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDP Gene migrated from ENSG00000124479 to ENSG00000124479 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDE1 Gene migrated from ENSG00000072864 to ENSG00000072864 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NDC1 Gene migrated from ENSG00000058804 to ENSG00000058804 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NCOR1 Gene migrated from ENSG00000141027 to ENSG00000141027 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NCKAP1 Gene migrated from ENSG00000061676 to ENSG00000061676 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NCDN Gene migrated from ENSG00000020129 to ENSG00000020129 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NCAPD2 Gene migrated from ENSG00000010292 to ENSG00000010292 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NBEA Gene migrated from ENSG00000172915 to ENSG00000172915 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAV3 Gene migrated from ENSG00000067798 to ENSG00000067798 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NARS1 Gene symbol changed from NARS to NARS1 during gene set migration (ENSG00000134440 -> ENSG00000134440)
Intellectual disability syndromic and non-syndromic v2.0 NAPB Gene migrated from ENSG00000125814 to ENSG00000125814 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NANS Gene migrated from ENSG00000095380 to ENSG00000095380 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NALCN Gene migrated from ENSG00000102452 to ENSG00000102452 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAGLU Gene migrated from ENSG00000108784 to ENSG00000108784 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAGA Gene migrated from ENSG00000198951 to ENSG00000198951 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAE1 Gene migrated from ENSG00000159593 to ENSG00000159593 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NACC1 Gene migrated from ENSG00000160877 to ENSG00000160877 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAA20 Gene migrated from ENSG00000173418 to ENSG00000173418 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAA15 Gene migrated from ENSG00000164134 to ENSG00000164134 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 NAA10 Gene migrated from ENSG00000102030 to ENSG00000102030 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYT1L Gene migrated from ENSG00000186487 to ENSG00000186487 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYO5A Gene migrated from ENSG00000197535 to ENSG00000197535 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYH10 Gene migrated from ENSG00000133026 to ENSG00000133026 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MYCN Gene migrated from ENSG00000134323 to ENSG00000134323 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MVK Gene migrated from ENSG00000110921 to ENSG00000110921 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MMUT Gene symbol changed from MUT to MMUT during gene set migration (ENSG00000146085 -> ENSG00000146085)
Intellectual disability syndromic and non-syndromic v2.0 MT-TW Gene migrated from ENSG00000210117 to ENSG00000210117 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MT-TV Gene migrated from ENSG00000210077 to ENSG00000210077 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MT-TS2 Gene migrated from ENSG00000210184 to ENSG00000210184 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MT-TS1 Gene migrated from ENSG00000210151 to ENSG00000210151 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MT-TR Gene migrated from ENSG00000210174 to ENSG00000210174 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MT-TE Gene migrated from ENSG00000210194 to ENSG00000210194 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTSS2 Gene symbol changed from MTSS1L to MTSS2 during gene set migration (ENSG00000132613 -> ENSG00000132613)
Intellectual disability syndromic and non-syndromic v2.0 MTRR Gene migrated from ENSG00000124275 to ENSG00000124275 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTR Gene migrated from ENSG00000116984 to ENSG00000116984 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTOR Gene migrated from ENSG00000198793 to ENSG00000198793 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTO1 Gene migrated from ENSG00000135297 to ENSG00000135297 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR37 Gene migrated from ENSG00000047056 to ENSG00000047056 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MT-ND4 Gene migrated from ENSG00000198886 to ENSG00000198886 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTHFS Gene migrated from ENSG00000136371 to ENSG00000136371 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTHFR Gene migrated from ENSG00000177000 to ENSG00000177000 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MTFMT Gene migrated from ENSG00000103707 to ENSG00000103707 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MT-CO2 Gene migrated from ENSG00000198712 to ENSG00000198712 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MT-ATP6 Gene migrated from ENSG00000198899 to ENSG00000198899 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MSMO1 Gene migrated from ENSG00000052802 to ENSG00000052802 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MSL3 Gene migrated from ENSG00000005302 to ENSG00000005302 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MSL2 Gene migrated from ENSG00000174579 to ENSG00000174579 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MRPS34 Gene migrated from ENSG00000074071 to ENSG00000074071 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MRPS22 Gene migrated from ENSG00000175110 to ENSG00000175110 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MRPL49 Gene migrated from ENSG00000149792 to ENSG00000149792 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MRAS Gene migrated from ENSG00000158186 to ENSG00000158186 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MPV17 Gene migrated from ENSG00000115204 to ENSG00000115204 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PALS1 Gene symbol changed from MPP5 to PALS1 during gene set migration (ENSG00000072415 -> ENSG00000072415)
Intellectual disability syndromic and non-syndromic v2.0 MPLKIP Gene migrated from ENSG00000168303 to ENSG00000168303 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MPDZ Gene migrated from ENSG00000107186 to ENSG00000107186 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MPDU1 Gene migrated from ENSG00000129255 to ENSG00000129255 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MORC2 Gene migrated from ENSG00000133422 to ENSG00000133422 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MOGS Gene migrated from ENSG00000115275 to ENSG00000115275 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MOCS2 Gene migrated from ENSG00000164172 to ENSG00000164172 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MOCS1 Gene migrated from ENSG00000124615 to ENSG00000124615 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MN1 Gene migrated from ENSG00000169184 to ENSG00000169184 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MMADHC Gene migrated from ENSG00000168288 to ENSG00000168288 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MMACHC Gene migrated from ENSG00000132763 to ENSG00000132763 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MMAB Gene migrated from ENSG00000139428 to ENSG00000139428 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MMAA Gene migrated from ENSG00000151611 to ENSG00000151611 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MLYCD Gene migrated from ENSG00000103150 to ENSG00000103150 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MLC1 Gene migrated from ENSG00000100427 to ENSG00000100427 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MKS1 Gene migrated from ENSG00000011143 to ENSG00000011143 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MKKS Gene migrated from ENSG00000125863 to ENSG00000125863 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MID1 Gene migrated from ENSG00000101871 to ENSG00000101871 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MICU1 Gene migrated from ENSG00000107745 to ENSG00000107745 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MGAT2 Gene migrated from ENSG00000168282 to ENSG00000168282 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MFSD8 Gene migrated from ENSG00000164073 to ENSG00000164073 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MFSD2A Gene migrated from ENSG00000168389 to ENSG00000168389 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MFF Gene migrated from ENSG00000168958 to ENSG00000168958 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 METTL5 Gene migrated from ENSG00000138382 to ENSG00000138382 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 METTL23 Gene migrated from ENSG00000181038 to ENSG00000181038 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MEIS2 Gene migrated from ENSG00000134138 to ENSG00000134138 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MEGF8 Gene migrated from ENSG00000105429 to ENSG00000105429 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MEG3 Gene migrated from ENSG00000214548 to ENSG00000214548 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MEF2C Gene migrated from ENSG00000081189 to ENSG00000081189 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED27 Gene migrated from ENSG00000160563 to ENSG00000160563 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED25 Gene migrated from ENSG00000104973 to ENSG00000104973 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED23 Gene migrated from ENSG00000112282 to ENSG00000112282 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED17 Gene migrated from ENSG00000042429 to ENSG00000042429 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED16 Gene migrated from ENSG00000175221 to ENSG00000175221 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED13L Gene migrated from ENSG00000123066 to ENSG00000123066 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED13 Gene migrated from ENSG00000108510 to ENSG00000108510 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED12L Gene migrated from ENSG00000144893 to ENSG00000144893 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED12 Gene migrated from ENSG00000184634 to ENSG00000184634 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MED11 Gene migrated from ENSG00000161920 to ENSG00000161920 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MECP2 Gene migrated from ENSG00000169057 to ENSG00000169057 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MDH2 Gene migrated from ENSG00000146701 to ENSG00000146701 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MDGA2 Gene migrated from ENSG00000139915 to ENSG00000139915 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MCPH1 Gene migrated from ENSG00000147316 to ENSG00000147316 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MCOLN1 Gene migrated from ENSG00000090674 to ENSG00000090674 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MCM6 Gene migrated from ENSG00000076003 to ENSG00000076003 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MCM3AP Gene migrated from ENSG00000160294 to ENSG00000160294 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MBTPS2 Gene migrated from ENSG00000012174 to ENSG00000012174 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MBOAT7 Gene migrated from ENSG00000125505 to ENSG00000125505 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MBD5 Gene migrated from ENSG00000204406 to ENSG00000204406 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAX Gene migrated from ENSG00000125952 to ENSG00000125952 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAU2 Gene migrated from ENSG00000129933 to ENSG00000129933 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAT1A Gene migrated from ENSG00000151224 to ENSG00000151224 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAST4 Gene migrated from ENSG00000069020 to ENSG00000069020 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAST3 Gene migrated from ENSG00000099308 to ENSG00000099308 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAST1 Gene migrated from ENSG00000105613 to ENSG00000105613 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MASP1 Gene migrated from ENSG00000127241 to ENSG00000127241 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MARK2 Gene migrated from ENSG00000072518 to ENSG00000072518 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAPRE2 Gene migrated from ENSG00000166974 to ENSG00000166974 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAPKAPK5 Gene migrated from ENSG00000089022 to ENSG00000089022 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAPK8IP3 Gene migrated from ENSG00000138834 to ENSG00000138834 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAPK1 Gene migrated from ENSG00000100030 to ENSG00000100030 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAP4K4 Gene migrated from ENSG00000071054 to ENSG00000071054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAP2K4 Gene migrated from ENSG00000065559 to ENSG00000065559 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAP2K2 Gene migrated from ENSG00000126934 to ENSG00000126934 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAP2K1 Gene migrated from ENSG00000169032 to ENSG00000169032 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAP1B Gene migrated from ENSG00000131711 to ENSG00000131711 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAOA Gene migrated from ENSG00000189221 to ENSG00000189221 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MANBA Gene migrated from ENSG00000109323 to ENSG00000109323 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAN2C1 Gene migrated from ENSG00000140400 to ENSG00000140400 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAN2B1 Gene migrated from ENSG00000104774 to ENSG00000104774 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAN1B1 Gene migrated from ENSG00000177239 to ENSG00000177239 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAGEL2 Gene migrated from ENSG00000254585 to ENSG00000254585 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAF Gene migrated from ENSG00000178573 to ENSG00000178573 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAEA Gene migrated from ENSG00000090316 to ENSG00000090316 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MADD Gene migrated from ENSG00000110514 to ENSG00000110514 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MACF1 Gene migrated from ENSG00000127603 to ENSG00000127603 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAB21L2 Gene migrated from ENSG00000181541 to ENSG00000181541 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 MAB21L1 Gene migrated from ENSG00000180660 to ENSG00000180660 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LZTR1 Gene migrated from ENSG00000099949 to ENSG00000099949 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LZTFL1 Gene migrated from ENSG00000163818 to ENSG00000163818 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LYRM7 Gene migrated from ENSG00000186687 to ENSG00000186687 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LTBP1 Gene migrated from ENSG00000049323 to ENSG00000049323 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LSS Gene migrated from ENSG00000160285 to ENSG00000160285 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LSM1 Gene migrated from ENSG00000175324 to ENSG00000175324 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LRRC7 Gene migrated from ENSG00000033122 to ENSG00000033122 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LRPPRC Gene migrated from ENSG00000138095 to ENSG00000138095 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LRP2 Gene migrated from ENSG00000081479 to ENSG00000081479 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LONP1 Gene migrated from ENSG00000196365 to ENSG00000196365 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LNPK Gene migrated from ENSG00000144320 to ENSG00000144320 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LMNB2 Gene migrated from ENSG00000176619 to ENSG00000176619 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LMNB1 Gene migrated from ENSG00000113368 to ENSG00000113368 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LMBRD2 Gene migrated from ENSG00000164187 to ENSG00000164187 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LMBRD1 Gene migrated from ENSG00000168216 to ENSG00000168216 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LMAN2L Gene migrated from ENSG00000114988 to ENSG00000114988 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LIPT1 Gene migrated from ENSG00000144182 to ENSG00000144182 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LINS1 Gene migrated from ENSG00000140471 to ENSG00000140471 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LINGO4 Gene migrated from ENSG00000213171 to ENSG00000213171 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHASERR Gene symbol changed from LINC01578 to CHASERR during gene set migration (ENSG00000272888 -> ENSG00000272888)
Intellectual disability syndromic and non-syndromic v2.0 GALE Gene migrated from ENSG00000117308 to ENSG00000117308 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GALC Gene migrated from ENSG00000054983 to ENSG00000054983 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GAD1 Gene migrated from ENSG00000128683 to ENSG00000128683 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRG2 Gene migrated from ENSG00000113327 to ENSG00000113327 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRD Gene migrated from ENSG00000187730 to ENSG00000187730 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRB3 Gene migrated from ENSG00000166206 to ENSG00000166206 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRB2 Gene migrated from ENSG00000145864 to ENSG00000145864 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRA5 Gene migrated from ENSG00000186297 to ENSG00000186297 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRA4 Gene migrated from ENSG00000109158 to ENSG00000109158 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRA3 Gene migrated from ENSG00000011677 to ENSG00000011677 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRA2 Gene migrated from ENSG00000151834 to ENSG00000151834 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABRA1 Gene migrated from ENSG00000022355 to ENSG00000022355 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABBR2 Gene migrated from ENSG00000136928 to ENSG00000136928 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GABBR1 Gene migrated from ENSG00000204681 to ENSG00000204681 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GALT Gene migrated from ENSG00000213930 to ENSG00000213930 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FZR1 Gene migrated from ENSG00000105325 to ENSG00000105325 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FUT8 Gene migrated from ENSG00000033170 to ENSG00000033170 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP1CB Gene migrated from ENSG00000213639 to ENSG00000213639 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPM1D Gene migrated from ENSG00000170836 to ENSG00000170836 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPIL1 Gene migrated from ENSG00000137168 to ENSG00000137168 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPFIBP1 Gene migrated from ENSG00000110841 to ENSG00000110841 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPFIA3 Gene migrated from ENSG00000177380 to ENSG00000177380 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPFIA2 Gene migrated from ENSG00000139220 to ENSG00000139220 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POU3F3 Gene migrated from ENSG00000198914 to ENSG00000198914 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POU3F2 Gene migrated from ENSG00000184486 to ENSG00000184486 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PORCN Gene migrated from ENSG00000102312 to ENSG00000102312 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POMT2 Gene migrated from ENSG00000009830 to ENSG00000009830 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POMT1 Gene migrated from ENSG00000130714 to ENSG00000130714 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POMK Gene migrated from ENSG00000185900 to ENSG00000185900 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POMGNT2 Gene migrated from ENSG00000144647 to ENSG00000144647 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POMGNT1 Gene migrated from ENSG00000085998 to ENSG00000085998 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLRMT Gene migrated from ENSG00000099821 to ENSG00000099821 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLR3K Gene migrated from ENSG00000161980 to ENSG00000161980 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLR3B Gene migrated from ENSG00000013503 to ENSG00000013503 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLR3A Gene migrated from ENSG00000148606 to ENSG00000148606 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLR2A Gene migrated from ENSG00000181222 to ENSG00000181222 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLR1C Gene migrated from ENSG00000171453 to ENSG00000171453 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLR1A Gene migrated from ENSG00000068654 to ENSG00000068654 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLG Gene migrated from ENSG00000140521 to ENSG00000140521 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POLA1 Gene migrated from ENSG00000101868 to ENSG00000101868 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POGZ Gene migrated from ENSG00000143442 to ENSG00000143442 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 POC1A Gene migrated from ENSG00000164087 to ENSG00000164087 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PNPT1 Gene migrated from ENSG00000138035 to ENSG00000138035 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PNPLA8 Gene migrated from ENSG00000135241 to ENSG00000135241 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PNPLA6 Gene migrated from ENSG00000032444 to ENSG00000032444 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PNKP Gene migrated from ENSG00000039650 to ENSG00000039650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PMPCB Gene migrated from ENSG00000105819 to ENSG00000105819 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PMPCA Gene migrated from ENSG00000165688 to ENSG00000165688 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PMM2 Gene migrated from ENSG00000140650 to ENSG00000140650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLXNB2 Gene migrated from ENSG00000196576 to ENSG00000196576 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLXNA1 Gene migrated from ENSG00000114554 to ENSG00000114554 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLPBP Gene migrated from ENSG00000147471 to ENSG00000147471 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLP1 Gene migrated from ENSG00000123560 to ENSG00000123560 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLK4 Gene migrated from ENSG00000142731 to ENSG00000142731 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLK1 Gene migrated from ENSG00000166851 to ENSG00000166851 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLCB1 Gene migrated from ENSG00000182621 to ENSG00000182621 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLAT Gene migrated from ENSG00000104368 to ENSG00000104368 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLAA Gene migrated from ENSG00000137055 to ENSG00000137055 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLA2G6 Gene migrated from ENSG00000184381 to ENSG00000184381 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PLAAT3 Gene symbol changed from PLA2G16 to PLAAT3 during gene set migration (ENSG00000176485 -> ENSG00000176485)
Intellectual disability syndromic and non-syndromic v2.0 PITRM1 Gene migrated from ENSG00000107959 to ENSG00000107959 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PISD Gene migrated from ENSG00000241878 to ENSG00000241878 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIP5K1C Gene migrated from ENSG00000186111 to ENSG00000186111 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIK3R2 Gene migrated from ENSG00000105647 to ENSG00000105647 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIK3CA Gene migrated from ENSG00000121879 to ENSG00000121879 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIK3C2A Gene migrated from ENSG00000011405 to ENSG00000011405 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGW Gene migrated from ENSG00000277161 to ENSG00000277161 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGV Gene migrated from ENSG00000060642 to ENSG00000060642 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGT Gene migrated from ENSG00000124155 to ENSG00000124155 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGS Gene migrated from ENSG00000087111 to ENSG00000087111 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGQ Gene migrated from ENSG00000007541 to ENSG00000007541 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGP Gene migrated from ENSG00000185808 to ENSG00000185808 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGO Gene migrated from ENSG00000165282 to ENSG00000165282 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGN Gene migrated from ENSG00000197563 to ENSG00000197563 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGL Gene migrated from ENSG00000108474 to ENSG00000108474 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGK Gene migrated from ENSG00000142892 to ENSG00000142892 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGH Gene migrated from ENSG00000100564 to ENSG00000100564 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGG Gene migrated from ENSG00000174227 to ENSG00000174227 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGC Gene migrated from ENSG00000135845 to ENSG00000135845 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGB Gene migrated from ENSG00000069943 to ENSG00000069943 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIGA Gene migrated from ENSG00000165195 to ENSG00000165195 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIDD1 Gene migrated from ENSG00000177595 to ENSG00000177595 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PIBF1 Gene migrated from ENSG00000083535 to ENSG00000083535 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PI4KA Gene migrated from ENSG00000241973 to ENSG00000241973 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PI4K2A Gene migrated from ENSG00000155252 to ENSG00000155252 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHIP Gene migrated from ENSG00000146247 to ENSG00000146247 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHGDH Gene migrated from ENSG00000092621 to ENSG00000092621 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHF8 Gene migrated from ENSG00000172943 to ENSG00000172943 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHF6 Gene migrated from ENSG00000156531 to ENSG00000156531 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHF5A Gene migrated from ENSG00000100410 to ENSG00000100410 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHF21A Gene migrated from ENSG00000135365 to ENSG00000135365 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PHACTR1 Gene migrated from ENSG00000112137 to ENSG00000112137 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PGM3 Gene migrated from ENSG00000013375 to ENSG00000013375 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PGM2L1 Gene migrated from ENSG00000165434 to ENSG00000165434 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PGK1 Gene migrated from ENSG00000102144 to ENSG00000102144 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PGBD5 Gene migrated from ENSG00000177614 to ENSG00000177614 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PGAP3 Gene migrated from ENSG00000161395 to ENSG00000161395 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PGAP2 Gene migrated from ENSG00000148985 to ENSG00000148985 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PGAP1 Gene migrated from ENSG00000197121 to ENSG00000197121 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX7 Gene migrated from ENSG00000112357 to ENSG00000112357 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX6 Gene migrated from ENSG00000124587 to ENSG00000124587 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX5 Gene migrated from ENSG00000139197 to ENSG00000139197 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX3 Gene migrated from ENSG00000034693 to ENSG00000034693 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX26 Gene migrated from ENSG00000215193 to ENSG00000215193 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX2 Gene migrated from ENSG00000164751 to ENSG00000164751 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX19 Gene migrated from ENSG00000162735 to ENSG00000162735 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX16 Gene migrated from ENSG00000121680 to ENSG00000121680 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX14 Gene migrated from ENSG00000142655 to ENSG00000142655 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX13 Gene migrated from ENSG00000162928 to ENSG00000162928 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX12 Gene migrated from ENSG00000108733 to ENSG00000108733 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX11B Gene migrated from ENSG00000131779 to ENSG00000131779 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX10 Gene migrated from ENSG00000157911 to ENSG00000157911 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEX1 Gene migrated from ENSG00000127980 to ENSG00000127980 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PET100 Gene migrated from ENSG00000229833 to ENSG00000229833 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PEPD Gene migrated from ENSG00000124299 to ENSG00000124299 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDZD8 Gene migrated from ENSG00000165650 to ENSG00000165650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDSS1 Gene migrated from ENSG00000148459 to ENSG00000148459 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDP1 Gene migrated from ENSG00000164951 to ENSG00000164951 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDHX Gene migrated from ENSG00000110435 to ENSG00000110435 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDHB Gene migrated from ENSG00000168291 to ENSG00000168291 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDHA1 Gene migrated from ENSG00000131828 to ENSG00000131828 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDGFRB Gene migrated from ENSG00000113721 to ENSG00000113721 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDE6D Gene migrated from ENSG00000156973 to ENSG00000156973 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDE4D Gene migrated from ENSG00000113448 to ENSG00000113448 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDE1B Gene migrated from ENSG00000123360 to ENSG00000123360 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDE10A Gene migrated from ENSG00000112541 to ENSG00000112541 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PDCD6IP Gene migrated from ENSG00000170248 to ENSG00000170248 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCYT2 Gene migrated from ENSG00000185813 to ENSG00000185813 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCLO Gene migrated from ENSG00000186472 to ENSG00000186472 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCGF2 Gene migrated from ENSG00000277258 to ENSG00000277258 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCDHGC4 Gene migrated from ENSG00000242419 to ENSG00000242419 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCDH19 Gene migrated from ENSG00000165194 to ENSG00000165194 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCDH12 Gene migrated from ENSG00000113555 to ENSG00000113555 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCCB Gene migrated from ENSG00000114054 to ENSG00000114054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCCA Gene migrated from ENSG00000175198 to ENSG00000175198 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCBP2 Gene migrated from ENSG00000197111 to ENSG00000197111 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PCBP1 Gene migrated from ENSG00000169564 to ENSG00000169564 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PC Gene migrated from ENSG00000173599 to ENSG00000173599 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PBX1 Gene migrated from ENSG00000185630 to ENSG00000185630 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAX8 Gene migrated from ENSG00000125618 to ENSG00000125618 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAX6 Gene migrated from ENSG00000007372 to ENSG00000007372 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAX5 Gene migrated from ENSG00000196092 to ENSG00000196092 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PARP6 Gene migrated from ENSG00000137817 to ENSG00000137817 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PARN Gene migrated from ENSG00000140694 to ENSG00000140694 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAN2 Gene migrated from ENSG00000135473 to ENSG00000135473 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAM16 Gene migrated from ENSG00000217930 to ENSG00000217930 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAK3 Gene migrated from ENSG00000077264 to ENSG00000077264 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAK2 Gene migrated from ENSG00000180370 to ENSG00000180370 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAK1 Gene migrated from ENSG00000149269 to ENSG00000149269 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAH Gene migrated from ENSG00000171759 to ENSG00000171759 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PAFAH1B1 Gene migrated from ENSG00000007168 to ENSG00000007168 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PACS2 Gene migrated from ENSG00000179364 to ENSG00000179364 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PACS1 Gene migrated from ENSG00000175115 to ENSG00000175115 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PABPC1 Gene migrated from ENSG00000070756 to ENSG00000070756 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 P4HTM Gene migrated from ENSG00000178467 to ENSG00000178467 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OXR1 Gene migrated from ENSG00000164830 to ENSG00000164830 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OTX2 Gene migrated from ENSG00000165588 to ENSG00000165588 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OTUD7A Gene migrated from ENSG00000169918 to ENSG00000169918 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OTUD6B Gene migrated from ENSG00000155100 to ENSG00000155100 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OTUD5 Gene migrated from ENSG00000068308 to ENSG00000068308 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OTC Gene migrated from ENSG00000036473 to ENSG00000036473 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OSGEP Gene migrated from ENSG00000092094 to ENSG00000092094 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 OPHN1 Gene migrated from ENSG00000079482 to ENSG00000079482 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 PPP1R12A Gene migrated from ENSG00000058272 to ENSG00000058272 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IBA57 Gene migrated from ENSG00000181873 to ENSG00000181873 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IARS1 Gene symbol changed from IARS to IARS1 during gene set migration (ENSG00000196305 -> ENSG00000196305)
Intellectual disability syndromic and non-syndromic v2.0 HUWE1 Gene migrated from ENSG00000086758 to ENSG00000086758 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HTRA2 Gene migrated from ENSG00000115317 to ENSG00000115317 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HSPG2 Gene migrated from ENSG00000142798 to ENSG00000142798 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HSPD1 Gene migrated from ENSG00000144381 to ENSG00000144381 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HSD17B4 Gene migrated from ENSG00000133835 to ENSG00000133835 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HSD17B10 Gene migrated from ENSG00000072506 to ENSG00000072506 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HS6ST2 Gene migrated from ENSG00000171004 to ENSG00000171004 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HS2ST1 Gene migrated from ENSG00000153936 to ENSG00000153936 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HRAS Gene migrated from ENSG00000174775 to ENSG00000174775 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HPRT1 Gene migrated from ENSG00000165704 to ENSG00000165704 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HPDL Gene migrated from ENSG00000186603 to ENSG00000186603 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HPD Gene migrated from ENSG00000158104 to ENSG00000158104 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HOXA1 Gene migrated from ENSG00000105991 to ENSG00000105991 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HNRNPU Gene migrated from ENSG00000153187 to ENSG00000153187 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HNRNPR Gene migrated from ENSG00000125944 to ENSG00000125944 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HNRNPK Gene migrated from ENSG00000165119 to ENSG00000165119 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HNRNPH2 Gene migrated from ENSG00000126945 to ENSG00000126945 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HNRNPH1 Gene migrated from ENSG00000169045 to ENSG00000169045 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HNRNPD Gene migrated from ENSG00000138668 to ENSG00000138668 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HNRNPC Gene migrated from ENSG00000092199 to ENSG00000092199 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HNMT Gene migrated from ENSG00000150540 to ENSG00000150540 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HMGCL Gene migrated from ENSG00000117305 to ENSG00000117305 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HMGB1 Gene migrated from ENSG00000189403 to ENSG00000189403 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HMBS Gene migrated from ENSG00000256269 to ENSG00000256269 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HLCS Gene migrated from ENSG00000159267 to ENSG00000159267 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HK1 Gene migrated from ENSG00000156515 to ENSG00000156515 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HIVEP2 Gene migrated from ENSG00000010818 to ENSG00000010818 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 H4C9 Gene symbol changed from HIST1H4I to H4C9 during gene set migration (ENSG00000276180 -> ENSG00000276180)
Intellectual disability syndromic and non-syndromic v2.0 H4C5 Gene symbol changed from HIST1H4E to H4C5 during gene set migration (ENSG00000276966 -> ENSG00000276966)
Intellectual disability syndromic and non-syndromic v2.0 H4C3 Gene symbol changed from HIST1H4C to H4C3 during gene set migration (ENSG00000197061 -> ENSG00000197061)
Intellectual disability syndromic and non-syndromic v2.0 H1-4 Gene symbol changed from HIST1H1E to H1-4 during gene set migration (ENSG00000168298 -> ENSG00000168298)
Intellectual disability syndromic and non-syndromic v2.0 HIRA Gene migrated from ENSG00000100084 to ENSG00000100084 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HIKESHI Gene migrated from ENSG00000149196 to ENSG00000149196 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HID1 Gene migrated from ENSG00000167861 to ENSG00000167861 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HIBCH Gene migrated from ENSG00000198130 to ENSG00000198130 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HGSNAT Gene migrated from ENSG00000165102 to ENSG00000165102 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HEXB Gene migrated from ENSG00000049860 to ENSG00000049860 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HEXA Gene migrated from ENSG00000213614 to ENSG00000213614 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HESX1 Gene migrated from ENSG00000163666 to ENSG00000163666 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HERC2 Gene migrated from ENSG00000128731 to ENSG00000128731 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HERC1 Gene migrated from ENSG00000103657 to ENSG00000103657 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HEPACAM Gene migrated from ENSG00000165478 to ENSG00000165478 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HECW2 Gene migrated from ENSG00000138411 to ENSG00000138411 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HECTD4 Gene migrated from ENSG00000173064 to ENSG00000173064 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HECTD1 Gene migrated from ENSG00000092148 to ENSG00000092148 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HDAC8 Gene migrated from ENSG00000147099 to ENSG00000147099 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HDAC3 Gene migrated from ENSG00000171720 to ENSG00000171720 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HCN2 Gene migrated from ENSG00000099822 to ENSG00000099822 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HCN1 Gene migrated from ENSG00000164588 to ENSG00000164588 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HCFC1 Gene migrated from ENSG00000172534 to ENSG00000172534 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HCCS Gene migrated from ENSG00000004961 to ENSG00000004961 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HDAC4 Gene migrated from ENSG00000068024 to ENSG00000068024 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HADHB Gene migrated from ENSG00000138029 to ENSG00000138029 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HADHA Gene migrated from ENSG00000084754 to ENSG00000084754 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HACE1 Gene migrated from ENSG00000085382 to ENSG00000085382 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 H3-3B Gene symbol changed from H3F3B to H3-3B during gene set migration (ENSG00000132475 -> ENSG00000132475)
Intellectual disability syndromic and non-syndromic v2.0 H3-3A Gene symbol changed from H3F3A to H3-3A during gene set migration (ENSG00000163041 -> ENSG00000163041)
Intellectual disability syndromic and non-syndromic v2.0 GUSB Gene migrated from ENSG00000169919 to ENSG00000169919 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTPBP3 Gene migrated from ENSG00000130299 to ENSG00000130299 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTPBP2 Gene migrated from ENSG00000172432 to ENSG00000172432 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTPBP1 Gene migrated from ENSG00000100226 to ENSG00000100226 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTF3C5 Gene migrated from ENSG00000148308 to ENSG00000148308 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTF3C3 Gene migrated from ENSG00000119041 to ENSG00000119041 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTF2H5 Gene migrated from ENSG00000272047 to ENSG00000272047 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTF2E2 Gene migrated from ENSG00000197265 to ENSG00000197265 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GSX2 Gene migrated from ENSG00000180613 to ENSG00000180613 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GSS Gene migrated from ENSG00000100983 to ENSG00000100983 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GSPT2 Gene migrated from ENSG00000189369 to ENSG00000189369 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRM7 Gene migrated from ENSG00000196277 to ENSG00000196277 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRM1 Gene migrated from ENSG00000152822 to ENSG00000152822 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIN2D Gene migrated from ENSG00000105464 to ENSG00000105464 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIN2B Gene migrated from ENSG00000273079 to ENSG00000273079 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIN2A Gene migrated from ENSG00000183454 to ENSG00000183454 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIN1 Gene migrated from ENSG00000176884 to ENSG00000176884 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIK2 Gene migrated from ENSG00000164418 to ENSG00000164418 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRID2 Gene migrated from ENSG00000152208 to ENSG00000152208 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIA4 Gene migrated from ENSG00000152578 to ENSG00000152578 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIA3 Gene migrated from ENSG00000125675 to ENSG00000125675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIA2 Gene migrated from ENSG00000120251 to ENSG00000120251 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GRIA1 Gene migrated from ENSG00000155511 to ENSG00000155511 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPT2 Gene migrated from ENSG00000166123 to ENSG00000166123 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPRC5B Gene migrated from ENSG00000167191 to ENSG00000167191 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPHN Gene migrated from ENSG00000171723 to ENSG00000171723 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPC4 Gene migrated from ENSG00000076716 to ENSG00000076716 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPC3 Gene migrated from ENSG00000147257 to ENSG00000147257 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPATCH11 Gene migrated from ENSG00000152133 to ENSG00000152133 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GPAA1 Gene migrated from ENSG00000197858 to ENSG00000197858 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GOT2 Gene migrated from ENSG00000125166 to ENSG00000125166 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GON4L Gene migrated from ENSG00000116580 to ENSG00000116580 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GOLGA2 Gene migrated from ENSG00000167110 to ENSG00000167110 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNS Gene migrated from ENSG00000135677 to ENSG00000135677 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNPTG Gene migrated from ENSG00000090581 to ENSG00000090581 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNPTAB Gene migrated from ENSG00000111670 to ENSG00000111670 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNPAT Gene migrated from ENSG00000116906 to ENSG00000116906 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNE Gene migrated from ENSG00000159921 to ENSG00000159921 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNB5 Gene migrated from ENSG00000069966 to ENSG00000069966 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNB2 Gene migrated from ENSG00000172354 to ENSG00000172354 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNB1 Gene migrated from ENSG00000078369 to ENSG00000078369 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNAS Gene migrated from ENSG00000087460 to ENSG00000087460 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNAO1 Gene migrated from ENSG00000087258 to ENSG00000087258 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNAI2 Gene migrated from ENSG00000114353 to ENSG00000114353 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GNAI1 Gene migrated from ENSG00000127955 to ENSG00000127955 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GMPPB Gene migrated from ENSG00000173540 to ENSG00000173540 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GMPPA Gene migrated from ENSG00000144591 to ENSG00000144591 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GM2A Gene migrated from ENSG00000196743 to ENSG00000196743 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLUL Gene migrated from ENSG00000135821 to ENSG00000135821 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLS Gene migrated from ENSG00000115419 to ENSG00000115419 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLRA2 Gene migrated from ENSG00000101958 to ENSG00000101958 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLIS3 Gene migrated from ENSG00000107249 to ENSG00000107249 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLI3 Gene migrated from ENSG00000106571 to ENSG00000106571 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLI2 Gene migrated from ENSG00000074047 to ENSG00000074047 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLDC Gene migrated from ENSG00000178445 to ENSG00000178445 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GLB1 Gene migrated from ENSG00000170266 to ENSG00000170266 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GK Gene migrated from ENSG00000198814 to ENSG00000198814 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GJC2 Gene migrated from ENSG00000198835 to ENSG00000198835 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GIGYF1 Gene migrated from ENSG00000146830 to ENSG00000146830 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GFM2 Gene migrated from ENSG00000164347 to ENSG00000164347 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GFM1 Gene migrated from ENSG00000168827 to ENSG00000168827 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GFER Gene migrated from ENSG00000127554 to ENSG00000127554 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GFAP Gene migrated from ENSG00000131095 to ENSG00000131095 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GEMIN5 Gene migrated from ENSG00000082516 to ENSG00000082516 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GEMIN4 Gene migrated from ENSG00000179409 to ENSG00000179409 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GDI1 Gene migrated from ENSG00000203879 to ENSG00000203879 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GCSH Gene migrated from ENSG00000140905 to ENSG00000140905 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GCH1 Gene migrated from ENSG00000131979 to ENSG00000131979 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GCDH Gene migrated from ENSG00000105607 to ENSG00000105607 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GATM Gene migrated from ENSG00000171766 to ENSG00000171766 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GATAD2B Gene migrated from ENSG00000143614 to ENSG00000143614 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GATAD2A Gene migrated from ENSG00000167491 to ENSG00000167491 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GATA6 Gene migrated from ENSG00000141448 to ENSG00000141448 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GAMT Gene migrated from ENSG00000130005 to ENSG00000130005 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GALNT2 Gene migrated from ENSG00000143641 to ENSG00000143641 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FRAS1 Gene migrated from ENSG00000138759 to ENSG00000138759 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FRA10AC1 Gene migrated from ENSG00000148690 to ENSG00000148690 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FOXRED1 Gene migrated from ENSG00000110074 to ENSG00000110074 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FOXP4 Gene migrated from ENSG00000137166 to ENSG00000137166 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FOXP2 Gene migrated from ENSG00000128573 to ENSG00000128573 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FOXP1 Gene migrated from ENSG00000114861 to ENSG00000114861 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FOXG1 Gene migrated from ENSG00000176165 to ENSG00000176165 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FOSL2 Gene migrated from ENSG00000075426 to ENSG00000075426 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FOLR1 Gene migrated from ENSG00000110195 to ENSG00000110195 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FMR1 Gene migrated from ENSG00000102081 to ENSG00000102081 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FMN2 Gene migrated from ENSG00000155816 to ENSG00000155816 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FLVCR2 Gene migrated from ENSG00000119686 to ENSG00000119686 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FLVCR1 Gene migrated from ENSG00000162769 to ENSG00000162769 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FLNA Gene migrated from ENSG00000196924 to ENSG00000196924 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FKTN Gene migrated from ENSG00000106692 to ENSG00000106692 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FKRP Gene migrated from ENSG00000181027 to ENSG00000181027 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FITM2 Gene migrated from ENSG00000197296 to ENSG00000197296 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FIG4 Gene migrated from ENSG00000112367 to ENSG00000112367 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FIBP Gene migrated from ENSG00000172500 to ENSG00000172500 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FH Gene migrated from ENSG00000091483 to ENSG00000091483 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FGFR3 Gene migrated from ENSG00000068078 to ENSG00000068078 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FGFR1 Gene migrated from ENSG00000077782 to ENSG00000077782 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FGF14 Gene migrated from ENSG00000102466 to ENSG00000102466 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FGF13 Gene migrated from ENSG00000129682 to ENSG00000129682 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FGF12 Gene migrated from ENSG00000114279 to ENSG00000114279 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FGD1 Gene migrated from ENSG00000102302 to ENSG00000102302 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FEZF2 Gene migrated from ENSG00000153266 to ENSG00000153266 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FEM1B Gene migrated from ENSG00000169018 to ENSG00000169018 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FDXR Gene migrated from ENSG00000161513 to ENSG00000161513 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FDFT1 Gene migrated from ENSG00000079459 to ENSG00000079459 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBXW7 Gene migrated from ENSG00000109670 to ENSG00000109670 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBXW11 Gene migrated from ENSG00000072803 to ENSG00000072803 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBXO31 Gene migrated from ENSG00000103264 to ENSG00000103264 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBXO28 Gene migrated from ENSG00000143756 to ENSG00000143756 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBXO22 Gene migrated from ENSG00000167196 to ENSG00000167196 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBXO11 Gene migrated from ENSG00000138081 to ENSG00000138081 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBXL4 Gene migrated from ENSG00000112234 to ENSG00000112234 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBXL3 Gene migrated from ENSG00000005812 to ENSG00000005812 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FBRSL1 Gene migrated from ENSG00000112787 to ENSG00000112787 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FAT4 Gene migrated from ENSG00000196159 to ENSG00000196159 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FASTKD5 Gene migrated from ENSG00000215251 to ENSG00000215251 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FASTKD2 Gene migrated from ENSG00000118246 to ENSG00000118246 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FARSB Gene migrated from ENSG00000116120 to ENSG00000116120 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FARSA Gene migrated from ENSG00000179115 to ENSG00000179115 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FARS2 Gene migrated from ENSG00000145982 to ENSG00000145982 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FAR1 Gene migrated from ENSG00000197601 to ENSG00000197601 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FAM50A Gene migrated from ENSG00000071859 to ENSG00000071859 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FAM20C Gene migrated from ENSG00000177706 to ENSG00000177706 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FAM177A1 Gene migrated from ENSG00000151327 to ENSG00000151327 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FAM149B1 Gene migrated from ENSG00000138286 to ENSG00000138286 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 HYCC1 Gene symbol changed from FAM126A to HYCC1 during gene set migration (ENSG00000122591 -> ENSG00000122591)
Intellectual disability syndromic and non-syndromic v2.0 EZH2 Gene migrated from ENSG00000106462 to ENSG00000106462 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EZH1 Gene migrated from ENSG00000108799 to ENSG00000108799 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXTL3 Gene migrated from ENSG00000012232 to ENSG00000012232 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXT2 Gene migrated from ENSG00000151348 to ENSG00000151348 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXOSC8 Gene migrated from ENSG00000120699 to ENSG00000120699 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXOSC3 Gene migrated from ENSG00000107371 to ENSG00000107371 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXOC8 Gene migrated from ENSG00000116903 to ENSG00000116903 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EXOC7 Gene migrated from ENSG00000182473 to ENSG00000182473 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ETHE1 Gene migrated from ENSG00000105755 to ENSG00000105755 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ETFDH Gene migrated from ENSG00000171503 to ENSG00000171503 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ETFB Gene migrated from ENSG00000105379 to ENSG00000105379 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ETFA Gene migrated from ENSG00000140374 to ENSG00000140374 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ESRRG Gene migrated from ENSG00000196482 to ENSG00000196482 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ESCO2 Gene migrated from ENSG00000171320 to ENSG00000171320 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ESAM Gene migrated from ENSG00000149564 to ENSG00000149564 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERLIN2 Gene migrated from ENSG00000147475 to ENSG00000147475 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERI1 Gene migrated from ENSG00000104626 to ENSG00000104626 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERF Gene migrated from ENSG00000105722 to ENSG00000105722 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERCC8 Gene migrated from ENSG00000049167 to ENSG00000049167 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERCC6L2 Gene migrated from ENSG00000182150 to ENSG00000182150 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERCC6 Gene migrated from ENSG00000225830 to ENSG00000225830 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERCC5 Gene migrated from ENSG00000134899 to ENSG00000134899 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERCC3 Gene migrated from ENSG00000163161 to ENSG00000163161 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERCC2 Gene migrated from ENSG00000104884 to ENSG00000104884 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ERCC1 Gene migrated from ENSG00000012061 to ENSG00000012061 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EPRS1 Gene symbol changed from EPRS to EPRS1 during gene set migration (ENSG00000136628 -> ENSG00000136628)
Intellectual disability syndromic and non-syndromic v2.0 EPG5 Gene migrated from ENSG00000152223 to ENSG00000152223 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EPB41L3 Gene migrated from ENSG00000082397 to ENSG00000082397 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EP400 Gene migrated from ENSG00000183495 to ENSG00000183495 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EP300 Gene migrated from ENSG00000100393 to ENSG00000100393 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ENTPD1 Gene migrated from ENSG00000138185 to ENSG00000138185 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EMC10 Gene migrated from ENSG00000161671 to ENSG00000161671 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EML1 Gene migrated from ENSG00000066629 to ENSG00000066629 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EMC1 Gene migrated from ENSG00000127463 to ENSG00000127463 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ELP2 Gene migrated from ENSG00000134759 to ENSG00000134759 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ELOVL4 Gene migrated from ENSG00000118402 to ENSG00000118402 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ELAC2 Gene migrated from ENSG00000006744 to ENSG00000006744 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIPR1 Gene migrated from ENSG00000032389 to ENSG00000032389 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF5A Gene migrated from ENSG00000132507 to ENSG00000132507 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF4A3 Gene migrated from ENSG00000141543 to ENSG00000141543 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF4A2 Gene migrated from ENSG00000156976 to ENSG00000156976 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF3F Gene migrated from ENSG00000175390 to ENSG00000175390 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF3B Gene migrated from ENSG00000106263 to ENSG00000106263 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF3A Gene migrated from ENSG00000107581 to ENSG00000107581 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2S3 Gene migrated from ENSG00000130741 to ENSG00000130741 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2AK3 Gene migrated from ENSG00000172071 to ENSG00000172071 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EIF2AK2 Gene migrated from ENSG00000055332 to ENSG00000055332 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EHMT1 Gene migrated from ENSG00000181090 to ENSG00000181090 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EFTUD2 Gene migrated from ENSG00000108883 to ENSG00000108883 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EEFSEC Gene migrated from ENSG00000132394 to ENSG00000132394 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EEF2 Gene migrated from ENSG00000167658 to ENSG00000167658 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EEF1D Gene migrated from ENSG00000104529 to ENSG00000104529 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EEF1B2 Gene migrated from ENSG00000114942 to ENSG00000114942 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EEF1A2 Gene migrated from ENSG00000101210 to ENSG00000101210 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EED Gene migrated from ENSG00000074266 to ENSG00000074266 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EDEM3 Gene migrated from ENSG00000116406 to ENSG00000116406 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EBP Gene migrated from ENSG00000147155 to ENSG00000147155 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EBF3 Gene migrated from ENSG00000108001 to ENSG00000108001 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 EARS2 Gene migrated from ENSG00000103356 to ENSG00000103356 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DYRK1A Gene migrated from ENSG00000157540 to ENSG00000157540 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DYNC1I2 Gene migrated from ENSG00000077380 to ENSG00000077380 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DYNC1H1 Gene migrated from ENSG00000197102 to ENSG00000197102 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DYM Gene migrated from ENSG00000141627 to ENSG00000141627 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DTYMK Gene migrated from ENSG00000168393 to ENSG00000168393 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DRG1 Gene migrated from ENSG00000185721 to ENSG00000185721 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DRD1 Gene migrated from ENSG00000184845 to ENSG00000184845 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPYSL5 Gene migrated from ENSG00000157851 to ENSG00000157851 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPYS Gene migrated from ENSG00000147647 to ENSG00000147647 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPM2 Gene migrated from ENSG00000136908 to ENSG00000136908 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPM1 Gene migrated from ENSG00000000419 to ENSG00000000419 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPH5 Gene migrated from ENSG00000117543 to ENSG00000117543 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPH2 Gene migrated from ENSG00000132768 to ENSG00000132768 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPH1 Gene migrated from ENSG00000108963 to ENSG00000108963 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPF2 Gene migrated from ENSG00000133884 to ENSG00000133884 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DPAGT1 Gene migrated from ENSG00000172269 to ENSG00000172269 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOT1L Gene migrated from ENSG00000104885 to ENSG00000104885 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOLK Gene migrated from ENSG00000175283 to ENSG00000175283 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOHH Gene migrated from ENSG00000129932 to ENSG00000129932 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOCK7 Gene migrated from ENSG00000116641 to ENSG00000116641 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOCK6 Gene migrated from ENSG00000130158 to ENSG00000130158 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOCK4 Gene migrated from ENSG00000128512 to ENSG00000128512 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DOCK3 Gene migrated from ENSG00000088538 to ENSG00000088538 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNMT3B Gene migrated from ENSG00000088305 to ENSG00000088305 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNMT3A Gene migrated from ENSG00000119772 to ENSG00000119772 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNM1L Gene migrated from ENSG00000087470 to ENSG00000087470 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNAJC19 Gene migrated from ENSG00000205981 to ENSG00000205981 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNAJC12 Gene migrated from ENSG00000108176 to ENSG00000108176 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DNM1 Gene migrated from ENSG00000106976 to ENSG00000106976 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DMXL2 Gene migrated from ENSG00000104093 to ENSG00000104093 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DMD Gene migrated from ENSG00000198947 to ENSG00000198947 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DMAP1 Gene migrated from ENSG00000178028 to ENSG00000178028 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DLL1 Gene migrated from ENSG00000198719 to ENSG00000198719 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DLG4 Gene migrated from ENSG00000132535 to ENSG00000132535 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DLG3 Gene migrated from ENSG00000082458 to ENSG00000082458 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DLD Gene migrated from ENSG00000091140 to ENSG00000091140 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DLAT Gene migrated from ENSG00000150768 to ENSG00000150768 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DKC1 Gene migrated from ENSG00000130826 to ENSG00000130826 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DISP1 Gene migrated from ENSG00000154309 to ENSG00000154309 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DIS3L2 Gene migrated from ENSG00000144535 to ENSG00000144535 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DIP2C Gene migrated from ENSG00000151240 to ENSG00000151240 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DIAPH1 Gene migrated from ENSG00000131504 to ENSG00000131504 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHX9 Gene migrated from ENSG00000135829 to ENSG00000135829 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHX37 Gene migrated from ENSG00000150990 to ENSG00000150990 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHX30 Gene migrated from ENSG00000132153 to ENSG00000132153 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHRSX Gene migrated from ENSG00000169084 to ENSG00000169084 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHPS Gene migrated from ENSG00000095059 to ENSG00000095059 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHFR Gene migrated from ENSG00000228716 to ENSG00000228716 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHDDS Gene migrated from ENSG00000117682 to ENSG00000117682 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHCR7 Gene migrated from ENSG00000172893 to ENSG00000172893 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DHCR24 Gene migrated from ENSG00000116133 to ENSG00000116133 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DEPDC5 Gene migrated from ENSG00000100150 to ENSG00000100150 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DENND5B Gene migrated from ENSG00000170456 to ENSG00000170456 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DENND5A Gene migrated from ENSG00000184014 to ENSG00000184014 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DEGS1 Gene migrated from ENSG00000143753 to ENSG00000143753 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DEAF1 Gene migrated from ENSG00000177030 to ENSG00000177030 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDX6 Gene migrated from ENSG00000110367 to ENSG00000110367 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDX59 Gene migrated from ENSG00000118197 to ENSG00000118197 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDX3X Gene migrated from ENSG00000215301 to ENSG00000215301 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDX39B Gene migrated from ENSG00000198563 to ENSG00000198563 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDX23 Gene migrated from ENSG00000174243 to ENSG00000174243 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDX17 Gene migrated from ENSG00000100201 to ENSG00000100201 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDX11 Gene migrated from ENSG00000013573 to ENSG00000013573 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDOST Gene migrated from ENSG00000244038 to ENSG00000244038 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDHD2 Gene migrated from ENSG00000085788 to ENSG00000085788 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDC Gene migrated from ENSG00000132437 to ENSG00000132437 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DDB1 Gene migrated from ENSG00000167986 to ENSG00000167986 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DCX Gene migrated from ENSG00000077279 to ENSG00000077279 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DCPS Gene migrated from ENSG00000110063 to ENSG00000110063 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DCHS1 Gene migrated from ENSG00000166341 to ENSG00000166341 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DCAF17 Gene migrated from ENSG00000115827 to ENSG00000115827 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DBT Gene migrated from ENSG00000137992 to ENSG00000137992 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DARS2 Gene migrated from ENSG00000117593 to ENSG00000117593 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DARS1 Gene symbol changed from DARS to DARS1 during gene set migration (ENSG00000115866 -> ENSG00000115866)
Intellectual disability syndromic and non-syndromic v2.0 DAGLA Gene migrated from ENSG00000134780 to ENSG00000134780 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DAG1 Gene migrated from ENSG00000173402 to ENSG00000173402 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 D2HGDH Gene migrated from ENSG00000180902 to ENSG00000180902 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZFTRAF1 Gene symbol changed from CYHR1 to ZFTRAF1 during gene set migration (ENSG00000187954 -> ENSG00000187954)
Intellectual disability syndromic and non-syndromic v2.0 CYFIP2 Gene migrated from ENSG00000055163 to ENSG00000055163 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CYB5R3 Gene migrated from ENSG00000100243 to ENSG00000100243 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STEEP1 Gene symbol changed from CXorf56 to STEEP1 during gene set migration (ENSG00000018610 -> ENSG00000018610)
Intellectual disability syndromic and non-syndromic v2.0 CWF19L1 Gene migrated from ENSG00000095485 to ENSG00000095485 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CWC27 Gene migrated from ENSG00000153015 to ENSG00000153015 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CUX2 Gene migrated from ENSG00000111249 to ENSG00000111249 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CUX1 Gene migrated from ENSG00000257923 to ENSG00000257923 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CUL4B Gene migrated from ENSG00000158290 to ENSG00000158290 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CUL3 Gene migrated from ENSG00000036257 to ENSG00000036257 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CUL1 Gene migrated from ENSG00000055130 to ENSG00000055130 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTU2 Gene migrated from ENSG00000174177 to ENSG00000174177 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTSD Gene migrated from ENSG00000117984 to ENSG00000117984 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTSA Gene migrated from ENSG00000064601 to ENSG00000064601 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTR9 Gene migrated from ENSG00000198730 to ENSG00000198730 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTNND2 Gene migrated from ENSG00000169862 to ENSG00000169862 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTNNB1 Gene migrated from ENSG00000168036 to ENSG00000168036 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTNNA2 Gene migrated from ENSG00000066032 to ENSG00000066032 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTDP1 Gene migrated from ENSG00000060069 to ENSG00000060069 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTCF Gene migrated from ENSG00000102974 to ENSG00000102974 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CTBP1 Gene migrated from ENSG00000159692 to ENSG00000159692 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSPP1 Gene migrated from ENSG00000104218 to ENSG00000104218 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSNK2B Gene migrated from ENSG00000204435 to ENSG00000204435 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSNK2A1 Gene migrated from ENSG00000101266 to ENSG00000101266 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSMD1 Gene migrated from ENSG00000183117 to ENSG00000183117 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CSDE1 Gene migrated from ENSG00000009307 to ENSG00000009307 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRNKL1 Gene migrated from ENSG00000101343 to ENSG00000101343 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRMP1 Gene migrated from ENSG00000072832 to ENSG00000072832 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRLS1 Gene migrated from ENSG00000088766 to ENSG00000088766 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRIPT Gene migrated from ENSG00000119878 to ENSG00000119878 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRELD1 Gene migrated from ENSG00000163703 to ENSG00000163703 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CREBBP Gene migrated from ENSG00000005339 to ENSG00000005339 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRB2 Gene migrated from ENSG00000148204 to ENSG00000148204 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRADD Gene migrated from ENSG00000169372 to ENSG00000169372 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CPSF3 Gene migrated from ENSG00000119203 to ENSG00000119203 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CPS1 Gene migrated from ENSG00000021826 to ENSG00000021826 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CPE Gene migrated from ENSG00000109472 to ENSG00000109472 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX4I1 Gene migrated from ENSG00000131143 to ENSG00000131143 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX11 Gene migrated from ENSG00000166260 to ENSG00000166260 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX10 Gene migrated from ENSG00000006695 to ENSG00000006695 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COQ8A Gene migrated from ENSG00000163050 to ENSG00000163050 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COQ5 Gene migrated from ENSG00000110871 to ENSG00000110871 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COQ4 Gene migrated from ENSG00000167113 to ENSG00000167113 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COPB2 Gene migrated from ENSG00000184432 to ENSG00000184432 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COPB1 Gene migrated from ENSG00000129083 to ENSG00000129083 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COLEC11 Gene migrated from ENSG00000118004 to ENSG00000118004 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COX15 Gene migrated from ENSG00000014919 to ENSG00000014919 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CERT1 Gene symbol changed from COL4A3BP to CERT1 during gene set migration (ENSG00000113163 -> ENSG00000113163)
Intellectual disability syndromic and non-syndromic v2.0 COL4A2 Gene migrated from ENSG00000134871 to ENSG00000134871 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COL4A1 Gene migrated from ENSG00000187498 to ENSG00000187498 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COG8 Gene migrated from ENSG00000213380 to ENSG00000213380 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COG7 Gene migrated from ENSG00000168434 to ENSG00000168434 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COG6 Gene migrated from ENSG00000133103 to ENSG00000133103 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COG5 Gene migrated from ENSG00000164597 to ENSG00000164597 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COG4 Gene migrated from ENSG00000103051 to ENSG00000103051 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COG1 Gene migrated from ENSG00000166685 to ENSG00000166685 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COASY Gene migrated from ENSG00000068120 to ENSG00000068120 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNTNAP2 Gene migrated from ENSG00000174469 to ENSG00000174469 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNTNAP1 Gene migrated from ENSG00000108797 to ENSG00000108797 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNPY3 Gene migrated from ENSG00000137161 to ENSG00000137161 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNP Gene migrated from ENSG00000173786 to ENSG00000173786 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNOT9 Gene migrated from ENSG00000144580 to ENSG00000144580 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNOT3 Gene migrated from ENSG00000088038 to ENSG00000088038 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNOT2 Gene migrated from ENSG00000111596 to ENSG00000111596 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNOT1 Gene migrated from ENSG00000125107 to ENSG00000125107 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNNM2 Gene migrated from ENSG00000148842 to ENSG00000148842 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CNKSR2 Gene migrated from ENSG00000149970 to ENSG00000149970 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLTC Gene migrated from ENSG00000141367 to ENSG00000141367 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLPB Gene migrated from ENSG00000162129 to ENSG00000162129 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLP1 Gene migrated from ENSG00000172409 to ENSG00000172409 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLN8 Gene migrated from ENSG00000182372 to ENSG00000182372 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLN6 Gene migrated from ENSG00000128973 to ENSG00000128973 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLN5 Gene migrated from ENSG00000102805 to ENSG00000102805 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLN3 Gene migrated from ENSG00000188603 to ENSG00000188603 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLDN5 Gene migrated from ENSG00000184113 to ENSG00000184113 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLCNKB Gene migrated from ENSG00000184908 to ENSG00000184908 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLCN6 Gene migrated from ENSG00000011021 to ENSG00000011021 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLCN4 Gene migrated from ENSG00000073464 to ENSG00000073464 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CLCN3 Gene migrated from ENSG00000109572 to ENSG00000109572 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CKAP2L Gene migrated from ENSG00000169607 to ENSG00000169607 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CIT Gene migrated from ENSG00000122966 to ENSG00000122966 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CIC Gene migrated from ENSG00000079432 to ENSG00000079432 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHTF18 Gene migrated from ENSG00000127586 to ENSG00000127586 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHMP1A Gene migrated from ENSG00000131165 to ENSG00000131165 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHKB Gene migrated from ENSG00000100288 to ENSG00000100288 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHKA Gene migrated from ENSG00000110721 to ENSG00000110721 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHD8 Gene migrated from ENSG00000100888 to ENSG00000100888 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHD7 Gene migrated from ENSG00000171316 to ENSG00000171316 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHD5 Gene migrated from ENSG00000116254 to ENSG00000116254 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHD4 Gene migrated from ENSG00000111642 to ENSG00000111642 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHD3 Gene migrated from ENSG00000170004 to ENSG00000170004 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHD2 Gene migrated from ENSG00000173575 to ENSG00000173575 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHD1 Gene migrated from ENSG00000153922 to ENSG00000153922 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CHAMP1 Gene migrated from ENSG00000198824 to ENSG00000198824 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP85L Gene migrated from ENSG00000111860 to ENSG00000111860 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP83 Gene migrated from ENSG00000173588 to ENSG00000173588 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP76 Gene migrated from ENSG00000101624 to ENSG00000101624 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP57 Gene migrated from ENSG00000166037 to ENSG00000166037 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP55 Gene migrated from ENSG00000138180 to ENSG00000138180 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP41 Gene migrated from ENSG00000106477 to ENSG00000106477 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP295 Gene migrated from ENSG00000166004 to ENSG00000166004 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP290 Gene migrated from ENSG00000198707 to ENSG00000198707 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP164 Gene migrated from ENSG00000110274 to ENSG00000110274 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP152 Gene migrated from ENSG00000103995 to ENSG00000103995 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP135 Gene migrated from ENSG00000174799 to ENSG00000174799 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP120 Gene migrated from ENSG00000168944 to ENSG00000168944 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CEP104 Gene migrated from ENSG00000116198 to ENSG00000116198 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CPAP Gene symbol changed from CENPJ to CPAP during gene set migration (ENSG00000151849 -> ENSG00000151849)
Intellectual disability syndromic and non-syndromic v2.0 CENPF Gene migrated from ENSG00000117724 to ENSG00000117724 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CELSR3 Gene migrated from ENSG00000008300 to ENSG00000008300 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CELSR1 Gene migrated from ENSG00000075275 to ENSG00000075275 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CELF4 Gene migrated from ENSG00000101489 to ENSG00000101489 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CELF2 Gene migrated from ENSG00000048740 to ENSG00000048740 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CECR2 Gene migrated from ENSG00000099954 to ENSG00000099954 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDON Gene migrated from ENSG00000064309 to ENSG00000064309 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDKL5 Gene migrated from ENSG00000008086 to ENSG00000008086 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK8 Gene migrated from ENSG00000132964 to ENSG00000132964 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK6 Gene migrated from ENSG00000105810 to ENSG00000105810 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK5RAP2 Gene migrated from ENSG00000136861 to ENSG00000136861 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK4 Gene migrated from ENSG00000135446 to ENSG00000135446 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK19 Gene migrated from ENSG00000155111 to ENSG00000155111 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK16 Gene migrated from ENSG00000102225 to ENSG00000102225 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK13 Gene migrated from ENSG00000065883 to ENSG00000065883 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDK10 Gene migrated from ENSG00000185324 to ENSG00000185324 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDH2 Gene migrated from ENSG00000170558 to ENSG00000170558 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDH11 Gene migrated from ENSG00000140937 to ENSG00000140937 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDC42BPB Gene migrated from ENSG00000198752 to ENSG00000198752 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CDC42 Gene migrated from ENSG00000070831 to ENSG00000070831 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCT6A Gene migrated from ENSG00000146731 to ENSG00000146731 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCT3 Gene migrated from ENSG00000163468 to ENSG00000163468 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCNK Gene migrated from ENSG00000090061 to ENSG00000090061 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCND2 Gene migrated from ENSG00000118971 to ENSG00000118971 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC88C Gene migrated from ENSG00000015133 to ENSG00000015133 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC88A Gene migrated from ENSG00000115355 to ENSG00000115355 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC82 Gene migrated from ENSG00000149231 to ENSG00000149231 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC47 Gene migrated from ENSG00000108588 to ENSG00000108588 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC22 Gene migrated from ENSG00000101997 to ENSG00000101997 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CCDC186 Gene migrated from ENSG00000165813 to ENSG00000165813 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VMA22 Gene symbol changed from CCDC115 to VMA22 during gene set migration (ENSG00000136710 -> ENSG00000136710)
Intellectual disability syndromic and non-syndromic v2.0 CCBE1 Gene migrated from ENSG00000183287 to ENSG00000183287 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CC2D2A Gene migrated from ENSG00000048342 to ENSG00000048342 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CC2D1A Gene migrated from ENSG00000132024 to ENSG00000132024 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CBY1 Gene migrated from ENSG00000100211 to ENSG00000100211 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CBX1 Gene migrated from ENSG00000108468 to ENSG00000108468 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CBS Gene migrated from ENSG00000160200 to ENSG00000160200 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CBL Gene migrated from ENSG00000110395 to ENSG00000110395 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CASP2 Gene migrated from ENSG00000106144 to ENSG00000106144 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CASK Gene migrated from ENSG00000147044 to ENSG00000147044 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CARS2 Gene migrated from ENSG00000134905 to ENSG00000134905 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CARS1 Gene symbol changed from CARS to CARS1 during gene set migration (ENSG00000110619 -> ENSG00000110619)
Intellectual disability syndromic and non-syndromic v2.0 CAPZA2 Gene migrated from ENSG00000198898 to ENSG00000198898 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAPRIN1 Gene migrated from ENSG00000135387 to ENSG00000135387 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAPN15 Gene migrated from ENSG00000103326 to ENSG00000103326 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAMTA1 Gene migrated from ENSG00000171735 to ENSG00000171735 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAMSAP1 Gene migrated from ENSG00000130559 to ENSG00000130559 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAMK4 Gene migrated from ENSG00000152495 to ENSG00000152495 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAMK2D Gene migrated from ENSG00000145349 to ENSG00000145349 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAMK2B Gene migrated from ENSG00000058404 to ENSG00000058404 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAMK2A Gene migrated from ENSG00000070808 to ENSG00000070808 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CAD Gene migrated from ENSG00000084774 to ENSG00000084774 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA2D2 Gene migrated from ENSG00000007402 to ENSG00000007402 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA1I Gene migrated from ENSG00000100346 to ENSG00000100346 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA1G Gene migrated from ENSG00000006283 to ENSG00000006283 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA1E Gene migrated from ENSG00000198216 to ENSG00000198216 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA1D Gene migrated from ENSG00000157388 to ENSG00000157388 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA1C Gene migrated from ENSG00000151067 to ENSG00000151067 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA1B Gene migrated from ENSG00000148408 to ENSG00000148408 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACNA1A Gene migrated from ENSG00000141837 to ENSG00000141837 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CACHD1 Gene migrated from ENSG00000158966 to ENSG00000158966 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CA8 Gene migrated from ENSG00000178538 to ENSG00000178538 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CA2 Gene migrated from ENSG00000104267 to ENSG00000104267 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CPLANE1 Gene symbol changed from C5orf42 to CPLANE1 during gene set migration (ENSG00000197603 -> ENSG00000197603)
Intellectual disability syndromic and non-syndromic v2.0 C2orf69 Gene migrated from ENSG00000178074 to ENSG00000178074 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 C2CD3 Gene migrated from ENSG00000168014 to ENSG00000168014 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AIRIM Gene symbol changed from C1orf109 to AIRIM during gene set migration (ENSG00000116922 -> ENSG00000116922)
Intellectual disability syndromic and non-syndromic v2.0 VPS35L Gene symbol changed from C16orf62 to VPS35L during gene set migration (ENSG00000103544 -> ENSG00000103544)
Intellectual disability syndromic and non-syndromic v2.0 TEDC1 Gene symbol changed from C14orf80 to TEDC1 during gene set migration (ENSG00000185347 -> ENSG00000185347)
Intellectual disability syndromic and non-syndromic v2.0 KICS2 Gene symbol changed from C12orf66 to KICS2 during gene set migration (ENSG00000174206 -> ENSG00000174206)
Intellectual disability syndromic and non-syndromic v2.0 MTRFR Gene symbol changed from C12orf65 to MTRFR during gene set migration (ENSG00000130921 -> ENSG00000130921)
Intellectual disability syndromic and non-syndromic v2.0 C12orf57 Gene migrated from ENSG00000111678 to ENSG00000111678 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 FERRY3 Gene symbol changed from C12orf4 to FERRY3 during gene set migration (ENSG00000047621 -> ENSG00000047621)
Intellectual disability syndromic and non-syndromic v2.0 BUB1B Gene migrated from ENSG00000156970 to ENSG00000156970 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BTD Gene migrated from ENSG00000169814 to ENSG00000169814 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BSND Gene migrated from ENSG00000162399 to ENSG00000162399 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BSN Gene migrated from ENSG00000164061 to ENSG00000164061 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BSCL2 Gene migrated from ENSG00000168000 to ENSG00000168000 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRWD3 Gene migrated from ENSG00000165288 to ENSG00000165288 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRSK2 Gene migrated from ENSG00000174672 to ENSG00000174672 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRSK1 Gene migrated from ENSG00000160469 to ENSG00000160469 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRPF1 Gene migrated from ENSG00000156983 to ENSG00000156983 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRF2 Gene migrated from ENSG00000104221 to ENSG00000104221 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRF1 Gene migrated from ENSG00000185024 to ENSG00000185024 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRD4 Gene migrated from ENSG00000141867 to ENSG00000141867 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRPM3 Gene migrated from ENSG00000083067 to ENSG00000083067 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRAT1 Gene migrated from ENSG00000106009 to ENSG00000106009 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BRAF Gene migrated from ENSG00000157764 to ENSG00000157764 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BPTF Gene migrated from ENSG00000171634 to ENSG00000171634 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BORCS8 Gene migrated from ENSG00000254901 to ENSG00000254901 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BORCS5 Gene migrated from ENSG00000165714 to ENSG00000165714 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BOLA3 Gene migrated from ENSG00000163170 to ENSG00000163170 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BMP4 Gene migrated from ENSG00000125378 to ENSG00000125378 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BLOC1S1 Gene migrated from ENSG00000135441 to ENSG00000135441 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BICRA Gene migrated from ENSG00000063169 to ENSG00000063169 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BHLHE22 Gene migrated from ENSG00000180828 to ENSG00000180828 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCS1L Gene migrated from ENSG00000074582 to ENSG00000074582 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCOR Gene migrated from ENSG00000183337 to ENSG00000183337 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCL11B Gene migrated from ENSG00000127152 to ENSG00000127152 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCL11A Gene migrated from ENSG00000119866 to ENSG00000119866 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCKDK Gene migrated from ENSG00000103507 to ENSG00000103507 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCKDHB Gene migrated from ENSG00000083123 to ENSG00000083123 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCKDHA Gene migrated from ENSG00000248098 to ENSG00000248098 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCAS3 Gene migrated from ENSG00000141376 to ENSG00000141376 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BCAP31 Gene migrated from ENSG00000185825 to ENSG00000185825 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBS9 Gene migrated from ENSG00000122507 to ENSG00000122507 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBS7 Gene migrated from ENSG00000138686 to ENSG00000138686 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBS5 Gene migrated from ENSG00000163093 to ENSG00000163093 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBS4 Gene migrated from ENSG00000140463 to ENSG00000140463 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBS2 Gene migrated from ENSG00000125124 to ENSG00000125124 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBS12 Gene migrated from ENSG00000181004 to ENSG00000181004 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBS10 Gene migrated from ENSG00000179941 to ENSG00000179941 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBS1 Gene migrated from ENSG00000174483 to ENSG00000174483 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BBIP1 Gene migrated from ENSG00000214413 to ENSG00000214413 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BAP1 Gene migrated from ENSG00000163930 to ENSG00000163930 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BAIAP2 Gene migrated from ENSG00000175866 to ENSG00000175866 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B9D2 Gene migrated from ENSG00000123810 to ENSG00000123810 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B9D1 Gene migrated from ENSG00000108641 to ENSG00000108641 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B4GALT7 Gene migrated from ENSG00000027847 to ENSG00000027847 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B4GALT1 Gene migrated from ENSG00000086062 to ENSG00000086062 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B4GALNT1 Gene migrated from ENSG00000135454 to ENSG00000135454 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B3GLCT Gene migrated from ENSG00000187676 to ENSG00000187676 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 B3GALNT2 Gene migrated from ENSG00000162885 to ENSG00000162885 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AXIN1 Gene migrated from ENSG00000103126 to ENSG00000103126 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AUTS2 Gene migrated from ENSG00000158321 to ENSG00000158321 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AUH Gene migrated from ENSG00000148090 to ENSG00000148090 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATXN7L3 Gene migrated from ENSG00000087152 to ENSG00000087152 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATRX Gene migrated from ENSG00000085224 to ENSG00000085224 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATR Gene migrated from ENSG00000175054 to ENSG00000175054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP9A Gene migrated from ENSG00000054793 to ENSG00000054793 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP8A2 Gene migrated from ENSG00000132932 to ENSG00000132932 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP7A Gene migrated from ENSG00000165240 to ENSG00000165240 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP6V1B2 Gene migrated from ENSG00000147416 to ENSG00000147416 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP6V1A Gene migrated from ENSG00000114573 to ENSG00000114573 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP6V0C Gene migrated from ENSG00000185883 to ENSG00000185883 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP6V0A2 Gene migrated from ENSG00000185344 to ENSG00000185344 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP6V0A1 Gene migrated from ENSG00000033627 to ENSG00000033627 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP6AP2 Gene migrated from ENSG00000182220 to ENSG00000182220 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP6AP1 Gene migrated from ENSG00000071553 to ENSG00000071553 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP5PO Gene symbol changed from ATP5O to ATP5PO during gene set migration (ENSG00000241837 -> ENSG00000241837)
Intellectual disability syndromic and non-syndromic v2.0 ATP5F1A Gene symbol changed from ATP5A1 to ATP5F1A during gene set migration (ENSG00000152234 -> ENSG00000152234)
Intellectual disability syndromic and non-syndromic v2.0 ATP2B3 Gene migrated from ENSG00000067842 to ENSG00000067842 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP2B2 Gene migrated from ENSG00000157087 to ENSG00000157087 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP2B1 Gene migrated from ENSG00000070961 to ENSG00000070961 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP1A3 Gene migrated from ENSG00000105409 to ENSG00000105409 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP1A2 Gene migrated from ENSG00000018625 to ENSG00000018625 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATP1A1 Gene migrated from ENSG00000163399 to ENSG00000163399 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATN1 Gene migrated from ENSG00000111676 to ENSG00000111676 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATIC Gene migrated from ENSG00000138363 to ENSG00000138363 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATG7 Gene migrated from ENSG00000197548 to ENSG00000197548 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATG4D Gene migrated from ENSG00000130734 to ENSG00000130734 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATG12 Gene migrated from ENSG00000145782 to ENSG00000145782 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATAD3A Gene migrated from ENSG00000197785 to ENSG00000197785 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ATAD1 Gene migrated from ENSG00000138138 to ENSG00000138138 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASXL3 Gene migrated from ENSG00000141431 to ENSG00000141431 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASXL2 Gene migrated from ENSG00000143970 to ENSG00000143970 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASXL1 Gene migrated from ENSG00000171456 to ENSG00000171456 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASTN1 Gene migrated from ENSG00000152092 to ENSG00000152092 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASPM Gene migrated from ENSG00000066279 to ENSG00000066279 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASPA Gene migrated from ENSG00000108381 to ENSG00000108381 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASNS Gene migrated from ENSG00000070669 to ENSG00000070669 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASS1 Gene migrated from ENSG00000130707 to ENSG00000130707 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASL Gene migrated from ENSG00000126522 to ENSG00000126522 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASH1L Gene migrated from ENSG00000116539 to ENSG00000116539 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASCC3 Gene migrated from ENSG00000112249 to ENSG00000112249 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ASAH1 Gene migrated from ENSG00000104763 to ENSG00000104763 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARX Gene migrated from ENSG00000004848 to ENSG00000004848 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARV1 Gene migrated from ENSG00000173409 to ENSG00000173409 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARSL Gene symbol changed from ARSE to ARSL during gene set migration (ENSG00000157399 -> ENSG00000157399)
Intellectual disability syndromic and non-syndromic v2.0 ARSB Gene migrated from ENSG00000113273 to ENSG00000113273 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARSA Gene migrated from ENSG00000100299 to ENSG00000100299 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARPC4 Gene migrated from ENSG00000241553 to ENSG00000241553 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BMAL1 Gene symbol changed from ARNTL to BMAL1 during gene set migration (ENSG00000133794 -> ENSG00000133794)
Intellectual disability syndromic and non-syndromic v2.0 ARMC9 Gene migrated from ENSG00000135931 to ENSG00000135931 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARL6 Gene migrated from ENSG00000113966 to ENSG00000113966 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARL13B Gene migrated from ENSG00000169379 to ENSG00000169379 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARID2 Gene migrated from ENSG00000189079 to ENSG00000189079 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARID1B Gene migrated from ENSG00000049618 to ENSG00000049618 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARID1A Gene migrated from ENSG00000117713 to ENSG00000117713 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARHGEF9 Gene migrated from ENSG00000131089 to ENSG00000131089 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARHGAP35 Gene migrated from ENSG00000160007 to ENSG00000160007 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARG1 Gene migrated from ENSG00000118520 to ENSG00000118520 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARFGEF2 Gene migrated from ENSG00000124198 to ENSG00000124198 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARFGEF1 Gene migrated from ENSG00000066777 to ENSG00000066777 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARF3 Gene migrated from ENSG00000134287 to ENSG00000134287 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARF1 Gene migrated from ENSG00000143761 to ENSG00000143761 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ARCN1 Gene migrated from ENSG00000095139 to ENSG00000095139 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 COA8 Gene symbol changed from APOPT1 to COA8 during gene set migration (ENSG00000256053 -> ENSG00000256053)
Intellectual disability syndromic and non-syndromic v2.0 APC2 Gene migrated from ENSG00000115266 to ENSG00000115266 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP4S1 Gene migrated from ENSG00000100478 to ENSG00000100478 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP4M1 Gene migrated from ENSG00000221838 to ENSG00000221838 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP4E1 Gene migrated from ENSG00000081014 to ENSG00000081014 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP4B1 Gene migrated from ENSG00000134262 to ENSG00000134262 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP3B2 Gene migrated from ENSG00000103723 to ENSG00000103723 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP3B1 Gene migrated from ENSG00000132842 to ENSG00000132842 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP2S1 Gene migrated from ENSG00000042753 to ENSG00000042753 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP2M1 Gene migrated from ENSG00000161203 to ENSG00000161203 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP1S2 Gene migrated from ENSG00000182287 to ENSG00000182287 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP1S1 Gene migrated from ENSG00000106367 to ENSG00000106367 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP1G1 Gene migrated from ENSG00000166747 to ENSG00000166747 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AP1B1 Gene migrated from ENSG00000100280 to ENSG00000100280 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANO4 Gene migrated from ENSG00000151572 to ENSG00000151572 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANKS1B Gene migrated from ENSG00000185046 to ENSG00000185046 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANKRD17 Gene migrated from ENSG00000132466 to ENSG00000132466 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANKRD11 Gene migrated from ENSG00000167522 to ENSG00000167522 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANK3 Gene migrated from ENSG00000151150 to ENSG00000151150 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ANK2 Gene migrated from ENSG00000145362 to ENSG00000145362 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AMT Gene migrated from ENSG00000145020 to ENSG00000145020 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AMPD2 Gene migrated from ENSG00000116337 to ENSG00000116337 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AMOTL1 Gene migrated from ENSG00000166025 to ENSG00000166025 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AMER1 Gene migrated from ENSG00000184675 to ENSG00000184675 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALMS1 Gene migrated from ENSG00000116127 to ENSG00000116127 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALKBH8 Gene migrated from ENSG00000137760 to ENSG00000137760 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG9 Gene migrated from ENSG00000086848 to ENSG00000086848 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG8 Gene migrated from ENSG00000159063 to ENSG00000159063 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG6 Gene migrated from ENSG00000088035 to ENSG00000088035 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG3 Gene migrated from ENSG00000214160 to ENSG00000214160 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG2 Gene migrated from ENSG00000119523 to ENSG00000119523 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG14 Gene migrated from ENSG00000172339 to ENSG00000172339 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG13 Gene migrated from ENSG00000101901 to ENSG00000101901 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG12 Gene migrated from ENSG00000182858 to ENSG00000182858 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG11 Gene migrated from ENSG00000253710 to ENSG00000253710 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALG1 Gene migrated from ENSG00000033011 to ENSG00000033011 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALDH7A1 Gene migrated from ENSG00000164904 to ENSG00000164904 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALDH5A1 Gene migrated from ENSG00000112294 to ENSG00000112294 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALDH4A1 Gene migrated from ENSG00000159423 to ENSG00000159423 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALDH3A2 Gene migrated from ENSG00000072210 to ENSG00000072210 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ALDH18A1 Gene migrated from ENSG00000059573 to ENSG00000059573 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AKT3 Gene migrated from ENSG00000117020 to ENSG00000117020 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AJAP1 Gene migrated from ENSG00000196581 to ENSG00000196581 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AIMP1 Gene migrated from ENSG00000164022 to ENSG00000164022 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AIFM1 Gene migrated from ENSG00000156709 to ENSG00000156709 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AHI1 Gene migrated from ENSG00000135541 to ENSG00000135541 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AHDC1 Gene migrated from ENSG00000126705 to ENSG00000126705 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AHCY Gene migrated from ENSG00000101444 to ENSG00000101444 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGTPBP1 Gene migrated from ENSG00000135049 to ENSG00000135049 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGO2 Gene migrated from ENSG00000123908 to ENSG00000123908 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGO1 Gene migrated from ENSG00000092847 to ENSG00000092847 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGMO Gene migrated from ENSG00000187546 to ENSG00000187546 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AGA Gene migrated from ENSG00000038002 to ENSG00000038002 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AFF4 Gene migrated from ENSG00000072364 to ENSG00000072364 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AFF3 Gene migrated from ENSG00000144218 to ENSG00000144218 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AFF2 Gene migrated from ENSG00000155966 to ENSG00000155966 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADSL Gene migrated from ENSG00000239900 to ENSG00000239900 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADNP Gene migrated from ENSG00000101126 to ENSG00000101126 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADK Gene migrated from ENSG00000156110 to ENSG00000156110 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADGRL1 Gene migrated from ENSG00000072071 to ENSG00000072071 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADGRG1 Gene migrated from ENSG00000205336 to ENSG00000205336 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADD3 Gene migrated from ENSG00000148700 to ENSG00000148700 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADAT3 Gene migrated from ENSG00000213638 to ENSG00000213638 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADARB1 Gene migrated from ENSG00000197381 to ENSG00000197381 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADAR Gene migrated from ENSG00000160710 to ENSG00000160710 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADAMTS10 Gene migrated from ENSG00000142303 to ENSG00000142303 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ADAM22 Gene migrated from ENSG00000008277 to ENSG00000008277 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACY1 Gene migrated from ENSG00000243989 to ENSG00000243989 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACTL6B Gene migrated from ENSG00000077080 to ENSG00000077080 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACTL6A Gene migrated from ENSG00000136518 to ENSG00000136518 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACTG1 Gene migrated from ENSG00000184009 to ENSG00000184009 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACTB Gene migrated from ENSG00000075624 to ENSG00000075624 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACSL4 Gene migrated from ENSG00000068366 to ENSG00000068366 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACOX1 Gene migrated from ENSG00000161533 to ENSG00000161533 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACO2 Gene migrated from ENSG00000100412 to ENSG00000100412 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACBD6 Gene migrated from ENSG00000230124 to ENSG00000230124 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACADM Gene migrated from ENSG00000117054 to ENSG00000117054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ACAD9 Gene migrated from ENSG00000177646 to ENSG00000177646 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABHD5 Gene migrated from ENSG00000011198 to ENSG00000011198 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABHD16A Gene migrated from ENSG00000204427 to ENSG00000204427 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABCD4 Gene migrated from ENSG00000119688 to ENSG00000119688 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABCD1 Gene migrated from ENSG00000101986 to ENSG00000101986 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABCC9 Gene migrated from ENSG00000069431 to ENSG00000069431 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABCA2 Gene migrated from ENSG00000107331 to ENSG00000107331 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ABAT Gene migrated from ENSG00000183044 to ENSG00000183044 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AAAS Gene migrated from ENSG00000094914 to ENSG00000094914 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 GTF2I Gene migrated from ENSG00000263001 to ENSG00000263001 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZSWIM6 Gene migrated from ENSG00000130449 to ENSG00000130449 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZSCAN10 Gene migrated from ENSG00000130182 to ENSG00000130182 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZRSR2 Gene migrated from ENSG00000169249 to ENSG00000169249 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNRF3 Gene migrated from ENSG00000183579 to ENSG00000183579 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNHIT3 Gene migrated from ENSG00000273611 to ENSG00000273611 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF711 Gene migrated from ENSG00000147180 to ENSG00000147180 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF699 Gene migrated from ENSG00000196110 to ENSG00000196110 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF526 Gene migrated from ENSG00000167625 to ENSG00000167625 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF462 Gene migrated from ENSG00000148143 to ENSG00000148143 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF335 Gene migrated from ENSG00000198026 to ENSG00000198026 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF292 Gene migrated from ENSG00000188994 to ENSG00000188994 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF148 Gene migrated from ENSG00000163848 to ENSG00000163848 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZNF142 Gene migrated from ENSG00000115568 to ENSG00000115568 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZMYND8 Gene migrated from ENSG00000101040 to ENSG00000101040 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZMYND11 Gene migrated from ENSG00000015171 to ENSG00000015171 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZMYM3 Gene migrated from ENSG00000147130 to ENSG00000147130 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZMYM2 Gene migrated from ENSG00000121741 to ENSG00000121741 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZMIZ1 Gene migrated from ENSG00000108175 to ENSG00000108175 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZIC2 Gene migrated from ENSG00000043355 to ENSG00000043355 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZIC1 Gene migrated from ENSG00000152977 to ENSG00000152977 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZFYVE26 Gene migrated from ENSG00000072121 to ENSG00000072121 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZFX Gene migrated from ENSG00000005889 to ENSG00000005889 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZFHX4 Gene migrated from ENSG00000091656 to ENSG00000091656 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZFHX3 Gene migrated from ENSG00000140836 to ENSG00000140836 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZEB2 Gene migrated from ENSG00000169554 to ENSG00000169554 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZDHHC9 Gene migrated from ENSG00000188706 to ENSG00000188706 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZC4H2 Gene migrated from ENSG00000126970 to ENSG00000126970 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZBTB7A Gene migrated from ENSG00000178951 to ENSG00000178951 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZBTB47 Gene migrated from ENSG00000114853 to ENSG00000114853 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZBTB24 Gene migrated from ENSG00000112365 to ENSG00000112365 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZBTB20 Gene migrated from ENSG00000181722 to ENSG00000181722 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZBTB18 Gene migrated from ENSG00000179456 to ENSG00000179456 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ZBTB11 Gene migrated from ENSG00000066422 to ENSG00000066422 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 YY1 Gene migrated from ENSG00000100811 to ENSG00000100811 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 YWHAG Gene migrated from ENSG00000170027 to ENSG00000170027 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 YWHAE Gene migrated from ENSG00000108953 to ENSG00000108953 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 YIF1B Gene migrated from ENSG00000167645 to ENSG00000167645 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 YARS1 Gene symbol changed from YARS to YARS1 during gene set migration (ENSG00000134684 -> ENSG00000134684)
Intellectual disability syndromic and non-syndromic v2.0 XYLT1 Gene migrated from ENSG00000103489 to ENSG00000103489 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 XRCC4 Gene migrated from ENSG00000152422 to ENSG00000152422 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 XPOT Gene migrated from ENSG00000184575 to ENSG00000184575 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 XPO1 Gene migrated from ENSG00000082898 to ENSG00000082898 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 XPA Gene migrated from ENSG00000136936 to ENSG00000136936 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WWOX Gene migrated from ENSG00000186153 to ENSG00000186153 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WSB2 Gene migrated from ENSG00000176871 to ENSG00000176871 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WNT5A Gene migrated from ENSG00000114251 to ENSG00000114251 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WNT1 Gene migrated from ENSG00000125084 to ENSG00000125084 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WNK3 Gene migrated from ENSG00000196632 to ENSG00000196632 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WIPI2 Gene migrated from ENSG00000157954 to ENSG00000157954 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR91 Gene migrated from ENSG00000105875 to ENSG00000105875 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR83OS Gene migrated from ENSG00000105583 to ENSG00000105583 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR81 Gene migrated from ENSG00000167716 to ENSG00000167716 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR73 Gene migrated from ENSG00000177082 to ENSG00000177082 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR62 Gene migrated from ENSG00000075702 to ENSG00000075702 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR5 Gene migrated from ENSG00000196363 to ENSG00000196363 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR47 Gene migrated from ENSG00000085433 to ENSG00000085433 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR45B Gene migrated from ENSG00000141580 to ENSG00000141580 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR45 Gene migrated from ENSG00000196998 to ENSG00000196998 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR44 Gene migrated from ENSG00000131725 to ENSG00000131725 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR4 Gene migrated from ENSG00000160193 to ENSG00000160193 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR26 Gene migrated from ENSG00000162923 to ENSG00000162923 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDR11 Gene migrated from ENSG00000120008 to ENSG00000120008 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDPCP Gene migrated from ENSG00000143951 to ENSG00000143951 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WDFY3 Gene migrated from ENSG00000163625 to ENSG00000163625 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WBP4 Gene migrated from ENSG00000120688 to ENSG00000120688 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WASHC4 Gene migrated from ENSG00000136051 to ENSG00000136051 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WASF1 Gene migrated from ENSG00000112290 to ENSG00000112290 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WARS2 Gene migrated from ENSG00000116874 to ENSG00000116874 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WARS1 Gene symbol changed from WARS to WARS1 during gene set migration (ENSG00000140105 -> ENSG00000140105)
Intellectual disability syndromic and non-syndromic v2.0 WAPL Gene migrated from ENSG00000062650 to ENSG00000062650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 WAC Gene migrated from ENSG00000095787 to ENSG00000095787 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VWA3B Gene migrated from ENSG00000168658 to ENSG00000168658 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VRK1 Gene migrated from ENSG00000100749 to ENSG00000100749 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS53 Gene migrated from ENSG00000141252 to ENSG00000141252 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS51 Gene migrated from ENSG00000149823 to ENSG00000149823 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS50 Gene migrated from ENSG00000004766 to ENSG00000004766 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS4A Gene migrated from ENSG00000132612 to ENSG00000132612 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS41 Gene migrated from ENSG00000006715 to ENSG00000006715 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS33B Gene migrated from ENSG00000184056 to ENSG00000184056 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS16 Gene migrated from ENSG00000215305 to ENSG00000215305 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS13B Gene migrated from ENSG00000132549 to ENSG00000132549 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VPS11 Gene migrated from ENSG00000160695 to ENSG00000160695 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VLDLR Gene migrated from ENSG00000147852 to ENSG00000147852 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VIPAS39 Gene migrated from ENSG00000151445 to ENSG00000151445 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VCP Gene migrated from ENSG00000165280 to ENSG00000165280 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VARS2 Gene migrated from ENSG00000137411 to ENSG00000137411 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 VARS1 Gene symbol changed from VARS to VARS1 during gene set migration (ENSG00000204394 -> ENSG00000204394)
Intellectual disability syndromic and non-syndromic v2.0 VAMP2 Gene migrated from ENSG00000220205 to ENSG00000220205 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 USP9X Gene migrated from ENSG00000124486 to ENSG00000124486 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 USP7 Gene migrated from ENSG00000187555 to ENSG00000187555 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 USP27X Gene migrated from ENSG00000273820 to ENSG00000273820 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 USP18 Gene migrated from ENSG00000184979 to ENSG00000184979 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UPF3B Gene migrated from ENSG00000125351 to ENSG00000125351 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UPF1 Gene migrated from ENSG00000005007 to ENSG00000005007 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UPB1 Gene migrated from ENSG00000100024 to ENSG00000100024 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UNC80 Gene migrated from ENSG00000144406 to ENSG00000144406 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UNC79 Gene migrated from ENSG00000133958 to ENSG00000133958 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UNC13A Gene migrated from ENSG00000130477 to ENSG00000130477 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UMPS Gene migrated from ENSG00000114491 to ENSG00000114491 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UGP2 Gene migrated from ENSG00000169764 to ENSG00000169764 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UGGT1 Gene migrated from ENSG00000136731 to ENSG00000136731 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UFSP2 Gene migrated from ENSG00000109775 to ENSG00000109775 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UFM1 Gene migrated from ENSG00000120686 to ENSG00000120686 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UFC1 Gene migrated from ENSG00000143222 to ENSG00000143222 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBTF Gene migrated from ENSG00000108312 to ENSG00000108312 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBR7 Gene migrated from ENSG00000012963 to ENSG00000012963 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBR5 Gene migrated from ENSG00000104517 to ENSG00000104517 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UGDH Gene migrated from ENSG00000109814 to ENSG00000109814 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBR1 Gene migrated from ENSG00000159459 to ENSG00000159459 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBE4A Gene migrated from ENSG00000110344 to ENSG00000110344 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBE3C Gene migrated from ENSG00000009335 to ENSG00000009335 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBE3B Gene migrated from ENSG00000151148 to ENSG00000151148 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBE3A Gene migrated from ENSG00000114062 to ENSG00000114062 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBE2A Gene migrated from ENSG00000077721 to ENSG00000077721 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBAP2L Gene migrated from ENSG00000143569 to ENSG00000143569 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 UBA5 Gene migrated from ENSG00000081307 to ENSG00000081307 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 U2AF2 Gene migrated from ENSG00000063244 to ENSG00000063244 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TWIST1 Gene migrated from ENSG00000122691 to ENSG00000122691 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUSC3 Gene migrated from ENSG00000104723 to ENSG00000104723 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBGCP6 Gene migrated from ENSG00000128159 to ENSG00000128159 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBGCP2 Gene migrated from ENSG00000130640 to ENSG00000130640 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBG1 Gene migrated from ENSG00000131462 to ENSG00000131462 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBB4A Gene migrated from ENSG00000104833 to ENSG00000104833 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBB3 Gene migrated from ENSG00000258947 to ENSG00000258947 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBB2B Gene migrated from ENSG00000137285 to ENSG00000137285 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBB2A Gene migrated from ENSG00000137267 to ENSG00000137267 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBB Gene migrated from ENSG00000196230 to ENSG00000196230 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TUBA1A Gene migrated from ENSG00000167552 to ENSG00000167552 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTI2 Gene migrated from ENSG00000129696 to ENSG00000129696 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTI1 Gene migrated from ENSG00000101407 to ENSG00000101407 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTC8 Gene migrated from ENSG00000165533 to ENSG00000165533 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TTC5 Gene migrated from ENSG00000136319 to ENSG00000136319 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SKIC3 Gene symbol changed from TTC37 to SKIC3 during gene set migration (ENSG00000198677 -> ENSG00000198677)
Intellectual disability syndromic and non-syndromic v2.0 TTC19 Gene migrated from ENSG00000011295 to ENSG00000011295 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSPOAP1 Gene migrated from ENSG00000005379 to ENSG00000005379 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSHB Gene migrated from ENSG00000134200 to ENSG00000134200 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSFM Gene migrated from ENSG00000123297 to ENSG00000123297 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSEN54 Gene migrated from ENSG00000182173 to ENSG00000182173 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSEN2 Gene migrated from ENSG00000154743 to ENSG00000154743 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSEN15 Gene migrated from ENSG00000198860 to ENSG00000198860 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSC2 Gene migrated from ENSG00000103197 to ENSG00000103197 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TSC1 Gene migrated from ENSG00000165699 to ENSG00000165699 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 TRRAP Gene migrated from ENSG00000196367 to ENSG00000196367 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STT3A Gene migrated from ENSG00000134910 to ENSG00000134910 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STRADA Gene migrated from ENSG00000266173 to ENSG00000266173 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STRA6 Gene migrated from ENSG00000137868 to ENSG00000137868 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STIL Gene migrated from ENSG00000123473 to ENSG00000123473 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STAMBP Gene migrated from ENSG00000124356 to ENSG00000124356 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STAG2 Gene migrated from ENSG00000101972 to ENSG00000101972 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 STAG1 Gene migrated from ENSG00000118007 to ENSG00000118007 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 DENND2B Gene symbol changed from ST5 to DENND2B during gene set migration (ENSG00000166444 -> ENSG00000166444)
Intellectual disability syndromic and non-syndromic v2.0 ST3GAL5 Gene migrated from ENSG00000115525 to ENSG00000115525 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ST3GAL3 Gene migrated from ENSG00000126091 to ENSG00000126091 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SSR4 Gene migrated from ENSG00000180879 to ENSG00000180879 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SSPOP Gene symbol changed from SSPO to SSPOP during gene set migration (ENSG00000197558 -> ENSG00000197558)
Intellectual disability syndromic and non-syndromic v2.0 SRSF1 Gene migrated from ENSG00000136450 to ENSG00000136450 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SRRM4 Gene migrated from ENSG00000139767 to ENSG00000139767 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SRRM2 Gene migrated from ENSG00000167978 to ENSG00000167978 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SRRM1 Gene migrated from ENSG00000133226 to ENSG00000133226 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SRPK3 Gene migrated from ENSG00000184343 to ENSG00000184343 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SRD5A3 Gene migrated from ENSG00000128039 to ENSG00000128039 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SRCAP Gene migrated from ENSG00000080603 to ENSG00000080603 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPTBN4 Gene migrated from ENSG00000160460 to ENSG00000160460 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPTBN2 Gene migrated from ENSG00000173898 to ENSG00000173898 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPTBN1 Gene migrated from ENSG00000115306 to ENSG00000115306 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPTAN1 Gene migrated from ENSG00000197694 to ENSG00000197694 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPRED2 Gene migrated from ENSG00000198369 to ENSG00000198369 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPRED1 Gene migrated from ENSG00000166068 to ENSG00000166068 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPR Gene migrated from ENSG00000116096 to ENSG00000116096 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPOUT1 Gene migrated from ENSG00000198917 to ENSG00000198917 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPOP Gene migrated from ENSG00000121067 to ENSG00000121067 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPNS1 Gene migrated from ENSG00000169682 to ENSG00000169682 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPG11 Gene migrated from ENSG00000104133 to ENSG00000104133 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPEN Gene migrated from ENSG00000065526 to ENSG00000065526 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SPECC1L Gene migrated from ENSG00000100014 to ENSG00000100014 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AFG2B Gene symbol changed from SPATA5L1 to AFG2B during gene set migration (ENSG00000171763 -> ENSG00000171763)
Intellectual disability syndromic and non-syndromic v2.0 AFG2A Gene symbol changed from SPATA5 to AFG2A during gene set migration (ENSG00000145375 -> ENSG00000145375)
Intellectual disability syndromic and non-syndromic v2.0 SPART Gene migrated from ENSG00000133104 to ENSG00000133104 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SP9 Gene migrated from ENSG00000217236 to ENSG00000217236 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX6 Gene migrated from ENSG00000110693 to ENSG00000110693 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX5 Gene migrated from ENSG00000134532 to ENSG00000134532 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX4 Gene migrated from ENSG00000124766 to ENSG00000124766 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX2 Gene migrated from ENSG00000181449 to ENSG00000181449 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX11 Gene migrated from ENSG00000176887 to ENSG00000176887 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOX10 Gene migrated from ENSG00000100146 to ENSG00000100146 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOS1 Gene migrated from ENSG00000115904 to ENSG00000115904 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SON Gene migrated from ENSG00000159140 to ENSG00000159140 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOD1 Gene migrated from ENSG00000142168 to ENSG00000142168 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SOS2 Gene migrated from ENSG00000100485 to ENSG00000100485 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNX27 Gene migrated from ENSG00000143376 to ENSG00000143376 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNX14 Gene migrated from ENSG00000135317 to ENSG00000135317 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNW1 Gene migrated from ENSG00000100603 to ENSG00000100603 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNRPB Gene migrated from ENSG00000125835 to ENSG00000125835 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNF8 Gene migrated from ENSG00000159210 to ENSG00000159210 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNAPIN Gene migrated from ENSG00000143553 to ENSG00000143553 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNAPC4 Gene migrated from ENSG00000165684 to ENSG00000165684 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNAP29 Gene migrated from ENSG00000099940 to ENSG00000099940 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SNAP25 Gene migrated from ENSG00000132639 to ENSG00000132639 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMS Gene migrated from ENSG00000102172 to ENSG00000102172 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMPD4 Gene migrated from ENSG00000136699 to ENSG00000136699 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMPD1 Gene migrated from ENSG00000166311 to ENSG00000166311 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMOC1 Gene migrated from ENSG00000198732 to ENSG00000198732 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMG9 Gene migrated from ENSG00000105771 to ENSG00000105771 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMG8 Gene migrated from ENSG00000167447 to ENSG00000167447 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMC5 Gene migrated from ENSG00000198887 to ENSG00000198887 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMC3 Gene migrated from ENSG00000108055 to ENSG00000108055 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMC1A Gene migrated from ENSG00000072501 to ENSG00000072501 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCE1 Gene migrated from ENSG00000073584 to ENSG00000073584 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCD1 Gene migrated from ENSG00000066117 to ENSG00000066117 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCC2 Gene migrated from ENSG00000139613 to ENSG00000139613 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCC1 Gene migrated from ENSG00000173473 to ENSG00000173473 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCB1 Gene migrated from ENSG00000099956 to ENSG00000099956 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCA5 Gene migrated from ENSG00000153147 to ENSG00000153147 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCA4 Gene migrated from ENSG00000127616 to ENSG00000127616 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCA2 Gene migrated from ENSG00000080503 to ENSG00000080503 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMARCA1 Gene migrated from ENSG00000102038 to ENSG00000102038 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMAD6 Gene migrated from ENSG00000137834 to ENSG00000137834 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SMAD4 Gene migrated from ENSG00000141646 to ENSG00000141646 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLK Gene migrated from ENSG00000065613 to ENSG00000065613 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLITRK2 Gene migrated from ENSG00000185985 to ENSG00000185985 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLF2 Gene migrated from ENSG00000119906 to ENSG00000119906 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC9A6 Gene migrated from ENSG00000198689 to ENSG00000198689 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC6A9 Gene migrated from ENSG00000196517 to ENSG00000196517 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC6A8 Gene migrated from ENSG00000130821 to ENSG00000130821 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC6A3 Gene migrated from ENSG00000142319 to ENSG00000142319 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC6A19 Gene migrated from ENSG00000174358 to ENSG00000174358 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC6A17 Gene migrated from ENSG00000197106 to ENSG00000197106 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC6A1 Gene migrated from ENSG00000157103 to ENSG00000157103 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC5A6 Gene migrated from ENSG00000138074 to ENSG00000138074 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC4A4 Gene migrated from ENSG00000080493 to ENSG00000080493 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC4A10 Gene migrated from ENSG00000144290 to ENSG00000144290 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC46A1 Gene migrated from ENSG00000076351 to ENSG00000076351 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC45A1 Gene migrated from ENSG00000162426 to ENSG00000162426 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC39A8 Gene migrated from ENSG00000138821 to ENSG00000138821 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC39A14 Gene migrated from ENSG00000104635 to ENSG00000104635 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC38A3 Gene migrated from ENSG00000188338 to ENSG00000188338 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC35C1 Gene migrated from ENSG00000181830 to ENSG00000181830 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC35A2 Gene migrated from ENSG00000102100 to ENSG00000102100 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC33A1 Gene migrated from ENSG00000169359 to ENSG00000169359 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC32A1 Gene migrated from ENSG00000101438 to ENSG00000101438 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC31A1 Gene migrated from ENSG00000136868 to ENSG00000136868 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC30A9 Gene migrated from ENSG00000014824 to ENSG00000014824 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC2A1 Gene migrated from ENSG00000117394 to ENSG00000117394 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A22 Gene migrated from ENSG00000177542 to ENSG00000177542 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A15 Gene migrated from ENSG00000102743 to ENSG00000102743 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A12 Gene migrated from ENSG00000115840 to ENSG00000115840 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC25A1 Gene migrated from ENSG00000100075 to ENSG00000100075 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC1A4 Gene migrated from ENSG00000115902 to ENSG00000115902 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC1A2 Gene migrated from ENSG00000110436 to ENSG00000110436 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC19A3 Gene migrated from ENSG00000135917 to ENSG00000135917 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC18A2 Gene migrated from ENSG00000165646 to ENSG00000165646 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC17A5 Gene migrated from ENSG00000119899 to ENSG00000119899 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC16A2 Gene migrated from ENSG00000147100 to ENSG00000147100 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC13A5 Gene migrated from ENSG00000141485 to ENSG00000141485 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC12A9 Gene migrated from ENSG00000146828 to ENSG00000146828 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC12A6 Gene migrated from ENSG00000140199 to ENSG00000140199 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC12A5 Gene migrated from ENSG00000124140 to ENSG00000124140 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SLC12A2 Gene migrated from ENSG00000064651 to ENSG00000064651 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SKOR2 Gene migrated from ENSG00000215474 to ENSG00000215474 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SKI Gene migrated from ENSG00000157933 to ENSG00000157933 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SIX3 Gene migrated from ENSG00000138083 to ENSG00000138083 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SIN3B Gene migrated from ENSG00000127511 to ENSG00000127511 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SIN3A Gene migrated from ENSG00000169375 to ENSG00000169375 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SIL1 Gene migrated from ENSG00000120725 to ENSG00000120725 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SIK1 Gene migrated from ENSG00000142178 to ENSG00000142178 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SIAH1 Gene migrated from ENSG00000196470 to ENSG00000196470 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SHOC2 Gene migrated from ENSG00000108061 to ENSG00000108061 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SHMT2 Gene migrated from ENSG00000182199 to ENSG00000182199 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SHH Gene migrated from ENSG00000164690 to ENSG00000164690 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SHANK3 Gene migrated from ENSG00000251322 to ENSG00000251322 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SHANK2 Gene migrated from ENSG00000162105 to ENSG00000162105 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SHANK1 Gene migrated from ENSG00000161681 to ENSG00000161681 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SGSM3 Gene migrated from ENSG00000100359 to ENSG00000100359 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SGSH Gene migrated from ENSG00000181523 to ENSG00000181523 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SGPL1 Gene migrated from ENSG00000166224 to ENSG00000166224 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SFXN4 Gene migrated from ENSG00000183605 to ENSG00000183605 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SF3B1 Gene migrated from ENSG00000115524 to ENSG00000115524 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SF1 Gene migrated from ENSG00000168066 to ENSG00000168066 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SETD5 Gene migrated from ENSG00000168137 to ENSG00000168137 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SETD2 Gene migrated from ENSG00000181555 to ENSG00000181555 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SETD1B Gene migrated from ENSG00000139718 to ENSG00000139718 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SETD1A Gene migrated from ENSG00000099381 to ENSG00000099381 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SETBP1 Gene migrated from ENSG00000152217 to ENSG00000152217 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SET Gene migrated from ENSG00000119335 to ENSG00000119335 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SERAC1 Gene migrated from ENSG00000122335 to ENSG00000122335 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SEPTIN2 Gene symbol changed from SEPT2 to SEPTIN2 during gene set migration (ENSG00000168385 -> ENSG00000168385)
Intellectual disability syndromic and non-syndromic v2.0 SEPSECS Gene migrated from ENSG00000109618 to ENSG00000109618 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SEPHS1 Gene migrated from ENSG00000086475 to ENSG00000086475 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SEMA6B Gene migrated from ENSG00000167680 to ENSG00000167680 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SELENOI Gene migrated from ENSG00000138018 to ENSG00000138018 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SEL1L Gene migrated from ENSG00000071537 to ENSG00000071537 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SECISBP2 Gene migrated from ENSG00000187742 to ENSG00000187742 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SEC31A Gene migrated from ENSG00000138674 to ENSG00000138674 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SDHAF1 Gene migrated from ENSG00000205138 to ENSG00000205138 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SDHA Gene migrated from ENSG00000073578 to ENSG00000073578 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SDCCAG8 Gene migrated from ENSG00000054282 to ENSG00000054282 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCYL2 Gene migrated from ENSG00000136021 to ENSG00000136021 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCO2 Gene migrated from ENSG00000130489 to ENSG00000284194 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCN8A Gene migrated from ENSG00000196876 to ENSG00000196876 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCN3A Gene migrated from ENSG00000153253 to ENSG00000153253 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCN2A Gene migrated from ENSG00000136531 to ENSG00000136531 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCN1B Gene migrated from ENSG00000105711 to ENSG00000105711 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCN1A Gene migrated from ENSG00000144285 to ENSG00000144285 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCAPER Gene migrated from ENSG00000140386 to ENSG00000140386 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCAMP5 Gene migrated from ENSG00000198794 to ENSG00000198794 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SCAF4 Gene migrated from ENSG00000156304 to ENSG00000156304 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SC5D Gene migrated from ENSG00000109929 to ENSG00000109929 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SBF1 Gene migrated from ENSG00000100241 to ENSG00000100241 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SATB2 Gene migrated from ENSG00000119042 to ENSG00000119042 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SATB1 Gene migrated from ENSG00000182568 to ENSG00000182568 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SASS6 Gene migrated from ENSG00000156876 to ENSG00000156876 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SART3 Gene migrated from ENSG00000075856 to ENSG00000075856 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SARS2 Gene migrated from ENSG00000104835 to ENSG00000104835 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SARS1 Gene symbol changed from SARS to SARS1 during gene set migration (ENSG00000031698 -> ENSG00000031698)
Intellectual disability syndromic and non-syndromic v2.0 SAMHD1 Gene migrated from ENSG00000101347 to ENSG00000101347 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 SAMD9 Gene migrated from ENSG00000205413 to ENSG00000205413 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RYBP Gene migrated from ENSG00000163602 to ENSG00000163602 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RUNX1T1 Gene migrated from ENSG00000079102 to ENSG00000079102 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RTTN Gene migrated from ENSG00000176225 to ENSG00000176225 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RTN4IP1 Gene migrated from ENSG00000130347 to ENSG00000130347 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RTF1 Gene migrated from ENSG00000137815 to ENSG00000137815 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RTEL1 Gene migrated from ENSG00000258366 to ENSG00000258366 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RSRC1 Gene migrated from ENSG00000174891 to ENSG00000174891 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RSPRY1 Gene migrated from ENSG00000159579 to ENSG00000159579 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RSF1 Gene migrated from ENSG00000048649 to ENSG00000048649 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RRM2B Gene migrated from ENSG00000048392 to ENSG00000048392 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RREB1 Gene migrated from ENSG00000124782 to ENSG00000124782 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RRAS2 Gene migrated from ENSG00000133818 to ENSG00000133818 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPS6KC1 Gene migrated from ENSG00000136643 to ENSG00000136643 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPS6KA3 Gene migrated from ENSG00000177189 to ENSG00000177189 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPS4X Gene migrated from ENSG00000198034 to ENSG00000198034 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPL10 Gene migrated from ENSG00000147403 to ENSG00000147403 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPIA Gene migrated from ENSG00000153574 to ENSG00000153574 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPH3A Gene migrated from ENSG00000089169 to ENSG00000089169 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RPGRIP1L Gene migrated from ENSG00000103494 to ENSG00000103494 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RORA Gene migrated from ENSG00000069667 to ENSG00000069667 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ROR2 Gene migrated from ENSG00000169071 to ENSG00000169071 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ROGDI Gene migrated from ENSG00000067836 to ENSG00000067836 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ROBO1 Gene migrated from ENSG00000169855 to ENSG00000169855 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 RNU7-1 Gene migrated from ENSG00000238923 to ENSG00000238923 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LIG4 Gene migrated from ENSG00000174405 to ENSG00000174405 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LIAS Gene migrated from ENSG00000121897 to ENSG00000121897 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LHX2 Gene migrated from ENSG00000106689 to ENSG00000106689 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LGI3 Gene migrated from ENSG00000168481 to ENSG00000168481 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LGI1 Gene migrated from ENSG00000108231 to ENSG00000108231 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LETM1 Gene migrated from ENSG00000168924 to ENSG00000168924 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LEO1 Gene migrated from ENSG00000166477 to ENSG00000166477 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LAS1L Gene migrated from ENSG00000001497 to ENSG00000001497 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LARS2 Gene migrated from ENSG00000011376 to ENSG00000011376 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LARS1 Gene symbol changed from LARS to LARS1 during gene set migration (ENSG00000133706 -> ENSG00000133706)
Intellectual disability syndromic and non-syndromic v2.0 LARP7 Gene migrated from ENSG00000174720 to ENSG00000174720 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LARP1 Gene migrated from ENSG00000155506 to ENSG00000155506 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LARGE1 Gene migrated from ENSG00000133424 to ENSG00000133424 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LAMP2 Gene migrated from ENSG00000005893 to ENSG00000005893 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LAMC3 Gene migrated from ENSG00000050555 to ENSG00000050555 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LAMB2 Gene migrated from ENSG00000172037 to ENSG00000172037 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LAMB1 Gene migrated from ENSG00000091136 to ENSG00000091136 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LAMA2 Gene migrated from ENSG00000196569 to ENSG00000196569 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LAMA1 Gene migrated from ENSG00000101680 to ENSG00000101680 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 LAGE3 Gene migrated from ENSG00000196976 to ENSG00000196976 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 L2HGDH Gene migrated from ENSG00000087299 to ENSG00000087299 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 L1CAM Gene migrated from ENSG00000198910 to ENSG00000198910 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KRAS Gene migrated from ENSG00000133703 to ENSG00000133703 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KPTN Gene migrated from ENSG00000118162 to ENSG00000118162 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KNL1 Gene migrated from ENSG00000137812 to ENSG00000137812 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KMT5B Gene migrated from ENSG00000110066 to ENSG00000110066 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KMT2E Gene migrated from ENSG00000005483 to ENSG00000005483 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KMT2D Gene migrated from ENSG00000167548 to ENSG00000167548 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KMT2C Gene migrated from ENSG00000055609 to ENSG00000055609 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KMT2B Gene migrated from ENSG00000272333 to ENSG00000272333 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KMT2A Gene migrated from ENSG00000118058 to ENSG00000118058 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KLHL7 Gene migrated from ENSG00000122550 to ENSG00000122550 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KLHL20 Gene migrated from ENSG00000076321 to ENSG00000076321 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KLHL15 Gene migrated from ENSG00000174010 to ENSG00000174010 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KLHL13 Gene migrated from ENSG00000003096 to ENSG00000003096 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KLF7 Gene migrated from ENSG00000118263 to ENSG00000118263 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF7 Gene migrated from ENSG00000166813 to ENSG00000166813 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF5C Gene migrated from ENSG00000168280 to ENSG00000168280 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF4A Gene migrated from ENSG00000090889 to ENSG00000090889 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF2A Gene migrated from ENSG00000068796 to ENSG00000068796 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF26A Gene migrated from ENSG00000066735 to ENSG00000066735 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF21B Gene migrated from ENSG00000116852 to ENSG00000116852 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIFBP Gene symbol changed from KIF1BP to KIFBP during gene set migration (ENSG00000198954 -> ENSG00000198954)
Intellectual disability syndromic and non-syndromic v2.0 KIF1A Gene migrated from ENSG00000130294 to ENSG00000130294 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF14 Gene migrated from ENSG00000118193 to ENSG00000118193 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIF11 Gene migrated from ENSG00000138160 to ENSG00000138160 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KIDINS220 Gene migrated from ENSG00000134313 to ENSG00000134313 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 BLTP1 Gene symbol changed from KIAA1109 to BLTP1 during gene set migration (ENSG00000138688 -> ENSG00000138688)
Intellectual disability syndromic and non-syndromic v2.0 KIAA0586 Gene migrated from ENSG00000100578 to ENSG00000100578 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KATNIP Gene symbol changed from KIAA0556 to KATNIP during gene set migration (ENSG00000047578 -> ENSG00000047578)
Intellectual disability syndromic and non-syndromic v2.0 KDM6B Gene migrated from ENSG00000132510 to ENSG00000132510 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM6A Gene migrated from ENSG00000147050 to ENSG00000147050 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM5C Gene migrated from ENSG00000126012 to ENSG00000126012 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM5B Gene migrated from ENSG00000117139 to ENSG00000117139 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM5A Gene migrated from ENSG00000073614 to ENSG00000073614 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM4B Gene migrated from ENSG00000127663 to ENSG00000127663 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM3B Gene migrated from ENSG00000120733 to ENSG00000120733 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM2B Gene migrated from ENSG00000089094 to ENSG00000089094 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM2A Gene migrated from ENSG00000173120 to ENSG00000173120 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KDM1A Gene migrated from ENSG00000004487 to ENSG00000004487 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCTD7 Gene migrated from ENSG00000243335 to ENSG00000243335 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCTD3 Gene migrated from ENSG00000136636 to ENSG00000136636 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNT2 Gene migrated from ENSG00000162687 to ENSG00000162687 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNT1 Gene migrated from ENSG00000107147 to ENSG00000107147 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNQ5 Gene migrated from ENSG00000185760 to ENSG00000185760 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNQ3 Gene migrated from ENSG00000184156 to ENSG00000184156 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNQ2 Gene migrated from ENSG00000075043 to ENSG00000075043 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNN3 Gene migrated from ENSG00000143603 to ENSG00000143603 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNN2 Gene migrated from ENSG00000080709 to ENSG00000080709 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNMA1 Gene migrated from ENSG00000156113 to ENSG00000156113 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNK9 Gene migrated from ENSG00000169427 to ENSG00000169427 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNK4 Gene migrated from ENSG00000182450 to ENSG00000182450 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNJ6 Gene migrated from ENSG00000157542 to ENSG00000157542 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNJ4 Gene migrated from ENSG00000168135 to ENSG00000168135 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNJ10 Gene migrated from ENSG00000177807 to ENSG00000177807 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNH5 Gene migrated from ENSG00000140015 to ENSG00000140015 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNH1 Gene migrated from ENSG00000143473 to ENSG00000143473 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCND3 Gene migrated from ENSG00000171385 to ENSG00000171385 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCND2 Gene migrated from ENSG00000184408 to ENSG00000184408 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCND1 Gene migrated from ENSG00000102057 to ENSG00000102057 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNC2 Gene migrated from ENSG00000166006 to ENSG00000166006 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNC1 Gene migrated from ENSG00000129159 to ENSG00000129159 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNB2 Gene migrated from ENSG00000182674 to ENSG00000182674 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNB1 Gene migrated from ENSG00000158445 to ENSG00000158445 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNA3 Gene migrated from ENSG00000177272 to ENSG00000177272 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KCNA2 Gene migrated from ENSG00000177301 to ENSG00000177301 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KBTBD2 Gene migrated from ENSG00000170852 to ENSG00000170852 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KATNB1 Gene migrated from ENSG00000140854 to ENSG00000140854 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KAT8 Gene migrated from ENSG00000103510 to ENSG00000103510 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KAT6B Gene migrated from ENSG00000156650 to ENSG00000156650 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KAT6A Gene migrated from ENSG00000083168 to ENSG00000083168 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KAT5 Gene migrated from ENSG00000172977 to ENSG00000172977 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 KARS1 Gene symbol changed from KARS to KARS1 during gene set migration (ENSG00000065427 -> ENSG00000065427)
Intellectual disability syndromic and non-syndromic v2.0 KANSL1 Gene migrated from ENSG00000120071 to ENSG00000120071 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 JMJD1C Gene migrated from ENSG00000171988 to ENSG00000171988 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 JKAMP Gene migrated from ENSG00000050130 to ENSG00000050130 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 JARID2 Gene migrated from ENSG00000008083 to ENSG00000008083 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 JAM3 Gene migrated from ENSG00000166086 to ENSG00000166086 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IVD Gene migrated from ENSG00000128928 to ENSG00000128928 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ITSN1 Gene migrated from ENSG00000205726 to ENSG00000205726 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ITPR1 Gene migrated from ENSG00000150995 to ENSG00000150995 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ITPA Gene migrated from ENSG00000125877 to ENSG00000125877 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ITGAV Gene migrated from ENSG00000138448 to ENSG00000138448 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ITFG2 Gene migrated from ENSG00000111203 to ENSG00000111203 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 CRPPA Gene symbol changed from ISPD to CRPPA during gene set migration (ENSG00000214960 -> ENSG00000214960)
Intellectual disability syndromic and non-syndromic v2.0 ISCA2 Gene migrated from ENSG00000165898 to ENSG00000165898 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 ISCA1 Gene migrated from ENSG00000135070 to ENSG00000135070 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IRX5 Gene migrated from ENSG00000176842 to ENSG00000176842 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IRF2BPL Gene migrated from ENSG00000119669 to ENSG00000119669 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IREB2 Gene migrated from ENSG00000136381 to ENSG00000136381 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IQSEC2 Gene migrated from ENSG00000124313 to ENSG00000124313 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IQSEC1 Gene migrated from ENSG00000144711 to ENSG00000144711 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IPO8 Gene migrated from ENSG00000133704 to ENSG00000133704 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INTS6 Gene migrated from ENSG00000102786 to ENSG00000102786 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INTS13 Gene migrated from ENSG00000064102 to ENSG00000064102 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INTS11 Gene migrated from ENSG00000127054 to ENSG00000127054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INTS1 Gene migrated from ENSG00000164880 to ENSG00000164880 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INPP5K Gene migrated from ENSG00000132376 to ENSG00000132376 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INPP5E Gene migrated from ENSG00000148384 to ENSG00000148384 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 INPP4A Gene migrated from ENSG00000040933 to ENSG00000040933 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IMPDH2 Gene migrated from ENSG00000178035 to ENSG00000178035 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IL1RAPL1 Gene migrated from ENSG00000169306 to ENSG00000169306 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IKBKG Gene migrated from ENSG00000269335 to ENSG00000269335 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IGF1R Gene migrated from ENSG00000140443 to ENSG00000140443 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IGF1 Gene migrated from ENSG00000017427 to ENSG00000017427 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IFT74 Gene migrated from ENSG00000096872 to ENSG00000096872 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IFT27 Gene migrated from ENSG00000100360 to ENSG00000100360 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IFT172 Gene migrated from ENSG00000138002 to ENSG00000138002 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IFIH1 Gene migrated from ENSG00000115267 to ENSG00000115267 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IER3IP1 Gene migrated from ENSG00000134049 to ENSG00000134049 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IDUA Gene migrated from ENSG00000127415 to ENSG00000127415 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IDS Gene migrated from ENSG00000010404 to ENSG00000010404 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 IDH2 Gene migrated from ENSG00000182054 to ENSG00000182054 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 AARS1 Gene symbol changed from AARS to AARS1 during gene set migration (ENSG00000090861 -> ENSG00000090861)
Intellectual disability syndromic and non-syndromic v2.0 KCNA6 Gene migrated from ENSG00000151079 to ENSG00000151079 (gene set migration)
Intellectual disability syndromic and non-syndromic v2.0 Panel migrated to gene set Ensemblv115. Source version: v1.831
Intellectual disability syndromic and non-syndromic v1.831 CLUAP1 Sarah Milton gene: CLUAP1 was added
gene: CLUAP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature,Literature
Mode of inheritance for gene: CLUAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CLUAP1 were set to 34209753; 28679688; 26820066
Phenotypes for gene: CLUAP1 were set to Leber congenital amaurosis, MONDO:0018998, CLUAP1-related; Ciliopathy, MONDO:0005308, CLUAP1-related
Intellectual disability syndromic and non-syndromic v1.830 PTPRD Sarah Milton gene: PTPRD was added
gene: PTPRD was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: PTPRD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTPRD were set to 37056996; 31088393; 38890753
Phenotypes for gene: PTPRD were set to Neurodevelopmental disorder, MONDO:0700092, PTPRD related
Intellectual disability syndromic and non-syndromic v1.829 TMEM161B Zornitza Stark gene: TMEM161B was added
gene: TMEM161B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: TMEM161B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM161B were set to 37486637; 36669109; 36669111
Phenotypes for gene: TMEM161B were set to Neurodevelopmental disorder, MONDO:0700092, TMEM161B-related
Intellectual disability syndromic and non-syndromic v1.827 IRF2BP1 Zornitza Stark changed review comment from: PMID 38091987 reports two unrelated individuals with de novo truncating IRF2BP1 variants presenting with neurodevelopmental disorder, severe immunodeficiency, microcephaly and developmental delay, while PMID 37501076 adds a third unrelated individual with a de novo nonsense IRF2BP1 variant causing neonatal‑onset microcephaly, epilepsy, hypotonia and global developmental delay.
Sources: Literature; to: PMID 38091987 reports two unrelated individuals with de novo truncating IRF2BP1 variants presenting with neurodevelopmental disorder, severe immunodeficiency, microcephaly and developmental delay, while PMID 37501076 adds a third unrelated individual with a de novo nonsense IRF2BP1 variant causing neonatal‑onset microcephaly, epilepsy, hypotonia and global developmental delay.

However, all three individuals were identified as part of large cohort studies and I also note LoF variants in gnomAD.

Sources: Literature
Intellectual disability syndromic and non-syndromic v1.827 IRF2BP1 Zornitza Stark gene: IRF2BP1 was added
gene: IRF2BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: IRF2BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: IRF2BP1 were set to 38091987; 37501076
Phenotypes for gene: IRF2BP1 were set to Neurodevelopmental disorder, MONDO:0700092, IRF2BP1-related
Intellectual disability syndromic and non-syndromic v1.826 DENR Zornitza Stark gene: DENR was added
gene: DENR was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: DENR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DENR were set to 27239039
Phenotypes for gene: DENR were set to Neurodevelopmental disorder, MONDO:0700092, DENR-related
Intellectual disability syndromic and non-syndromic v1.824 NCOR1 Bryony Thompson gene: NCOR1 was added
gene: NCOR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: NCOR1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: NCOR1 were set to 32034166; 31849593; 30664766; 30289594; 29483668
Phenotypes for gene: NCOR1 were set to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.820 PLAT Zornitza Stark gene: PLAT was added
gene: PLAT was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen,ClinGen
disputed tags were added to gene: PLAT.
Mode of inheritance for gene: PLAT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLAT were set to 39574431; 37808270; 27417437
Phenotypes for gene: PLAT were set to Syndromic disease, MONDO:0002254, PLAT-related; Thrombophilia, familial, due to decreased release of tissue plasminogen activator MONDO:0012872
Intellectual disability syndromic and non-syndromic v1.818 NLGN1 Zornitza Stark Publications for gene: NLGN1 were set to PMID: 30460678
Intellectual disability syndromic and non-syndromic v1.812 MACF1 Lucy Spencer Publications for gene: MACF1 were set to 30471716
Intellectual disability syndromic and non-syndromic v1.811 RING1 Sangavi Sivagnanasundram Publications for gene: RING1 were set to 29386386; 41653922
Intellectual disability syndromic and non-syndromic v1.811 RING1 Sangavi Sivagnanasundram Publications for gene: RING1 were set to 29386386
Intellectual disability syndromic and non-syndromic v1.806 UBA7 Bryony Thompson gene: UBA7 was added
gene: UBA7 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: UBA7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBA7 were set to 42023152; 33710394; 28397838
Phenotypes for gene: UBA7 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.805 MELK Zornitza Stark gene: MELK was added
gene: MELK was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: MELK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MELK were set to 41973119
Phenotypes for gene: MELK were set to Neurodevelopmental disorder, MONDO:0700092, MELK-related
Intellectual disability syndromic and non-syndromic v1.804 CECR2 Lucy Spencer gene: CECR2 was added
gene: CECR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: CECR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CECR2 were set to 41964217; 37424722
Phenotypes for gene: CECR2 were set to Neurodevelopmental disorder, MONDO:0700092, CECR2-related; neural tube defects, susceptibility to MONDO:0020705, CECR2-related
Intellectual disability syndromic and non-syndromic v1.800 SRRM4 chirag patel gene: SRRM4 was added
gene: SRRM4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: SRRM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SRRM4 were set to 41958152
Phenotypes for gene: SRRM4 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM4-related
Mode of pathogenicity for gene: SRRM4 was set to Other
Intellectual disability syndromic and non-syndromic v1.799 RPS4X chirag patel gene: RPS4X was added
gene: RPS4X was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: RPS4X was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: RPS4X were set to 42031741
Phenotypes for gene: RPS4X were set to Neurodevelopmental disorder, MONDO:0700092, RPS4X-related
Intellectual disability syndromic and non-syndromic v1.798 DRD1 chirag patel gene: DRD1 was added
gene: DRD1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: DRD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DRD1 were set to 41966088; 37048120
Phenotypes for gene: DRD1 were set to Neurodevelopmental disorder, MONDO:0700092, DRD1-related
Intellectual disability syndromic and non-syndromic v1.798 CDK6 chirag patel Publications for gene: CDK6 were set to 23918663; 40801391; 41856556
Intellectual disability syndromic and non-syndromic v1.797 CDK6 chirag patel Publications for gene: CDK6 were set to 23918663; 40801391
Intellectual disability syndromic and non-syndromic v1.793 PDS5B chirag patel Publications for gene: PDS5B were set to 41810376
Intellectual disability syndromic and non-syndromic v1.795 PDS5B chirag patel Publications for gene: PDS5B were set to 41810376
Intellectual disability syndromic and non-syndromic v1.794 PDS5B chirag patel Publications for gene: PDS5B were set to Neurodevelopmental disorder, MONDO:0700092, PDS5B-related
Intellectual disability syndromic and non-syndromic v1.793 PDS5B chirag patel Publications for gene: PDS5B were set to 10.64898/2026.02.23.26346364
Intellectual disability syndromic and non-syndromic v1.790 PDS5A chirag patel Publications for gene: PDS5A were set to 30158690; 41810376
Intellectual disability syndromic and non-syndromic v1.790 PDS5A chirag patel Publications for gene: PDS5A were set to 10.64898/2026.02.23.26346364; 30158690
Intellectual disability syndromic and non-syndromic v1.787 MDGA1 chirag patel gene: MDGA1 was added
gene: MDGA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: MDGA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MDGA1 were set to 41862769; 40585099
Phenotypes for gene: MDGA1 were set to Neurodevelopmental disorder, MONDO:0700092, MDGA1-related
Intellectual disability syndromic and non-syndromic v1.780 CDK4 Lucy Spencer Publications for gene: CDK4 were set to 40210435
Intellectual disability syndromic and non-syndromic v1.777 SUPT6H Lucy Spencer gene: SUPT6H was added
gene: SUPT6H was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: SUPT6H was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SUPT6H were set to 41864309
Phenotypes for gene: SUPT6H were set to Neurodevelopmental disorder, MONDO:0700092, SUPT6H-related
Intellectual disability syndromic and non-syndromic v1.776 WWP1 Zornitza Stark gene: WWP1 was added
gene: WWP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: WWP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WWP1 were set to 41786693; 32699206
Phenotypes for gene: WWP1 were set to Neurodevelopmental disorder, MONDO:0700092, WWP1-related
Intellectual disability syndromic and non-syndromic v1.775 EMG1 Zornitza Stark Publications for gene: EMG1 were set to 19463982
Intellectual disability syndromic and non-syndromic v1.774 KLHL15 Zornitza Stark Publications for gene: KLHL15 were set to 25644381; 24817631
Intellectual disability syndromic and non-syndromic v1.772 GTF2E2 Zornitza Stark Publications for gene: GTF2E2 were set to PMID: 28973399
Intellectual disability syndromic and non-syndromic v1.770 GSX2 Zornitza Stark Publications for gene: GSX2 were set to 31412107
Intellectual disability syndromic and non-syndromic v1.768 OLA1 Zornitza Stark gene: OLA1 was added
gene: OLA1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: OLA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OLA1 were set to 41887223
Phenotypes for gene: OLA1 were set to Neurodevelopmental disorder, MONDO:0700092, OLA1-related
Intellectual disability syndromic and non-syndromic v1.766 SUPT4H1 Sarah Milton gene: SUPT4H1 was added
gene: SUPT4H1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SUPT4H1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUPT4H1 were set to 41842694
Phenotypes for gene: SUPT4H1 were set to Syndromic disease, MONDO:0002254, SUPT4H1-related
Intellectual disability syndromic and non-syndromic v1.765 LMAN2L Zornitza Stark Publications for gene: LMAN2L were set to PMID: 31020005; 26566883
Intellectual disability syndromic and non-syndromic v1.763 ATG12 Sangavi Sivagnanasundram gene: ATG12 was added
gene: ATG12 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: ATG12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATG12 were set to 41895291
Phenotypes for gene: ATG12 were set to ATG12-related neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.761 NDUFA5 Zornitza Stark gene: NDUFA5 was added
gene: NDUFA5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: NDUFA5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA5 were set to 41916321
Phenotypes for gene: NDUFA5 were set to Complex I deficiency
Penetrance for gene: NDUFA5 were set to Complete
Intellectual disability syndromic and non-syndromic v1.760 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to
Intellectual disability syndromic and non-syndromic v1.757 SLC20A2 Zornitza Stark edited their review of gene: SLC20A2: Added comment: PMID 41458256: Reports a single individual a homozygous nonsense SLC20A2 variant presenting with infantile primary familial brain calcification, cerebral arterial vasculopathy and ischaemic stroke. Individual exhibited seizures, hypotonia, poor feeding, and extensive ischaemic changes.

PMID 35881308: reports two siblings from a consanguineous Turkish family with a homozygous splice‑site loss‑of‑function variant NM_006749.5:c.1794+1G>A. The affected children presented with severe paediatric‑onset features resembling congenital CMV infection: growth retardation, bilateral cataracts, microcephaly, seizures, cerebral atrophy, corpus callosum hypoplasia and brain microcalcifications.

Gene is classically associated with a milder mono-allelic disorder, which typically does not involve ID.; Changed rating: AMBER; Changed publications: 41458256, 35881308; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.755 FRMD4A Zornitza Stark Publications for gene: FRMD4A were set to 25388005; 30214071
Intellectual disability syndromic and non-syndromic v1.752 NPRL2 Lucy Spencer gene: NPRL2 was added
gene: NPRL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NPRL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NPRL2 were set to 26505888; 34376795; 40804712; 30093711
Phenotypes for gene: NPRL2 were set to epilepsy, familial focal, with variable foci 2 (MIM#617116)
Review for gene: NPRL2 was set to AMBER
Added comment: Intellectual disability/developmental delay has been reported in some individuals with NPRL2-related epilepsy;

PMID: 30093711 3 patients with NPRL2 variants and 2 have ID, 2 also have brain abnormalities. NPRL2 forms the GATOR1 complex with DEPDC5 and NPLR3, the paper describes the phenotype of all 3 as overlapping- ID better reported in the other genes

PMID: 40804712 1 individual with mild ID and severe speech impairment. has a frameshift variant in NPRL2

PMID: 34376795 proband with seizures and dev delay/DEE, mother had ID and seizures. both had a canonical splice in NPRL2

PMID: 26505888 1 proband with ID and temporal lobe epilepsy. Had a maternally inherited missense Thr110Ser only 1 het i gnomad

Borderline amber/green for this panel
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.749 EMX2 Krithika Murali Publications for gene: EMX2 were set to 8528262; 9359037; 9153481; 9153481; 18409201
Intellectual disability syndromic and non-syndromic v1.745 DIP2B Bryony Thompson Publications for gene: DIP2B were set to 17236128
Intellectual disability syndromic and non-syndromic v1.742 KCNJ4 chirag patel gene: KCNJ4 was added
gene: KCNJ4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: KCNJ4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNJ4 were set to 41830586
Phenotypes for gene: KCNJ4 were set to Neurodevelopmental disorder, MONDO:0700092, KCNJ4-related
Mode of pathogenicity for gene: KCNJ4 was set to Other
Intellectual disability syndromic and non-syndromic v1.741 WDTC1 Lucy Spencer gene: WDTC1 was added
gene: WDTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: WDTC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDTC1 were set to 41793087
Phenotypes for gene: WDTC1 were set to Neurodevelopmental disorder MONDO:0700092, WDTC1-related
Intellectual disability syndromic and non-syndromic v1.740 SLC6A17 Lucy Spencer Publications for gene: SLC6A17 were set to 25704603; 23672601
Intellectual disability syndromic and non-syndromic v1.736 TSEN54 Zornitza Stark Publications for gene: TSEN54 were set to 20301773
Intellectual disability syndromic and non-syndromic v1.734 MT-TW Zornitza Stark gene: MT-TW was added
gene: MT-TW was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TW.
Mode of inheritance for gene gene: MT-TW was set to MITOCHONDRIAL
Publications for gene: MT-TW were set to 7695240; 9266739; 9673981; 12776230; 15054399; 18337306; 19809478; 26524491; 23841600; 30937556
Phenotypes for gene: MT-TW were set to Mitochondrial disease (MONDO:0044970), MT-TW-related
Intellectual disability syndromic and non-syndromic v1.733 MT-TV Zornitza Stark gene: MT-TV was added
gene: MT-TV was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TV.
Mode of inheritance for gene gene: MT-TV was set to MITOCHONDRIAL
Publications for gene: MT-TV were set to 9450773; 12056939; 19252805; 15320572; 18314141; 24691472; 39468830
Phenotypes for gene: MT-TV were set to Mitochondrial disease (MONDO:0044970), MT-TV-related
Intellectual disability syndromic and non-syndromic v1.732 MT-TS2 Zornitza Stark gene: MT-TS2 was added
gene: MT-TS2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TS2.
Mode of inheritance for gene gene: MT-TS2 was set to MITOCHONDRIAL
Publications for gene: MT-TS2 were set to 9792552; 10090882; 16950817; 21257182; 22369973; 22378285
Phenotypes for gene: MT-TS2 were set to Mitochondrial disease (MONDO:0044970), MT-TS2-related
Intellectual disability syndromic and non-syndromic v1.731 MT-TS1 Zornitza Stark gene: MT-TS1 was added
gene: MT-TS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TS1.
Mode of inheritance for gene gene: MT-TS1 was set to MITOCHONDRIAL
Publications for gene: MT-TS1 were set to 7669057; 9778262; 14605505; 23696415; 33279600; 7581383
Phenotypes for gene: MT-TS1 were set to Mitochondrial disease (MONDO:0044970), MT-TS1-related
Intellectual disability syndromic and non-syndromic v1.730 MT-TR Zornitza Stark gene: MT-TR was added
gene: MT-TR was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TR.
Mode of inheritance for gene gene: MT-TR was set to MITOCHONDRIAL
Publications for gene: MT-TR were set to 15286228; 17588757; 19809478; 22781096
Phenotypes for gene: MT-TR were set to mitochondrial disease (MONDO:0044970), MT-TR-related
Intellectual disability syndromic and non-syndromic v1.729 ASAH2 Zornitza Stark gene: ASAH2 was added
gene: ASAH2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: ASAH2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ASAH2 were set to 41808410
Phenotypes for gene: ASAH2 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.726 ABCB7 Lucy Spencer gene: ABCB7 was added
gene: ABCB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABCB7 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ABCB7 were set to 11050011; 26242992
Phenotypes for gene: ABCB7 were set to Anaemia, sideroblastic, with ataxia, MIM# 301310
Review for gene: ABCB7 was set to AMBER
Added comment: Some limited reports of developmental delay/ID in the literature and mentioned in the ClinGen review
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.724 RNU6ATAC Zornitza Stark Publications for gene: RNU6ATAC were set to 40975062
Intellectual disability syndromic and non-syndromic v1.720 RNPC3 chirag patel Publications for gene: RNPC3 were set to 29866761; 32462814; 33650182
Intellectual disability syndromic and non-syndromic v1.716 POC1A chirag patel Publications for gene: POC1A were set to
Intellectual disability syndromic and non-syndromic v1.712 TRIM71 Zornitza Stark Publications for gene: TRIM71 were set to 29983323; 32168371; 30975633; 40892928
Intellectual disability syndromic and non-syndromic v1.711 TRIM71 Zornitza Stark gene: TRIM71 was added
gene: TRIM71 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: TRIM71 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TRIM71 were set to 29983323; 32168371; 30975633; 40892928
Phenotypes for gene: TRIM71 were set to Congenital hydrocephalus 4 (MIM#618667)
Intellectual disability syndromic and non-syndromic v1.709 TNK2 Sarah Milton gene: TNK2 was added
gene: TNK2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: TNK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: TNK2 were set to 27977884; 23686771; 31517310
Phenotypes for gene: TNK2 were set to late onset infantile epilepsy; Mayer-Rokitansky-Küster-Hauser syndrome
Intellectual disability syndromic and non-syndromic v1.705 PDS5B chirag patel gene: PDS5B was added
gene: PDS5B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PDS5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PDS5B were set to 10.64898/2026.02.23.26346364
Phenotypes for gene: PDS5B were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.705 PDS5A chirag patel gene: PDS5A was added
gene: PDS5A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PDS5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PDS5A were set to 10.64898/2026.02.23.26346364; 30158690
Phenotypes for gene: PDS5A were set to Complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.704 FMO4 chirag patel gene: FMO4 was added
gene: FMO4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: FMO4 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: FMO4 were set to 41714691, 28940097
Phenotypes for gene: FMO4 were set to Neurodevelopmental disorder, MONDO:0700092; FMO4 related
Intellectual disability syndromic and non-syndromic v1.703 NRDC Zornitza Stark Publications for gene: NRDC were set to 41449824; 28017472; 34582790; 19935654
Intellectual disability syndromic and non-syndromic v1.701 VWA3B Zornitza Stark gene: VWA3B was added
gene: VWA3B was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: VWA3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VWA3B were set to 26157035; 41673450; 37772257
Phenotypes for gene: VWA3B were set to Spinocerebellar ataxia, autosomal recessive 22 MIM#616948
Intellectual disability syndromic and non-syndromic v1.700 XPOT Zornitza Stark gene: XPOT was added
gene: XPOT was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
preprint tags were added to gene: XPOT.
Mode of inheritance for gene: XPOT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: XPOT were set to 10.64898/2026.01.28.26344748
Phenotypes for gene: XPOT were set to Syndromic disease, MONDO:0002254
Intellectual disability syndromic and non-syndromic v1.699 WDR59 Zornitza Stark gene: WDR59 was added
gene: WDR59 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
founder tags were added to gene: WDR59.
Mode of inheritance for gene: WDR59 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR59 were set to 41715954
Phenotypes for gene: WDR59 were set to Syndromic disease, MONDO:0002254
Intellectual disability syndromic and non-syndromic v1.698 WAPL Zornitza Stark gene: WAPL was added
gene: WAPL was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
preprint tags were added to gene: WAPL.
Mode of inheritance for gene: WAPL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WAPL were set to 10.64898/2026.02.23.26346364; 30158690
Phenotypes for gene: WAPL were set to complex neurodevelopmental disorder, MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.697 C17orf80 Zornitza Stark gene: C17orf80 was added
gene: C17orf80 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
new gene name tags were added to gene: C17orf80.
Mode of inheritance for gene: C17orf80 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C17orf80 were set to 41720819
Phenotypes for gene: C17orf80 were set to Mitochondrial disease, MONDO:0044970
Intellectual disability syndromic and non-syndromic v1.695 RDH11 Lucy Spencer gene: RDH11 was added
gene: RDH11 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list
Mode of inheritance for gene: RDH11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RDH11 were set to 24916380; 15634683; 30731079; 18326732
Phenotypes for gene: RDH11 were set to Retinal dystrophy, juvenile cataracts, and short stature syndrome, MIM# 616108
Intellectual disability syndromic and non-syndromic v1.694 RAB1A Lucy Spencer Publications for gene: RAB1A were set to PMID: 37924809
Intellectual disability syndromic and non-syndromic v1.690 JKAMP Zornitza Stark gene: JKAMP was added
gene: JKAMP was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: JKAMP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: JKAMP were set to 41643666
Phenotypes for gene: JKAMP were set to Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM# 621533
Review for gene: JKAMP was set to GREEN
Added comment: 14 individuals from 10 families reported. All had moderate to profound neurodevelopmental delay, intellectual disability, and infantile-onset epilepsy. Six were nonverbal, and the remaining individuals spoke only a few words. Five individuals had neurodevelopmental regression. Three individuals died suddenly; death was associated with seizures or status epilepticus in two. Thirteen individuals had hypotonia, 5 had visual impairment, 5 had microcephaly, and 1 had hearing loss. Brain MRIs showed cortical or cerebral atrophy in 11, delayed myelination in 6, and diffuse demyelinating disease in 1.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.688 RBFOX3 Lucy Spencer gene: RBFOX3 was added
gene: RBFOX3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: RBFOX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RBFOX3 were set to 35951651; 36117209; 24039908; 40011789
Phenotypes for gene: RBFOX3 were set to Neurodevelopmental disorder (MONDO:0700092), RBFOX3-related
Intellectual disability syndromic and non-syndromic v1.686 TRAPPC2L Krithika Murali Phenotypes for gene: TRAPPC2L were changed from Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 to Neurodevelopmental disorder - MONDO:0700092, TRAPPC2L-related
Intellectual disability syndromic and non-syndromic v1.686 TRAPPC2L Krithika Murali Publications for gene: TRAPPC2L were set to 36849228; 32843486; 30120216
Intellectual disability syndromic and non-syndromic v1.685 TRAPPC2L Krithika Murali Publications for gene: TRAPPC2L were set to 30120216; 32843486
Intellectual disability syndromic and non-syndromic v1.683 PPP1R15B Lucy Spencer Publications for gene: PPP1R15B were set to 26159176; 26307080; 27640355
Intellectual disability syndromic and non-syndromic v1.679 ATP2B3 Bryony Thompson changed review comment from: PMIDs 25953895, 27653636, 28807751, 36207321 and 37821930 report 11 patients from 8 unrelated families with hemizygous ATP2B3 missense variants causing early‑onset cerebellar ataxia, hypotonia, developmental delay and sometimes seizures or dystonia. 2 of the patients had alternate diagnoses in PMM2 & LAMA1. Functional studies (HeLa Ca2+ assays, yeast complementation, homology modelling) demonstrate loss‑of‑function or altered pump activity. Single reports also link ATP2B3 to autism (PMID 28720891) and fetal akinesia (PMID 31680123).; to: At least 3 cases reported with ID/developmental delay without other variants detected
PMIDs 25953895, 27653636, 28807751, 36207321 and 37821930 report 11 patients from 8 unrelated families with hemizygous ATP2B3 missense variants causing early‑onset cerebellar ataxia, hypotonia, developmental delay and sometimes seizures or dystonia. 2 of the patients had alternate diagnoses in PMM2 & LAMA1. Functional studies (HeLa Ca2+ assays, yeast complementation, homology modelling) demonstrate loss‑of‑function or altered pump activity. Single reports also link ATP2B3 to autism (PMID 28720891) and fetal akinesia (PMID 31680123).
Intellectual disability syndromic and non-syndromic v1.676 NAV2 Zornitza Stark gene: NAV2 was added
gene: NAV2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: NAV2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NAV2 were set to PMID:35218524
Phenotypes for gene: NAV2 were set to Developmental delay; cerebellar hypoplasia; cerebellar dysplasia
Intellectual disability syndromic and non-syndromic v1.675 LRRC32 Zornitza Stark Publications for gene: LRRC32 were set to 30976112
Intellectual disability syndromic and non-syndromic v1.674 RSF1 Rylee Peters gene: RSF1 was added
gene: RSF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: RSF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RSF1 were set to 41606215
Phenotypes for gene: RSF1 were set to Neurodevelopmental disorder, MONDO:0700092, RSF1-related
Intellectual disability syndromic and non-syndromic v1.673 EXOC8 Bryony Thompson gene: EXOC8 was added
gene: EXOC8 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: EXOC8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOC8 were set to 32103185; 22700954; 36344539; 35460391
Phenotypes for gene: EXOC8 were set to neurodevelopmental disorder with microcephaly, seizures, and brain atrophy MONDO:0033662
Intellectual disability syndromic and non-syndromic v1.672 ARHGEF2 Bryony Thompson gene: ARHGEF2 was added
gene: ARHGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARHGEF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ARHGEF2 were set to 28453519
Phenotypes for gene: ARHGEF2 were set to neurodevelopmental disorder with midbrain and hindbrain malformations MONDO:0056797
Intellectual disability syndromic and non-syndromic v1.670 EPG5 Zornitza Stark Publications for gene: EPG5 were set to 23222957; 26917586
Intellectual disability syndromic and non-syndromic v1.669 EPG5 Zornitza Stark edited their review of gene: EPG5: Added comment: Neurodevelopmental disorder with parkinsonism or other movement abnormalities (NEDPAM) is an autosomal recessive disorder characterized by mild to severe developmental delay or intellectual disability and movement abnormalities including spasticity, early onset-parkinsonism with dystonia, myoclonus, or a combination of these. Movement abnormalities may have onset from birth to adulthood in the sixth decade of life. Adolescent-onset dystonia and parkinsonism on the background of neurodevelopmental delay may be rapidly progressive, with cognitive decline. Patients may have additional features such as seizures and optic nerve atrophy. PMIDs 41053928, 36410285 and 40192014 report over 100 affected individuals.; Changed publications: 23222957, 26917586, 41053928, 36410285, 40192014; Changed phenotypes: Vici syndrome, MIM# 242840, Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506
Intellectual disability syndromic and non-syndromic v1.668 RAPGEF2 Bryony Thompson gene: RAPGEF2 was added
gene: RAPGEF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
STR tags were added to gene: RAPGEF2.
Mode of inheritance for gene: RAPGEF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAPGEF2 were set to 41556274; 30636905
Phenotypes for gene: RAPGEF2 were set to Neurodevelopmental disorder, MONDO:0700092; amyotrophic lateral sclerosis MONDO:0004976
Intellectual disability syndromic and non-syndromic v1.663 CELSR1 Rylee Peters gene: CELSR1 was added
gene: CELSR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CELSR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CELSR1 were set to 41530147; 36453712
Review for gene: CELSR1 was set to GREEN
Added comment: PMID: 41530147 describes 7 individuals from 5 unrelated families with biallelic CELSR1 variants association with brain malformations, neurodevelopmental delay, intellectual disability, behavioural disorders, and 4/7 individuals with epilepsy. Celsr1 knockout mice recapitulate brain malformations and seizure susceptibility. Heterozygous mice were indistinguishable from controls.

PMID: 36453712 describes 4 additional compound heterozygous individuals with epilepsy, 3/4 reported with mild intellectual disability and no abnormalities on brain MRI.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.662 TTBK1 Zornitza Stark gene: TTBK1 was added
gene: TTBK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: TTBK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTBK1 were set to 41545183
Phenotypes for gene: TTBK1 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.661 TMEM189 chirag patel gene: TMEM189 was added
gene: TMEM189 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: TMEM189 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM189 were set to 41491239
Phenotypes for gene: TMEM189 were set to Neurodevelopmental disorder, MONDO:0700092, PEDS1-related
Intellectual disability syndromic and non-syndromic v1.659 MAP2K4 Sangavi Sivagnanasundram gene: MAP2K4 was added
gene: MAP2K4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAP2K4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAP2K4 were set to 41480045
Phenotypes for gene: MAP2K4 were set to Neurodevelopmental disorder, MONDO:0700092
Mode of pathogenicity for gene: MAP2K4 was set to Other
Intellectual disability syndromic and non-syndromic v1.658 CTNND2 Zornitza Stark Publications for gene: CTNND2 were set to 25839933; 29127138; 25807484; 38604781; 25473103; 31814264
Intellectual disability syndromic and non-syndromic v1.656 CTNND2 Zornitza Stark edited their review of gene: CTNND2: Added comment: PMID 41502569 (preprint) reports phenotypic and molecular information for 57 individuals, 42 previously unpublished, with heterozygous CTNND2 variants. The 41 CTNND2 variants included 12 previously reported loss-of-function- and one missense variant, and 28 novel variants comprising 10 missense and 18 predicted loss-of-function changes. Eight of the novel variants occurred de novo, and 12 were inherited from a parent with a neurodevelopmental phenotype. The most common clinical features were developmental delay (90%), intellectual disability (74%), and behavioral abnormalities (79%). Functional studies revealed impaired early neurogenesis in one patient-derived line, characterized by aberrant neural rosette formation. Transcriptome analysis showed dysregulated WNT signaling, and partial rescue of these defects was achieved by modulating the WNT pathway, highlighting δ-catenin's role in early neural development.

Note several of the reported missense variants in this gene have high gnomAD counts so these should be interpreted with caution. Nevertheless, large number of individuals reported now with LoF variants and NDD phenotype.; Changed rating: GREEN; Changed publications: 25839933, 29127138, 25807484, 41502569; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, CTNND2-related
Intellectual disability syndromic and non-syndromic v1.655 PGBD5 Zornitza Stark gene: PGBD5 was added
gene: PGBD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PGBD5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PGBD5 were set to 41533792
Phenotypes for gene: PGBD5 were set to Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482
Review for gene: PGBD5 was set to GREEN
Added comment: 10 individuals reported from 5 consanguineous families with bi-allelic variants in this gene and global developmental delay with impaired intellectual development, delayed motor skills, and motor abnormalities. Affected individuals were unable to speak or walk due to peripheral spasticity, ataxia, or hypotonia, and developed early-onset seizures. Additional features included dysmorphic facies, short stature, and brain imaging abnormalities, such as thin corpus callosum and cerebellar atrophy.

Pgbd5-null mice were runted and had significantly smaller brains compared to wildtype. Mutant mice showed increased locomotor activity, reduced anxiety-like behavior, impaired motor coordination, increased susceptibility to seizures, and decreased cortical volume on brain MRI. Analysis of neurons derived from Pgbd5-null mouse brains showed reduced DNA breakage and repair in postmitotic neuronal precursors during cortical development compared to controls.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.650 ISCA-37448-Loss Sarah Milton Region: ISCA-37448-Loss was added
Region: ISCA-37448-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-37448-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37448-Loss were set to Chromosome 15q11.2 deletion syndrome, MIM#615656
Penetrance for Region: ISCA-37448-Loss were set to Incomplete
Intellectual disability syndromic and non-syndromic v1.649 SMARCA1 Zornitza Stark Publications for gene: SMARCA1 were set to 37841849
Intellectual disability syndromic and non-syndromic v1.645 ISCA-46743-Gain Sarah Milton Region: ISCA-46743-Gain was added
Region: ISCA-46743-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46743-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for Region: ISCA-46743-Gain were set to Xq25 duplication syndrome, MIM#300979
Intellectual disability syndromic and non-syndromic v1.644 ISCA-46304-Gain Sarah Milton Region: ISCA-46304-Gain was added
Region: ISCA-46304-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46304-Gain was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for Region: ISCA-46304-Gain were set to PMID: 29141583, 22679399
Phenotypes for Region: ISCA-46304-Gain were set to Syndromic X-linked intellectual disability Lubs type, MONDO:0010283
Intellectual disability syndromic and non-syndromic v1.643 ISCA-46300-Loss Sarah Milton Region: ISCA-46300-Loss was added
Region: ISCA-46300-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46300-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-46300-Loss were set to Chromosome 15q24 deletion syndrome, MONDO:0013256
Intellectual disability syndromic and non-syndromic v1.642 ISCA-46299-Gain Sarah Milton Region: ISCA-46299-Gain was added
Region: ISCA-46299-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-46299-Gain.
Mode of inheritance for Region: ISCA-46299-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-46299-Gain were set to PMID: 22840365
Phenotypes for Region: ISCA-46299-Gain were set to Xp11.22 microduplication syndrome MIM#300705
Intellectual disability syndromic and non-syndromic v1.640 SPART Zornitza Stark Publications for gene: SPART were set to PMID: 26003402; 28679690; 27112432; 20437587; 12134148; 18413476; 31314595; 28875386
Intellectual disability syndromic and non-syndromic v1.638 NRDC Rylee Peters gene: NRDC was added
gene: NRDC was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: NRDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NRDC were set to 41449824; 28017472; 34582790; 19935654
Phenotypes for gene: NRDC were set to Neurodevelopmental disorder, MONDO:0700092, NRDC-related
Intellectual disability syndromic and non-syndromic v1.636 ARCN1 Zornitza Stark Publications for gene: ARCN1 were set to 27476655; 33154040
Intellectual disability syndromic and non-syndromic v1.634 YWHAZ Zornitza Stark Publications for gene: YWHAZ were set to 36001342
Intellectual disability syndromic and non-syndromic v1.633 MED14 Zornitza Stark gene: MED14 was added
gene: MED14 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: MED14 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: MED14 were set to PMID: 40597352
Phenotypes for gene: MED14 were set to Neurodevelopmental disorder (MONDO:0700092), MED14-related
Intellectual disability syndromic and non-syndromic v1.632 SPNS1 Zornitza Stark gene: SPNS1 was added
gene: SPNS1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: SPNS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPNS1 were set to 40608416; 38451736
Phenotypes for gene: SPNS1 were set to Lysosomal disorder, SPNS1-related, MONDO:0002561
Intellectual disability syndromic and non-syndromic v1.631 MTSS1L Zornitza Stark Publications for gene: MTSS1L were set to PMID: 36067766
Intellectual disability syndromic and non-syndromic v1.629 SF3B1 Zornitza Stark Publications for gene: SF3B1 were set to
Intellectual disability syndromic and non-syndromic v1.628 VPS51 Zornitza Stark Publications for gene: VPS51 were set to 30624672; 31207318
Intellectual disability syndromic and non-syndromic v1.626 SEC31A Zornitza Stark Publications for gene: SEC31A were set to 30464055; 40508110
Intellectual disability syndromic and non-syndromic v1.623 ISCA-46296-Loss Sarah Milton Region: ISCA-46296-Loss was added
Region: ISCA-46296-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-46296-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-46296-Loss were set to PMID: 25217958
Intellectual disability syndromic and non-syndromic v1.622 LAGE3 Sarah Milton gene: LAGE3 was added
gene: LAGE3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Victorian Clinical Genetics Services
Mode of inheritance for gene: LAGE3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: LAGE3 were set to 28805828
Phenotypes for gene: LAGE3 were set to Galloway-Mowat syndrome 2, X-linked, MIM# 301006
Intellectual disability syndromic and non-syndromic v1.621 ZNF185 Lucy Spencer gene: ZNF185 was added
gene: ZNF185 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF185 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: ZNF185 were set to 41404552
Phenotypes for gene: ZNF185 were set to Cerebrooculonasal syndrome MONDO:0011575, ZNF185-related
Review for gene: ZNF185 was set to RED
Added comment: PMID 41404552 describes a single female individual with cerebro oculo nasal syndrome and a de novo heterozygous X linked frameshift ZNF185. The proband presented with developmental delay, moderate ID, dysmorphic facial features, cleft lip/palate, nasal anomaly, CHD and anopthalmia. She was shown to have skewed X-inactivation 19:81, however it is not stated if the skewing was towards the allele with the variant. The variant in this individual (p.Gln102SerfsTer18) is NMD predicted and absent from gnomad, however there are at least 6 NMD variants present in gnomad as hemizygous (4 with over 4 hemis) all of which also have over 5 heterozygotes
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.616 GSPT2 Zornitza Stark Publications for gene: GSPT2 were set to 28414775
Intellectual disability syndromic and non-syndromic v1.615 UNC13C Sangavi Sivagnanasundram gene: UNC13C was added
gene: UNC13C was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UNC13C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UNC13C were set to 41399760
Phenotypes for gene: UNC13C were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.614 SEPT2 chirag patel gene: SEPT2 was added
gene: SEPT2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: SEPT2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SEPT2 were set to 41408595
Phenotypes for gene: SEPT2 were set to Neurodevelopmental disorder, MONDO:0700092, SEPTIN2-related
Intellectual disability syndromic and non-syndromic v1.613 PCBP1 Sarah Milton gene: PCBP1 was added
gene: PCBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PCBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PCBP1 were set to 41415500
Phenotypes for gene: PCBP1 were set to Neurodevelopmental disorder, MONDO:0700092, PCBP1-related
Intellectual disability syndromic and non-syndromic v1.610 NDUFA3 Zornitza Stark gene: NDUFA3 was added
gene: NDUFA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: NDUFA3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA3 were set to 41038977; 39661167
Phenotypes for gene: NDUFA3 were set to Mitochondrial disease, MONDO:0044970,NDUFA3-related
Intellectual disability syndromic and non-syndromic v1.609 MIR17HG Zornitza Stark Publications for gene: MIR17HG were set to PMID: 25391829; 21892160
Intellectual disability syndromic and non-syndromic v1.604 COPB1 Zornitza Stark Publications for gene: COPB1 were set to 33632302
Intellectual disability syndromic and non-syndromic v1.602 CNP Zornitza Stark gene: CNP was added
gene: CNP was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: CNP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CNP were set to 32128616; 12590258; 40396300
Phenotypes for gene: CNP were set to Leukodystrophy, hypomyelinating, 20, MIM# 619071
Intellectual disability syndromic and non-syndromic v1.601 PFAS Zornitza Stark gene: PFAS was added
gene: PFAS was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: PFAS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PFAS were set to 40421664
Phenotypes for gene: PFAS were set to Inborn error of metabolism, MONDO:0019052, PFAS-related
Intellectual disability syndromic and non-syndromic v1.600 ISCA-46295-Loss Sarah Milton Region: ISCA-46295-Loss was added
Region: ISCA-46295-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-46295-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for Region: ISCA-46295-Loss were set to PMID: 19289393
Phenotypes for Region: ISCA-46295-Loss were set to Chromosome 15q13.3 microdeletion syndrome MIM#612001; intellectual disability; seizures
Intellectual disability syndromic and non-syndromic v1.599 ISCA-46290-Gain Sarah Milton Region: ISCA-46290-Gain was added
Region: ISCA-46290-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-46290-Gain was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for Region: ISCA-46290-Gain were set to 19716111; 27605428; 29707408; 16900295
Phenotypes for Region: ISCA-46290-Gain were set to Chromosome Xp11.23-p11.22 duplication syndrome MIM#300801; intellectual disability; seizures
Intellectual disability syndromic and non-syndromic v1.598 ISCA-37500-Loss Sarah Milton Region: ISCA-37500-Loss was added
Region: ISCA-37500-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37500-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37500-Loss were set to 20921022; 24352913
Phenotypes for Region: ISCA-37500-Loss were set to Chromosome 15q25 deletion syndrome MIM#614294; intellectual disability; congenital abnormalities; haematological abnormalities
Intellectual disability syndromic and non-syndromic v1.597 ISCA-37498-Loss Sarah Milton Region: ISCA-37498-Loss was added
Region: ISCA-37498-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for Region: ISCA-37498-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37498-Loss were set to 11q13.2q13.4 deletion syndrome
Intellectual disability syndromic and non-syndromic v1.596 DLAT Zornitza Stark Publications for gene: DLAT were set to
Intellectual disability syndromic and non-syndromic v1.594 RNU4-2 Zornitza Stark Publications for gene: RNU4-2 were set to 38991538
Intellectual disability syndromic and non-syndromic v1.592 ATP9A Zornitza Stark Publications for gene: ATP9A were set to 34379057; 34764295
Intellectual disability syndromic and non-syndromic v1.590 ISCA-37494-Gain Sarah Milton Region: ISCA-37494-Gain was added
Region: ISCA-37494-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37494-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37494-Gain were set to 25927380; 20301461; 32043567; 32112660
Phenotypes for Region: ISCA-37494-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815; intellectual disability; hypotonia; seizures; spasticity; recurrent respiratory infections
Intellectual disability syndromic and non-syndromic v1.590 ISCA-37493-Loss Sarah Milton Region: ISCA-37493-Loss was added
Region: ISCA-37493-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37493-Loss.
Mode of inheritance for Region: ISCA-37493-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37493-Loss were set to 28283832; 31929334; 31830750; 30853971
Phenotypes for Region: ISCA-37493-Loss were set to 1q43q44 microdeletion syndrome; intellectual disability; seizures; microcephaly; corpus callosum abnormalities
Intellectual disability syndromic and non-syndromic v1.589 ISCA-37486-Loss Sarah Milton Region: ISCA-37486-Loss was added
Region: ISCA-37486-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37486-Loss.
Mode of inheritance for Region: ISCA-37486-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37486-Loss were set to 19914906; 32993859; 32732550; 32597026; 32537635
Phenotypes for Region: ISCA-37486-Loss were set to Chromosome 16p11.2 deletion syndrome, MIM#611913, distal BP2-BP3; intellectual disability; autism; obesity
Intellectual disability syndromic and non-syndromic v1.588 ISCA-37478-Loss Sarah Milton Region: ISCA-37478-Loss was added
Region: ISCA-37478-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37478-Loss.
Mode of inheritance for Region: ISCA-37478-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37478-Loss were set to 22045295
Phenotypes for Region: ISCA-37478-Loss were set to Angelman syndrome, MIM# 105830; Prader-Willi syndrome, MIM# 176270
Intellectual disability syndromic and non-syndromic v1.587 ISCA-37478-Gain Sarah Milton Region: ISCA-37478-Gain was added
Region: ISCA-37478-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37478-Gain.
Mode of inheritance for Region: ISCA-37478-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37478-Gain were set to Chromosome 15q11q13 duplication syndrome, MIM#608636; autism; intellectual disability; ataxia
Intellectual disability syndromic and non-syndromic v1.584 ISCA-37468-Loss Sarah Milton Region: ISCA-37468-Loss was added
Region: ISCA-37468-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen,Expert Review Green
SV/CNV tags were added to Region: ISCA-37468-Loss.
Mode of inheritance for Region: ISCA-37468-Loss was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37468-Loss were set to PMID: 22126752; 16385466; 20186789
Phenotypes for Region: ISCA-37468-Loss were set to Chromosome Xp11.3 deletion syndrome MIM#300578; intellectual disability; retinal dystrophy
Intellectual disability syndromic and non-syndromic v1.583 ISCA-37446-Loss Sarah Milton Region: ISCA-37446-Loss was added
Region: ISCA-37446-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37446-Loss.
Mode of inheritance for Region: ISCA-37446-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37446-Loss were set to 18179902; 23765049; 21671380
Phenotypes for Region: ISCA-37446-Loss were set to Chromosome 22q11.2 deletion syndrome, distal MIM#611867; intellectual disability; autism; multiple congenital anomalies
Intellectual disability syndromic and non-syndromic v1.582 ISCA-37446-Gain Sarah Milton Region: ISCA-37446-Gain was added
Region: ISCA-37446-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37446-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37446-Gain were set to PMID: 18707033
Phenotypes for Region: ISCA-37446-Gain were set to Chromosome 22q11.2 microduplication syndrome MIM#608363, proximal A-D
Intellectual disability syndromic and non-syndromic v1.582 ISCA-37443-Loss Sarah Milton Region: ISCA-37443-Loss was added
Region: ISCA-37443-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37443-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37443-Loss were set to PMID: 20830797; 19460468; 19610115
Phenotypes for Region: ISCA-37443-Loss were set to Chromosome 3q29 microdeletion syndrome MIM#609425; intellectual disability; autism
Intellectual disability syndromic and non-syndromic v1.581 ISCA-37441-Loss Sarah Milton Region: ISCA-37441-Loss was added
Region: ISCA-37441-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37441-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37441-Loss were set to PMID: 20140962
Phenotypes for Region: ISCA-37441-Loss were set to Potocki-Shaffer syndrome MIM#601224; intellectual disability; multiple exostoses; biparietal foramina
Intellectual disability syndromic and non-syndromic v1.580 ISCA-37440-Loss Sarah Milton Region: ISCA-37440-Loss was added
Region: ISCA-37440-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37440-Loss was set to BIALLELIC, autosomal or pseudoautosomal
Publications for Region: ISCA-37440-Loss were set to PMID: 18234729; 23794250
Phenotypes for Region: ISCA-37440-Loss were set to 2p21 deletion syndrome; Hypotonia-cystinuria syndrome, MIM# 606407
Intellectual disability syndromic and non-syndromic v1.578 SCYL2 Zornitza Stark Publications for gene: SCYL2 were set to 31960134; 26203146
Intellectual disability syndromic and non-syndromic v1.577 SCYL2 Zornitza Stark gene: SCYL2 was added
gene: SCYL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: SCYL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCYL2 were set to 31960134; 26203146
Phenotypes for gene: SCYL2 were set to Arthrogryposis multiplex congenita (AMC); Zain syndrome
Intellectual disability syndromic and non-syndromic v1.576 PPP5C Zornitza Stark Publications for gene: PPP5C were set to 35361529; 25363768; 33057194
Intellectual disability syndromic and non-syndromic v1.574 ISCA-37439-Gain Sarah Milton Region: ISCA-37439-Gain was added
Region: ISCA-37439-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37439-Gain was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for Region: ISCA-37439-Gain were set to PMID: 20004760
Phenotypes for Region: ISCA-37439-Gain were set to Chromosome Xq28 duplication syndrome MIM#300815
Intellectual disability syndromic and non-syndromic v1.573 ISCA-37434-Loss Sarah Milton Region: ISCA-37434-Loss was added
Region: ISCA-37434-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37434-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37434-Loss were set to PMID: 12974736; 18245432
Phenotypes for Region: ISCA-37434-Loss were set to Chromosome 1p36 deletion syndrome MIM#607872; intellectual disability; hypotonia; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.571 ISCA-37433-Loss Sarah Milton Region: ISCA-37433-Loss was added
Region: ISCA-37433-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37433-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for Region: ISCA-37433-Loss were set to DiGeorge syndrome MIM#188400
Intellectual disability syndromic and non-syndromic v1.570 ISCA-37433-Gain Sarah Milton Region: ISCA-37433-Gain was added
Region: ISCA-37433-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37433-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37433-Gain were set to PMID: 18707033
Phenotypes for Region: ISCA-37433-Gain were set to Chromosome 22q11.2 microduplication syndrome MIM#608363
Intellectual disability syndromic and non-syndromic v1.569 ISCA-37432-Loss Sarah Milton Region: ISCA-37432-Loss was added
Region: ISCA-37432-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37432-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37432-Loss were set to PMID: 19844256
Phenotypes for Region: ISCA-37432-Loss were set to Chromosome 17q12 deletion syndrome MIM#614527; Renal cysts and diabetes (RCAD) syndrome
Intellectual disability syndromic and non-syndromic v1.568 ISCA-37432-Gain Sarah Milton Region: ISCA-37432-Gain was added
Region: ISCA-37432-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37432-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37432-Gain were set to PMID: 19844256
Phenotypes for Region: ISCA-37432-Gain were set to Chromosome 17q12 duplication syndrome 614526; intellectual disability; seizures; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.567 ISCA-37431-Loss Sarah Milton Region: ISCA-37431-Loss was added
Region: ISCA-37431-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37431-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37431-Loss were set to 12660952; 14729829
Phenotypes for Region: ISCA-37431-Loss were set to Chromosome 17q11.2 deletion syndrome, MIM#613675; NF1 deletion syndrome
Intellectual disability syndromic and non-syndromic v1.566 ISCA-37430-Loss Sarah Milton Region: ISCA-37430-Loss was added
Region: ISCA-37430-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37430-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37430-Loss were set to Miller-Dieker lissencephaly syndrome, MIM# 247200
Intellectual disability syndromic and non-syndromic v1.564 CDK4 Zornitza Stark gene: CDK4 was added
gene: CDK4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: CDK4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDK4 were set to 40210435
Phenotypes for gene: CDK4 were set to Neurodevelopmental disorder, MONDO:0700092; {Melanoma, cutaneous malignant, 3} MIM#609048
Intellectual disability syndromic and non-syndromic v1.563 MAU2 Lucy Spencer gene: MAU2 was added
gene: MAU2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: MAU2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAU2 were set to 41332805; 37962004; 32433956
Phenotypes for gene: MAU2 were set to Cornelia de Lange syndrome MONDO:0016033, MAU2-related
Intellectual disability syndromic and non-syndromic v1.561 TMEM251 Zornitza Stark gene: TMEM251 was added
gene: TMEM251 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM251 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM251 were set to 40171858; 33252156
Phenotypes for gene: TMEM251 were set to Dysostosis multiplex, Ain-Naz type MIM@619345
Review for gene: TMEM251 was set to GREEN
Added comment: PMID 40171858: reports 2 siblings from an Iranian consanguineous family and six previously reported families (8 patients, 7 unrelated families) with biallelic loss‑of‑function LYSET variants presenting with MLII‑like mucolipidosis; core features include dysostosis multiplex, coarse facial features, hepatomegaly, joint contractures, developmental delay; mouse knockout recapitulates the phenotype, supporting gene‑disease causality.

HGNC approved name is LYSET.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.557 NOP58 Zornitza Stark gene: NOP58 was added
gene: NOP58 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: NOP58 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NOP58 were set to 41383020
Phenotypes for gene: NOP58 were set to Neurodevelopmental disorder, MONDO:0700092, NOP58-related
Intellectual disability syndromic and non-syndromic v1.556 EMC10 Zornitza Stark Publications for gene: EMC10 were set to PMID: 32869858; 33531666
Intellectual disability syndromic and non-syndromic v1.553 UNC13A Zornitza Stark Publications for gene: UNC13A were set to 27648472; 28192369
Intellectual disability syndromic and non-syndromic v1.552 WDR83 chirag patel gene: WDR83 was added
gene: WDR83 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR83 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: WDR83 were set to 41381792
Phenotypes for gene: WDR83 were set to Neurodevelopmental disorder, MONDO:0700092, WDR83-related
Mode of pathogenicity for gene: WDR83 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Intellectual disability syndromic and non-syndromic v1.551 NDUFB7 Zornitza Stark gene: NDUFB7 was added
gene: NDUFB7 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: NDUFB7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFB7 were set to 33502047; 27626371; 40025060
Phenotypes for gene: NDUFB7 were set to Mitochondrial complex I deficiency nuclear type 39 (MC1DN39), MIM#620135
Intellectual disability syndromic and non-syndromic v1.550 FIBP Zornitza Stark Publications for gene: FIBP were set to 26660953; 27183861
Intellectual disability syndromic and non-syndromic v1.548 FIBP Zornitza Stark edited their review of gene: FIBP: Added comment: Beyond the two families previously reviewed (PMIDs 26660953; 27183861), four additional studies (PMIDs 36919607, 37218527, 37876348, 40099975) contribute four new unrelated families (total six unrelated families, nine patients) with a consistent autosomal‑recessive overgrowth syndrome. All six families have biallelic loss‑of‑function FIBP variants (nonsense or frameshift leading to NMD). Detailed clinical descriptions include overgrowth, macrocephaly, facial dysmorphism, developmental delay/intellectual disability, renal dysplasia and, in two families, early‑onset tumor predisposition. Segregation analyses confirm recessive inheritance in every case. Functional work (RT‑qPCR, fibroblast proliferation assays, mouse embryonic expression) demonstrates reduced FIBP expression and increased cell proliferation, supporting pathogenicity.; Changed publications: 40099975, 37876348, 36919607, 27183861, 26660953
Intellectual disability syndromic and non-syndromic v1.548 DPH2 Zornitza Stark Publications for gene: DPH2 were set to 32576952; 27421267
Intellectual disability syndromic and non-syndromic v1.546 WASHC3 Zornitza Stark Publications for gene: WASHC3 were set to DOI: https://doi.org/10.1016/j.gimo.2024.101915
Intellectual disability syndromic and non-syndromic v1.545 SEC24C Zornitza Stark gene: SEC24C was added
gene: SEC24C was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: SEC24C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SEC24C were set to 40131364
Phenotypes for gene: SEC24C were set to Neurodevelopmental disorder, MONDO:0700092, SEC24C-related
Intellectual disability syndromic and non-syndromic v1.543 ZIC2_HPE5_GCN Bryony Thompson STR: ZIC2_HPE5_GCN was added
STR: ZIC2_HPE5_GCN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
paediatric-onset tags were added to STR: ZIC2_HPE5_GCN.
Mode of inheritance for STR: ZIC2_HPE5_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ZIC2_HPE5_GCN were set to 11285244; 33811808
Phenotypes for STR: ZIC2_HPE5_GCN were set to Holoprosencephaly 5 MIM#609637
Intellectual disability syndromic and non-syndromic v1.542 RSPRY1 Zornitza Stark Publications for gene: RSPRY1 were set to 26365341
Intellectual disability syndromic and non-syndromic v1.540 USMG5 Zornitza Stark gene: USMG5 was added
gene: USMG5 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: USMG5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: USMG5 were set to 29917077; 30240627; 40014158
Phenotypes for gene: USMG5 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 6 MIM#618683
Intellectual disability syndromic and non-syndromic v1.538 PRMT1 Zornitza Stark gene: PRMT1 was added
gene: PRMT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PRMT1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: PRMT1 were set to 39937650
Phenotypes for gene: PRMT1 were set to Neurodevelopmental disorder, MONDO:0700092, PRMT1-related
Intellectual disability syndromic and non-syndromic v1.537 EXOSC4 Zornitza Stark gene: EXOSC4 was added
gene: EXOSC4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: EXOSC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOSC4 were set to 39009343; 37961665; 36344539
Phenotypes for gene: EXOSC4 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.536 KDM2A Zornitza Stark Publications for gene: KDM2A were set to
Intellectual disability syndromic and non-syndromic v1.533 SELENOI Zornitza Stark Publications for gene: SELENOI were set to 28052917
Intellectual disability syndromic and non-syndromic v1.531 TRMT1L Zornitza Stark gene: TRMT1L was added
gene: TRMT1L was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: TRMT1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRMT1L were set to 39786990
Phenotypes for gene: TRMT1L were set to Neurodevelopmental disorder, MONDO:0700092, TRMT1L-related
Intellectual disability syndromic and non-syndromic v1.530 SPAG9 Zornitza Stark gene: SPAG9 was added
gene: SPAG9 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: SPAG9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPAG9 were set to 39846792
Phenotypes for gene: SPAG9 were set to Neurodevelopmental disorder, MONDO:0700092, SPAG9-related
Intellectual disability syndromic and non-syndromic v1.529 NUBP2 Zornitza Stark gene: NUBP2 was added
gene: NUBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: NUBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NUBP2 were set to 39867373
Phenotypes for gene: NUBP2 were set to Neurodevelopmental disorder, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.525 KIF21A Zornitza Stark Publications for gene: KIF21A were set to
Intellectual disability syndromic and non-syndromic v1.524 BAZ2B Zornitza Stark Publications for gene: BAZ2B were set to 31999386
Intellectual disability syndromic and non-syndromic v1.522 ISCA-37431-Gain Sarah Milton Region: ISCA-37431-Gain was added
Region: ISCA-37431-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37431-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37431-Gain were set to 22241097
Phenotypes for Region: ISCA-37431-Gain were set to Chromosome 17q11.2 duplication syndrome, 1.4-Mb MIM#618874; NF1 microduplication; intellectual disability; micro- and macrocephaly; seizures; dysmorphic features
Intellectual disability syndromic and non-syndromic v1.521 ISCA-37430-Gain Sarah Milton Region: ISCA-37430-Gain was added
Region: ISCA-37430-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37430-Gain.
Mode of inheritance for Region: ISCA-37430-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37430-Gain were set to Chromosome 17p13.3 duplication syndrome, centromeric, MIM#613215; intellectual disability
Intellectual disability syndromic and non-syndromic v1.520 ISCA-37429-Loss Sarah Milton Region: ISCA-37429-Loss was added
Region: ISCA-37429-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37429-Loss.
Mode of inheritance for Region: ISCA-37429-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37429-Loss were set to Wolf-Hirschhorn syndrome, MIM# 194190; intellectual disability; growth retardation; seizures; dysmorphic features
Intellectual disability syndromic and non-syndromic v1.519 ISCA-37425-Loss Sarah Milton Region: ISCA-37425-Loss was added
Region: ISCA-37425-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37425-Loss.
Mode of inheritance for Region: ISCA-37425-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37425-Loss were set to 23190751; 19596467
Phenotypes for Region: ISCA-37425-Loss were set to Sotos syndrome, chromosome 5q35 deletion; intellectual disability; overgrowth
Intellectual disability syndromic and non-syndromic v1.518 ISCA-37425-Gain Sarah Milton Region: ISCA-37425-Gain was added
Region: ISCA-37425-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37425-Gain.
Mode of inheritance for Region: ISCA-37425-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37425-Gain were set to 24819041
Phenotypes for Region: ISCA-37425-Gain were set to Chromosome 5q35 duplication syndrome; microcephaly; failure to thrive; seizures
Intellectual disability syndromic and non-syndromic v1.517 ISCA-37424-Loss Sarah Milton Region: ISCA-37424-Loss was added
Region: ISCA-37424-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37424-Loss.
Mode of inheritance for Region: ISCA-37424-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37424-Loss were set to 20345475; 25846706
Phenotypes for Region: ISCA-37424-Loss were set to Chromosome 10q22.3q23.2 deletion syndrome (LCR-3/4-flanked); intellectual disability; autism; macrocephaly
Intellectual disability syndromic and non-syndromic v1.517 ISCA-37423-Loss Sarah Milton Region: ISCA-37423-Loss was added
Region: ISCA-37423-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37423-Loss.
Mode of inheritance for Region: ISCA-37423-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37423-Loss were set to 23696316; 23011633; 20969981
Phenotypes for Region: ISCA-37423-Loss were set to 8p23.1 deletion syndrome; congenital heart disease; developmental delay
Intellectual disability syndromic and non-syndromic v1.512 MT-TE Zornitza Stark gene: MT-TE was added
gene: MT-TE was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-TE.
Mode of inheritance for gene gene: MT-TE was set to MITOCHONDRIAL
Publications for gene: MT-TE were set to 8155739; 21194154; 17715279; 23334599; 7726155; 7726154; 9353617; 15048886; 15670724; 23847141; 23334599; 17266923; 17056256
Phenotypes for gene: MT-TE were set to Mitochondrial disease (MONDO:0044970), MT-TE-related
Intellectual disability syndromic and non-syndromic v1.510 ISCA-37423-Gain Sarah Milton Region: ISCA-37423-Gain was added
Region: ISCA-37423-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37423-Gain.
Mode of inheritance for Region: ISCA-37423-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37423-Gain were set to 26097203; 25520754
Phenotypes for Region: ISCA-37423-Gain were set to 8p23.1 duplication syndrome; intellectual disability; congenital heart disease
Intellectual disability syndromic and non-syndromic v1.509 ISCA-37421-Loss Sarah Milton Region: ISCA-37421-Loss was added
Region: ISCA-37421-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37421-Loss.
Mode of inheritance for Region: ISCA-37421-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37421-Loss were set to 32655619
Phenotypes for Region: ISCA-37421-Loss were set to Chromosome 1q21.1 deletion syndrome, MIM# 612474; intellectual disability; microcephaly; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.508 DNAJA3 Zornitza Stark gene: DNAJA3 was added
gene: DNAJA3 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: DNAJA3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAJA3 were set to 34750646; 30770860
Phenotypes for gene: DNAJA3 were set to Mitochondrial disease, MONDO:0044970, DNAJA3-related
Intellectual disability syndromic and non-syndromic v1.505 ISCA-37418-Loss Zornitza Stark Publications for Region: ISCA-37418-Loss were set to
Intellectual disability syndromic and non-syndromic v1.504 ISCA-37421-Gain Sarah Milton Region: ISCA-37421-Gain was added
Region: ISCA-37421-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37421-Gain.
Mode of inheritance for Region: ISCA-37421-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37421-Gain were set to 32655619
Phenotypes for Region: ISCA-37421-Gain were set to Chromosome 1q21.1 duplication syndrome, MIM# 612475; intellectual disability; autism; macrocephaly
Intellectual disability syndromic and non-syndromic v1.503 ISCA-37418-Loss Sarah Milton Region: ISCA-37418-Loss was added
Region: ISCA-37418-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,ClinGen,NHS GMS
Mode of inheritance for Region: ISCA-37418-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Phenotypes for Region: ISCA-37418-Loss were set to Potocki-Lupski syndrome; Smith-Magenis syndrome; moderate intellectual disability, delayed speech and language skills, distinctive facial features, sleep disturbances, and behavioral problems; 182290; Structural cardiovascular anomalies (dilated aortic root, bicommissural aortic valve, atrial/ventricular and septal defects) and sleep disturbance; hypotonia, failure to thrive, mental retardation, pervasive developmental disorders, congenital anomalies; Dental abnormalities; hypotonia, poor feeding, failure to thrive, developmental delay particularly cognitive and language deficity, mild-moderate intellectual deficit, and neuropsychiatric disorders
Intellectual disability syndromic and non-syndromic v1.502 ISCA-37418-Gain Sarah Milton Region: ISCA-37418-Gain was added
Region: ISCA-37418-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for Region: ISCA-37418-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37418-Gain were set to Potocki-Lupski syndrome, MIM# 610883; intellectual disability; hypotonia; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.501 ISCA-37415-Gain Sarah Milton Region: ISCA-37415-Gain was added
Region: ISCA-37415-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37415-Gain.
Mode of inheritance for Region: ISCA-37415-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37415-Gain were set to 30287593
Phenotypes for Region: ISCA-37415-Gain were set to 16p13.11 microduplication syndrome; intellectual disability; autism; aortopathy
Intellectual disability syndromic and non-syndromic v1.500 ISCA-37411-Loss Sarah Milton Region: ISCA-37411-Loss was added
Region: ISCA-37411-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37411-Loss.
Mode of inheritance for Region: ISCA-37411-Loss was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for Region: ISCA-37411-Loss were set to 19372089; 20979196
Phenotypes for Region: ISCA-37411-Loss were set to Chromosome 15q13.3 microdeletion syndrome, MIM# 612001; intellectual disability; epilepsy
Intellectual disability syndromic and non-syndromic v1.499 ISCA-37406-Loss Sarah Milton Region: ISCA-37406-Loss was added
Region: ISCA-37406-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37406-Loss.
Mode of inheritance for Region: ISCA-37406-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37406-Loss were set to 20101707; 17473832; 16783566
Phenotypes for Region: ISCA-37406-Loss were set to Chromosome 16p13.3 deletion syndrome, Rubinstein-Taybi deletion syndrome
Intellectual disability syndromic and non-syndromic v1.499 ISCA-37405-Loss Sarah Milton Region: ISCA-37405-Loss was added
Region: ISCA-37405-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37405-Loss.
Mode of inheritance for Region: ISCA-37405-Loss was set to BIALLELIC, autosomal or pseudoautosomal
Publications for Region: ISCA-37405-Loss were set to 29146700
Phenotypes for Region: ISCA-37405-Loss were set to Nephronophthisis 1, juvenile, MIM# 256100; Joubert syndrome 4, MIM# 609583; Senior-Loken syndrome 1, MIM# 266900
Intellectual disability syndromic and non-syndromic v1.498 ISCA-37404-Loss Sarah Milton Region: ISCA-37404-Loss was added
Region: ISCA-37404-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37404-Loss.
Mode of inheritance for Region: ISCA-37404-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for Region: ISCA-37404-Loss were set to 20301323; 20301505
Phenotypes for Region: ISCA-37404-Loss were set to Angelman syndrome, MIM# 105830; Prader-Willi syndrome, MIM# 176270
Intellectual disability syndromic and non-syndromic v1.497 CTNND2 Zornitza Stark Publications for gene: CTNND2 were set to 25839933; 29127138; 25807484
Intellectual disability syndromic and non-syndromic v1.495 PRMT9 Lucy Spencer Publications for gene: PRMT9 were set to PMID: 38561334
Intellectual disability syndromic and non-syndromic v1.491 ESRRG Zornitza Stark gene: ESRRG was added
gene: ESRRG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: ESRRG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ESRRG were set to 41265451
Phenotypes for gene: ESRRG were set to Movement disorder, MONDO:0005395, ESRRG-related
Intellectual disability syndromic and non-syndromic v1.490 ELMSAN1 Zornitza Stark gene: ELMSAN1 was added
gene: ELMSAN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
new gene name tags were added to gene: ELMSAN1.
Mode of inheritance for gene: ELMSAN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ELMSAN1 were set to Neurodevelopmental disorder, MONDO:0700092, ELMSAN1-related
Intellectual disability syndromic and non-syndromic v1.489 SUCO Zornitza Stark gene: SUCO was added
gene: SUCO was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000; 41282771
Phenotypes for gene: SUCO were set to Syndromic disease (MONDO:0002254), SUCO-related
Intellectual disability syndromic and non-syndromic v1.488 GTF2H4 Zornitza Stark gene: GTF2H4 was added
gene: GTF2H4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature
Mode of inheritance for gene: GTF2H4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF2H4 were set to 40924495; 40924475
Phenotypes for gene: GTF2H4 were set to Xeroderma pigmentosum, complementation group J, MIM# 621435
Intellectual disability syndromic and non-syndromic v1.486 ISCA-37404-Gain Sarah Milton Region: ISCA-37404-Gain was added
Region: ISCA-37404-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37404-Gain.
Mode of inheritance for Region: ISCA-37404-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37404-Gain were set to 24239951; 24075935
Phenotypes for Region: ISCA-37404-Gain were set to Chromosome 15q11q13 duplication syndrome; {Autism susceptibility 4} 608636; intellectual disability; seizures; ataxia
Intellectual disability syndromic and non-syndromic v1.485 ISCA-37400-Loss Sarah Milton Region: ISCA-37400-Loss was added
Region: ISCA-37400-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37400-Loss.
Mode of inheritance for Region: ISCA-37400-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37400-Loss were set to Chromosome 16p11.2 deletion syndrome, proximal, MIM# 611913; autism; intellectual disability; seizures
Intellectual disability syndromic and non-syndromic v1.484 ISCA-37400-Gain Sarah Milton Region: ISCA-37400-Gain was added
Region: ISCA-37400-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37400-Gain.
Mode of inheritance for Region: ISCA-37400-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37400-Gain were set to 21841781; 18184952; 21731881
Phenotypes for Region: ISCA-37400-Gain were set to Chromosome 16p11.2 duplication syndrome, MIM# 614671; intellectual disability; autism
Intellectual disability syndromic and non-syndromic v1.484 ISCA-37397-Loss Sarah Milton Region: ISCA-37397-Loss was added
Region: ISCA-37397-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37397-Loss.
Mode of inheritance for Region: ISCA-37397-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37397-Loss were set to 21671380; 23765049; 18179902
Phenotypes for Region: ISCA-37397-Loss were set to Chromosome 22q11.2 deletion syndrome, distal, MIM#611867; intellectual disability; seizures; growth retardation; multiple congenital anomalies
Intellectual disability syndromic and non-syndromic v1.483 ISCA-37397-Gain Sarah Milton Region: ISCA-37397-Gain was added
Region: ISCA-37397-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37397-Gain.
Mode of inheritance for Region: ISCA-37397-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37397-Gain were set to 21671380; 31479204
Phenotypes for Region: ISCA-37397-Gain were set to Chromosome 22q11.2 microduplication syndrome, MIM#608363, distal; intellectual disability; dysmorphic features; congenital anomalies
Intellectual disability syndromic and non-syndromic v1.482 ISCA-37396-Loss Sarah Milton Region: ISCA-37396-Loss was added
Region: ISCA-37396-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
SV/CNV tags were added to Region: ISCA-37396-Loss.
Mode of inheritance for Region: ISCA-37396-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37396-Loss were set to 22180641; 19557438; 19233321; 22359776
Phenotypes for Region: ISCA-37396-Loss were set to Chromosome 15q24 deletion syndrome, MIM#613406; intellectual disability; facial dysmorphisms; congenital malformations of the hands and feet, eye, and genitalia; joint laxity; and growth retardation and failure to thrive
Intellectual disability syndromic and non-syndromic v1.481 ISCA-37394-Loss Sarah Milton Region: ISCA-37394-Loss was added
Region: ISCA-37394-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37394-Loss.
Mode of inheritance for Region: ISCA-37394-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37394-Loss were set to 20691407
Phenotypes for Region: ISCA-37394-Loss were set to Chromosome 2q37 deletion syndrome, MIM# 600430; brachydactyly; intellectual disability
Intellectual disability syndromic and non-syndromic v1.480 ISCA-37393-Gain Sarah Milton Region: ISCA-37393-Gain was added
Region: ISCA-37393-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37393-Gain.
Mode of inheritance for Region: ISCA-37393-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for Region: ISCA-37393-Gain were set to Cat eye syndrome, MIM# 115470; coloboma; anal atresia; heart and renal malformations
Intellectual disability syndromic and non-syndromic v1.479 ISCA-37392-Loss Sarah Milton Region: ISCA-37392-Loss was added
Region: ISCA-37392-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37392-Loss.
Mode of inheritance for Region: ISCA-37392-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37392-Loss were set to 20301427
Phenotypes for Region: ISCA-37392-Loss were set to Williams-Beuren syndrome, MIM# 194050; intellectual disability; growth retardation; cardiovascular disease
Intellectual disability syndromic and non-syndromic v1.478 ISCA-37392-Gain Sarah Milton Region: ISCA-37392-Gain was added
Region: ISCA-37392-Gain was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37392-Gain.
Mode of inheritance for Region: ISCA-37392-Gain was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37392-Gain were set to 33187326; 27615053; 26610320
Phenotypes for Region: ISCA-37392-Gain were set to Chromosome 7q11.23 duplication syndrome, MIM# 609757; intellectual disability; hypotonia; macrocephaly; seizures; aortic dilatation
Intellectual disability syndromic and non-syndromic v1.478 ISCA-37390-Loss Sarah Milton Region: ISCA-37390-Loss was added
Region: ISCA-37390-Loss was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert Review
SV/CNV tags were added to Region: ISCA-37390-Loss.
Mode of inheritance for Region: ISCA-37390-Loss was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for Region: ISCA-37390-Loss were set to 16953888
Phenotypes for Region: ISCA-37390-Loss were set to Cri-du-chat syndrome MIM#123450; intellectual disability; microcephaly
Intellectual disability syndromic and non-syndromic v1.477 MT-ND4 Zornitza Stark gene: MT-ND4 was added
gene: MT-ND4 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-ND4.
Mode of inheritance for gene gene: MT-ND4 was set to MITOCHONDRIAL
Publications for gene: MT-ND4 were set to 12707444; 16120329; 15576045; 20502985; 27761019; 32445240; 32659360; 3201231
Phenotypes for gene: MT-ND4 were set to Mitochondrial disease (MONDO:0044970), MT-ND4-related
Intellectual disability syndromic and non-syndromic v1.476 MT-CO2 Zornitza Stark gene: MT-CO2 was added
gene: MT-CO2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-CO2.
Mode of inheritance for gene gene: MT-CO2 was set to MITOCHONDRIAL
Publications for gene: MT-CO2 were set to 34325999; 30315213; 28521807; 10205264; 10486321; 11558799; 18245391; 23616164; 31167410; 23965802; 30030519
Phenotypes for gene: MT-CO2 were set to Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related
Intellectual disability syndromic and non-syndromic v1.475 MT-ATP6 Zornitza Stark gene: MT-ATP6 was added
gene: MT-ATP6 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Expert list
mtDNA tags were added to gene: MT-ATP6.
Mode of inheritance for gene gene: MT-ATP6 was set to MITOCHONDRIAL
Publications for gene: MT-ATP6 were set to 40112238
Phenotypes for gene: MT-ATP6 were set to Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related
Intellectual disability syndromic and non-syndromic v1.470 ABI2 Zornitza Stark gene: ABI2 was added
gene: ABI2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ABI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ABI2 were set to 40475134
Phenotypes for gene: ABI2 were set to Neurodevelopmental disorder, MONDO:0700092, ABI2-related
Review for gene: ABI2 was set to AMBER
Added comment: Preprint reporting eight unrelated individuals with severe NDD and de novo heterozygous ABI2 missense variants, including a recurrent p.Tyr491Cys in the highly conserved SH3 domain in six individuals. Key clinical features included moderate to severe motor delay, absent or delayed expressive language, intellectual disability, seizures, autistic traits, as well as macrocephaly, thinning of the corpus callosum, and white matter signal abnormalities.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.468 NUDT2 Zornitza Stark edited their review of gene: NUDT2: Added comment: PMID 38141063 reports 18 individuals from 10 unrelated families with biallelic loss‑of‑function NUDT2 variants presenting with early‑onset neurodevelopmental disorder characterized by hypotonia, motor delay, gait disturbance, mild intellectual disability, peripheral neuropathy, corpus callosum abnormalities and progressive basal ganglia signal abnormalities.; Changed publications: 27431290, 30059600, 33058507, 38141063
Intellectual disability syndromic and non-syndromic v1.468 KARS Zornitza Stark changed review comment from: Sources: Expert list; to: Infantile-onset progressive leukoencephalopathy with or without deafness (LEPID) is a complex neurodegenerative disorder with onset of symptoms in infancy or early childhood. Most individuals present with sensorineural deafness or hypoacousia and global developmental delay. Affected individuals show episodic regression with progressive motor deterioration resulting in spastic tetraplegia and loss of ambulation, as well as impaired intellectual development with poor or absent speech. Additional more variable features may include poor overall growth with microcephaly, seizures, visual loss, microcytic anaemia, and hepatic enlargement or abnormal liver enzymes.

Brain imaging shows deep white matter abnormalities consistent with a progressive leukoencephalopathy.

Calcifications of the brain and spinal cord are a feature.
Intellectual disability syndromic and non-syndromic v1.452 EN2 chirag patel gene: EN2 was added
gene: EN2 was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
disputed tags were added to gene: EN2.
Mode of inheritance for gene: EN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EN2 were set to Complex neurodevelopmental disorder, MONDO:0100038
Review for gene: EN2 was set to RED
Added comment: ClinGen DISPUTED - Feb 2021

https://search.clinicalgenome.org/kb/gene-validity/CGGV:assertion_91eb2fc6-864c-4a4a-9b2d-0b2bdd695999-2021-02-16T170000.000Z?page=1&size=25&search=
Sources: ClinGen
Intellectual disability syndromic and non-syndromic v1.446 COX4I1 Lucy Spencer gene: COX4I1 was added
gene: COX4I1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Expert list
Mode of inheritance for gene: COX4I1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COX4I1 were set to 28766551; 22592081; 31290619; 40095452; 41203052
Phenotypes for gene: COX4I1 were set to Mitochondrial complex IV deficiency, nuclear type 16, MIM#619060
Intellectual disability syndromic and non-syndromic v1.444 COQ5 Zornitza Stark Publications for gene: COQ5 were set to 29044765
Intellectual disability syndromic and non-syndromic v1.441 CUL1 Zornitza Stark gene: CUL1 was added
gene: CUL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: CUL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CUL1 were set to PMID: 41189326
Phenotypes for gene: CUL1 were set to Neurodevelopmental disorder, MONDO:0700092, CUL1-related
Intellectual disability syndromic and non-syndromic v1.439 SEC31A Zornitza Stark Publications for gene: SEC31A were set to 30464055
Intellectual disability syndromic and non-syndromic v1.433 CACNA1A Zornitza Stark Publications for gene: CACNA1A were set to 27476654; 33985586
Intellectual disability syndromic and non-syndromic v1.430 EXOSC10 Zornitza Stark gene: EXOSC10 was added
gene: EXOSC10 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Amber,Literature
Mode of inheritance for gene: EXOSC10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EXOSC10 were set to 41132091
Phenotypes for gene: EXOSC10 were set to Microcephaly, MONDO:0001149, EXOSC10-related
Intellectual disability syndromic and non-syndromic v1.429 RPS6KC1 Rylee Peters gene: RPS6KC1 was added
gene: RPS6KC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: RPS6KC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RPS6KC1 were set to 41130203
Phenotypes for gene: RPS6KC1 were set to Complex neurodevelopmental disorder, MONDO:0100038, RPS6KC1-related
Intellectual disability syndromic and non-syndromic v1.425 KLHL13 Krithika Murali gene: KLHL13 was added
gene: KLHL13 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KLHL13 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: KLHL13 were set to PMID: 41159445
Phenotypes for gene: KLHL13 were set to Neurodevelopmental disorder, MONDO:0700092, KLHL13-related
Review for gene: KLHL13 was set to GREEN
Added comment: PMID: 41159445 Akhther et al 2025 (pre-print) report 8 affected individuals from 4 unrelated famlies with hemizygous/heterozygous KLHL13 variants and an X-linked neurodevelopmental disorder with the following phenotypic features including mild-severe ID, developmental delay, macrocephaly, hypotonia, unsteady gait, facial dysmrophism and behavioural issues. Functional studies support LoF disease mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.420 BAIAP2 Bryony Thompson gene: BAIAP2 was added
gene: BAIAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: BAIAP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BAIAP2 were set to 41133935; 38149472
Phenotypes for gene: BAIAP2 were set to BAIAP2-related complex neurodevelopmental disorder MONDO:0100038
Intellectual disability syndromic and non-syndromic v1.418 QSER1 Zornitza Stark gene: QSER1 was added
gene: QSER1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Red,Literature,Literature
Mode of inheritance for gene: QSER1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: QSER1 were set to PMID: 41139957
Phenotypes for gene: QSER1 were set to Neurodevelopmental disorder, MONDO:0700092, QSER1-related
Intellectual disability syndromic and non-syndromic v1.416 CCNK Sangavi Sivagnanasundram gene: CCNK was added
gene: CCNK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCNK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CCNK were set to 41101726; 37597256; 30122539
Phenotypes for gene: CCNK were set to CCNK-related neurodevelopmental disorder-severe intellectual disability-facial dysmorphism syndrome MONDO:0035775
Intellectual disability syndromic and non-syndromic v1.414 SRRM1 Zornitza Stark gene: SRRM1 was added
gene: SRRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SRRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SRRM1 were set to 41145827
Phenotypes for gene: SRRM1 were set to Neurodevelopmental disorder, MONDO:0700092, SRRM1-related
Review for gene: SRRM1 was set to GREEN
Added comment: PMID 41145827 reports three individuals from three unrelated families with heterozygous truncating SRRM1 variants presenting with a neurodevelopmental disorder characterised by developmental delay, intellectual disability, short stature, behavioural and skeletal anomalies, and facial dysmorphism. Two variants are confirmed de novo and functional assays in neuronal‑like cells and Drosophila support haploinsufficiency as a disease mechanism.

Serine/arginine repetitive matrix protein 1 (SRRM1) is a key component of spliceosomes and plays various roles in messenger RNA processing.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.408 OTUD7A Zornitza Stark Publications for gene: OTUD7A were set to 31997314; 29395075; 29395074; 33381903
Intellectual disability syndromic and non-syndromic v1.406 AUTS2 Zornitza Stark Publications for gene: AUTS2 were set to 23332918; 25205402; 31474318; 39953909
Intellectual disability syndromic and non-syndromic v1.405 AUTS2 Zornitza Stark Publications for gene: AUTS2 were set to 23332918; 25205402; 31474318
Intellectual disability syndromic and non-syndromic v1.404 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.403 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.403 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171; 41040850
Intellectual disability syndromic and non-syndromic v1.402 SLC31A1 Zornitza Stark Publications for gene: SLC31A1 were set to PMID: 35913762; 36562171
Intellectual disability syndromic and non-syndromic v1.399 SLC27A3 Sarah Milton gene: SLC27A3 was added
gene: SLC27A3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLC27A3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC27A3 were set to PMID: 41054338
Phenotypes for gene: SLC27A3 were set to Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related
Intellectual disability syndromic and non-syndromic v1.398 DIP2B_FRA12A_CGG Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128
Intellectual disability syndromic and non-syndromic v1.396 SSPO Sarah Milton gene: SSPO was added
gene: SSPO was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
new gene name tags were added to gene: SSPO.
Mode of inheritance for gene: SSPO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SSPO were set to PMID: 41077560
Phenotypes for gene: SSPO were set to Neurodevelopmental disorder, MONDO:0700092, SSPOP-related
Intellectual disability syndromic and non-syndromic v1.395 PPFIA2 Zornitza Stark gene: PPFIA2 was added
gene: PPFIA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: PPFIA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPFIA2 were set to 41044885
Phenotypes for gene: PPFIA2 were set to Neurodevelopmental disorder, MONDO:0700092, PPFIA2 related
Intellectual disability syndromic and non-syndromic v1.394 EIPR1 Zornitza Stark gene: EIPR1 was added
gene: EIPR1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: EIPR1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIPR1 were set to 41058046
Phenotypes for gene: EIPR1 were set to Mendelian neurodevelopmental disorder MONDO:0100500, EIPR1-related
Penetrance for gene: EIPR1 were set to unknown
Intellectual disability syndromic and non-syndromic v1.393 BRSK1 Zornitza Stark gene: BRSK1 was added
gene: BRSK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review Green,Literature
Mode of inheritance for gene: BRSK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BRSK1 were set to 41035394
Phenotypes for gene: BRSK1 were set to Neurodevelopmental disorder, MONDO:0700092, BRSK1-related
Intellectual disability syndromic and non-syndromic v1.392 KLHL20 Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390
Intellectual disability syndromic and non-syndromic v1.391 KLHL20 Zornitza Stark Phenotypes for gene: KLHL20 were changed from Neurodevelopmental disorder (MONDO:0700092), KLHL20-related to Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390
Intellectual disability syndromic and non-syndromic v1.390 KLHL20 Zornitza Stark reviewed gene: KLHL20: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.384 CDKL1 Zornitza Stark commented on gene: CDKL1: PMID 40088891 reports two unrelated individuals with de novo heterozygous CDKL1 missense variants (p.Val115Ala, p.Arg169Cys) presenting with childhood‑onset neurodevelopmental disorder, developmental delay and seizures; Drosophila rescue assays show dominant‑negative activity of the variants. However, note that the variants are present at low frequency in gnomAD v4, p.Val115Ala: 2 individuals, p.Arg169Cys: 13 individuals. Some supportive functional data presented. Upgrade to Amber but not Green due to pop counts.
Intellectual disability syndromic and non-syndromic v1.382 TBCB Zornitza Stark Phenotypes for gene: TBCB were changed from Neurodevelopmental disorder, MONDO:0700092, TBCB-related to Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382
Intellectual disability syndromic and non-syndromic v1.381 TBCB Zornitza Stark reviewed gene: TBCB: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.380 TBX2 Krithika Murali gene: TBX2 was added
gene: TBX2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TBX2 were set to PMID: 36733940
Phenotypes for gene: TBX2 were set to Vertebral anomalies and variable endocrine and T-cell dysfunction - MIM#618223
Review for gene: TBX2 was set to AMBER
Added comment: PMID: 36733940 Rafeeq et al 2022 report a novel de novo nonsense variant (c.529A>T; p.Lys177*; NM_005994.4) in a child with chondrodysplasia. Skeletal features included spinal deformities, short limbs, metaphyseal and epiphyseal dysplasia, and bilateral developmental dislocation of the hip (DDH).

Global developmental delay was also noted in this child.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.378 EIF3B Zornitza Stark gene: EIF3B was added
gene: EIF3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF3B were set to 41033306
Phenotypes for gene: EIF3B were set to Syndromic disease (MONDO:0002254), EIF3B-related
Review for gene: EIF3B was set to GREEN
Added comment: Fourteen individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioural abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.376 EIF3A Zornitza Stark gene: EIF3A was added
gene: EIF3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: EIF3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EIF3A were set to 41033306
Phenotypes for gene: EIF3A were set to Syndromic disease (MONDO:0002254), EIF3A-related
Added comment: Four individuals reported with mono-allelic variants. The clinical phenotype varied but predominantly included cardiac defects, craniofacial dysmorphisms, mild developmental delays, and behavioral abnormalities. Zebrafish model recapitulated phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.373 MDGA2 Zornitza Stark gene: MDGA2 was added
gene: MDGA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MDGA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MDGA2 were set to https://doi.org/10.1101/2025.08.28.25330873; 40168357; 27608760
Phenotypes for gene: MDGA2 were set to MDGA2-related neurodevelopmental disorder MONDO:0700092
Review for gene: MDGA2 was set to GREEN
Added comment: Affected individuals present with a broad neurodevelopmental impairment-like phenotype.

Pre-print - https://doi.org/10.1101/2025.08.28.25330873
Individuals with developmental and epileptic encephalopathy (DEE)
8 individuals from 6 consanguineous families exhibiting infantile hypotonia, severe neurodevelopmental delay, intractable seizures, progressive brain atrophy, and consistent dysmorphic features.
7 different biallelic LoF variants were identified
p.Tyr913Ter, p.Arg404Ter, p.Leu920Ter, c.421-1G>A, p.Lys391SerfsTer7 and c.421-96_595+99del - all variants are rare or absent in gnomAD v4.1
In vitro functional studies of three nonsense variants in mammalian expression systems and hippocampal cultured neurons that resulted in impaired MDGA2 membrane trafficking are supportive of a loss-of-function mechanism.

PMID: 40168357, 27608760
A knockout mouse model showed that MGAD2-deficient mice presented with autism-like behaviours (social deficits, repetitive behaviour, and cognitive impairment).
The mice also showed abnormalities in excitatory synapses.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.371 DBX1 Zornitza Stark gene: DBX1 was added
gene: DBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DBX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DBX1 were set to 40995053
Phenotypes for gene: DBX1 were set to central hypoventilation syndrome, congenital MONDO:0800031
Review for gene: DBX1 was set to RED
Added comment: Single individual reported with congenital central hypoventilation syndrome (atypical CCHS) with central hypotonia, global developmental delay, seizures, autoaggressive behaviour. Consanguineous parents, hmz frameshift variant c.340_341delGC, absent from gnomAD.
Mouse Dbx1 knockout is lethal indicating essential role in respiration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.369 NFXL1 Zornitza Stark gene: NFXL1 was added
gene: NFXL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NFXL1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NFXL1 were set to 40430072; 41024252
Phenotypes for gene: NFXL1 were set to Syndromic disease (MONDO:0002254), NFXL1-related
Review for gene: NFXL1 was set to AMBER
Added comment: PMID: 40430072 2 siblings with psychosis and schizophrenia, homozygous for Cys441Tyr. Some modelling suggested a deleterious affect but no functional studies performed.

PMID: 41024252 8 patients from 7 families with joint hyperlaxity, with or without short stature and renal disease. 6 families were homozygous for p.(Cys539Trpfs*64) while the other two were homozygous for p.(Lys681*). Paper described both as founder variants but they are rare/absent in gnomad.

Joint hyperlaxity (7), chronic kidney disease/FSGS (2) small echogenic kidneys (3), acute kidney injury (1), dysmorphic features (6), short stature (6), speech delay (3).

One patient also had epilepsy, developmental delay and spasticity however c.728+1G>A in WDR45 explained this part of her phenotype. Other patients also had more severe outlying symptoms with no other explanation mentioned: 1 with developmental delay, hearing loss, brain malformations, skeletal abnormalities, and another a 3 year old who passed away following a complex medical course including blue sclera, proximal tibial fracture, severe respiratory distress due to a chest infection, and acute kidney injury.

Amber given the variable phenotype findings of the reported patients and only 2 homozygous variants identified so far.

Extent of associated DD/ID currently unclear but adding on this panel as it is often ordered in children with multi-system features suggestive of an underlying syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.366 CDK9 Zornitza Stark gene: CDK9 was added
gene: CDK9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDK9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDK9 were set to 33640901; 30237576; 26633546
Phenotypes for gene: CDK9 were set to multiple congenital anomalies/dysmorphic syndrome-variable intellectual disability syndrome MONDO:0015160; CHARGE-like syndrome with retinal dystrophy
Review for gene: CDK9 was set to AMBER
Added comment: Two independent reports:
1) A boy with a phenotype resembling CHARGE syndrome (multiple anomalies involving the eyes, ears, cleft lip, and palate, and intellectual disability) with retinal dystrophy (p.A288T/p.R303C),
2) 4 consanguineous families homozygous for p.R225C, including a set of cousins.
CDK9 variants demonstrated decreased kinase activity. One of the studies suggested the extent the kinase activity is reduced may account for the absence/presence of the CHARGE-like phenotype with retinal dystrophy

One additional family with retinal dystrophy only.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.365 AGTPBP1 chirag patel Phenotypes for gene: AGTPBP1 were changed from Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy; Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 to Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650
Publications for gene AGTPBP1 were changed from 30420557, 28600779, 30976113, 38153683, 28325758 to 30420557, 28600779, 30976113, 38153683, 28325758
Intellectual disability syndromic and non-syndromic v1.363 ALS2 chirag patel Source Genetic Health Queensland was removed from ALS2.
Source ClinGen was added to ALS2.
Phenotypes for gene: ALS2 were changed from Spastic paralysis, infantile onset ascending, MIM#607225 to ALS2-related motor neuron disease, MONDO:0100227
Intellectual disability syndromic and non-syndromic v1.357 DDOST Bryony Thompson Publications for gene: DDOST were set to 22305527
Intellectual disability syndromic and non-syndromic v1.352 HYPK Zornitza Stark Publications for gene: HYPK were set to Clinical Genetics Early View
Intellectual disability syndromic and non-syndromic v1.350 BCAT1 Lucy Spencer gene: BCAT1 was added
gene: BCAT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BCAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BCAT1 were set to 41029903
Phenotypes for gene: BCAT1 were set to Neurodevelopmental disorder (MONDO:0700092), BCAT1-related
Review for gene: BCAT1 was set to RED
Added comment: PMID: 41029903 One patient with a suspected neurometabolic disorder; congenital blindness and suspected Leber Congenital Amaurosis, microcephaly, failure to thrive, profound global developmental delay and extensive delayed myelination on MRI. AT 10 he was non-verbal and non-ambulatory with regression of motor skills and -3SD for height and weight. Compound heterozygous for Phe264Leu (539 hets but no homs in gnomad v4) and Glu348Lys (over 8000 hets and 24 homs in gnomad v4).

in compound heterozygous iPSCs a severe 75% reduction in BCAT1 protein levels was seen, but mRNA levels were normal suggesting the variants affect protein stability or increased degradation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 RNU6ATAC Lucy Spencer gene: RNU6ATAC was added
gene: RNU6ATAC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU6ATAC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNU6ATAC were set to 40975062
Phenotypes for gene: RNU6ATAC were set to Neurodevelopmental disorder (MONDO:0700092), RNU6ATAC-related
Review for gene: RNU6ATAC was set to RED
Added comment: PMID: 40975062 1 patient compound heterozygous for n.36T>G and n.28C>T. Has short stature, microcephaly, hypotonia, neurodevelopmental delay, ID, seizures, ataxia, ventriculomegaly, syndactyly, nystagmus and oculomotor apraxia. Identified in a cohort of individuals with an excess of significant intron retention outliers in minor intron containing genes which are usually removed by the minor spliceosome of which RNU6ATAC is a part (as is RNU4ATAC). Proband had no candidate variants in RNU4ATAC or RNU12. Both RNU6ATAC variants are in a highly conserved 39bp region, and affect nucleotides predicted to be important for binding to U4ATAC.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 PTBP1 Lucy Spencer gene: PTBP1 was added
gene: PTBP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTBP1 were set to 40965981
Phenotypes for gene: PTBP1 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP1-related
Review for gene: PTBP1 was set to GREEN
Added comment: PMID: 40965981 27 individuals with abnormal prenatal ultrasound in thirteen (48%) including short femora, IUGR, hydramnios, increased nuchal translucency, asymmetry of heart cavities, and bilateral hydronephrosis. Skeletal anomalies were seen in 24 (89%), short stature/limbs in 63%, facial dysmorphism 25 (93%), developmental delay in 78%, behavioral problems in 30% and ID in 26% generally mild/moderate, 43% had variable brain MRI abnormalities. additional features included skin, nail, and hair anomalies (52%), dental anomalies (37%), ophthalmological findings (44%), and cardiovascular defects (22%).

Variants a mix of missense and startloss, and were confirmed de novo in 23/17 cases.

Various functional studies showed reduced nuclear localization and enhanced cytoplasmic retention, with start-loss variants also leading to increased protein stability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.350 PTBP2 Lucy Spencer gene: PTBP2 was added
gene: PTBP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTBP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTBP2 were set to 40965981
Phenotypes for gene: PTBP2 were set to Neurodevelopmental disorder (MONDO:0700092), PTBP2-related
Review for gene: PTBP2 was set to AMBER
Added comment: PMID: 40965981 2 males with developmental delay, ID, autistic features. 1 had some dysmorphic features and tonic-clonic seizures. both probands had a de novo variant in PTBP2 NM_021190.4:c.2T>C (p.Met1?) and NM_021190.4:c.41G>C (p.Arg14Thr), absent from gnomad. Transfection of the variants in transfection in NIH-3T3 cells showed the missense had cytoplasmic retention and colocalization with processing bodies, and that there were 2 alternative downstream start sites Met32 and Met35 that may be used instead.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.346 SF1 Sarah Milton gene: SF1 was added
gene: SF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SF1 were set to PMID: 40987292
Phenotypes for gene: SF1 were set to Neurodevelopmental disorder, MONDO:0700092, SF1-related
Review for gene: SF1 was set to GREEN
Added comment: SF1 is involved in the first step of spliceosome complex assembly by recognizing the intron branchpoint consensus sequence at the 3′ splice site of the pre-mRNA. It is also involved in regulating alternative splicing

PMID: 40987292 describes 15 affected individuals with a neurodevelopmental disorder with monoallelic variants in SF1. Affected individuals had developmental delay, mild to moderate ID, behavioural disorders, seizures (3/15), brachydactyly (5/15), nail hypoplasia (5/15).
Variant types included missense and high impact LOF (nonsense and frameshift).

Most variants were appropriately rare in gnomAD v4 however one reported variant had 9 hets.
pLI for SF1 is 1 with overall few LOF variants in gene.

Supportive functional studies reported in publication. SF1 deficient neural progenitor cells showed altered gene expression in genes involved in neuronal differentiation/synaptic transmission and axonal guidance.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.342 SYNE2 chirag patel gene: SYNE2 was added
gene: SYNE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SYNE2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SYNE2 were set to 34573277
Phenotypes for gene: SYNE2 were set to Neurodevelopmental disorder, MONDO:0700092, SYNE2 related
Review for gene: SYNE2 was set to RED
Added comment: 1 individual with autism spectrum disorder, developmental delay and intellectual disability (from a cohort of 410 trios with neurodevelopmental disorders). Trio WES found compound heterozygous variants in SYNE2 [c.2483T>G; p.(Val828Gly) and c.2362G>A; p.(Glu788Lys)]. Both variants are rare, predicted to be highly damaging using in silico tools, and located in the nesprin-2 giant spectrin repeat domain. Both parents and the healthy brother were heterozygous. Expression and functional testing in patient lymphoblastoid cell lines showed a significant reduction of nesprin-2 giant protein levels, however SYNE2 transcription and the nuclear envelope localisation of the mutant proteins was unaffected as compared to parental control cells.

SYNE 1-4 genes encode for nesprins (nuclear envelope spectrin repeat proteins) which play fundamental roles in nuclear architecture and positioning, directed cell migration, cellular signalling, ciliogenesis, and mechanobiology.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 INTS6 Sarah Milton changed review comment from: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature; to: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 INTS6 Sarah Milton gene: INTS6 was added
gene: INTS6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: INTS6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: INTS6 were set to PMID: 40966122
Phenotypes for gene: INTS6 were set to Neurodevelopmental disorder, MONDO:0700092, INTS6-related
Review for gene: INTS6 was set to GREEN
Added comment: INTS6 encodes a member of the integrator complex which plays a role in RNA polymerase II transcription termination and small nuclear RNA processing.

PMID: 40966122 describes 24 affected individuals from 23 families with a variable neurodevelopmental disorder. Variant types included monoallelic missense, nonsense, frameshift and splice site.
Phenotypes included autism, variable language and motor delay, variable ID/developmental delay, sleep disturbances and epilepsy in a small subset.

21 variants were confirmed to be de novo.
All variants either absent in gnomad v4 or had 1 heterozygote only.
pLI for INTS6 is 1 and few overall LOF variants in gnomAD v4 in gene.

Supportive functional studies including biallelic knockout mice demonstrating abnormal brain morphology. Heterozygous knockout mice assessed to have abnormal behaviour and reduced learning efficiency and memory retention. Some variant specific studies performed consistent with loss of function mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.340 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to 40210679; 40442284
Intellectual disability syndromic and non-syndromic v1.338 CRNKL1 Zornitza Stark Publications for gene: CRNKL1 were set to
Intellectual disability syndromic and non-syndromic v1.335 MRPS36 Krithika Murali gene: MRPS36 was added
gene: MRPS36 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MRPS36 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MRPS36 were set to PMID: 41018056; 38685873
Phenotypes for gene: MRPS36 were set to Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related
Review for gene: MRPS36 was set to AMBER
Added comment: 3 individuals from 2 unrelated families reported with biallelic MRPS36 variants (current HGNC is KGD4). Gene encodes E4 subunit of OGDHC complex. Individuals present with a phenotype consistent with Leigh syndrome including seizures, hypotonia, dystonia, brain imaging anomalies, persistent lactic acidosis. GDD, ID and cardiomyopathy also reported.

Patient-derived fibroblast studies demonstrates reduced OGDHC enzymatic activity, however, this functional evidence is not gene or variant-specific.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.333 GTF2I Zornitza Stark Publications for gene: GTF2I were set to
Intellectual disability syndromic and non-syndromic v1.329 BBOX1 Zornitza Stark gene: BBOX1 was added
gene: BBOX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BBOX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BBOX1 were set to 41022783
Phenotypes for gene: BBOX1 were set to Carnitine deficiency, MONDO:0017716, BBOX1-related
Review for gene: BBOX1 was set to AMBER
Added comment: Three individuals from two unrelated families reported, presenting with myopathy, neurodevelopmental delay, and later-onset psychiatric manifestations. C. elegans knockout and patient-variant models show embryonic lethality rescued by L‑carnitine supplementation
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.327 INPP4A Zornitza Stark Publications for gene: INPP4A were set to 31978615; 31938306; 25338135; 20011524
Intellectual disability syndromic and non-syndromic v1.325 B9D1 Zornitza Stark Publications for gene: B9D1 were set to 24886560; 21493627
Intellectual disability syndromic and non-syndromic v1.313 AP2S1 Zornitza Stark Publications for gene: AP2S1 were set to 33057194
Intellectual disability syndromic and non-syndromic v1.307 GNAI2 Zornitza Stark Publications for gene: GNAI2 were set to 31036916
Intellectual disability syndromic and non-syndromic v1.305 TRPC5 Zornitza Stark Publications for gene: TRPC5 were set to 36323681; 24817631; 23033978; 33504798; 28191890
Intellectual disability syndromic and non-syndromic v1.302 TMEM167A chirag patel gene: TMEM167A was added
gene: TMEM167A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM167A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM167A were set to PMID: 40924476
Phenotypes for gene: TMEM167A were set to Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related
Review for gene: TMEM167A was set to GREEN
Added comment: 6 individuals from 6 unrelated families (4/6 consanguineous) presenting with neonatal diabetes onset <4mths (6/6), severe microcephaly (6/6), epilepsy (5/6), and developmental delay (4/6).

Whole genome sequencing identified biallelic variants in TMEM167A gene. Variants were homozygous in 5/6 families, and variant types were missense (4), frameshift (1), and splice (1), and all variants were rare/unreported in gnomAD. Segregation studies not reported in paper.

Microcephaly, epilepsy and diabetes syndrome has 2 known associated genes (IER3IP1 and YIPF5) which encode proteins involved in endoplasmic reticulum to Golgi trafficking. TMEM167A is highly expressed in developing and adult human pancreas and brain. Both TMEM167A depletion in EndoC-βH1 cells and knock‑in of p.Val59Glu variant in iPSC-derived β cells sensitized β cells to ER stress. The p.Val59Glu variant impaired proinsulin trafficking to the Golgi and induced iPSC-β cell dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.301 RAB11A Zornitza Stark Publications for gene: RAB11A were set to 29100083
Intellectual disability syndromic and non-syndromic v1.296 ZNF865 Sangavi Sivagnanasundram gene: ZNF865 was added
gene: ZNF865 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF865 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF865 were set to 40936200
Phenotypes for gene: ZNF865 were set to ZNF865‑associated neurodevelopmental disorder MONDO:0700092
Review for gene: ZNF865 was set to AMBER
Added comment: PMID: 40936200
18 patients reported with DD, hypotonia and six individuals were reported with some dysmorphic features (frontal bossing, a broad nasal bridge, hypertelorism, and low-set ears)
All 18 individuals were reported with de novo truncating variants in ZNF865. All variants were rare/absent in gnomAD v4.1.

The mechanism of disease for this gene is unknown. No pathogenic SNVs have been reported in ClinVar at this stage however there are reports of VUS’s and pathogenic CNVs.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.296 SNAPIN Lucy Spencer gene: SNAPIN was added
gene: SNAPIN was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNAPIN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNAPIN were set to 40930097; 26539891
Phenotypes for gene: SNAPIN were set to Neurodevelopmental disorder (MONDO:0700092), SNAPIN-related
Review for gene: SNAPIN was set to GREEN
Added comment: PMID: 40930097 6 patients from 5 families with neuroanatomical, craniofacial, and skeletal anomalies on prenatal ultrasound/MRI, all homozygous for variants in SNAPIN. 2 stopgain, 1 canonical splice, 5 missense. common phenotypes: ventriculomegaly 5/6, cerebellar hypoplasia/atrophy 5/6, clubfeet 4/6, corpus callosum agenesis 4/6, flexion contractures 4/6, microcephaly 3/6, micrognathia/retrognathia 4/6. The patients with the nonsense or splice variants did not survive the perinatal period, while those with missense survived into early childhood.

This paper also mentions a 7th patient reported in PMID: 26539891, who has ID, microcephaly, cortical atrophy, bulbar and cerebellar hypoplasia, sensorineural polyneuropathy, and hypotonia. They are homozygous for a missense variant Asn55Tyr. Of note, the other paper report this as Arg55Trp and one of their patients also has this variant, based off the transcript information provided in both papers Arg55Trp is correct.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.295 SKOR2 Zornitza Stark gene: SKOR2 was added
gene: SKOR2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SKOR2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SKOR2 were set to 40890458; 29997391; 21937600
Phenotypes for gene: SKOR2 were set to complex neurodevelopmental disorder with motor features MONDO:0100516
Review for gene: SKOR2 was set to GREEN
Added comment: 3 unrelated families with consistent phenotypes and a supportive mouse model:
PMID: 40890458 - 2 unrelated consanguineous Iranian families with a combination of learning disability, facial dysmorphisms, and motor and speech impairments with homozygous variants (c.374 G>C: p.Arg125Pro & c.1271_1274del: p.K424Rfs*71). The homozygous missense variant segregated with disease in 8 individuals (no unaffected individuals tested were homozygous).

PMID: 29997391 - proband with neurodevelopmental delay, hypotonia, ataxia, cerebellar dysplasia from a consanguineous Turkish family with a homozygous null variant (NM_001278063.1:c.2750C>G; p.Ser917*). None of the 4 healthy siblings were homozygous for the variant.

PMID: 21937600 - Skor2 -/- mouse model had defective Purkinje cell development, a severe reduction of granule cell proliferation and a malformed cerebellum. Mouse had unstable gait.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.293 GBX1 Zornitza Stark gene: GBX1 was added
gene: GBX1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GBX1 were set to 40519143
Phenotypes for gene: GBX1 were set to Neurodevelopmental disorder, MONDO:0700092, GBX1-related
Review for gene: GBX1 was set to RED
Added comment: Single individual with de novo LoF variant with DD and focal epilepsy. Zebrafish model had abnormal morphology of the interocular area. Furthermore, the zebrafish larvae exhibited an increased susceptibility to neurophysiological abnormalities associated with epileptiform activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.291 MTERF3 Zornitza Stark gene: MTERF3 was added
gene: MTERF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MTERF3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MTERF3 were set to 40543543
Phenotypes for gene: MTERF3 were set to Mitochondrial disease (MONDO:0044970), MTERF3-related
Review for gene: MTERF3 was set to AMBER
Added comment: Two individuals reported from unrelated families, presenting with DD/ID, intermittent hypoglycaemia and metabolic acidosis. Genetic testing identified compound heterozygous variants c.635dup p.(Asn212Lysfs*7) and c.1055C > T p.(Pro352Leu) in Patient 1, and a homozygous variant c.943A > Gp.(Met315Val) in Patient 2. Patient's fibroblasts and MTERF3 knockdown cells showed impaired mitochondrial respiration and reduced levels of OXPHOS complexes I, III, and IV. Transcription of MT-ND5, ND6, COII, and COIII was reduced, while other mitochondrial genes were upregulated. Wild-type MTERF3 expression restored these defects, but the variant Pro352Leu from patient failed to rescue mitochondrial dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.289 ATP5A1 Zornitza Stark gene: ATP5A1 was added
gene: ATP5A1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ATP5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP5A1 were set to 34483339; 34954817; 40859057
Phenotypes for gene: ATP5A1 were set to Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD
Review for gene: ATP5A1 was set to GREEN
Added comment: At least 12 individuals reported with de novo missense variants in this gene, several recurrent.

PMIDs: 34483339, 34954817: 6xde novo patients 4 with Arg207His, 1 Arg182Gln 1 Ser346Phe. All Arg207His patients were neonates with failure to thrive, hyperammonemia, lactic acidosis, and respiratory defects in fibroblasts, major symptoms remitted with treatment by late infancy, and at age 14mo to 3yrs growth and development were normal. Other 2 patients are 17yo with ID, ataxia, spastic paraparesis and dystonia, and a 12yo with psychomotor retardation, spastic tetraparesis, generalised dystonia, absent speech, swallowing problems, and increased blood lactate concentrations.

And an internal VCGS patient Arg182Gln (variant also seen in a different patient above) with ID, muscular hypotonia, clinodactyly of the 5th finger, and dysmorphic facial features, proteomics showed decreased ATP5F1A and a complex V deficiency. There is also an alternative change at this residue in the DECIPHER cohort Arg182Pro de novo in an individual with a neurodevelopmental disorder.

PMID: 40672495: 6x de novo individuals - 4 variants p.Arg182Gln, p.Ser346Phe, p.Pro331Leu, and p.Leu109Ser - with complex but overlapping neurological phenotypes including developmental delays, intellectual disability, pyramidal tract dysfunction, and dystonia.

In vivo functional studies in C. elegans were performed for three of the variants, showing growth defects and disruption of mitochondrial function (measured by mitochondrial stress). Authors suggest a dominant negative mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.285 COMMD9 Krithika Murali gene: COMMD9 was added
gene: COMMD9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COMMD9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COMMD9 were set to PMID: 40601774
Phenotypes for gene: COMMD9 were set to Neurodevelopmental disorder, MONDO:0700092, COMMD9-related
Review for gene: COMMD9 was set to RED
Added comment: PMID: 40601774 report a cohort ascertained through GeneMatcher with phenotypic features overlapping with Ritscher-Schinzel syndrome.

Homozygous fs variant in COMMD9 [NM_014186.3:c.208_209del, p.Leu70Glyfs*5] identified in a 4 yo M with dev delay, dysmorphism, skeletal changes including brachydactyly and radioulnar dysostosis, hypotonia, MRI-B anomalies - dysgyria, dilated
lateral ventricles, deep white matter periventricular demyelination, thin corpus callosum, cerebellar vermis hypoplasia and malrotation.

Consanguineous parents confirmed to be heterozygous carriers. No information provided regarding segregation of these variants in unaffected siblings.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.283 TBCB Krithika Murali gene: TBCB was added
gene: TBCB was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TBCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBCB were set to PMID: 40856104
Phenotypes for gene: TBCB were set to Neurodevelopmental disorder, MONDO:0700092, TBCB-related
Review for gene: TBCB was set to AMBER
Added comment: PMID: 40856104 Bratman, S. et al 2025 (Genetics in Medicine) report 10 individuals from 8 unrelated families of Ashkenazi Jewish descent with a homozygous missense founder variant in TBCB (c.589T>A, p.Tyr197Asn) identified through exome sequencing. This variant is present at 1.3% carrier frequency in the AJ population in gnomAD v4 with 0 homozygotes. Variant is reasonably well-conserved, REVEL 0.9 and in the Cap-Gly domain. No other homozygous missense variants in this region in gnomAD v4 and homozygous variants rare, overall.

Phenotypic features included:
- Motor/speech delays in infancy (almost all)
- ASD (8/10)
- ADHD (5/10)
- Mild ID - formal cognitive evaluation (5/8).
- Spastic paraparesis in late childhood (9-12y) with slowly progressive gait difficulties and lower limb spasticity. Urinary abnormalities were not reported.
- Brain MRI was performed on five individuals - three displayed a thin corpus callosum,
and two had decreased white matter.

No prenatal features reported.

Supportive Drosophilia models.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.281 COMMD4 Lucy Spencer gene: COMMD4 was added
gene: COMMD4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COMMD4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COMMD4 were set to 40601774
Phenotypes for gene: COMMD4 were set to Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related
Review for gene: COMMD4 was set to RED
Added comment: PMID: 40601774 3 siblings with Ritscher-Schinzel syndrome and a homozygous missense in COMMD4 NM_017828.5:c.122T>G; p.Leu41Arg. All three individuals died in infancy and the authors suggest there could be a dual diagnosis to explain the severity.

This variant was expressed in a H4 neuroglioma cell line with COMMD4 knocked out, and showed an enhanced degradative turnover compared to WT when treated with cyclohexamide. Western blot in HEK293T cells showed a decrease in the steady-state abundance of COMMD4.

Knock out of COMMD4 protein leads to destabilization of the Commander complex.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.280 TMEM184B Lucy Spencer gene: TMEM184B was added
gene: TMEM184B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMEM184B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TMEM184B were set to 39006436
Phenotypes for gene: TMEM184B were set to Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related
Review for gene: TMEM184B was set to GREEN
Added comment: A cohort of 6 patients with developmental delay (5/6), corpus callosum hypoplasia (4/6), microcephaly (1/6), seizures (3/6), and ID (2/6). 2 patients also had gastrointestinal motility disruption. All 6 have de novo variants in TMEM184B, 5 missense 1 canonical splice. 1 of the missense variants has 35 hets in gnomad but the rest are absent. The authors also say they are aware of a 7th patient with overlapping features by personal communication.

A knockout zebrafish model showed a dose dependent reduction in head size and body length in larvae. Knock-in of 2 of the missense variants also showed head size and body length reduction, but the other missense did not. However the other three missense failed to rescue the phenotype of a knockout zebrafish while WT and a negative control did. The authors suggest the first 2 variants are dominant negative while the latter three and loss of function.

The splice variant was shown to cause exon 7 skipping which is out of frame.

Transfection of the missense and splice variants in HEK293T cells showed that all but 1 had reduced TMEM184B protein levels.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.280 POLR3D Zornitza Stark gene: POLR3D was added
gene: POLR3D was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: POLR3D was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3D were set to 37915380
Phenotypes for gene: POLR3D were set to Leukodystrophy, MONDO:0019046, POLR3D-related
Review for gene: POLR3D was set to RED
Added comment: PMID 37915380: single individual with compound het variants in POLR3D and childhood onset leukodystrophy manifesting as DD/ID.

Additional neurological features included cerebellar signs (e.g., dysarthria, ataxia, and intention tremor) and dysphagia, while non-neurological features included hypodontia, hypogonadotropic hypogonadism, and dysmorphic facial features. Her MRI was notable for diffuse hypomyelination with myelin preservation of early myelinating structures, characteristic of POLR3-related leukodystrophy. Exome sequencing revealed the biallelic variants in POLR3D, a missense variant (c.541C > T, p.P181S) and an intronic splice site variant (c.656-6G > A, p.?). Functional studies of the patient's fibroblasts demonstrated significantly decreased RNA-level expression of POLR3D, along with reduced expression of other Pol III subunit genes. Notably, Pol III transcription was also shown to be aberrant, with a significant decrease in 7SK RNA and several distinct tRNA genes analyzed. Affinity purification coupled to mass spectrometry of the POLR3D p.P181S variant showed normal assembly of Pol III subunits yet altered interaction of Pol III with the PAQosome chaperone complex, indicating the missense variant is likely to alter complex maturation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.278 HS6ST2 Bryony Thompson gene: HS6ST2 was added
gene: HS6ST2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HS6ST2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: HS6ST2 were set to 40686562; 30471091; 36993824; 38015989
Phenotypes for gene: HS6ST2 were set to X-linked syndromic intellectual disability MONDO:0020119
Review for gene: HS6ST2 was set to GREEN
Added comment: 4 males with a neurodevelopmental phenotype from 3 families (1 set monozygotic twins) hemizygous for rare missense variants and a supporting mouse model.
PMID: 40686562 - a Chinese male child with a syndromic neurodevelopmental phenotype hemizygous c.764C>A (p.Pro255Glu) and in vitro assays showing the variant alters function. Parents were unaffected and variant was maternally inherited.

PMID: 38015989 - knockout mouse model impairs dendritic spines of hippocampal neurons, and affects memory.

PMID: 36993824 - an Iranian male child with a syndromic neurodevelopmental phenotype hemizygouc.979C>T p.Pro327Ser.

PMID: 30471091 - Italian monozygotic male twins with a syndromic neurodevelopmental phenotype hemizygous c.916G>C (p.G306R - inherited from unaffected mother) and functional assay showing altered enzyme activity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.277 FSCN1 Zornitza Stark gene: FSCN1 was added
gene: FSCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FSCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FSCN1 were set to 40874942
Phenotypes for gene: FSCN1 were set to Neurodevelopmental disorder, MONDO:0700092, FSCN1-related
Review for gene: FSCN1 was set to RED
Added comment: Two individuals reported from an Iranian cohort with same missense variant, c.665C>A; p.Ala222Asp plus other circumstantial data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.276 TTC1 Zornitza Stark gene: TTC1 was added
gene: TTC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TTC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTC1 were set to 40879651
Phenotypes for gene: TTC1 were set to Pontocerebellar hypoplasia, MONDO:0020135, TTC1-related
Review for gene: TTC1 was set to RED
Added comment: Four individuals from two families reported with the same homozygous missense variant, NM_003314.3: c.784 T > G, p.Phe262Val. No other supporting data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.274 MAEA Zornitza Stark gene: MAEA was added
gene: MAEA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MAEA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAEA were set to 40880485
Phenotypes for gene: MAEA were set to Neurodevelopmental disorder, MONDO:0700092, MAEA-related
Review for gene: MAEA was set to AMBER
Added comment: At least 4 individuals with de novo missense variants in this gene reported as part of large DDD papers. PMID 40880485 presents extensive data showing that loss of MAEA impairs RAD51 recruitment at stalled replication forks, leading to increased sensitivity to replication stress-inducing agents and excessive degradation of nascent DNA strands.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.273 CSMD2 Krithika Murali changed review comment from: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature; to: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4. In addition, no information about unaffected/affected siblings and segregation testing has been provided

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.273 CDK6 Zornitza Stark Publications for gene: CDK6 were set to 23918663
Intellectual disability syndromic and non-syndromic v1.272 CSMD2 Krithika Murali gene: CSMD2 was added
gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688
Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related
Review for gene: CSMD2 was set to RED
Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.272 CSMD2 Krithika Murali gene: CSMD2 was added
gene: CSMD2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CSMD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CSMD2 were set to PMID: 40632521; 31068362; 38649688
Phenotypes for gene: CSMD2 were set to Focal epilepsy - MONDO:0005384, CSMD2-related
Review for gene: CSMD2 was set to RED
Added comment: PMID: 40632521 Li et al 2025 (Epilepsia) reported 6 unrelated individuals of Han Chinese descent with biallelic CSMD2 missense variants (NM_052896) and focal epilepsy. 5 individuals were compound heterozygous and one was homozygous. These individuals were ascertained through trio WES analysis of 420 unrelated individuals with focal epilepsy enrolled in the China Epilepsy Gene 1.0 project.

Phenotypic features
- age of onset 1.5-10 years old
- complex partial seizures (4), secondary GTCS (2)
- Normal MRI-B (3), focal cortical dysplasia (1)
- mild ID (1).

The variants were noted to be rare in EXAC-East Asian cohort, most located in CUB/Sushi domains. The gene has some evidence of missense and LoF constraint in gnomAD v4. There was also enrichment of biallelic CSMD2 variants in affected individuals versus a control cohort of unaffected parents (5/420 compound hets affected individuals, 3/1942 compound hets in unaffected parents). Previous mouse Csmd2 knockdown models demonstrated reduction in dendritic spine density and complexity. LoF is the postulated disease mechanism.

Closely related gene paralog CSMD1 has a definitive association with autosomal recessive complex neurodevelopmental disorder with a more severe phenotype. Different expression profiles during developmental stages between CSMD1 and CSMD2 postulated for the comparatively milder phenotype associated with the latter.

CSMD2 has 71 exons and 3631 amino acids. The true prevalence of biallelic missense variants in healthy individuals across diverse ancestries has not been ascertained. Review of the missense variants in this study highlighted issues in a number of them including poor-moderate conservation, conflicting or benign in silicos including REVEL, non-coding in an alternative transcript, Case 4 p.Val1547Ile homozygote – this variant has been noted in an East Asian male homozygote aged between 45-50 in gnomAD v4.

Given prevalence of focal epilepsy, stronger case-control evidence from diverse ancestries and variant-specific functional evidence is required to support this proposed gene-disease association.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.267 WDR18 Krithika Murali gene: WDR18 was added
gene: WDR18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WDR18 were set to PMID: 40677927
Phenotypes for gene: WDR18 were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: WDR18 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.266 MIS18BP1 Krithika Murali gene: MIS18BP1 was added
gene: MIS18BP1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MIS18BP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MIS18BP1 were set to PMID: 40677927
Phenotypes for gene: MIS18BP1 were set to Cornelia de Lange syndrome (MONDO:0016033)
Review for gene: MIS18BP1 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.265 HYPK Zornitza Stark gene: HYPK was added
gene: HYPK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HYPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HYPK were set to Clinical Genetics Early View
Phenotypes for gene: HYPK were set to Neurodevelopmental disorder, MONDO:0700092, HYPK-related
Review for gene: HYPK was set to RED
Added comment: Single case report - Patel, R. et al 2025 Clinical Genetics Early View

Male proband with developmental delay, autism and facial dysmorphism with a de novo missense HYPK variant (p. R70I). Variant-specific biochemical analyses demonstrates enhanced inhibitory activity of HYPK on NatA-mediated N-terminal protein acetylation.

GestaltMatcher analysis indicates that the proband's facial phenotype closely resembles Ogden syndrome (NAA10) and some resemblance to NAA15-NDS - both associated genes are also involved in the N-terminal acetylation pathway.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.264 DDX39A Zornitza Stark gene: DDX39A was added
gene: DDX39A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DDX39A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX39A were set to 40726340
Phenotypes for gene: DDX39A were set to Neurodevelopmental disorder, MONDO:0700092, DDX39A-related
Review for gene: DDX39A was set to RED
Added comment: PMID: 40726340 Ahmed et al 2025 (Clinical Genetics) report a 7 month old F with GDD, seizures, microcephaly, hypotonia, corpus callosum thinning and homozygous missense variant (p.Lys137Gln) in DDX39A on trio WES with both non-consanguineous parents confirmed to be heterozygous carriers. DDX39A is involved in mRNA splicing and export. Patient-derived fibroblast studies showed that mutant protein resulted in aberrant nuclear clumping and failure to interact with the TREX complex.

Of note, closely-related paralogue DDX39B is also a component of the TREX complex and has a definitive monoallelic association with neurodevelopmental disorder.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.263 ARID3A Zornitza Stark gene: ARID3A was added
gene: ARID3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARID3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARID3A were set to 40677927
Phenotypes for gene: ARID3A were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: ARID3A was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.262 PIK3C3 Zornitza Stark gene: PIK3C3 was added
gene: PIK3C3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PIK3C3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PIK3C3 were set to 40677927
Phenotypes for gene: PIK3C3 were set to Cornelia de Lange syndrome - MONDO:0016033
Review for gene: PIK3C3 was set to RED
Added comment: PMID: 40677927 Ansari et al 2025 (Hum Mut) - performed short-read WGS on 108 individuals with suspected CdLS with no causative variant identified on previous genetic testing.

In addition to variants in genes with known gene-disease associations, 5 de novo variants absent in gnomAD in 5 novel genes also identified in 5 unrelated individuals:

- ARID3A (missense variant, REVEL 0.72)
- PIK3C3 (missense, mechanistically not thought to be an obvious candidate gene for CdLS)
- MCM7 (LoF variant, gene linked with cohesin complex)
- MIS18BP1 (LoF variant, this individual also had a de novo intragenic deletion in PUF60)
- WDR18 (missense variant, weak in silico, REVEL 0.268)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.260 GLYAT Zornitza Stark gene: GLYAT was added
gene: GLYAT was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GLYAT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLYAT were set to 40747359
Phenotypes for gene: GLYAT were set to Neurodevelopmental disorder, MONDO:0700092, GLYAT-related
Review for gene: GLYAT was set to RED
Added comment: Single individual reported with homozygous LoF variant, p.Q108Ter. The individual was treated with pantothenic acid and a mitochondrial cocktail consisting of coenzyme Q10, vitamins B1, B2, B6, B12, C, folate, and carnitine, together with a low-protein diet, which led to the alleviation of edema and hypotonia and an improvement in her motor function and social interactions. Her serum glycine level was also normalized.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.258 C1orf109 Zornitza Stark gene: C1orf109 was added
gene: C1orf109 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: C1orf109 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: C1orf109 were set to 40760247
Phenotypes for gene: C1orf109 were set to Neurodevelopmental disorder, MONDO:0700092, C1orf109-related
Review for gene: C1orf109 was set to GREEN
Added comment: Cohort of 11 unrelated families, encompassing 18 individuals with bi-allelic variants in C1orf109, 17 liveborn. Affected individuals presented with moderate-to-severe or severe global developmental delay/intellectual disability (17 of 17) and never achieved developmental milestones. Microcephaly and seizures were other common features.

Reduced ribosome activity demonstrated during early brain development.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.256 ASAP2 Zornitza Stark gene: ASAP2 was added
gene: ASAP2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ASAP2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ASAP2 were set to 40770811; 28191890; 33057194; 35982160
Phenotypes for gene: ASAP2 were set to Neurodevelopmental disorder, MONDO:0700092, ASAP2-related
Review for gene: ASAP2 was set to AMBER
Added comment: One individual reported with compound het missense variants. Identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811. Another individual with biallelic variants identified in the DDD cohort. Several others found with de novo variants through retrospective literature review of large cohort studies reporting multiple gene candidates. Functional experiments using CRISPR-Cas9 knockout in NPCs and brain organoids demonstrated reduced NPC proliferation, supporting the essential role of ASAP2 in brain development. Rated AMBER as only two families with bi-allelic variants and minimal information on the cases with mono-allelic variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.254 RTF1 Zornitza Stark gene: RTF1 was added
gene: RTF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RTF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RTF1 were set to 40770811; 33057194; 35982160; 31038196
Phenotypes for gene: RTF1 were set to Neurodevelopmental disorder, MONDO:0700092, RTF1-related
Review for gene: RTF1 was set to GREEN
Added comment: Two individuals with de novo missense variants identified in a cohort of individuals presenting with ID/microcephaly, PMID 40770811, and further 8 identified through retrospective literature review of large cohort studies reporting multiple candidates. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 MED29 Sarah Milton gene: MED29 was added
gene: MED29 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: MED29 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MED29 were set to PMID: 40745490
Phenotypes for gene: MED29 were set to Pontocerebellar hypoplasia, MONDO:0020135, MED29-related
Review for gene: MED29 was set to AMBER
Added comment: MED29 encodes part of the mediator (MED) complex which has role in RNA polymerase II (Poll II) gene transcription.

PMID: 40745490 describes 2 siblings from one consanguineous family affected with pontocerebellar hypoplasia, profound GDD, severe microcephaly, cataracts and variable seizures.
Both shared the same homozygous missense variant with presumed LOF mechanism.

No homozygous LOF variants in gnomAD v4.

Extensive functional studies performed with morpholino knockdown of MED29 having marked reduction of GABAergic neurons and abnormal touch response.
Studies of hippocampal neurons from mice with knockdown MED29 showed impaired development.
Mouse embryos that had knockdown of MED29 during development demonstrated abnormal neuronal migration.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.253 CCDC93 Sarah Milton gene: CCDC93 was added
gene: CCDC93 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC93 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC93 were set to PMID: 40601774
Phenotypes for gene: CCDC93 were set to Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related
Review for gene: CCDC93 was set to AMBER
Added comment: CCDC93 encodes the coiled coil domain containing subunit of commander complex involved in recycling of integral membrane proteins.

PMID: 40601774 describes 1 affected individual with compound heterozygous variants in CCDC93 who presented with Ritscher Schinzel like phenotype. Features included hypoplasia of cerebellar hemispheres, hypoplasia of the brainstem and of the corpus callosum, distinctive facial features and multiple small renal cysts.
Variants were missense and nonsense.

No homozygous LOF variants in gnomAD v4.

Some supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 SCN3B Sarah Milton gene: SCN3B was added
gene: SCN3B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SCN3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCN3B were set to PMID: 40879121
Phenotypes for gene: SCN3B were set to Neurodevelopmental disorder, MONDO:0700092, SCN3B-related
Review for gene: SCN3B was set to AMBER
Added comment: SCN3B Encodes b3 auxiliary subunit of the sodium channel.

4 affected individuals from 2 consanguineous families reported in PMID: 40879121 with biallelic variants in this gene with neurodevelopmental phenotypes. Presentation included GDD, ID of variable severity, autism, seizures.
One variant was nonsense, one canonical splice site in the penultimate exon.

No homozygous LOF variants in gnomAD v4.

Some functional studies performed with loss of function of channel demonstrated for one variant.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 XPO1 Sangavi Sivagnanasundram gene: XPO1 was added
gene: XPO1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: XPO1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: XPO1 were set to 40819229
Phenotypes for gene: XPO1 were set to Neurodevelopmental disorder, XPO1-related, MONDO:0700092
Review for gene: XPO1 was set to GREEN
Added comment: Established gene-disease association
22 probands with de novo XPO1 variants presenting with phenotypes associated with NDD (DD, ID, motor delay, behavioral problems, facial dysmorphisms, microcephaly and organ anomalies) along with supportive Drosophila knockdown model reported.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.252 ZNF496 Zornitza Stark gene: ZNF496 was added
gene: ZNF496 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF496 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZNF496 were set to 40806714
Phenotypes for gene: ZNF496 were set to Neurodevelopmental disorder, MONDO:0700092, ZNF496-related
Review for gene: ZNF496 was set to RED
Added comment: Single individual with NDD and de novo LoF variant, no other supportive data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.251 TRIM74 Sangavi Sivagnanasundram gene: TRIM74 was added
gene: TRIM74 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRIM74 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRIM74 were set to 40735933
Phenotypes for gene: TRIM74 were set to Neurodevelopmental disorder, TRIM74-related, MONDO:0700092
Review for gene: TRIM74 was set to RED
Added comment: Only one reported case with DD.

PMID: 40735933
5yr M presenting from non consanguineous parents with global developmental delay, hypotonia, seizures, and diffuse cerebral atrophy with mega cisterna magna. Parents of the proband were found to be carriers of the variant.
Homozygous variant c.562C > T (p.Pro121Leu) - NFE AF 0.0188% - rare enough for AR

Supportive functional analysis on human fibroblast showed protein function disruption leading to protein aggregation, proteostasis collapse, and cell death.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.248 TMPRSS7 Zornitza Stark gene: TMPRSS7 was added
gene: TMPRSS7 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TMPRSS7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMPRSS7 were set to 40796295
Phenotypes for gene: TMPRSS7 were set to Neurodevelopmental disorder, TMPRSS7-related
Review for gene: TMPRSS7 was set to RED
Added comment: PMID 40796295: individual with compound het variants, p.R479H and p.S685Kfs*26 and neurodevelopmental disorder. Tmprss7 homozygous knockout (KO) mice exhibited dysregulated synaptic dendritic spine density, function, and dendritic elongation in the cerebral cortex and hippocampus. In addition, the KO animals displayed neurobehavioral deficits, including impairments in spatial learning, anxiety-like behavior, and a reduced preference for social novelty. Multi-omics analysis discovered enrichment of pathways related to synaptic signaling disruptions in both the cerebral cortex and hippocampus.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.247 PPP1R2 Zornitza Stark gene: PPP1R2 was added
gene: PPP1R2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PPP1R2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PPP1R2 were set to 40597352; 26558779
Phenotypes for gene: PPP1R2 were set to Neurodevelopmental disorder, PPP1R2-related
Review for gene: PPP1R2 was set to RED
Added comment: Single individual reported with homozygous splicing variant c.403 + 3 A >T. Abnormal splicing demonstrated but leaky. Clinical features included pre and postnatal growth restriction, ventricular septal defect, dysmorphic features (proptosis, long eye lashes, thick eyebrows, low-set ears), microcephaly, sensorineural hearing loss, cortical cataracts, retinal defects, intellectual disability with limited speech, and autism spectrum disorder. Note mouse model is embryonically lethal, leading the authors to speculate survival may be due to fraction of normally spliced transcripts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.245 BORCS5 Zornitza Stark gene: BORCS5 was added
gene: BORCS5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BORCS5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BORCS5 were set to 40385417
Phenotypes for gene: BORCS5 were set to Lysosomal storage disease, MONDO:0002561, BORCS5-related
Review for gene: BORCS5 was set to GREEN
Added comment: preprint PMID 40385417, describing 12 individuals from 7 families with a spectrum of abnormalities (osteopetrosis not mentioned), suggestive of lysosomal disorder.

Homozygous loss-of-function variants presented with prenatally lethal arthrogryposis multiplex congenita, brain malformations, and neuropathological evidence of diffuse neuroaxonal dystrophy. Individuals with missense variants presented differently, with microcephaly, developmental epileptic encephalopathy, intellectual disability, optic atrophy, spasticity, and progressive movement disorders. In this group, brain MRI showed diffuse hypomyelination and progressive global cerebral atrophy, consistent with neurodegeneration. Borcs5 knockout in zebrafish exhibited microcephaly, motor deficits, and seizures, mirroring the patients' clinical presentation. At the cellular level, BORCS5 loss-of-function but not missense variants, resulted in lower protein expression and impaired BORC assembly, paralleled by perinuclear lysosomal clustering. However, both loss-of-function and missense BORCS5 variants were associated with reduced total lysosomal proteolysis, reduced activity of the lysosomal hydrolases glucocerebrosidase and cathepsin B, and presence of multilamellar bodies, indicating lysosomal dysfunction.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.244 ARNTL Sarah Milton gene: ARNTL was added
gene: ARNTL was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARNTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARNTL were set to PMID: 40720646
Phenotypes for gene: ARNTL were set to Neurodevelopmental disorder, MONDO:0700092, BMAL1-related
Review for gene: ARNTL was set to GREEN
Added comment: Note has new HGNC approved name - BMAL1

BMAL1 encodes a transcription factor that plays a role in the mammalian molecular clock, binds to promoter of PER and CRY family genes to promote transcription. Other circardian genes have sleep phase disorder assoc but not neurodevelopmental phenotype.

10 affected individuals described in PMID: 40455867 with variable developmental delay/ID from average IQ to severe ID, seizures in 50%, autism, some had sleep disturbance and marfanoid habitus.
Variants were LOF & missense and very rare or absent in gnomAD v4.
5 confirmed de novo, 2 confirmed inherited (one from apparently unaffected mother).

Functional studies using luciferase reporter assay of downstream target PER showed reduced luminescence for most variants with presumed LOF mechanism. One variant p.(Ile201Thr) led to increased luminescence with author's postulating GOF mechanism for this variant. Drosophilia studies for 2 of the variants demonstrated altered circadian rhythm. ?needs more studies to further define mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.244 MAN2A2 Zornitza Stark Publications for gene: MAN2A2 were set to 36357165
Intellectual disability syndromic and non-syndromic v1.241 CCDC186 Zornitza Stark gene: CCDC186 was added
gene: CCDC186 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CCDC186 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC186 were set to 33259146; 37569695; 40633195
Phenotypes for gene: CCDC186 were set to Neurodevelopmental disorder, MONDO:0700092, CCDC186-related
Review for gene: CCDC186 was set to GREEN
Added comment: At least 3 unrelated families reported with bi-allelic LoF variants and a neurodevelopmental phenotype comprising ID and seizures, plus other more variable features.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.240 PCLO Zornitza Stark Publications for gene: PCLO were set to 25832664
Intellectual disability syndromic and non-syndromic v1.237 TAF13 Zornitza Stark Publications for gene: TAF13 were set to 28257693
Intellectual disability syndromic and non-syndromic v1.235 FAAH2 Zornitza Stark Publications for gene: FAAH2 were set to 25885783
Intellectual disability syndromic and non-syndromic v1.220 TBC1D32 Zornitza Stark gene: TBC1D32 was added
gene: TBC1D32 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: TBC1D32 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBC1D32 were set to 24285566; 32573025; 32060556; 31130284; 36826837; 40319332
Phenotypes for gene: TBC1D32 were set to Orofacial digital syndrome type IX, MIM#258865
Review for gene: TBC1D32 was set to GREEN
Added comment: Multiple affected individuals reported from unrelated families. Midline brain abnormalities are a feature and DD/ID is variable.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.218 RNU5B-1 Zornitza Stark Publications for gene: RNU5B-1 were set to https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf; https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1
Intellectual disability syndromic and non-syndromic v1.216 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to 40210679
Intellectual disability syndromic and non-syndromic v1.213 ST5 Rylee Peters gene: ST5 was added
gene: ST5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ST5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ST5 were set to 40717498
Phenotypes for gene: ST5 were set to Neurodevelopmental disorder (MONDO:0700092), DENND2B-related
Review for gene: ST5 was set to GREEN
Added comment: HGNC: DENND2B
Cohort of 11 individuals all with a history of motor and/or language developmental delay, intellectual disability in 6/11 (mild to severe), brain structure/function abnormalities were reported in 9/11 patients (7/11 seizures; 5/9 abnormal findings on brain MRI), muscle weakness/hypotonia in 8/9, psychosis in 4/10 patients, symptoms of catatonia in 4/10, other psychiatric/behavioural concerns (anxiety, attention deficit, autism or autistic features) in 10/10.

Total of 10 variants including 2x frameshift/nonsense, 6x missense, 1x splice, 1x single amino acid deletion – all absent from v4 and de novo except 1 inherited from a father with cognitive and psychiatric symptoms and the inframe del which has 2 hets in gnomAD and is inherited an unaffected father (no formal assessment).

In vivo zebrafish modelling measuring cilia length suggests that patient variants tested (9/10 excluding the splice variant) did not induce cilia length shortening, which is consistent with KO models and therefore a loss of function effect.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.213 BLOC1S1 Rylee Peters changed review comment from: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211
11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1.

The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy (in some cases), and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy.

Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.; to: De Pace et al. 2025 [preprint] doi: https://doi.org/10.1101/2025.07.17.25331211
11 individuals from seven unrelated families (includes 4 individuals from 3 families described in Bertoli-Avella PMID: 33875846), with severe neurodevelopmental disorder and harbour biallelic variants of BLOC1S1.

The disorder presents with early infantile onset and is characterised by deficient myelination, global developmental delay, intellectual disability, hypotonia, epilepsy, and visual impairment (bilateral optic atrophy in most). The severity ranged from early death to a milder form with preserved ambulation and single-word communication. All individuals harbouring BLOC1S1 variants with available neuroimaging exhibit hypomyelinating leukodystrophy.

Functional analyses show that BLOC1S1 KO impairs the anterograde transport of lysosomes and autophagy in both non-neuronal cells and iPSC-derived neurons. Missense variants displayed various combinations of defective expression, assembly, lysosome dispersal and/or autophagy. The frameshift variant showed the most severe deficiencies in tested assays.
Intellectual disability syndromic and non-syndromic v1.211 KDM2B Zornitza Stark Publications for gene: KDM2B were set to 36322151
Intellectual disability syndromic and non-syndromic v1.209 SNW1 Lucy Spencer gene: SNW1 was added
gene: SNW1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SNW1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SNW1 were set to 40608414
Phenotypes for gene: SNW1 were set to Neurodevelopmental disorder (MONDO:0700092), SNW1-related
Review for gene: SNW1 was set to GREEN
Added comment: cohort of 9 patients with moderate to profound ID, microcephaly, seizures (7/9), facial dysmorphism, and brain malformations (6/9 - corpus callosum hypoplasia, Dandy-Walker malformation).

3 splice, 1 frameshift, 2 missense, 3 in frame deletions, 1 start loss. all but 1 de novo (the last parents not available).

SNW1 is a core component of the spliceosome and facilitates the conformational changes of the spliceosome. Expression of variants in HEK293 cells showed some decreased SNW1 expression while others increased it (including the frameshift), and only the frameshift variant was mislocalised/in the cytoplasm instead of the nucleus. Several of the variants caused loss of binding to PPIL1 or other proteins which SNW1 usually recruits to the spliceosome. All variants in this study were found to either affect protein expression or localization or influence interactions with other proteins in the spliceosome complex suggesting loss of function.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.208 CHTF18 Sangavi Sivagnanasundram gene: CHTF18 was added
gene: CHTF18 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHTF18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHTF18 were set to 40717333
Phenotypes for gene: CHTF18 were set to complex neurodevelopmental disorder with or without congenital anomalies (Cohesinopathies) MONDO:0100465
Review for gene: CHTF18 was set to AMBER
Added comment: Only two individuals reported with ID/DD:
1 - 9M with DD, autism and seizures. De novo variant identified - p.Leu355Val
2 - 23month F with congenital bilateral ventriculomegaly status post ventriculoperitoneal shunt placement, epilepsy, right eye optic nerve hypoplasia, hypotonic cerebral palsy complicated by left hip subluxation, and G-tube dependence. De novo variant identified - p.His645Pro
3 - 3F presenting with global DD, hypotonia, seizure and abnormal brain MRI. De novo variant identified - p.Leu676Arg
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.208 SV2A Zornitza Stark Publications for gene: SV2A were set to PMID: 37985816
Intellectual disability syndromic and non-syndromic v1.206 RNU5A-1 Zornitza Stark gene: RNU5A-1 was added
gene: RNU5A-1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RNU5A-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RNU5A-1 were set to 40379786
Phenotypes for gene: RNU5A-1 were set to Neurodevelopmental disorder (MONDO:0700092), RNU5A-1 related
Review for gene: RNU5A-1 was set to AMBER
Added comment: PMID: 40379786 (2025) - three unrelated individuals with de novo variants in the RNU5A-1 gene (classified as VUS) and a neurodevelopmental disorder. Six individuals with rare de novo variants were identified in total but clinical details were only available for 3/6. Of these three individuals, two harboured the same variant (n.40_41insA) on the maternal allele, while the third individual harboured a different variant (n.39del) but also on the 5′ loop I domain of RNU5A-1. Clinical data showed neurodevelopmental abnormalities (mild ID (2), severe ID (1), epilepsy (2), brain MRI abnormalities (1)) with variable congenital malformations.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.204 BSN Zornitza Stark gene: BSN was added
gene: BSN was added to Intellectual disability syndromic and non-syndromic. Sources: Expert Review
Mode of inheritance for gene: BSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BSN were set to 40393460
Phenotypes for gene: BSN were set to Neurodevelopmental disorder (MONDO:0700092), BSN-related
Review for gene: BSN was set to GREEN
Added comment: Guzman et al 2025: Described 12 additional patients with missense (3/12) and premature termination variants (9/12) which included de novo and inherited variants, suggesting incomplete penetrance.

They assessed all reported patients (n=29) which revealed common clinical characteristics including epilepsy(13/29), febrile seizures (7/29), generalised tonic-clonic seizures (5/29), and focal-onset seizures (3/29). Behavioural phenotypes were present in almost half of all individuals (14/29), which included ADHD (7/29) and autistic behaviour (5/29). Additional common features included developmental delay (11/29), obesity (10/29), and delayed speech (8/29). In adults with BSN PTVs, milder features were common, suggesting phenotypic variability, including a range of individuals without obvious neurodevelopmental features (7/29).
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v1.198 PDE1B Zornitza Stark gene: PDE1B was added
gene: PDE1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PDE1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDE1B were set to 40492975
Phenotypes for gene: PDE1B were set to Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related
Review for gene: PDE1B was set to GREEN
Added comment: PMID:40492975 reported seven individuals from five unrelated families identified with biallelic PDE1B variants. Three truncating (p.Gln45Ter, p.Gln86Ter, p.Ser298Alafs*6) and three splicing variants (c.594 + 2 T>G, c.735 + 5G>A, c.837-1G>C) were identified from these patients in total. They presented with an early-onset movement disorder characterised by hypotonia in infancy, progressing to ataxia and dystonia in early childhood, with motor and speech delay, and intellectual disability. Functional evidence is also available for these variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.195 FASTKD5 chirag patel gene: FASTKD5 was added
gene: FASTKD5 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FASTKD5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FASTKD5 were set to PMID: 40499538
Phenotypes for gene: FASTKD5 were set to Leigh syndrome MONDO:0009723
Review for gene: FASTKD5 was set to GREEN
Added comment: 3 unrelated individuals with Leigh syndrome (1 x severe/early-onset/fatal, 1 x milder/childhood-onset, 1 x adult-onset). WES identified compound heterozygous variants in FASTKD5 gene (3 x missense variants, 2 x frameshift variants leading to a premature stop codon). The FASTKD5 gene codes for a mitochondrial protein essential for processing mRNAs at non-canonical cleavage sites in the primary mitochondrial transcript.

Analysis of fibroblasts from two subjects showed reduced steady-state levels of FASTKD5 protein by immunoblot, reduced translation of the cytochrome c oxidase subunit 1, impaired assembly of complex IV, and a consequent decrease in cytochrome c oxidase enzymatic activity. The extent of these deficiencies appeared to correlate with the severity of the clinical phenotype. Expression of a wild-type FASTKD5 cDNA, but not cDNAs expressing the missense variants, rescued all the molecular defects in the subjects' fibroblasts, demonstrating that the alleles are pathogenic. 2/3 missense variants resulted in near complete loss of function, while one was hypomorphic, resulting from impaired protein stability.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.193 NDUFA4 Sarah Milton gene: NDUFA4 was added
gene: NDUFA4 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NDUFA4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NDUFA4 were set to PMID: 39967265
Phenotypes for gene: NDUFA4 were set to Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065
Review for gene: NDUFA4 was set to GREEN
Added comment: HGNC symbol now COXFA4

Around 10 patients reported in literature thus far with most having developmental delay. Association with hypertrophic cardiomyopathy reported in 3 siblings from a family in PMID: 39967265
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.190 LONP1 Zornitza Stark Publications for gene: LONP1 were set to 31636596
Intellectual disability syndromic and non-syndromic v1.185 LGI1 Krithika Murali gene: LGI1 was added
gene: LGI1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: LGI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LGI1 were set to PMID:40455867
Phenotypes for gene: LGI1 were set to Developmental and epileptic encephalopathy MONDO:0100062, LGI1-related
Review for gene: LGI1 was set to GREEN
Added comment: PMID: 40455867 report patients with biallelic variants in 6 individuals from 4 consanguineous families with a more severe DEE phenotype. All indivduals had seizures, global dev delay/ID and generalised hypotonia. Four out of five exhibited spasticity.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.183 WDR91 Bryony Thompson gene: WDR91 was added
gene: WDR91 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WDR91 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR91 were set to 32732226; 38041506; 34791078; 40550703; 28860274; 34028500; ClinVar: SCV000965687.1
Phenotypes for gene: WDR91 were set to Complex neurodevelopmental disorder MONDO:0100038
Review for gene: WDR91 was set to GREEN
Added comment: Homozygous LoF variants were identified in at least 5 families with a mainly neurodevelopmental disorder phenotype. Also, supporting mouse models
1. Brain malformation
2. Severe developmental delay, microcephaly, severe microlissencephaly, agenesis of corpus callosum, epilepsy, spastic tetraparesis, laryngomalacia, bicuspid aortic valve, congenital hip dislocation, growth retardation, dysmorphisms
3. Severe microcephaly, dysmorphic features, and organomegaly, along with early onset psychomotor delay, hypotonia, sensorineural hearing impairment, and visual impairment
4. Hygroma, macrocephaly, abnormal ears, unilateral simian crease, hydrocephaly, cerebellar hypoplasia, interventricular
communication
5. Neurodevelopmental disorder with brain malformations and multiple congenital anomalies
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.178 NSUN3 Zornitza Stark gene: NSUN3 was added
gene: NSUN3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: NSUN3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NSUN3 were set to 27356879; 32488845; 40465263
Phenotypes for gene: NSUN3 were set to Combined oxidative phosphorylation deficiency 48, MIM# 619012
Review for gene: NSUN3 was set to GREEN
Added comment: Six families reported. DD/ID can be part of the phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.177 SREK1 Sangavi Sivagnanasundram gene: SREK1 was added
gene: SREK1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SREK1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SREK1 were set to 40549565
Phenotypes for gene: SREK1 were set to Prader-Willi-like syndrome, SREK1-related MONDO:0008300
Review for gene: SREK1 was set to AMBER
Added comment: Three Pakistani probands from three consanguineous families identified with biallelic variants in SREK1. Affected individuals presented with hyperphagic obesity and neurodevelopmental delay. They also presented with psychological and behavioural issues and were phenotypically similar to Prader-Willi affected individuals. ID/DD is a feature in the affected individuals.

Further testing was conducted using human induced pluripotent stem cell (iPSC) -derived neurons followed by RNA sequencing conducted on the neurons.
The results of the assay was suggestive that variants located in the RNA recognition domain (residues 19–96 and 173–256) of SREK1 downregulation of SNORD115 and SNORD116 leading to Prader-Willi-like phenotype however proper validation and controls weren't used.

No relevant mouse models were identified on IMPC (international mouse phenotype consortium) to further support gene-disease association there gene reviewed as Amber.

Variants identified in SREK1 - AF's from gnomADv4.1
P95L - absent in gnomAD v4.1
T194M - EAS PopMax AF - 0.03787% (47 hets)
E601K - SAS PopMax AF - 0.01319% (12 hets)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.176 ADAM23 Sarah Milton gene: ADAM23 was added
gene: ADAM23 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ADAM23 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAM23 were set to PMID: 40455867
Phenotypes for gene: ADAM23 were set to Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related
Review for gene: ADAM23 was set to AMBER
Added comment: ADAM23 encodes a transmembrane protein receptor which is a receptor for LGI1. LGI1/ADAM22/ADAM23 form a complex that regulates excitatory synaptic transmission and neuronal excitability in the brain.

1 affected individual described in PMID: 40455867 with severe neonatal seizures, joint contractures, absent reflexes. Noted to have a homozygous NMD predicted variant in ADAM23.
Also had a de novo missense variant in PRKD1.

Knockout ADAM23 mice show early lethal epilepsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.176 SMARCC1 Gemma Edwards gene: SMARCC1 was added
gene: SMARCC1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMARCC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMARCC1 were set to 29983323; 37285932
Phenotypes for gene: SMARCC1 were set to SMARCC1-associated developmental dysgenesis syndrome (MONDO:0700123)
Review for gene: SMARCC1 was set to GREEN
Added comment: Phenotype expansion since original literature. ClinGen - "SMARCC1-associated developmental dysgenesis syndrome is characterized by developmental delay, cerebral ventriculomegaly, aqueductal stenosis, and other associated structural brain and cardiac defects". See cases in PMIDs 29983323, 37285932.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.175 IKZF2 Zornitza Stark gene: IKZF2 was added
gene: IKZF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: IKZF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: IKZF2 were set to 37316189
Phenotypes for gene: IKZF2 were set to Immunodysregulation, craniofacial anomalies, hearing impairment, athelia, and developmental delay, MIM# 621234
Review for gene: IKZF2 was set to AMBER
Added comment: PMID 37316189: two individuals with de novo variants and syndromic immunodysregulation, including craniofacial anomalies, hearing impairment, athelia, and developmental delay.

Note that variants in this gene are also associated with non-syndromic immune dysregulation and non-syndromic HL. Genotype-phenotype correlation unclear.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.173 ANKS1B Lilian Rudd gene: ANKS1B was added
gene: ANKS1B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
SV/CNV tags were added to gene: ANKS1B.
Mode of inheritance for gene: ANKS1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANKS1B were set to PMID: 31388001; 38129387
Phenotypes for gene: ANKS1B were set to neurodevelopmental disorder MONDO:0700092 ANKS1B related
Review for gene: ANKS1B was set to GREEN
Added comment: Intragenic deletions >3indepedant families with developmental delay (speech and motor apraxia and dysmorphism) borderline IQ's, behavioural/ASD, reduced penetrance, most inherited from mildly or not affected parents. Mouse model.

Complex neurodevelopmental features (especially developmental delay, speech delay and motor delay) appear to be associated with haploinsufficiency of this gene. Carbonell (PMID: 31388001) - reports deletions in seven families. Five of these families carry frameshift deletions predicted to undergo NMD. While there are two shorter transcripts for the gene (AIDA-1C and AIDA 1D), the short isoforms showed reduced transcription similarly to the long isoform (AIDA-1B, MANE NM_001352186.2) - as tested in probands compared to their mothers who were unaffected and not carriers of the deletions. Hoon Cho (PMID: 38129387) - presents five additional ANKS1B deletion patients. They list the variants as multigenic although they appear to only affect ANKS1B. The patients are listed to have neurodevelopmental syndrome and white matter/corpus callosum abnormalities on MRI. One of the five carries a frameshift deletion (35 year old male). Note: the nine patients listed at the top of Figure 1 are from Carbonell. Paper includes supportive mouse studies. Sources: Literature gnomAD and dgv gold frequency is insufficient.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.171 KCNA6 Zornitza Stark gene: KCNA6 was added
gene: KCNA6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: KCNA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNA6 were set to 36318112; 40472070
Phenotypes for gene: KCNA6 were set to Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related
Review for gene: KCNA6 was set to GREEN
Added comment: PMID 36318112: four individuals with de novo variants in this gene and NDD/epilepsy phenotype. Supportive functional data. Additional individual in PMID 40472070 with de novo variant and epilepsy.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.168 ZBTB7B Zornitza Stark gene: ZBTB7B was added
gene: ZBTB7B was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZBTB7B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ZBTB7B were set to 40392549
Phenotypes for gene: ZBTB7B were set to Inborn error of immunity, MONDO:0003778, ZBTB7B-related
Review for gene: ZBTB7B was set to AMBER
Added comment: Single patient presented with a complex syndromic phenotype including CID, severe atopy, severe fibroinflammatory interstitial lung disease, corneal vascularization and scarring, sensorineural hearing loss, global developmental delay, and growth failure.

K360N variant is not found in unaffected individuals; functional investigations indicate that K360N exhibits damaging multimorphic effects; and the causal relationship between K360N and the clinical phenotype was confirmed through gene transfer experiments in both T cells and pulmonary fibroblasts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.164 PTPN1 Zornitza Stark gene: PTPN1 was added
gene: PTPN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PTPN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PTPN1 were set to 39986310
Phenotypes for gene: PTPN1 were set to Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related
Review for gene: PTPN1 was set to GREEN
Added comment: 12 patients from 11 families with phenotype characterised by subacute loss of skills following initially normal development, spastic dystonia, bulbar involvement, preserved head circumference, and an absence of seizures. The observation of enhanced type 1 IFN signalling in patient blood and CSF, and of increased levels of CSF neopterin suggests that PTPN1 haploinsufficiency can be classified as a novel type 1 interferonopathy. Features apparently distinguishing PTP1B-related encephalopathy from Aicardi-Goutières syndrome are a later age at onset (nine of 12 cases in cohort presenting beyond 18 months of age), notable bulbar involvement manifesting as difficulties with swallowing and expressive speech, and cerebral atrophy as the predominant neuroradiological sign.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.162 WSB2 Krithika Murali gene: WSB2 was added
gene: WSB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: WSB2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WSB2 were set to PMID:40374945
Phenotypes for gene: WSB2 were set to Complex neurodevelopmental disorder, MONDO:0100038, WSB2-related
Review for gene: WSB2 was set to GREEN
Added comment: PMID: 40374945 describe 5 individuals from 4 unrelated families with biallelic WSB2 variants and a complex neurodevelopmental disorder. Phenotypic features include:
- Dev delay (all)
- Brain anomalies (4/5 including callosal anomalies and cerebellar hypoplasia)
- Dysmorphic feature
- IUGR/oligohydramnios (3/5)
- Hypotonia (all)
- Microcephaly (3/5)
- Seizures (3/5)

Includes two siblings with biallelic missense variants and shared phenotype. 3 unaffected siblings were heterozygous for the variant or hmz wt. Phenotypic features associated with hmz nonsense/fs variants were more severe than missense.

Supportive mouse model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.161 NKAP Zornitza Stark Mode of inheritance for gene: NKAP was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.160 PRR12 Zornitza Stark Publications for gene: PRR12 were set to 29556724
Intellectual disability syndromic and non-syndromic v1.159 RREB1 Zornitza Stark Publications for gene: RREB1 were set to 32938917; 38332451
Intellectual disability syndromic and non-syndromic v1.158 TAF1C Zornitza Stark Publications for gene: TAF1C were set to 32779182
Intellectual disability syndromic and non-syndromic v1.155 TM2D3 Zornitza Stark gene: TM2D3 was added
gene: TM2D3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TM2D3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TM2D3 were set to 40449487
Phenotypes for gene: TM2D3 were set to Neurodevelopmental disorder, MONDO:0700092, TM2D3-related
Review for gene: TM2D3 was set to GREEN
Added comment: Four individuals from 4 unrelated families identified with biallelic variants in this gene. Supportive functional data.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.153 SLK Zornitza Stark gene: SLK was added
gene: SLK was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SLK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLK were set to 40347834
Phenotypes for gene: SLK were set to Neurodevelopmental disorder, MONDO:0700092, SLK-related
Review for gene: SLK was set to GREEN
Added comment: Three affected individuals from three unrelated families reported. Two of the families were consanguineous and homozygous LoF variants were present in the probands. Third individual had compound het missense variants. Functional data from a Drosophila model and transdifferentiated neurons.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.148 MYCBP2 Zornitza Stark edited their review of gene: MYCBP2: Added comment: Concerns about LoF variants in population datasets as well as in individuals undergoing diagnostic testing for a wide variety of unrelated phenotypes: downgrade to RED.; Changed rating: RED
Intellectual disability syndromic and non-syndromic v1.148 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to 24026985
Intellectual disability syndromic and non-syndromic v1.141 SMAD6 Boris Keren gene: SMAD6 was added
gene: SMAD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMAD6 were set to PMID: 32499606
Penetrance for gene: SMAD6 were set to Incomplete
Review for gene: SMAD6 was set to GREEN
Added comment: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.132 FBXO22 Sarah Milton gene: FBXO22 was added
gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXO22 were set to PMID: 40215970
Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related
Review for gene: FBXO22 was set to GREEN
Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases.

14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4).

Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies.

Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.132 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark gene: GAP43 was added
gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GAP43 were set to 39738362
Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related
Review for gene: GAP43 was set to RED
Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities.

The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.130 LSM1 Zornitza Stark Publications for gene: LSM1 were set to PMID: 31010896
Intellectual disability syndromic and non-syndromic v1.127 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Previously referred to as RNU2-2P
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.125 BRF2 Zornitza Stark gene: BRF2 was added
gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRF2 were set to 40229899
Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related
Review for gene: BRF2 was set to GREEN
Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant.

Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID.

Supportive functional data, including animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.121 RAB3A Bryony Thompson gene: RAB3A was added
gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB3A were set to 40166812
Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092
Review for gene: RAB3A was set to GREEN
Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.120 PCNA Sangavi Sivagnanasundram gene: PCNA was added
gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCNA were set to 24911150, 33426167, 36990216
Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309
Review for gene: PCNA was set to AMBER
Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778

Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown.
Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability.
Sources: ClinGen
Intellectual disability syndromic and non-syndromic v1.120 EIF3K Sangavi Sivagnanasundram gene: EIF3K was added
gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF3K were set to 40219605
Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092
Review for gene: EIF3K was set to RED
Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported.

Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%).
The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype.
The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant.
Sources: Other
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID: 40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants.

Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.115 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.113 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.111 FMR1_FXS_CGG Bryony Thompson STR: FMR1_FXS_CGG was added
STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184
Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624
Review for STR: FMR1_FXS_CGG was set to GREEN
STR: FMR1_FXS_CGG was marked as clinically relevant
STR: FMR1_FXS_CGG was marked as current diagnostic
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.109 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.106 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.104 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.101 EEF1D Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321
Intellectual disability syndromic and non-syndromic v1.96 CDKL1 Sarah Milton gene: CDKL1 was added
gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL1 were set to PMID: 40088891
Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related
Mode of pathogenicity for gene: CDKL1 was set to Other
Review for gene: CDKL1 was set to AMBER
Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4).

Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.96 CDKL2 Sarah Milton gene: CDKL2 was added
gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CDKL2 were set to PMID: 40088891
Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related
Penetrance for gene: CDKL2 were set to Complete
Mode of pathogenicity for gene: CDKL2 was set to Other
Review for gene: CDKL2 was set to AMBER
Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans.
(CDKL5 has been associated with a neurodevelopmental disorder previously.)

Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion.
2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging.

Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5)

Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies.

Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative.
Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.95 MED16 Zornitza Stark Publications for gene: MED16 were set to